Microorganism enrichment method and enrichment system

The method and system use non-resonant light to concentrate microorganisms in pores, overcoming buoyancy and Brownian motion forces, ensuring accurate analysis of microbial interactions without thermal damage.

JP7800958B2Active Publication Date: 2026-01-16PUBLIC UNIVERSITY CORPORATION OSAKA CITY UNIVERSITY
View PDF 11 Cites 0 Cited by

Patent Information

Application Number
JP2024518065
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2022-04-28
Filing Date
2023-04-28
Publication Date
2026-01-16
Estimated Expiration
2043-04-28

AI Technical Summary

Technical Problem

Existing methods for analyzing interactions between multiple types of microorganisms in mixed cultures are hindered by the difficulty in concentrating them at high densities, leading to potential thermal damage and inaccurate analysis due to heating effects.

Method used

A method and system using a substrate with pores and non-resonant light irradiation to create a photo-induced force that overcomes buoyancy and Brownian motion forces, allowing microorganisms to be accumulated without thermal damage, using a microorganism enrichment system with a substrate and non-resonant light source.

Benefits of technology

Enables suitable analysis of interactions between multiple types of microorganisms by uniformly distributing them for enhanced interaction and analysis, while minimizing thermal damage.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007800958000001
    Figure 0007800958000001
  • Figure 0007800958000002
    Figure 0007800958000002
  • Figure 0007800958000003
    Figure 0007800958000003
Patent Text Reader

Abstract

This microbe accumulation method includes first to third steps for accumulating a plurality of types of microbes. The first step is a step for readying an accumulation substrate (13) provided with a plurality of pores (131). Each of the plurality of pores (131) has an opening capable of capturing, for each of the plurality of types of microbes, at least one microbe of each respective type, and a depth extending in a direction including a vertically downward component. The second step is a step for setting a laser light radiation condition. The third step is a step for radiating laser light, through a sample, onto the plurality of pores (131) in accordance with the radiation condition. The region irradiated with the laser light does not include a photothermal conversion material. The step for performing setting includes a step for setting the intensity of non-resonant light in a non-resonant-light irradiation range such that the magnitude of a vertically downward component of a light-induced force produced by irradiation of the non-resonant light is greater than the magnitude of a vertically upward component of a buoyancy force due to a liquid sample and also greater than the magnitude of a vertically upward component of a force produced by Brownian motion of molecules in the liquid sample.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present disclosure relates to a method and system for enriching microorganisms, and more particularly to a method and system for enriching multiple types of microorganisms suspended in a liquid sample. [Background technology]

[0002] Many types of microorganisms colonize the human intestines, oral cavity, skin, and other areas, forming a microflora also known as the "microbiota." Analysis of the "microbiome," which is the totality of genomic information possessed by microorganisms, is revealing that the microbiota is deeply involved in human health (diseases, biological reactions, etc.). Microorganisms that contribute to the health of their host, the human, are also called "probiotics." Products using probiotics, such as supplements, yogurt, and cream, are widely available on the market. [Prior art documents] [Patent documents]

[0003] [Patent Document 1] International Publication No. 2017 / 195872 [Patent Document 2] International Publication No. 2021 / 040021 Summary of the Invention [Problem to be solved by the invention]

[0004] These multiple types of microorganisms coexist symbiotically, interacting with each other through the exchange of metabolites. In recent years, research has been conducted to elucidate the mechanisms of symbiosis among multiple types of microorganisms and evaluate the efficacy of drugs against multiple types of microorganisms. Therefore, there is a demand for technologies that can effectively analyze the interactions between multiple types of microorganisms.

[0005] Mixed culture is a well-known method for preparing multiple types of microorganisms for analysis. However, in mixed cultures, the microorganisms are generally suspended in a liquid sample and are spaced far apart, making it difficult for interactions between the microorganisms to occur. Therefore, it is possible to fix the microorganisms at a high density, or in other words, to concentrate them. This makes it easier for interactions between the microorganisms to occur, which is expected to improve analytical accuracy.

[0006] The microorganism collection device disclosed in International Publication No. 2017 / 195872 (Patent Document 1) collects multiple microorganisms dispersed in a liquid sample. The collection device includes a light source and a holding member configured to hold the liquid sample. A photothermal conversion region is formed in the holding member. The photothermal conversion region converts light from the light source into heat to heat the liquid sample, thereby generating thermal convection in the liquid sample. This thermal convection can be used to accumulate microorganisms.

[0007] It is conceivable to apply the device disclosed in Patent Document 1 to the accumulation of multiple types of microorganisms. However, the microorganisms are also heated as the liquid sample is heated. Therefore, there is a possibility that the microorganisms may be thermally damaged and die. This may make it impossible to effectively analyze the interactions between multiple types of microorganisms.

[0008] The present disclosure has been made to solve the above-mentioned problems, and its purpose is to provide a method and system for enriching microorganisms that are suitable for analyzing interactions between multiple types of microorganisms. [Means for solving the problem]

[0009] In one aspect of the present disclosure, a method for enriching microorganisms enriches multiple types of microorganisms contained in a liquid sample. The method for enriching microorganisms includes first to fourth steps. The first step is a step of preparing a substrate having multiple pores. Each of the multiple pores has an opening capable of capturing at least one of each type of multiple types of microorganisms and a depth extending in a direction including a vertically downward component. The second step is a step of introducing a liquid sample onto the substrate. The third step is a step of setting irradiation conditions for non-resonant light, which is light outside the wavelength range of electronic resonance of the multiple types of microorganisms. The fourth step is a step of irradiating the multiple pores with the non-resonant light through the liquid sample in accordance with the irradiation conditions. The region of the multiple pores irradiated with the non-resonant light does not contain a photothermal conversion material that converts the non-resonant light into heat. The setting step includes a step of setting the intensity of the non-resonant light in the irradiation range of the non-resonant light so that, for multiple types of microorganisms, the magnitude of the vertical downward component of the light-induced force due to irradiation with the non-resonant light is greater than the magnitude of the vertical upward component of the buoyancy force due to the liquid sample, and greater than the magnitude of the vertical upward component of the force due to the Brownian motion of molecules in the liquid sample.

[0010] In another aspect of the present disclosure, a microorganism enrichment system enriches multiple types of microorganisms contained in a liquid sample. The microorganism enrichment system includes a substrate having multiple pores. Each of the multiple pores has an opening capable of capturing at least one of each of the multiple types of microorganisms and a depth extending in a direction including a vertically downward component. The enrichment system further includes a light source that, with a liquid sample disposed on the substrate, irradiates the multiple pores with non-resonant light, which is light outside the wavelength range of the electronic resonances of the multiple types of microorganisms, through the liquid sample, and a control device that controls the light source. The region of the multiple pores that is irradiated with the non-resonant light does not contain a photothermal conversion material that converts the non-resonant light into heat. The control device sets the intensity of the non-resonant light in the irradiation range of the non-resonant light so that the magnitude of the vertically downward component of the photo-induced force caused by the irradiation of the non-resonant light is greater than the magnitude of the vertically upward component of the buoyancy force caused by the liquid sample and greater than the magnitude of the vertically upward component of the force due to Brownian motion of molecules in the liquid sample. [Effects of the Invention]

[0011] According to the present disclosure, it becomes possible to suitably analyze interactions between multiple types of microorganisms. [Brief explanation of the drawings]

