Genetic medicine for treating neurodegenerative diseases

Abstract

The present invention relates to gene medicine for treating nerve injury disease, and belongs to the field of gene therapy technology.The present invention discloses the use of Porf-2 gene in preparing or screening medicine for treating / improving nerve injury disease, and also discloses isolated nucleic acid molecule for treating / improving nerve injury disease, comprising double-stranded RNA and / or shRNA that targets Porf-2 gene in nerve tissue and knocks down the expression of Porf-2 gene in said nerve tissue, and further develops the expression vector of interference nucleic acid of Porf-2 gene, the virus based on said expression vector and its pharmaceutical composition, and the use thereof in medicine for treating / improving nerve injury disease, which are highly expected to be clinically applied.

Description

[Technical Field]

[0001] The present invention relates to gene therapy for treating nerve damage diseases, and belongs to the field of gene therapy technology.

[0002] This application claims priority from a Chinese invention patent application (application number: 202111294181X, title of invention: gene drug for treating nerve damage diseases, filing date: November 3, 2021), the entire contents of which are incorporated herein by reference. [Background technology]

[0003] The optic nerve is formed by the axons of retinal ganglion cells (RGCs) converging at the optic nerve head and passing through the sclera. It is part of the process by which the brain protrudes outward to form the visual organs during embryonic development, and is essentially part of the central nervous system.

[0004] Optic nerve injury, also known as traumatic optic neuropathy, is one of the most common and serious complications of head injury. Traffic accident injuries, falls, and bruises, especially those from traffic accidents, are particularly prone to optic nerve injury. Direct injury to the optic nerve by a sharp instrument or other parts of the optic nerve is relatively rare in clinical practice; more than 90% of optic nerve injuries are indirect injuries to the optic canal. Specifically, indirect optic nerve injury refers to an impact on the outside of the orbit, generally the temporal region above the eyebrow ridge, which transmits external force through the skull to the optic canal, causing deformation or fracture of the optic canal and resulting in optic nerve damage, resulting in impaired vision and visual field.

[0005] In clinical treatment of optic nerve injury, current common treatments mainly include conservative treatment, hormonal therapy, surgical treatment (e.g., optic nerve decompression and autotransplantation), and optic nerve protection and regeneration. Traditional conservative treatment, hormonal therapy, and surgical treatment have not achieved satisfactory therapeutic effects. Due to the poor regenerative ability of RGCs, they are difficult to regenerate after optic nerve injury, leading to optic nerve atrophy and blindness. Therefore, how to repair and regenerate the damaged optic nerve and restore optic nerve function is currently a challenging issue in ophthalmology clinical research both at home and abroad in China.

[0006] Research has shown that identifying appropriate targets to enhance the regenerative capacity of damaged RGCs can promote optic nerve regeneration, as have the results of scientific research into gene therapy.

[0007] In gene therapy, adeno-associated virus (AAV) vector-based gene therapy technology has achieved some success after nearly 20 years of development. AAV, a member of the Parvoviridae family and the Dependent virus genus, is a non-enveloped, icosahedral, single-stranded DNA-defective virus with the simplest structure currently known. It requires the assistance of a helper virus (usually an adenovirus) for replication. The two terminal inverted repeats (ITRs) of AAV contain the cap and rep genes. The cap gene encodes the viral capsid protein, while the rep gene is involved in viral replication and integration. While wild-type AAV has an approximately 19% probability of infecting human chromosome 19, engineered recombinant AAV (rAAV) is unable to synthesize the Rep protein, resulting in a distinct lack of site-specific integration and a predominantly free form, resulting in an extremely low risk of insertional mutagenesis and oncogene activation. Recombinant adeno-associated viruses are considered one of the most promising gene transfer vectors, given their favorable safety profile, wide host cell range, low immunogenicity, and long-term expression of foreign genes in vivo, and are widely used in gene therapy research worldwide.

[0008] Currently, AAV vectors can be classified into 12 serotypes (AAV-1 to AAV-12) and over 100 variants (e.g., some derived chimeric AAV vectors). Different AAV vectors have different transfection efficiencies in different cells and tissues. Among them, AAV2 and AAV9 have been shown to have relatively high transfection efficiencies in the nervous system.