[0012] [Figure 1] 1 is an overall configuration diagram of a microbial accumulation system according to an embodiment of the present disclosure. [Figure 2] FIG. 2 is an exploded perspective view of the integrated kit. [Figure 3] Figure 3A is a top view of the integrated kit, and Figure 3B is a cross-sectional view of the integrated kit taken along line IIIB-IIIB in Figure 3A. [Figure 4] FIG. 1 is an image diagram showing the accumulation of multiple types of microorganisms. [Figure 5] 10 is a flowchart showing a processing procedure of a manufacturing method of an integrated kit according to the present embodiment. [Figure 6] 6A to 6E are schematic process diagrams (FIGS. 1 to 5) of the manufacturing method of the integrated kit according to this embodiment. [Figure 7] 1 is an SEM image showing an example of a mold. [Figure 8] FIG. 2 is a diagram showing a top view of an integrated substrate. [Figure 9] FIG. 1 is a diagram showing a cross-sectional image of an integrated substrate. [Figure 10] 1 is a diagram for explaining a light-induced force acting on a microorganism when irradiated with laser light from a laser light source. FIG. [Figure 11] FIG. 1 is a diagram for explaining the accumulation mechanism of multiple types of microorganisms in this embodiment. [Figure 12] 1 is a flowchart showing a processing procedure for a microorganism enrichment process. [Figure 13] FIG. 10 is a diagram for explaining the relationship between light pressure and spot diameter. [Figure 14] SYTO9 images showing the accumulation of microorganisms at different spot diameters. [Figure 15]FIG. 15 is a diagram showing the relationship between the spot diameter and the area of ​​the region in which fluorescence is observed in the fluorescent image of FIG. 14. [Figure 16] SYTO9 images showing the accumulation of microorganisms under different light exposure times. [Figure 17] This is a PI image showing the accumulation of microorganisms after 60 minutes of light irradiation. [Figure 18] FIG. 1 shows the relationship between light irradiation time, survival rate, and fluorescent area. [Figure 19] SYTO9 images showing microbial accumulation at different laser powers. [Figure 20] FIG. 1 shows the relationship between laser power, survival rate, and integration density. [Figure 21] This is a fluorescent observation image showing the accumulation of multiple types of multicolor stained microorganisms. [Figure 22] Fluorescence observation images showing bacterial accumulation in a high-concentration sample. [Figure 23] Fluorescence observation images showing bacterial accumulation in a low-concentration sample. [Figure 24] This is a magnified optical image for observing the accumulated bacteria. [Figure 25] FIG. 1 shows the area of ​​bacterial accumulation and survival rate. [Figure 26] FIG. 10 is an overall configuration diagram of a microbial accumulation system according to a modified example of an embodiment of the present disclosure. [Figure 27] FIG. 1 is a diagram showing an example of a mold for forming a microchannel substrate. [Figure 28] FIG. 28 is a diagram showing a microchannel substrate fabricated using the mold shown in FIG. 27. [Figure 29] FIG. 1 is a diagram illustrating an example of an integrated substrate. [Figure 30] This is an image of an actual assembled kit. [Figure 31] FIG. 10 is a diagram for explaining the accumulation mechanism of multiple types of microorganisms in a modified example. DETAILED DESCRIPTION OF THE INVENTION

[0013] <Terminology> In the present disclosure and its embodiments, "submicrometer order" includes a range of 100 nm (= 0.1 μm) to 1000 nm (= 1 μm). "Micrometer order" includes a range of 1 μm to 1000 μm (= 1 mm). Therefore, "submicrometer order to micrometer order" includes a range of 0.1 μm to 1000 μm. The term "submicrometer order to micrometer order" preferably means a range of several hundred nm to several hundred μm, and more preferably means a range of 1 μm to several tens of μm.

[0014] In the present disclosure and its embodiments, the term "microorganism" refers to an organism having a size ranging from the submicrometer order to the micrometer order. The shape of the microorganism is not particularly limited, and may be, for example, spherical, ellipsoidal, or rod-shaped. When the microorganism is ellipsoidal, at least one of the length of the major axis and the length of the minor axis of the ellipsoid may be within the range from the submicrometer order to the micrometer order. When the microorganism is rod-shaped, at least one of the width and length of the rod may be within the range from the submicrometer order to the micrometer order.

[0015] All unicellular organisms are microorganisms. Some multicellular organisms are also microorganisms. More specifically, organisms are classified as bacteria, archaea, and eukaryotes. Most bacteria and archaea are unicellular and therefore microorganisms. Multicellular species of bacteria and archaea are also microorganisms. Most eukaryotes are unicellular and therefore microorganisms. Microorganisms can also include cells, such as humans.

[0016] In this disclosure and its embodiments, the term "photoinduced force" is a general term for dissipative force, gradient force, and inter-substance photoinduced force. Dissipative force is a force generated when the momentum of light is imparted to a substance in a dissipative process such as light scattering or light absorption. Gradient force is a force that moves a substance with photoinduced polarization to a stable point of electromagnetic potential when the substance is placed in a non-uniform electromagnetic field. Inter-substance photoinduced force is the sum of the force due to the longitudinal electric field and the force due to the transverse electric field (radiation field) resulting from the induced polarization in multiple photoexcited substances.

[0017] In the present disclosure and its embodiments, "visible light" refers to light in the wavelength range of 400 nm to 700 nm. "Infrared light" refers to light in the wavelength range of 700 nm to 10,000 μm (= 1 mm), preferably light in the wavelength range of 700 nm to 2,500 nm, and more preferably light in the wavelength range of 700 nm to 1,400 nm. "White light" refers to light in the wavelength range from ultraviolet to near-infrared (for example, a wavelength range of 200 nm to 1,100 nm).

[0018] In the present disclosure and its embodiments, "resonant light" refers to light that, when incident on a microorganism, causes a large photoinduced polarization in the microorganism. Photoinduced polarization is electric polarization that occurs when electrons inside a substance are excited by light. Resonant light has a wavelength within the wavelength range of electronic resonance of the microorganism. On the other hand, "non-resonant light" refers to light that, when incident on the microorganism, causes a small photoinduced polarization in the microorganism. Non-resonant light has a wavelength outside the wavelength range of electronic resonance of the microorganism.

[0019] In the present disclosure and its embodiments, "chemotaxis" refers to the property of a microorganism to exhibit a directional response to the concentration gradient of a specific chemical substance present in its surroundings. A microorganism with chemotaxis exhibits a response of moving toward a preferred chemical substance and moving away from an unpreferred chemical substance.

[0020] [Embodiment Mode] Hereinafter, embodiments of the present disclosure will be described in detail with reference to the drawings. In the drawings, identical or corresponding parts are designated by the same reference numerals, and their description will not be repeated. The x and y directions represent horizontal directions. The x and y directions are perpendicular to each other. The z direction represents the vertical direction. The direction of gravity is downward in the z direction. The upward z direction (vertically upward) will be abbreviated as "upward" or "upward," and the downward z direction (vertically downward) will be abbreviated as "downward" or "downward."

[0021] <Overall system configuration> 1 is a diagram showing the overall configuration of a microorganism enrichment system according to an embodiment of the present disclosure. The enrichment system 100 includes an enrichment kit 1, an XYZ-axis stage 2, an adjustment mechanism 3, a laser light source 4, a dichroic mirror 5, an objective lens 6, an illumination light source 7, a camera 8, a human-machine interface (HMI) 9, and a controller 10.

[0022] The accumulation kit 1 holds a sample. The sample is a liquid specimen containing multiple types of microorganisms to be accumulated. The type of liquid (dispersion medium for multiple types of microorganisms) is not particularly limited, but in this example it is sterilized water. An example of the configuration of the accumulation kit 1 will be described with reference to Figs. 2 to 9.

[0023] The XYZ-axis stage 2 holds the assembly kit 1. The XYZ-axis stage 2 is provided with a through-hole (not shown) for transmitting white light (described later). Although not shown, multiple assembly kits may be prepared. In this case, the multiple assembly kits 1 are placed in order on the XYZ-axis stage 2, and the assembly process (see FIG. 12) described later is performed for each assembly kit 1.

[0024] The adjustment mechanism 3 is a drive mechanism including a servo motor and a focusing handle. The adjustment mechanism 3 adjusts the horizontal position and vertical height of the XYZ axis stage 2 according to commands from the controller 10. This allows the relative positional relationship between the integrated kit 1 and the objective lens 6 to be adjusted.

[0025] The laser light source 4 emits a continuous wave (CW) laser light (denoted by L1) in accordance with instructions from the controller 10. The output power (unit: W) of the laser light can also be adjusted by instructions from the controller 10. The wavelength of the laser light is outside the wavelength range of electronic resonance of microorganisms. In this embodiment, the wavelength of the laser light is a wavelength in the near-infrared range (specifically, 1064 nm). The laser light emitted from the laser light source 4 is directed toward a dichroic mirror 5.

[0026] The dichroic mirror 5 is disposed between the laser light source 4 and the objective lens 6, and between the objective lens 6 and the camera 8. The dichroic mirror 5 is configured to transmit visible light while reflecting infrared light. Therefore, the laser light, which is near-infrared light, is reflected by the dichroic mirror 5.

[0027] The objective lens 6 collects the laser light reflected by the dichroic mirror 5. The laser light collected by the objective lens 6 is irradiated onto the integrated kit 1.