[0009] However, gene therapy for nerve damage diseases, particularly optic nerve damage diseases, still has a long way to go. Therefore, it is expected that this field will find important targets that can be clinically applied in the future and develop methods and drugs to effectively treat nerve damage diseases, particularly optic nerve damage diseases. Summary of the Invention [Problem to be solved by the invention]

[0010] The present invention discloses the investigation of the effect of the Porf-2 gene in the treatment / amelioration of optic nerve damage diseases using RNA interference (RNAi) as a means, and further provides a method for treating / ameliorating optic nerve damage diseases, which comprises administering to the optic nerve tissue of a patient a molecule capable of specifically inhibiting the transcription or translation of the Porf-2 gene, or a molecule capable of specifically inhibiting the expression or activity of the Porf-2 protein, in order to treat / ameliorate optic nerve damage diseases.

[0011] Considering that the Porf-2 gene is present not only in optic nerve tissue but also in other nerve tissues, and having disclosed the "effect of the Porf-2 gene by RNAi means in the treatment / improvement of optic nerve damage diseases" by the inventors of the present invention, a person skilled in the art can reasonably infer that the Porf-2 gene can also be applied to the treatment / improvement of other nerve damage diseases. [Means for solving the problem]

[0012] Thus, a first aspect of the present invention provides the use of the Porf-2 gene in the treatment / amelioration of nerve damage diseases.

[0013] In the treatment / amelioration of the neurological disorder, the amount of the molecule administered to the patient's neural tissue is sufficient to reduce the transcription or translation of the Porf-2 gene or the expression or activity of the Porf-2 protein, preferably by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99%.

[0014] The molecule administered to the patient's neural tissue may be selected from, but is not limited to, a nucleic acid molecule, a carbohydrate, a lipid, a small molecule chemical drug, an antibody drug, a polypeptide, a protein, or an interfering virus.

[0015] The nucleic acid includes, but is not limited to, an antisense oligonucleotide, a double-stranded RNA (dsRNA), or a short hairpin RNA (shRNA).

[0016] The double-stranded RNA (dsRNA) or short hairpin RNA (shRNA) contains information about the promoter sequence or coding region sequence of the Porf-2 gene.

[0017] Preferably, the double-stranded RNA (dsRNA) is a small interfering RNA (siRNA). The small interfering RNA comprises a first strand and a second strand that are complementary to each other to form an RNA dimer, and the sequence of the first strand is substantially identical to a 15-27 contiguous nucleotide sequence (target sequence) in the Porf-2 gene. The siRNA can specifically bind to an mRNA fragment encoded by the target sequence and specifically silence the expression of the Porf-2 gene.

[0018] The target sequence in the Porf-2 gene is a fragment in the Porf-2 gene corresponding to an mRNA fragment that complementarily binds with the siRNA when the siRNA specifically silences the expression of the Porf-2 gene.

[0019] Preferably, the Porf-2 gene is a human-derived Porf-2 gene.

[0020] Preferably, the nerve damage disease is an optic nerve damage disease.

[0021] A second aspect of the present invention provides use of the Porf-2 gene or Porf-2 protein in preparing or screening for a therapeutic / ameliorating agent for a nerve damage disease.

[0022] In the treatment / amelioration of the neurological disorder, the amount of the molecule administered to the patient's neural tissue is sufficient to reduce the transcription or translation of the Porf-2 gene or the expression or activity of the Porf-2 protein, preferably by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99%.

[0023] The molecule administered to the patient's neural tissue may be selected from, but is not limited to, a nucleic acid molecule, a carbohydrate, a lipid, a small molecule chemical drug, an antibody drug, a polypeptide, a protein, or an interfering virus.

[0024] The nucleic acid includes, but is not limited to, an antisense oligonucleotide, a double-stranded RNA (dsRNA), or a short hairpin RNA (shRNA).

[0025] The double-stranded RNA (dsRNA) or short hairpin RNA (shRNA) contains information about the promoter sequence or coding region sequence of the Porf-2 gene.

[0026] Preferably, the double-stranded RNA (dsRNA) is a small interfering RNA (siRNA). The small interfering RNA comprises a first strand and a second strand that are complementary to each other to form an RNA dimer. The sequence of the first strand is substantially identical to a 15 to 27 consecutive nucleotide sequence (target sequence) in the Porf-2 gene. The siRNA specifically binds to an mRNA fragment encoded by the target sequence and can specifically silence the expression of the Porf-2 gene.