[0028] The illumination light source 7 is an artificial light source such as a halogen lamp, a mercury lamp, an LED (Light Emitting Diode), or a fluorescent lamp. The illumination light source 7 emits white light (indicated by L2) for photographing the sample on the integrated kit 1 in accordance with commands from the controller 10. The white light is irradiated onto the integrated kit 1 through a through-hole provided in the XYZ axis stage 2 and passes through the integrated kit 1. The white light that has passed through the integrated kit 1 travels via the objective lens 6 to the dichroic mirror 5. The white light, which is visible light, passes through the dichroic mirror 5 and is captured by the camera 8.

[0029] The camera 8 includes an imaging element such as a CCD (Charge Coupled Device) image sensor or a CMOS (Complementary Metal Oxide Semiconductor) image sensor. The camera 8 photographs the sample on the integrated kit 1 in accordance with instructions from the controller 10, and outputs a signal indicating the photographed image to the controller 10. The image photographed by the camera 8 may be a still image or a video image.

[0030] The HMI 9 includes input devices such as switches, a mouse, a keyboard, and a touch panel, and output devices such as lamps, a display, and a speaker (none of which are shown). The HMI 9 accepts user operations and outputs signals indicating the user operations to the controller 10. Note that the term "user" here refers to a person in charge of handling microorganisms, such as a developer, a researcher, a student, a technician, or an operator.

[0031] The controller 10 includes a processor 101 such as a CPU (Central Processing Unit), a memory 102 such as a ROM (Read Only Memory) and a RAM (Random Access Memory), and an input / output port 103 through which various signals are input and output. The controller 10 controls each device (adjustment mechanism 3, laser light source 4, illumination light source 7, camera 8) within the integrated system 100. The controller 10 is also capable of image analysis of images captured by the camera 8 (fluorescence image analysis in the embodiment described below).

[0032] The optical system shown in FIG. 1 is an example. The optical system of the integrated system 100 may include other optical components (mirrors, half mirrors, beam splitters, filters, optical fibers, etc.) instead of or in addition to the dichroic mirror 5. The optical system shown in FIG. 1 is configured such that white light from the illumination light source 7 is irradiated onto the sample from below upward, and the upper camera 8 photographs the sample below. However, the optical system of the integrated system 100 is configured such that the white light from the illumination light source 7 is irradiated onto the sample from below upward, and the upper camera 8 photographs the sample below. Upward from downwardThe sample may be illuminated in the direction of the arrow, and the lower camera 8 may be configured to photograph the upper sample.

[0033] The laser light source 4 corresponds to the "light source" according to the present disclosure. The laser light emitted from the laser light source 4 corresponds to the "non-resonant light" according to the present disclosure. The controller 10 corresponds to the "control device" according to the present disclosure.

[0034] <Configuration of integrated kit> Fig. 2 is an exploded perspective view of the integrated kit 1. Fig. 3A is a top view of the integrated kit 1. Fig. 3B is a cross-sectional view of the integrated kit 1 taken along line IIIB-IIIB in Fig. 3A. Referring to Figs. 2 to 3B, the integrated kit 1 includes a base material 11, a holding frame 12, an integrated substrate 13, and a cover glass 14.

[0035] The substrate 11 is provided to ensure the mechanical strength of the integrated kit 1. Furthermore, the substrate 11 is configured to transmit white light from the illumination light source 7. Specifically, the substrate 11 is, for example, a glass substrate (glass slide). The substrate 11 may also be a silicone substrate, a PET (polyethylene terephthalate) film, or the like. The shape of the substrate 11 is not particularly limited, but in this example, it is a planar shape (rectangular parallelepiped shape).

[0036] The holding frame 12 holds a sample (denoted by SP). In this example, the holding frame 12 is provided with a cylindrical through-hole 121. The through-hole 121 functions as a "liquid reservoir" that stores a certain amount of sample.

[0037] The integration substrate 13 is placed in the through-hole 121 of the holding frame 12. The integration substrate 13 is configured to accumulate multiple types of microorganisms as a result of irradiation with laser light. A manufacturing method and detailed structure of the integration substrate 13 will be described with reference to Figs. 5 to 9.

[0038] The cover glass 14 covers from above the sample held in the through-hole 121 of the holding frame 12. As shown in Fig. 3B, it is desirable to fill the through-hole 121 with the sample and then seal the sample with the cover glass 14. The reason for this will be described later.

[0039] FIG. 4 is an image diagram showing the accumulation of multiple types of microorganisms. The accumulation substrate 13 has multiple pores 131 arranged in a honeycomb pattern. Each of the multiple pores 131 has an opening that can capture at least one of each type of multiple types of microorganism, and a depth that extends in a direction that includes a vertically downward component. According to this embodiment, by irradiating the sample with laser light from the laser light source 4, multiple types of microorganisms suspended in the sample can be accumulated in the pores 131 of the accumulation substrate 13. This accumulation mechanism will also be described with reference to FIGS. 10 and 11.

[0040] Note that three types of microorganisms are shown schematically in the samples of Figures 3A, 3B, and 4. However, the number of types of microorganisms is not limited to three, and may be two or more. In reality, typical microorganisms are too small to be observed with the naked eye.

[0041] <Integrated kit manufacturing flow> Fig. 5 is a flowchart showing the procedure of the method for manufacturing the integrated kit 1 according to this embodiment. Figs. 6A to 6E are schematic process diagrams of the method for manufacturing the integrated kit 1 according to this embodiment. Hereinafter, steps will be abbreviated as "S".

[0042] 5 and 6A to 6E, in S101, a mold (casting die) 901 for manufacturing the integrated substrate 13 is prepared (see FIG. 6A). For example, the mold 901 can be fabricated by processing silicon using techniques such as electron beam lithography or dry etching.

[0043] FIG. 7 is a scanning electron microscope (SEM) image showing an example of a mold 901. The mold 901 has, for example, a plurality of cylindrical protrusions arranged in a honeycomb pattern. The diameter and height of the protrusions can be set to any value. In this example, the diameter of the protrusions was 14.0 μm, and the height of the protrusions was 12.1 μm.

[0044] 5 and 6A to 6E, in this embodiment, polydimethylsiloxane (PDMS: dimethylpolysiloxane), which is a liquid silicone rubber, is used as the material of the integrated substrate 13. In S102, a mixed liquid 902 of a PDMS prepolymer (PDMS before hardening) and a hardener is poured into a mold 901 (see FIG. 6B).

[0045] In S103, the degassed mixed solution 902 of the PDMS prepolymer and the curing agent is baked under predetermined conditions to cure the PDMS (see FIG. 6C).

[0046] In S104, the cured mixture 902 is peeled off from the mold 901, thereby completing the integrated substrate 13 (see FIG. 6D).

[0047] In S105, the integration substrate 13 is placed in the holding frame 12 (see FIG. 6E). This completes the integration kit 1 before sample introduction, and the series of processes ends.

[0048] Fig. 8 is a diagram showing a top view of the integrated substrate 13. Fig. 9 is a diagram showing a cross-sectional view of the integrated substrate 13. As shown in Figs. 8 and 9, the integrated substrate 13 has a plurality of cylindrical pores 131 arranged in a honeycomb pattern. The diameter of the pores 131 was 14 µm, and the depth of the pores was 13 µm.

[0049] Accumulation mechanism Next, the mechanism of accumulation of multiple types of microorganisms in this embodiment will be described. In each example described below, three types of bacteria, specifically, lactic acid bacteria (Lactobacillus casei), Pseudomonas aeruginosa, and Staphylococcus aureus, were used as the microorganisms to be accumulated.

[0050] Lactic acid bacteria are rod-shaped bacteria. The length of the long axis (major diameter) of a typical lactic acid bacterium is about 1 to 3 μm. Pseudomonas aeruginosa is a rod-shaped bacterium. The length of the long axis of a typical Pseudomonas aeruginosa is about 0.7 to 2 μm. Staphylococcus aureus is a coccus. The diameter of a typical Staphylococcus aureus is about 0.8 to 1 μm. Lactic acid bacteria and Pseudomonas aeruginosa have chemotaxis. On the other hand, Staphylococcus aureus does not have chemotaxis.

[0051] In general, intestinal bacteria are classified into good bacteria, bad bacteria, and opportunistic bacteria. Lactic acid bacteria are good bacteria. Pseudomonas aeruginosa is bad bacteria. Staphylococcus aureus is opportunistic bacteria. By adjusting the content ratio of lactic acid bacteria, Pseudomonas aeruginosa, and Staphylococcus aureus, the ratio of good bacteria, bad bacteria, and opportunistic bacteria can be set to the desired value. For example, it is possible to create an ideal balance of intestinal flora (intestinal flora) with good bacteria:bad bacteria:opportunistic bacteria = 2:1:7.