[0027] The target sequence in the Porf-2 gene is a fragment in the Porf-2 gene corresponding to an mRNA fragment that complementarily binds with the siRNA when the siRNA specifically silences the expression of the Porf-2 gene.

[0028] Preferably, the Porf-2 gene is a human Porf-2 gene.

[0029] Preferably, the nerve damage disease is an optic nerve damage disease.

[0030] A third aspect of the present invention provides use of the isolated Porf-2 gene or Porf-2 protein in screening for therapeutic / ameliorating drugs for nerve damage diseases.

[0031] The "use of the isolated Porf-2 gene or Porf-2 protein in screening for therapeutic / ameliorating drugs for nerve damage diseases" includes applying the isolated Porf-2 gene or Porf-2 protein as a target to screening for therapeutic / ameliorating drugs for nerve damage diseases.

[0032] Specifically, drugs are screened using the isolated Porf-2 gene or Porf-2 protein as the target of action, and drugs that can inhibit Porf-2 gene expression are identified as candidate drugs for treating / ameliorating neurological disorders. The siRNA and shRNA of the Porf-2 gene described in this invention are both screened using the Porf-2 gene as the target and can be used as candidate drugs for treating / ameliorating neurological disorders. Furthermore, small molecule chemical drugs, antibody drugs, polypeptides, or proteins can also target the Porf-2 gene or its protein.

[0033] The therapeutic / ameliorating drug for nerve damage diseases is a molecule that can specifically inhibit the transcription or translation of the Porf-2 gene, or a molecule that can specifically inhibit the expression or activity of the Porf-2 protein, thereby reducing the expression level of the Porf-2 gene in nerve tissue and achieving the purpose of treating / ameliorating nerve damage diseases.

[0034] The dosage of the drug for treating / ameliorating a nerve injury disease is sufficient to reduce the transcription or translation of the Porf-2 gene or the expression or activity of the Porf-2 protein, preferably by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99%.

[0035] Therapeutic / ameliorating drugs for neurological damage diseases obtained by screening the isolated Porf-2 gene or Porf-2 protein may be selected from, but are not limited to, nucleic acid molecules, carbohydrates, lipids, small molecule chemical drugs, antibody drugs, polypeptides, proteins, or interfering viruses.

[0036] The nucleic acid includes, but is not limited to, an antisense oligonucleotide, a double-stranded RNA (dsRNA), or a short hairpin RNA (shRNA).

[0037] The double-stranded RNA (dsRNA) or short hairpin RNA (shRNA) contains information about the promoter sequence or coding region sequence of the Porf-2 gene.

[0038] Preferably, the double-stranded RNA (dsRNA) is a small interfering RNA (siRNA). The small interfering RNA comprises a first strand and a second strand that are complementary to each other to form an RNA dimer, and the sequence of the first strand is substantially identical to a 15-27 contiguous nucleotide sequence (target sequence) in the Porf-2 gene. The siRNA can specifically bind to an mRNA fragment encoded by the target sequence and specifically silence the expression of the Porf-2 gene.

[0039] The target sequence in the Porf-2 gene is a fragment in the Porf-2 gene corresponding to an mRNA fragment that complementarily binds with the siRNA when the siRNA specifically silences the expression of the Porf-2 gene.

[0040] Preferably, the Porf-2 gene is a human Porf-2 gene.

[0041] Preferably, the nerve damage disease is an optic nerve damage disease.

[0042] A fourth aspect of the present invention provides an isolated nucleic acid molecule for treating / ameliorating a nerve damage disease, the isolated nucleic acid molecule comprising double-stranded RNA and / or shRNA that targets the Porf-2 gene in neural tissue and knocks down the expression of the Porf-2 gene in the neural tissue.

[0043] Preferably, the double-stranded RNA comprises a nucleotide sequence capable of hybridizing to the Porf-2 gene under stringent conditions.

[0044] Preferably, the shRNA comprises a nucleotide sequence capable of hybridizing to the Porf-2 gene under stringent conditions.

[0045] Furthermore, the double-stranded RNA comprises a first strand and a second strand that are complementary to each other to form an RNA dimer. The sequence of the first strand is identical or substantially identical to the target sequence of the Porf-2 gene. More preferably, the double-stranded RNA is an siRNA (small interfering RNA). More preferably, the siRNA is obtained by designing an RNA interference sequence using the Porf-2 gene sequence as the target sequence.