[0052] Fig. 10 is a diagram for explaining the light-induced force acting on bacteria when irradiated with laser light from the laser light source 4. Fig. 10 shows an example of Pseudomonas aeruginosa (indicated by B), which has flagella and strong chemotaxis (active motility).

[0053] Photoinduced forces include inter-substance photoinduced forces, gradient forces, and dissipative forces. In the vicinity of the beam waist of the laser light, inter-substance photoinduced forces and gradient forces act particularly strongly on the bacteria. This causes the bacteria to be attracted toward the beam waist. As the bacteria move away from the vicinity of the beam waist, dissipative forces become prominent as photoinduced forces acting on the bacteria. The direction in which the dissipative forces act is the same as the direction of irradiation of the laser light. In this example, the laser light is irradiated from above downward, so a dissipative force from above downward acts on the bacteria.

[0054] The dissipative force includes a component due to light absorption (absorption force) and a component due to light scattering (scattering force). The absorption force is proportional to the absorption cross-section of the target object and the laser intensity (= output / irradiation area). The scattering force is proportional to the scattering cross-section of the target object and the laser intensity. As mentioned above, this embodiment uses non-resonant light (laser light with a wavelength outside the wavelength range of electronic resonance of multiple types of bacteria). This is because the light absorption range of bacteria is avoided so that the laser light itself does not damage the bacteria. Therefore, the absorption force included in the dissipative force is negligibly small. Therefore, the dissipative force can also be called scattering force.

[0055] Each bacterium is approximately several micrometers in size. This is comparable to the 1064 nm wavelength of the laser light. Therefore, when the bacterium is irradiated with laser light, Mie scattering occurs, enhancing the scattering force even under conditions that avoid the light absorption region of the bacterium (under conditions of electronic non-resonance). More specifically, each bacterium in a liquid sample is subjected to upward buoyancy and forces due to Brownian motion (collisions) of molecules in the sample. In this embodiment, a downward scattering force is exerted on each bacterium that is greater than the buoyancy (the magnitude of its upward component) and the upward component of the force due to Brownian motion. More preferably, the magnitude of the downward component of the scattering force is greater than the sum of the buoyancy (the magnitude of its upward component) and the upward component of the force due to Brownian motion. This allows each bacterium to be forcefully pushed toward the pore. For simplicity, the dissipative force or scattering force due to laser light irradiation will also be referred to as "light pressure" below.

[0056] FIG. 11 is a diagram illustrating the accumulation mechanism of multiple types of bacteria in this embodiment. In addition to the buoyancy and the force due to Brownian motion acting on chemotactic bacteria, the chemotactic bacteria themselves can generate a propulsive force moving upward, as shown in FIG. 11. In this case, the bacteria move away from the accumulation substrate 13, which may make it even more difficult for the bacteria to accumulate on the accumulation substrate 13. Therefore, in this embodiment, the optical pressure acting downward on the bacteria by irradiation with laser light is set to be greater than the upward propulsive force due to the chemotaxis of the bacteria. In other words, the magnitude of the downward component of the optical pressure is greater than the (upward component of) buoyancy, greater than the upward component of the force due to Brownian motion, and greater than the upward component of the propulsive force due to chemotaxis. More preferably, the magnitude of the downward component of the optical pressure is greater than the sum of the upward component of the buoyancy, the upward component of the force due to Brownian motion, and the upward component of the propulsive force due to chemotaxis. By setting the light pressure to a value large enough to overcome the propulsive force due to chemotaxis, it is possible to achieve the accumulation of multiple types of bacteria, including chemotactic bacteria.

[0057] Even without irradiating a sample containing multiple types of bacteria with laser light, bacteria can be accumulated to a certain extent over a very long period of time. However, bacteria cannot be accumulated in a manner suitable for analyzing interactions between multiple types of bacteria. More specifically, without irradiating with laser light, Staphylococcus aureus, which does not have chemotaxis, is first trapped in the pores, followed by Lactobacillus and Pseudomonas aeruginosa, which are trapped in the pores in order of weaker chemotaxis. This results in an uneven distribution of multiple types of bacteria within the pores. In this case, spatial variations occur in the interactions between multiple types of bacteria, making this method unsuitable for analyzing interactions. In contrast, this embodiment allows multiple types of bacteria to be accumulated in a uniformly distributed state within the pores. Therefore, this embodiment makes it possible to suitably analyze interactions between multiple types of bacteria.

[0058] <Bacteria accumulation flow> 12 is a flowchart showing the procedure for bacteria accumulation processing. The processing shown in this flowchart is executed when a predetermined condition is met (for example, when a user operates a start button (not shown) on the HMI 9). Each step is basically realized by software processing by the controller 10 (processor 101), but some or all of the steps may also be realized by hardware (electrical circuits) arranged within the controller 10.

[0059] In S201, the controller 10 places the integrated kit 1 on the XYZ axis stage 2. This process can be realized, for example, by a feeding mechanism (not shown) for the integrated kit 1. Instead of automating this process, the user may place the integrated kit 1 manually.

[0060] In S202, the controller 10 introduces a sample containing multiple types of bacteria into the holding frame 12 of the assembly kit 1. This process can be achieved, for example, by a dispenser (not shown) that can inject the sample. Alternatively, the user may manually introduce the sample into the assembly kit 1.

[0061] In S203, the controller 10 seals the introduced sample with a cover glass 14. This process can also be automated by a feeding mechanism, but the user may also manually place the cover glass 14.

[0062] In S204, the controller 10 starts photographing the samples in the assembly kit 1. More specifically, the controller 10 controls the illumination light source 7 to start irradiating the assembly kit 1 with white light, and controls the camera 8 to photograph an image of the assembly kit 1 at the laser spot.

[0063] In S205, the controller 10 adjusts the horizontal position using the adjustment mechanism 3 so that the irradiation position of the laser light (position of the laser spot) is on the integrated substrate 13. The controller 10 can adjust the position of the laser spot on the integrated substrate 13, for example, by extracting the integrated substrate 13 from an image captured by the camera 8.

[0064] In S206, the controller 10 adjusts the vertical height of the integrated kit 1 using the adjustment mechanism 3 so that the optical pressure of the laser light exceeds the propulsive force due to chemotaxis. The optical pressure has the following relationship with the diameter of the laser spot on the upper surface of the integrated substrate 13 (hereinafter abbreviated as "spot diameter").

[0065] 13 is a diagram illustrating the relationship between light pressure and spot diameter. In this embodiment, the height of the integrated kit 1 is adjusted so that the laser spot is located below the upper surface of the integrated substrate 13. The distance between the laser spot and the upper surface of the integrated substrate 13 is denoted as D.

[0066] As the distance D increases, the spot diameter increases. When the output of the laser beam is fixed, the output per unit area of ​​the laser beam at the laser spot, i.e., the laser intensity (unit: W / m), increases as the distance D increases. 2 ) becomes lower, and therefore the light pressure also becomes weaker. Thus, there is a negative correlation between the light pressure and the spot diameter. The relationship between the distance D, the spot diameter, and the light pressure per unit area can be calculated in advance. This allows the light pressure to be set to a desired value that overcomes the propulsive force due to the chemotaxis of the bacteria by adjusting the vertical height of the integration kit 1 (adjusting the distance D).

[0067] Referring again to FIG. 12, in S207, the controller 10 sets the length of time (predetermined time) for irradiating the laser light. The controller 10 receives, for example, a user operation for setting the predetermined time from the HMI 9. Alternatively, the predetermined time may be automatically set according to the light pressure (spot diameter and / or the vertical height of the integrated kit 1). expensive The specified time tends to be shorter as the light pressure increases. The controller 10 may have a map that represents the relationship between the light pressure and the specified time. By referring to the map, the controller 10 can set the specified time corresponding to the light pressure set in S206.

[0068] In S208, the controller 10 controls the laser light source 4 to start (or continue) irradiating the integrated kit 1 with laser light. During irradiation with laser light, multiple types of bacteria are accumulated in the pores 131 according to the mechanism described in FIGS. 10 and 11.

[0069] In S209, the controller 10 determines whether the elapsed time from the start of laser light irradiation has reached a specified time. If the elapsed time has not reached the specified time (NO in S209), the controller 10 returns the process to S208. This allows the laser light irradiation to continue. If the elapsed time reaches the specified time (YES in S209), the controller 10 proceeds to S210 and controls the laser light source 4 to stop the laser light irradiation. Furthermore, the controller 10 ends the photographing of the samples in the assembly kit 1 (S211). That is, the controller 10 stops the irradiation of white light from the illumination light source 7 and stops the operation of the camera 8.

[0070] In S212, the controller 10 analyzes the captured image of the sample (a fluorescent image in the embodiment described below). The controller 10 can, for example, calculate the area of ​​accumulated bacteria and the survival rate of the accumulated bacteria. This completes the series of processes.

[0071] <Comparison with prior art> The characteristics of the accumulation mechanism of multiple types of bacteria in this embodiment will be described in detail in comparison with the mechanism described in Patent Document 1.

[0072] 1. Heating the laser spot In the collection kit described in Patent Document 1, a thin gold film is formed on a honeycomb polymer film. When a laser beam is irradiated onto the thin gold film, the light energy is converted into thermal energy by the gold film, causing local heating of the laser beam's irradiation position (laser spot) (photothermal effect). This creates a temperature gradient in the liquid sample, where the temperature increases the closer to the laser spot, causing thermal convection. This thermal convection carries bacteria toward the laser spot, causing the bacteria to accumulate near the laser spot (see paragraphs

[0064] to

[0072] of Patent Document 1). However, the bacteria are also heated as the liquid sample is heated. This causes thermal damage to the bacteria, potentially resulting in their death.

[0073] In contrast, in this embodiment, the integration substrate 13 is not provided with a photothermal conversion material equivalent to the gold thin film in Patent Document 1. In this embodiment, bacteria are accumulated by an optical method in which the bacteria are forced into pores by an optical pressure set to a value large enough to overcome the propulsive force due to chemotaxis. Therefore, according to this embodiment, multiple types of bacteria can be accumulated while suppressing thermal damage.

[0074] 2. Laser output and spot diameter In Patent Document 1, the laser beam is focused so that it can be irradiated onto the partition walls separating the pores of the honeycomb polymer membrane (see Figures 12 and 21 and paragraph

[0103] of Patent Document 1). This is because focusing the laser beam as much as possible is advantageous from the perspective of creating a large temperature gradient in the liquid sample. Another reason is that limiting the area where heat is generated by laser beam irradiation (and the area where the generated heat is transmitted to the surrounding area) reduces thermal damage to the bacteria. Specifically, the laser beam is focused to a spot diameter of approximately several micrometers. Patent Document 1 also states that the laser output from the laser light source is set to 40 mW. In Patent Document 1, the laser output after passing through the objective lens (magnification 100x, oil immersion) is calculated to be approximately 8 mW, which is approximately 20% of the laser output before passing through the objective lens (see paragraph

[0081] of Patent Document 1).

[0075] The bacterial accumulation mechanism in this embodiment is to apply the optical pressure of the laser light directly to the bacteria, forcing them into the pores. To increase the amount of accumulated bacteria, it is necessary to increase the area of ​​the sample irradiated with the laser light. Therefore, in this embodiment, the laser spot is not narrowed excessively. In the example described later (see FIG. 15), the spot diameter is set within the range of 62.6 to 152.6 μm. In the examples described later (FIGS. 19 and 20), the output of the laser light from the laser light source 4 is set to 800 mW. The laser output after passing through the objective lens (magnification 40×, dry) is calculated to be approximately 320 mW, which is approximately 40% of the laser output before passing through the objective lens. This output value is so high that, according to conventional technical common sense, a person skilled in the art would never consider irradiating microorganisms with it.

[0076] As described above, in this embodiment, the irradiation area of ​​the laser beam is two orders of magnitude larger and the output power (unit: W) of the laser beam is one to two orders of magnitude larger (approximately 40 times) than in Patent Document 1. That is, in this embodiment, high intensity (unit: W / m 2 ) laser light is irradiated over a wide area. This applies a strong optical pressure over a wide area that can overcome the propulsive force of the bacteria due to chemotaxis. This makes it possible to accumulate a large amount of bacteria with high efficiency.

[0077] 3. Pore size In the collection kit described in Patent Document 1, the pore diameter was approximately 5.0 μm and the pore depth was approximately 3.0 μm (see FIG. 5 and paragraph

[0051] of Patent Document 1). As mentioned above, the major axis lengths of lactic acid bacteria, Pseudomonas aeruginosa, and Staphylococcus aureus are in the range of approximately 0.7 to 3 μm. For example, when the major axis length is 3 μm, only a few bacteria (at most 2 or 3) are captured in each pore provided in the collection kit described in Patent Document 1.

[0078] In contrast, in this embodiment, the diameter of the pores 131 is 14 μm, and the depth of the pores 131 is 13 μm. In other words, the pores 131 provided in the integration substrate 13 in this embodiment are significantly larger than the pores provided in the collection kit of Patent Document 1. Specifically, the opening area of ​​the pores 131 is 7.8 times larger. The depth of the pores 131 is 4.3 times larger. The volume of the pores 131 is 34 times larger. By setting the size of each pore to be sufficiently large in this way (setting the size so that at least one of each type of bacteria can be captured or accommodated), multiple types of bacteria can be accumulated in the same pore. For example, as many as 68 to 102 bacteria with a major axis length of 3 μm can be accumulated. This makes it possible to suitably analyze interactions between multiple types of bacteria.

[0079] ≪4. Pore interconnection≫ In the collection kit described in Patent Document 1, a honeycomb polymer membrane is formed by using a plurality of water droplets arranged in a honeycomb pattern through self-organization as a mold (see Figure 4 of Patent Document 1). In a honeycomb polymer membrane, each pore is approximately spherical due to the spherical shape of the water droplets, and adjacent pores are connected to each other on the bottom side of the polymer membrane (see Figure 5 and paragraph

[0052] of Patent Document 1). The connection between adjacent pores forms "side holes" in the collection kit. Thermal convection also flows in the direction in which these side holes extend (side hole direction). Thermal convection in the side hole direction serves to prevent bacteria once captured in the pores from escaping from the pores.

[0080] In contrast, in this embodiment, as can be seen from the cross-sectional view of FIG. 9, adjacent pores are not connected to each other, and no "side holes" exist. Therefore, thermal convection in the direction of the side holes does not occur. Therefore, in this embodiment, the depth of the pores is determined so that the bacteria do not escape by chemotaxis even after laser light irradiation is stopped. Although bacteria are chemotactic, they only move straight in the direction of the concentration gradient of chemical substances (attractants / repellents). By making the pores sufficiently deep in consideration of bacterial chemotaxis, even if the bacteria move straight in response to the concentration gradient of the chemical substances, their movement can be contained within the pores. This allows bacteria captured in the pores by light irradiation to remain captured in the pores even after light irradiation is stopped.

[0081] 5. Evaporation of the dispersion medium In the collection kit described in Patent Document 1, a droplet-shaped sample held on the collection kit is open toward the space above (see FIG. 3 of Patent Document 1). As the sample's dispersion medium evaporates from the droplet surface, Marangoni convection can occur within the sample. On the other hand, in Patent Document 1, buoyancy convection caused by laser light irradiation is actively utilized for bacterial accumulation. Because the accumulation effect of buoyancy convection is strong, the occurrence of Marangoni convection in addition to buoyancy convection does not significantly hinder bacterial accumulation.

[0082] In contrast, this embodiment utilizes light pressure instead of buoyancy convection for bacterial accumulation. Because the accumulation effect of light pressure is not as strong as that of buoyancy convection, Marangoni convection can hinder bacterial accumulation. Therefore, in this embodiment, the through-hole 121 is filled with a sample, and the sample is sealed with a cover glass 14 (see FIGS. 3A and 3B). This closed system, in which the sample does not come into contact with the surrounding air, suppresses evaporation of the dispersion medium from the sample surface and the occurrence of Marangoni convection, which can hinder bacterial accumulation. Furthermore, increasing the volume of the dispersion medium ensures a sufficient distance between the sample surface and the laser spot, thereby reducing the effects of Marangoni convection.