[0046] Furthermore, the shRNA comprises a sense strand fragment, an antisense strand fragment, and a stem-loop fragment connecting the sense strand fragment and the antisense strand fragment, wherein the sequences of the sense strand fragment and the antisense strand fragment are complementary, and the sequence of the sense strand fragment is identical or substantially identical to the target sequence of the Porf-2 gene. More preferably, the sense strand fragment and the antisense strand fragment of the shRNA are obtained by designing an RNA interference sequence using the Porf-2 gene sequence as the target sequence. The shRNA is enzymatically cleaved in cells to become siRNA, which further plays a role in specifically knocking down the expression of the Porf-2 gene.

[0047] The target sequence in the Porf-2 gene is a fragment in the Porf-2 gene corresponding to an mRNA fragment that complementarily binds with the siRNA when the siRNA specifically silences the expression of the Porf-2 gene.

[0048] Preferably, the target sequence is a sequence of 15 to 27 consecutive nucleotides in the Porf-2 gene, more preferably a sequence of 19 to 23 consecutive nucleotides in the Porf-2 gene, and more preferably a sequence of 19, 20, or 21 consecutive nucleotides in the Porf-2 gene.

[0049] Preferably, the Porf-2 gene is a human-derived Porf-2 gene. More preferably, the target sequence of the Porf-2 gene is one represented by any of SEQ ID NOs: 1 to 6.

[0050] To obtain double-stranded RNA or shRNA targeting the human Porf-2 gene, the mRNA sequence of the human Porf-2 gene coding region (CDS region) was searched and obtained from NCBI, and siRNA interference sequences that specifically knock down the human Porf-2 gene were designed using software and screened by score. Through our screening, we selected target sequences of the human Porf-2 gene represented by any of SEQ ID NOs: 1 to 6.

[0051] Specifically, the sequence of SEQ ID NO:1 is gagaaggactatgagatttac, The sequence of SEQ ID NO:2 is gcctccaagcacttcaacaag, The sequence of SEQ ID NO:3 is gctgatccagatgtacatggg, The sequence of SEQ ID NO:4 is gcgataagcacgtatgccaag, The sequence of SEQ ID NO:5 is gccaagtactgttaccacaag, The sequence of SEQ ID NO:6 is gggacattgacgaggtgaatg.

[0052] A fifth aspect of the present invention provides an expression vector for an interfering nucleic acid of the Porf-2 gene, which comprises a gene fragment encoding the above-mentioned shRNA and is capable of expressing the shRNA.

[0053] The expression vector for the Porf-2 gene interfering nucleic acid is obtained by cloning the gene fragment encoding the shRNA into a known vector, preferably a slow virus vector, an adeno-associated virus vector, or a retrovirus vector.

[0054] Preferably, the expression vector for the interfering nucleic acid of the Porf-2 gene is a recombinant viral vector obtained by cloning a gene fragment encoding the shRNA into the coding region of a viral vector, and the viral vector is either a lentiviral vector, an adeno-associated viral vector, or a retroviral vector.

[0055] The expression vector of the Porf-2 gene interference nucleic acid becomes an infectious virus particle through viral packaging, infects neural tissue, and then transcribes the above-mentioned shRNA, which then undergoes steps such as enzymatic cleavage within the cell to become siRNA, ultimately achieving specific knockdown of the Porf-2 gene expression.

[0056] More preferably, the expression vector of the Porf-2 gene interfering nucleic acid further comprises a promoter sequence and / or a nucleotide sequence encoding a marker that can be detected in neural tissue, the marker being, for example, green fluorescent protein (GFP).

[0057] More preferably, the expression vector for the interfering nucleic acid of the Porf-2 gene is a recombinant adeno-associated virus vector obtained by inserting a gene fragment encoding the above-mentioned shRNA into the coding region between the ITR sequences at both ends of the adeno-associated virus vector.

[0058] The adeno-associated viral vector may be of serotype AAV1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, or may be a chimeric AAV derived from these serotypes, such as AAV2-AAV3, AAVrh.10, AAVhu.14, AAV3a / 3b, AAVrh32.33, AAVHSC15, AAV-HSC17, AAVhu.37, or AAVrh.8.

[0059] Upon transfection, AAV induces only a slight immune response in the host. In a preferred embodiment of the present invention, the adeno-associated viral vector is an AAV2 or AAV5 serotype vector. More preferably, the adeno-associated viral vector is an AAV2 serotype vector.

[0060] A sixth aspect of the present invention provides a virus obtained by transfecting a eukaryotic cell with a viral packaging system, wherein the viral packaging system comprises the recombinant adeno-associated viral vector described above.

[0061] In one specific embodiment of the present invention, the viral packaging system is an adeno-associated virus packaging system comprising the above-mentioned recombinant adeno-associated virus vector containing a Porf-2 gene interference nucleic acid, an adeno-associated virus packaging plasmid, and an adeno-associated virus helper plasmid.

[0062] In one preferred embodiment of the present invention, the viral packaging system employs a three-plasmid adeno-associated viral packaging system comprising the packaging plasmid pAAV-RC (containing the AAV2 coat protein gene), the helper plasmid pHelper (containing a gene that can assist AAV replication), and the recombinant adeno-associated viral vector containing the Porf-2 gene interfering nucleic acid.

[0063] The adeno-associated virus packaging system transfects eukaryotic cells and generates adeno-associated viruses (AAVs) that infect neural tissues, transcribe the shRNAs, and enzymatically process them into siRNAs, ultimately knocking down the Porf-2 gene.

[0064] A seventh aspect of the present invention provides a pharmaceutical composition comprising the virus described above and a pharmaceutically acceptable carrier or excipient.

[0065] Furthermore, the pharmaceutical composition contains 1 to 99% wt of the virus and a pharmaceutically acceptable carrier or excipient.

[0066] When preparing / formulating a pharmaceutical composition, the active ingredient is generally mixed with an excipient, diluted with an excipient, or enclosed in a pharmaceutical carrier. The pharmaceutical composition may be in the form of a tablet, pill, powder, solution, syrup, sterile injection, etc. Preferably, an injection form is used. More preferably, a form suitable for subretinal injection or intravitreal injection is used.

[0067] An eighth aspect of the present invention provides use of the above-mentioned expression vector for an interfering nucleic acid of the Porf-2 gene, the above-mentioned virus, or the above-mentioned pharmaceutical composition in the preparation of a drug for treating / ameliorating a nerve damage disease.

[0068] The virus or pharmaceutical composition described above can be used to treat / ameliorate nerve injury diseases. This method for treating / ameliorating nerve injury diseases comprises administering an effective amount of the virus or pharmaceutical composition to the nerve tissue of a subject. According to this method for treating / ameliorating nerve injury diseases, Porf-2 gene expression in the nerve tissue of the subject is knocked down. Furthermore, the expression of the Porf-2 gene is knocked down by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99%.

[0069] The subject may be a human.

[0070] Preferably, the nerve damage disease is an optic nerve damage disease.

[0071] Preferably, the expression vector of the interfering nucleic acid of the Porf-2 gene, the virus, or the pharmaceutical composition as described above is used to promote optic nerve axon regeneration after optic nerve injury.

[0072] Preferably, the expression vector of the interfering nucleic acid of the Porf-2 gene, the virus, or the pharmaceutical composition as described above is used to improve the survival rate of RGC cells after optic nerve injury.

[0073] Preferably, the expression vector of the interfering nucleic acid of the Porf-2 gene, the virus, or the pharmaceutical composition as described above is used to prevent thinning of the ganglion cell complex layer after optic nerve injury.

[0074] Preferably, the expression vector of the interfering nucleic acid of the Porf-2 gene, the virus, or the pharmaceutical composition as described above is used to promote the recovery of visual function after optic nerve damage.

[0075] It should be understood that within the scope of protection of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described in the following examples can be combined with each other to form new or preferred technical solutions, which will not be described one by one here due to space limitations. [Brief explanation of the drawings]

[0076] [Figure 1] 1 is a map of the first empty plasmid described in Example 1 of the present invention. [Figure 2] FIG. 1 shows the results of analyzing Porf-2 expression levels at different time points (after injury) obtained by immunofluorescence detection. [Figure 3] FIG. 11 shows the results of analyzing Porf-2 expression levels at different time points (after injury) obtained by qPCR detection. [Figure 4] This is a graph showing the results of analyzing Porf-2 expression levels in the qPCR detection experiment group and the control group two weeks after viral expression. [Figure 5] Statistical results of regenerated axons at different distances from the injury site in the experimental and control groups. [Figure 6] This is a graph showing the results of retinal cell survival statistically obtained after immunofluorescence staining of whole-mount retinas. DETAILED DESCRIPTION OF THE INVENTION