[0083] The results of the enrichment process for a sample containing three types of bacteria (Lactobacillus acidophilus, Pseudomonas aeruginosa, and Staphylococcus aureus) are described below. All bacteria were fluorescently stained. SYTO9 (registered trademark) or PI (Propidium Iodide) was used as the fluorescent dye. SYTO9 stains both living bacteria (viable bacteria) and dead bacteria (dead bacteria). When SYTO9 is excited externally, it emits green fluorescence. Fluorescence images observed using the SYTO9 excitation wavelength are referred to as "SYTO9 images." On the other hand, PI stains only dead bacteria. When PI is excited externally, it emits red fluorescence. Fluorescence images observed using the PI excitation wavelength are referred to as "PI images." and Also include:

[0084] ≪1. Spot diameter dependency≫ Figure 14 is a SYTO9 image showing the accumulation of bacteria (both live and dead bacteria) at different spot diameters. Figure 15 is a diagram showing the relationship between the spot diameter and the area of ​​the region where fluorescence was observed in the fluorescent image of Figure 14 (fluorescence area). The horizontal axis of Figure 15 represents the spot diameter, and the vertical axis represents the fluorescence area (= bacterial accumulation area). The laser output from the laser light source 4 was set to 800 mW. The light irradiation time (the specified time in Figure 12) was set to 15 minutes. The bacterial concentration was 10 8 [CFU / mL] (CFU: Colony Forming Unit).

[0085] When the distance D between the laser spot and the upper surface of the integration substrate 13 was 40 μm, the spot diameter was 62.6 μm. When the distance D was 70 μm, the spot diameter was 107.6 μm. When the distance D was 100 μm, the spot diameter was 152.6 μm. As shown in FIG. 15, it was confirmed that the bacterial accumulation area increased as the distance D increased and the spot diameter increased accordingly.

[0086] ≪2. Light irradiation time dependence≫ Figure 16 is a SYTO9 image showing the accumulation of bacteria (both live and dead) under different light irradiation times. Figure 17 is a PI image showing the accumulation of bacteria (only dead bacteria) under 60 minutes of light irradiation. The light irradiation time was set at 15-minute intervals from 15 to 90 minutes. The spot diameter was set to 107.6 μm. The laser power was set to 800 mW. The bacterial concentration was 10 8 [CFU / mL].

[0087] Figure 16 shows that the total bacterial accumulation area increases as the light irradiation time increases, and Figure 17 shows that a certain amount of bacteria can be killed when the light irradiation time is extended to 60 minutes.

[0088] The survival rate of the accumulated bacteria can be calculated by analyzing the SYTO9 and PI images shown in Figures 16 and 17. The survival rate means the ratio of the number of live bacteria to the total number of accumulated bacteria, as shown in the following formula (1). Survival rate = number of viable bacteria / (number of viable bacteria + number of dead bacteria) × 100 ···(1)

[0089] The denominator on the right side of equation (1) is the number of bacteria observed in the SYTO9 image. The numerator on the right side is calculated by subtracting the number of bacteria observed in the PI image (= number of dead bacteria) from the number of bacteria observed in the SYTO9 image (= number of live bacteria + number of dead bacteria).

[0090] Figure 18 shows the relationship between light irradiation time, survival rate, and fluorescent area. The horizontal axis represents light irradiation time. The left vertical axis represents bacterial survival rate. The right vertical axis represents fluorescent area. In this example, the fluorescent area increased as the light irradiation time increased, from 15 to 75 minutes. When the light irradiation time reached 75 minutes, the fluorescent area saturated. No significant difference was observed in the fluorescent area between the 75-minute and 90-minute light irradiation times. On the other hand, the survival rate monotonically decreased as the light irradiation time increased. However, even at a light irradiation time of 90 minutes, the survival rate remained high, exceeding 70%.

[0091] Figure 18 shows that there is a light irradiation time that can achieve both a large fluorescent area and a high survival rate. In this example, by setting the light irradiation time to around 45 minutes, bacteria can be accumulated efficiently while suppressing their death.

[0092] Patent Document 1 describes that bacteria can accumulate with a short light irradiation time of about one minute (see FIG. 12 and paragraph

[0074] of Patent Document 1). In contrast, in the present embodiment, a longer light irradiation time of about ten minutes to several tens of minutes may be required. However, according to the present embodiment, it is possible to accumulate bacteria while suppressing thermal damage in exchange for a longer light irradiation time.

[0093] 3. Laser output dependency Figure 19 shows SYTO9 images showing bacterial accumulation at different laser powers. The laser power was set to four levels: 200 mW, 400 mW, 600 mW, and 800 mW. The spot diameter was set to 62.6 μm. The irradiation time was set to 15 minutes. The bacterial concentration was 10 8 [CFU / mL]. Bacterial accumulation was observed when the laser output was 400mW or higher.

[0094] Figure 20 shows the relationship between laser power, survival rate, and accumulation density. The horizontal axis represents the laser power. The left vertical axis represents the bacterial survival rate. The right vertical axis represents the bacterial accumulation density. When the laser power is 800 mW, a high survival rate of over 90% and an accumulation density of 3.37 × 10 7 [pcs / cm 2 It was confirmed that the bacteria were successfully accumulated at high density.

[0095] ≪4. Multicolor dyeing≫ Figure 21 shows a fluorescent image showing the accumulation of multiple types of bacteria stained in multiple colors. Multicolor staining was performed using the fluorescence in situ hybridization (FISH) method. The spot diameter was set to 107.6 μm. The laser output was set to 800 mW. The light irradiation time was set to 5 minutes.

[0096] Specifically, lactic acid bacteria were stained using a probe conjugated with a green fluorescent dye (Alexa Flour (registered trademark) 488). The base sequence of the probe was 5'GGTATTAGCAYCTGTTTCCA3'. Pseudomonas aeruginosa was stained using a probe conjugated with a yellow fluorescent dye (Alexa Flour 555). The base sequence of the probe was 5'TCTGGAAAGTTCTCAGCA3'. Staphylococcus aureus was stained using a probe conjugated with a blue fluorescent dye (Alexa Flour 405). The base sequence of the probe was 5'GAAGCAAGCTTCTCGTCCGTTC3'.

[0097] Although it is difficult to see in Figure 21 because it is a black and white image, the above three colors of fluorescence were observed, confirming that the three types of bacteria had been successfully accumulated.

[0098] 5. Accumulation at high concentrations The accumulation results for high-concentration and low-concentration samples are explained. 9 [CFU / mL] as a high concentration, 10 8 [CFU / mL] was set as a low concentration. The low concentration is the same as the concentration in Figures 14 to 20, and the high concentration is 10 times that concentration. The laser output was set to 800 mW. The spot diameter was set to 152.6 μm.

[0099] Figure 22 is a fluorescent image showing bacterial accumulation in a high-concentration sample. Figure 23 is a fluorescent image showing bacterial accumulation in a low-concentration sample. The SYTO9 image is shown on the left, and the PI image is shown on the right. It was clear that the high-concentration sample had a larger bacterial accumulation area and a greater amount of bacterial accumulation than the low-concentration sample.

[0100] Figure 24 shows a magnified optical image of the accumulated bacteria. Many of the bacteria captured within the pores were observed moving, suggesting a high survival rate.

[0101] Figure 25 shows the bacterial accumulation area and survival rate. The horizontal axis represents the light irradiation time. The upper vertical axis represents the bacterial accumulation area, and the lower vertical axis represents the bacterial survival rate. The high-concentration sample showed a faster rise (increase rate) in the accumulation area compared to the low-concentration sample, especially at 15 to 30 minutes of light irradiation. Furthermore, even after 30 minutes, the accumulation area remained large for the same light irradiation time. After 45 minutes of light irradiation, the low-concentration sample showed a slight decrease in survival rate over time. In contrast, the high-concentration sample showed almost no decrease in survival rate, and the survival rate of the high-concentration sample was close to 100%. The following two points can be considered from the results shown in Figures 22 to 25.

[0102] First, in the case of a highly concentrated sample, many bacteria are pushed into the pores by the irradiation of the laser light and are quickly captured inside the pores. The laser light is less likely to directly hit the bacteria trapped inside the pores. This is because the bacteria inside the pores are stacked three-dimensionally, and the laser light is blocked from reaching the bacteria in the lower layers by the bacteria in the upper layers. Therefore, a significant proportion of the bacteria trapped inside the pores are not damaged by the laser light. Therefore, it is thought that by making the sample highly concentrated and capturing many bacteria in a short period of time, it is possible to suppress the decline in bacterial survival rate.

[0103] Second, in the low-concentration sample, the area of ​​bacterial accumulation was equivalent to the laser spot (see Figure 23), whereas in the high-concentration sample, the area of ​​bacterial accumulation was significantly wider than the laser spot (see Figure 22). This means that bacteria that were not irradiated with light also accumulated in the high-concentration sample. This is thought to be because when the irradiated bacteria were pushed toward the pores, a flow was generated in the sample as the bacteria moved, and surrounding bacteria that were not irradiated with light were caught in this flow and captured within the pores.

[0104] Taking the above two considerations into account, the concentration of the sample should be set to a high level so that bacteria accumulate over a wider area than the laser spot. adjustment This shows that a high survival rate can be achieved.