[0077] The inventors of this application published the following two papers in 2016 and 2017: Huang GH, Yang XT, Chen K, Xing J, Guo L, Zhu L, Li HJ, Li XC, Zhang SY, Feng DF, Porf-2 Inhibits Neural Stem Cell Proliferation Through Wnt / beta-Catenin Pathway by Its GAP Domain, Frontiers in Cellular Neuroscience,2016,10: 85.; Yang XT, Huang GH, Li HJ, Sun ZL, Xu NJ, Feng DF. Rac1 Guides Porf-2 to Wnt Pathway to Mediate Neural Stem Cell Proliferation. Frontiers in Molecular Neuroscience, 2017, 10:172.

[0078] These findings reveal the molecular mechanism by which Porf-2 protein inhibits neural stem cell proliferation. Specifically, Porf2 protein inactivates Rac1 through its GAP domain, which in turn activates the Wnt / β-Catenin pathway, thereby inhibiting neural stem cell division.

[0079] In their research on the Porf-2 gene, the inventors of the present application discovered that Porf-2 gene expression in RGC cells increases after a certain period of time following optic nerve injury. They further used RNAi to knock down Porf-2 gene expression in mouse optic nerve tissue and unexpectedly found that knockdown of Porf-2 gene in mouse optic nerve tissue promotes optic nerve axon regeneration after optic nerve injury, particularly increasing the survival rate of RGC cells after optic nerve injury, preventing thinning of the ganglion cell complex layer after optic nerve injury, and promoting the recovery of visual function. This research finding demonstrates that the Porf-2 gene can be used as a therapeutic target after optic nerve injury. Knocking down Porf-2 gene expression using RNAi, especially in combination with adeno-associated virus gene therapy technology for direct intraocular administration, may provide an effective means for the future treatment and amelioration of optic nerve injury diseases, with promising clinical applications.

[0080] The present invention will be further described below by way of examples. These examples are only used to illustrate the present invention, but are not used to limit the scope of protection of the present invention, and it should be understood that the present invention is not limited to these specific embodiments.

[0081] Materials and reagents used in the following examples are commercially available unless otherwise specified. Experimental methods for which specific conditions are not specified in the following examples generally follow standard conditions, such as those described in the Molecular Cloning Laboratory Manual by Sambrook et al., or the conditions suggested by the manufacturer. Unless otherwise specified, percentages and parts are all calculated by weight. Example 1

[0082] 1. Design and screening of interference sequences targeting the Porf-2 gene in neural tissues The mRNA sequence of the mouse Porf-2 gene coding region (CDS region) was searched and obtained from NCBI (see https: / / www.ncbi.nlm.nih.gov / gene / 223666). The software was used to design siRNA interference sequences that specifically knock down the mouse Porf-2 gene. The following six siRNA (siRNA-1 to 6) sequences were screened by score, as shown in Table 1 below.

[0083] Table 1 JPEG0007804763000001.jpg129170

[0084] For the above six siRNAs (siRNA-1 to 6), appropriate stem-loop fragment sequences (in this example, the DNA sequence corresponding to the stem-loop fragment: TTCAAGAGA) are designed to obtain six corresponding shRNAs (shRNA1 to 6).

[0085] The sense strands of shRNA1 to 6 are the sense strands of the corresponding siRNA-1 to 6, and the antisense strands of shRNA1 to 6 are the antisense strands of the corresponding siRNA-1 to 6, but these will not be described in detail.

[0086] Furthermore, the present inventors designed primer sequences (introducing a SmaI enzyme cleavage site) for amplifying DNA fragments corresponding to shRNA1 to 6, and the primer sequences are as shown in Table 2 below.

[0087] Table 2 JPEG0007804763000002.jpg226170

[0088] The primer sequences of the DNA fragments corresponding to shRNAs 1 to 6 in Table 1 above were sent to Shanghai Biotechnology Co., Ltd. for artificial synthesis. The synthesized single-stranded primers were then annealed and subjected to a sticky treatment to obtain double-stranded oligo sequences with sticky ends.