[0105] As described above, in this embodiment, the laser light irradiation conditions are set so that multiple types of bacteria can be optically accumulated without using the photothermal effect of a photothermal conversion material such as a gold thin film. More specifically, the laser light irradiation range is preferably set so as to include the entire opening of two or more pores (see FIG. 4). Furthermore, the laser intensity (= output power / irradiation area) is set so that the dissipation force (photoinduced force) acting in the direction of laser light irradiation is greater than the buoyancy force, greater than the force due to Brownian motion, and preferably greater than the propulsive force due to chemotaxis (see FIG. 11). This allows multiple types of bacteria to be accumulated alive within the pores over a wide area. Therefore, this embodiment makes it possible to effectively analyze interactions between multiple types of bacteria, including at least one type of bacterium with chemotaxis.

[0106] In the present embodiment, an example has been described in which the integration substrate 13 (its main surface) is arranged in the horizontal direction. In this case, each of the multiple pores 131 has a depth that extends in a direction that includes only a vertically downward component. However, the integration substrate 13 may be arranged at an angle relative to the horizontal direction. In other words, the depth of each of the multiple pores 131 may extend in a direction that includes a horizontal component in addition to a vertically downward component.

[0107] In addition, in this embodiment, an example has been described in which the laser light from the laser light source 4 is irradiated perpendicularly to (the main surface of) the integrated substrate 13. In this case, the propagation direction of the laser light coincides with the depth direction of the multiple pores 131. However, the laser light may be irradiated at an angle other than perpendicular to the integrated substrate 13 (excluding parallel). In other words, the propagation direction of the laser light does not have to coincide completely with the depth direction of the multiple pores 131, as long as it includes a vertical downward component.

[0108] [Modification of the embodiment] In the embodiment, an example in which bacteria accumulate in a stationary sample has been described. In this modified example, bacteria accumulate in a sample flowing through a microchannel.

[0109] 26 is an overall configuration diagram of a microorganism accumulation system according to a modified example of the embodiment of the present disclosure. Enrichment system 200 differs from accumulation system 100 according to the embodiment (see FIG. 1) in that it includes accumulation kit 15 instead of accumulation kit 1, and in that it further includes pump 16 and capillaries 17 and 18. The rest of the configuration is the same.

[0110] The integrated kit 15 includes a microchannel substrate 15A (see FIG. 28). The integrated kit 15 can be produced using a mold in the same manner as in the embodiment. The configuration of the integrated kit 15 will be described with reference to FIGS. 27 to 30.

[0111] The pump 16 is configured to pump the sample by the action of pressure, centrifugal force, or rotational force. The pump 16 may be, for example, an electric syringe pump, a manual dispenser, or a micropipette. The pump 16 is connected to a capillary tube 17 provided upstream of the integrated kit 15. The sample flows through the integrated kit 15 via the capillary tube 17 and is then discharged from a capillary tube 18 provided downstream of the integrated kit 15.

[0112] 27 is a diagram showing an example of a mold for forming a microchannel substrate. Mold 903 is produced using, for example, a 3D printer.

[0113] FIG. 28 is a diagram showing a microchannel substrate fabricated using the mold 903 shown in FIG. 27. Microchannel substrate 15A can be fabricated by pouring a PDMS solution into mold 903 and heating and curing the PDMS solution. In this example, microchannel substrate 15A includes a non-branched channel that includes one inlet and one outlet. However, the microchannel substrate may include multiple inlets and / or multiple outlets, or may be branched.

[0114] Fig. 29 is a diagram showing an example of an integrated substrate. An integrated substrate 15B as shown in Fig. 29 is bonded to a microchannel substrate 15A. The integrated substrate 15B is the same as the integrated substrate 13 in the embodiment (see Figs. 8 and 9). Fig. 30 is an image of an actually fabricated integrated kit 15.

[0115] 31 is a diagram for explaining the accumulation mechanism of multiple types of microorganisms in a modified example. When the microorganisms are chemotactic bacteria, the bacteria are subjected to buoyancy, a force due to Brownian motion, and the propulsive force of the bacteria itself, as well as a drag force due to the fluid (pressure-driven flow).

[0116] In this modification, the optical pressure acting downward on the bacteria due to irradiation with laser light is set to be greater than the upward component of the drag force. That is, the downward component of the optical pressure is greater than the (upward component of) buoyancy, greater than the upward component of the force due to Brownian motion, greater than the upward component of the propulsive force due to chemotaxis, and greater than the upward component of the drag force. More preferably, the downward component of the optical pressure is greater than the sum of the upward component of the buoyancy force, the upward component of the force due to Brownian motion, the upward component of the propulsive force due to chemotaxis, and the upward component of the drag force. By setting the optical pressure to a sufficiently large value in this way, it is possible to achieve the accumulation of multiple types of bacteria, including chemotactic bacteria, even in a fluid.

[0117] In addition, by using a microchannel, active bacteria (e.g., bacteria undergoing active cell division) are constantly supplied to the enrichment kit 15. According to this modification, even in a low-concentration sample, active bacteria can be enriched with high efficiency. Furthermore, similar to the embodiment, a high survival rate can be achieved.

[0118] [Note] Finally, various aspects of the present disclosure are summarized in the appendix.

[0119] (Appendix 1) A method for enriching microorganisms, which enriches multiple types of microorganisms contained in a liquid sample, comprising: The method includes a step of preparing a substrate having a plurality of pores, each of the plurality of pores having an opening capable of capturing at least one of each of the plurality of types of microorganisms and a depth extending in a direction including a vertical downward component, and further comprising: introducing the liquid sample onto the substrate; setting irradiation conditions for non-resonant light that is light outside the wavelength range of electronic resonance of the plurality of types of microorganisms; irradiating the non-resonant light through the liquid sample toward the plurality of pores according to the irradiation conditions; a region of the plurality of pores that is irradiated with the non-resonant light does not include a photothermal conversion material that converts the non-resonant light into heat; The setting step is a method for accumulating microorganisms, and includes a step of setting the intensity of the non-resonant light in the irradiation range of the non-resonant light so that, for the multiple types of microorganisms, the magnitude of the vertical downward component of the light-induced force due to irradiation of the non-resonant light is greater than the magnitude of the vertical upward component of the buoyancy force due to the liquid sample, and greater than the magnitude of the vertical upward component of the force due to Brownian motion of molecules in the liquid sample.

[0120] (Appendix 2) The method for accumulating microorganisms described in Appendix 1, wherein the setting step includes a step of setting the intensity in the irradiation range so that, for the multiple types of microorganisms, the magnitude of the vertical downward component of the light-induced force is greater than the sum of the magnitude of the vertical upward component of the buoyancy force and the magnitude of the vertical upward component of the force due to Brownian motion.

[0121] (Appendix 3) the plurality of types of microorganisms include microorganisms having chemotaxis, 3. The method for accumulating microorganisms described in Appendix 1 or 2, wherein the setting step includes a step of setting the intensity in the irradiation range so that, for the chemotactic microorganisms, the magnitude of the vertical downward component of the light-induced force is greater than the magnitude of the vertical upward component of the propulsive force due to chemotaxis.

[0122] (Appendix 4) The method for accumulating microorganisms described in Appendix 3, wherein the setting step includes a step of setting the intensity in the irradiation range so that, for the chemotactic microorganisms, the magnitude of the vertical downward component of the light-induced force is greater than the sum of the magnitude of the vertical upward component of the buoyancy force, the magnitude of the vertical upward component of the force due to Brownian motion, and the magnitude of the vertical upward component of the propulsive force due to chemotaxis.

[0123] (Appendix 5) A method for accumulating microorganisms described in Appendix 3 or 4, wherein the depth of each of the plurality of pores is determined so that the chemotactic microorganisms captured in each pore do not escape due to the propulsive force caused by the chemotaxis.

[0124] (Appendix 6) the introducing step is a step of circulating the liquid sample over the substrate, and the setting step includes a step of setting the intensity in the irradiation range so that the magnitude of the vertical downward component of the light-induced force is greater than the magnitude of the vertical upward component of the drag force caused by the liquid sample for the plurality of types of microorganisms. Additional notes 6. The method for enriching microorganisms according to any one of 1 to 5.

[0125] (Appendix 7) The setting step may include: Size is greater than the sum of the magnitude of the vertically upward component of the buoyancy, the magnitude of the vertically upward component of the force due to the Blough motion, and the magnitude of the vertically upward component of the drag force of the liquid sample. Additional notes 7. A method for enriching microorganisms according to claim 6.