[0089] 2. Construction of recombinant plasmid for knockdown of Porf-2 gene

[0090] The steps in the build process are as follows:

[0091] 1) Obtaining the interfering fragment into which the clone should be inserted: The double-stranded oligo sequences corresponding to shRNA1 to 6 were enzymatically cleaved using SmaI endonuclease (enzyme cleavage system purchased from NEB) to obtain the interfering fragment (DNA fragment) into which the clone should be inserted.

[0092] 2) The first empty plasmid, pAAV-H1-MCS-gRNA-CAG-EGFP-WPRE-SV40pA (an AAV2 serotype adeno-associated virus vector, purchased from Shanghai Taiertu Biotechnology Co., Ltd.), was digested with SmaI endonuclease (an enzyme digestion system purchased from NEB).

[0093] The map information of the first empty plasmid is shown in FIG.

[0094] The enzymatic cleavage system and its specific operation in steps 1) and 2) above are described in the instruction manual and will not be further described.

[0095] The interfering fragment into which the clone in step 1) is to be inserted and the first empty plasmid enzymatically digested in step 2) are both recovered using the AxyPrep PCR Cleanup Kit. For specific procedures, please refer to the instruction manual and no further mention will be made.

[0096] 3) Plasmid ligation: The interference fragment recovered from the above washing and the first empty plasmid were ligated with T4 ligase (20 μl system).

[0097] 4) Transformation, identification, and amplification of recombinant plasmid: The ligation product from step 3) was transformed into competent Top10 cells and plated on an Amp-resistant plate. Monoclonal colonies were selected and subjected to small-scale shaking and small-scale extraction (using an Axygen small-scale extraction kit). The plasmids obtained through small-scale extraction were identified by enzymatic digestion. Plasmids with sizes matching those of the target fragments were selected after enzymatic digestion and sent to Shanghai Biotechnology Co., Ltd. for sequencing and nucleic acid sequence alignment. Small-scale shaken bacterial suspensions containing recombinant plasmids with correct sequencing and alignment were selected and subjected to large-scale shaking. Extraction and purification were performed using an Axygen large-scale extraction kit to obtain recombinant plasmids with Porf-2 gene knockdown.

[0098] Specifically, the recombinant plasmids obtained above that knock down the Porf-2 gene are recombinant adeno-associated virus vectors that express shRNA1 to 6 (named RNAi-1, RNAi-2, ... RNAi-6, in that order).

[0099] In the recombinant plasmid obtained above in which the Porf-2 gene has been knocked down, shRNA1 to 6 sequences that interfere with the expression of the Porf-2 gene have been inserted into the coding region between the ITR sequences at both ends of the adeno-associated virus vector (the first empty plasmid described above), specifically, between the two Esp3I enzyme cleavage sites in Figure 1.

[0100] 3. Preliminary verification of the knockdown effect of recombinant adeno-associated virus vectors of the above shRNAs 1 to 6 at the cellular level

[0101] To preliminarily verify the knockdown effect at the cellular level, we constructed an overexpression plasmid of the Porf-2 gene and an interfered control plasmid.

[0102] The overexpression construct (OV) was constructed by inserting the Porf-2 cDNA sequence into a second empty plasmid (pAAV-CMV bGlobin-Arhgap39-mCherry-3xFlag-WPRE-hGHpA). This overexpression construct expresses the Porf-2 protein fused with red fluorescent protein (mCherry). The overexpression control plasmid (hereinafter also referred to as OC, i.e., overexpression empty control) refers to the second empty plasmid mentioned above. The interference control plasmid (hereafter also referred to as RNAi-NC) was obtained by inserting an shRNA without interference activity (without a corresponding target) into the first empty plasmid pAAV-H1-MCS-gRNA-CAG-EGFP-WPRE-SV40pA.

[0103] The recombinant adeno-associated virus vectors (RNAi-1–6) expressing the above shRNAs 1–6 were mixed with overexpression plasmids (OV), respectively, and co-transfected into 293T cells. Fluorescence expression was observed 24 hours later to determine the knockdown effect of RNAi-1–6.

[0104] Knockdown groups 1 to 6 are designated as OV+RNAi-1, OV+RNAi-2, OV+RNAi-6, respectively.

[0105] Furthermore, control groups 1 to 6 corresponding to the knockdown groups are also provided.

[0106] Control groups 1 to 6 are designated as OC+RNAi-1, OC+RNAi-2, OC+RNAi-6, respectively.

[0107] In addition, a control group (OV+RNAi-NC) and a control group (OV only) are also provided.