[0126] (Appendix 8) A method for accumulating microorganisms described in any one of Appendices 1 to 7, wherein the setting step further includes a step of setting the irradiation range so as to include the entire openings of two or more pores among the plurality of pores.

[0127] (Appendix 9) 9. The method for enriching microorganisms according to any one of claims 1 to 8, wherein adjacent pores among the plurality of pores are not in communication with each other.

[0128] (Appendix 10) The step of introducing includes a step of forming a closed system in which the liquid sample does not come into contact with a gas surrounding the liquid sample. Appendix 1 10. A method for enriching microorganisms according to any one of claims 9 to 9.

[0129] (Appendix 11) The step of introducing the microorganisms includes increasing the concentration of the microorganisms in the liquid sample to a high concentration such that the microorganisms are accumulated in an area wider than the irradiation area. adjustment 11. The method for enriching microorganisms according to any one of appendices 1 to 10, comprising the step of:

[0130] (Appendix 12) A microbial enrichment system for enriching multiple types of microorganisms contained in a liquid sample, comprising: The method includes providing a substrate having a plurality of pores, each of the plurality of pores having an opening capable of capturing at least one of each of the plurality of types of microorganisms and a depth extending in a direction including a vertical downward component, and further comprising: a light source that irradiates non-resonant light, which is light outside the wavelength range of electronic resonance of the plurality of types of microorganisms, toward the plurality of pores through the liquid sample while the liquid sample is placed on the substrate; a control device for controlling the light source, a region of the plurality of pores that is irradiated with the non-resonant light does not include a photothermal conversion material that converts the non-resonant light into heat; The control device sets the intensity of the non-resonant light in the irradiation range of the non-resonant light so that, for the multiple types of microorganisms, the magnitude of the vertical downward component of the light-induced force due to irradiation of the non-resonant light is greater than the magnitude of the vertical upward component of the buoyancy force due to the liquid sample, and greater than the magnitude of the vertical upward component of the force due to the Brownian motion of molecules in the liquid sample.

[0131] The embodiments disclosed herein should be considered to be illustrative in all respects and not restrictive. The scope of the present disclosure is defined by the claims, not by the description of the above embodiments, and is intended to include all modifications within the meaning and scope of the claims. [Explanation of symbols]

[0132] 1 Integration kit, 11 Substrate, 12 Holding frame, 121 Through-hole, 13 Integration substrate, 131 Pore, 14 Cover glass, 15 Integration kit, 15A Microchannel substrate, 15B Integration substrate, 16 Pump, 17, 18 Capillary, 2 XYZ axis stage, 3 Adjustment mechanism, 4 Laser light source, 5 Dichroic mirror, 6 Objective lens, 7 Illumination light source, 8 Camera, 9 HMI, 10 Controller, 101 Processor, 102 Memory, 103 Input / output port, 100, 200 Integration system, 901 Mold, 902 Mixture, 903 Mold.

Claims

1. A method for enriching microorganisms, which enriches multiple types of microorganisms contained in a liquid sample while they remain viable, comprising: The method includes a step of preparing a substrate having a plurality of pores, each of the plurality of pores having an opening area capable of capturing at least one of each of the plurality of types of microorganisms and a depth extending in a direction including a vertical downward component and capable of capturing at least one of each of the plurality of types of microorganisms; and introducing the liquid sample onto the substrate; setting irradiation conditions for non-resonant light that is light outside the wavelength range of electronic resonance of the plurality of types of microorganisms; irradiating the non-resonant light through the liquid sample onto the plurality of pores according to the irradiation conditions; a region of the plurality of pores that is irradiated with the non-resonant light does not include a photothermal conversion material that converts the non-resonant light into heat; The setting step includes a step of setting an irradiation range of the non-resonant light so as to include the entire openings of two or more of the plurality of pores, and a step of setting the intensity of the non-resonant light in the irradiation range so that, for the plurality of types of microorganisms, the magnitude of the vertical downward component of the light-induced force due to irradiation with the non-resonant light is greater than the magnitude of the vertical upward component of the buoyancy force due to the liquid sample and greater than the magnitude of the vertical upward component of the force due to Brownian motion of molecules in the liquid sample.

2. The method for accumulating microorganisms described in claim 1, wherein the setting step includes a step of setting the intensity in the irradiation range so that, for the multiple types of microorganisms, the magnitude of the vertical downward component of the light-induced force is greater than the sum of the magnitude of the vertical upward component of the buoyancy force and the magnitude of the vertical upward component of the force due to Brownian motion.

3. the plurality of types of microorganisms include microorganisms having chemotaxis, The method for accumulating microorganisms described in claim 1, wherein the setting step includes a step of setting the intensity in the irradiation range so that, for the chemotactic microorganisms, the magnitude of the vertical downward component of the light-induced force is greater than the magnitude of the vertical upward component of the propulsive force due to chemotaxis.

4. The method for accumulating microorganisms described in claim 3, wherein the setting step includes a step of setting the intensity in the irradiation range so that, for the chemotactic microorganisms, the magnitude of the vertically downward component of the light-induced force is greater than the sum of the magnitude of the vertically upward component of the buoyancy force, the magnitude of the vertically upward component of the force due to Brownian motion, and the magnitude of the vertically upward component of the propulsive force due to chemotaxis.

5. The method for accumulating microorganisms according to claim 3, wherein the depth of each of the plurality of pores is determined so that the chemotactic microorganisms trapped in each pore do not escape due to the propulsive force caused by the chemotaxis.

6. the introducing step is a step of flowing the liquid sample over the substrate; The microbial accumulation method of claim 1, wherein the setting step includes a step of setting the intensity in the irradiation range so that the magnitude of the vertical downward component of the light-induced force for the multiple types of microorganisms is greater than the magnitude of the vertical upward component of the drag force due to the liquid sample.

7. The method for accumulating microorganisms described in claim 6, wherein the setting step includes a step of setting the intensity in the irradiation range so that, for the multiple types of microorganisms, the magnitude of the vertical downward component of the light-induced force is greater than the sum of the magnitude of the vertical upward component of the buoyancy force, the magnitude of the vertical upward component of the force due to Brownian motion, and the magnitude of the vertical upward component of the drag force of the liquid sample.

8. The method for enriching microorganisms according to any one of claims 1 to 7, wherein adjacent pores among the plurality of pores are not in communication with each other.

9. The method for enriching microorganisms according to any one of claims 1 to 7, wherein the introducing step includes a step of forming a closed system in which the liquid sample does not come into contact with gas surrounding the liquid sample.

10. A method for accumulating microorganisms according to any one of claims 1 to 7, wherein the introducing step includes a step of adjusting the concentration of the multiple types of microorganisms in the liquid sample to a high concentration such that the multiple types of microorganisms accumulate over a wider area than the irradiation range.

11. A microbial enrichment system for enriching multiple types of live microorganisms contained in a liquid sample, comprising: A substrate having a plurality of pores formed therein, each of the plurality of pores having an opening area capable of capturing at least one of each of the plurality of types of microorganisms and a depth extending in a direction including a vertical downward component and capable of capturing at least one of each of the plurality of types of microorganisms; and a light source that radiates non-resonant light, which is light outside the wavelength range of electronic resonance of the plurality of types of microorganisms, through the liquid sample to the plurality of pores while the liquid sample is placed on the substrate; a control device for controlling the light source, a region of the plurality of pores that is irradiated with the non-resonant light does not include a photothermal conversion material that converts the non-resonant light into heat; The control device sets the irradiation range of the non-resonant light so as to include the entire openings of two or more of the plurality of pores, and sets the intensity of the non-resonant light in the irradiation range so that, for the plurality of types of microorganisms, the magnitude of the vertical downward component of the light-induced force due to irradiation with the non-resonant light is greater than the magnitude of the vertical upward component of the buoyancy force due to the liquid sample and greater than the magnitude of the vertical upward component of the force due to the Brownian motion of molecules in the liquid sample.

Citation Information

Patent Citations

  • Method of processing and measuring specimen and apparatus for measuring the same

    JP1992066873A

  • Biomolecule analysis apparatus

    JP2004354345A

  • Cell supply, exhaust and trap apparatus, and method for supplying, exhausting and trapping cell

    JP2006094783A

  • Apparatus for separating microorganism

    JP2006262825A

  • Detection kit for substance to be detected, detection system provided therewith and method for manufacturing detection kit for substance to be detected

    JP2018194550A