[0108] Green fluorescence was detected in all knockdown groups 1-6, control groups 1-6, and control group OV+RNAi-NC, indicating that they were all transfected with the corresponding interference plasmids. Note: No green fluorescence was observed in control group OV alone.

[0109] The red fluorescence detection results showed that the red fluorescence effects of knockdown groups 1-6 were significantly weaker than those of the control group OV. However, 1) when comparing the control group OV + RNAi-NC with the control group OV, there was no significant difference in the red fluorescence expression levels between the two, indicating that the interference control plasmid (RNAi-NC) had no knockdown ability. 2) Normal red fluorescence expression was observed in all control groups 1-6, and the expression levels were not significantly different from those of the control group OV, indicating that the knockdown plasmids RNAi-1-6 specifically knocked down only the Porf-2 gene. 3) Of the six knockdown groups, knockdown groups 4, 6, 2, and 3 showed good effects. Among them, knockdown group 4 had the weakest red fluorescence effect, followed by knockdown group 6.

[0110] Based on the above-mentioned verification results at the cellular level, the present inventors selected the knockdown plasmid RNAi-4 (ie, a recombinant adeno-associated virus vector expressing shRNA4) and produced an adeno-associated virus.

[0111] 4. Adeno-associated Virus Packaging

[0112] The adeno-associated virus packaging system of this example employs a three-plasmid system containing the packaging plasmid pAAV-RC (containing the AAV2 coat protein gene), the helper plasmid pHelper (containing a gene that can assist AAV replication), and the above-mentioned knockdown plasmid RNAi-4 (a recombinant adeno-associated virus vector that expresses shRNA4).

[0113] This part of the work was outsourced to Shanghai Taiertu Biotechnology Co., Ltd., and is briefly described below.

[0114] Step 1) Culture: On day 1, 293T cells with a confluence of over 90% were passaged at a ratio of 1:3 and cultured in high-glucose DMEM containing 10% FBS. The culture medium was replaced with serum-free medium approximately 1-2 h before transfection the following day.

[0115] Step 2) Transfection: 293T cells were co-transfected with Lipofectamine 2000, the knockdown plasmid RNAi-4, the packaging plasmid pAAV-RC, and the helper plasmid pHelper. Approximately 24 h after transfection, the solution was replaced. Approximately 72 h after transfection, the virus in the culture supernatant was precipitated using PEG 8000. After overnight precipitation, the virus was collected.

[0116] Step 3) Purification and concentration: The virus mixture collected in step 2) was purified by iodixanol density gradient centrifugation and then concentrated using an ultrafiltration tube to obtain the adeno-associated virus solution of this example, i.e., an adeno-associated virus solution expressing shRNA4.

[0117] Identification of the resulting virus

[0118] 1) Confirmation of virus purity: A small amount of the adeno-associated virus solution obtained above was taken, and protease K was added. The virus capsid was destroyed by incubating at 37°C for 30 minutes. The virus was then run on a PAGE gel and compared with a standard virus coat protein. This confirmed that the adeno-associated virus coat protein of this example was correct.

[0119] 2) Virus titer measurement: A small amount of the adeno-associated virus solution obtained above was taken, and protease K was added. The solution was incubated at 37°C for 30 minutes to disrupt the viral capsid. The enzyme was then inactivated by heating at 95°C for 5 minutes, and the mixture was centrifuged at 12,000 rpm for 2 minutes. The supernatant was then collected and diluted to different concentrations. qPCR amplification was performed. The calculated virus titer was approximately 1.82E+13, which met the requirements for viral product.

[0120] 3) Identification of viral integrity: The AAV2 vector (first empty vector pAAV-H1-MCS-gRNA-CAG-EGFP-WPRE-SV40pA) contains several characteristic sequences, such as the promoter CAG and the marker gene EGFP. Therefore, primers for different characteristic sequences were added to the supernatant collected in the identification step 2) above and subjected to qPCR detection. The results showed that the signal levels of the amplification products of the promoter CAG and marker gene EGFP of the adeno-associated virus produced in this example were very close to those of the standard sample (first empty vector). This indicates that the knockdown plasmid RNAi-4 (i.e., the recombinant adeno-associated virus vector expressing shRNA4) contained in the adeno-associated virus obtained in this example was correct and that no recombination had occurred between the knockdown plasmid RNAi-4 and the adeno-associated virus genome.

[0121] 5. Construction of the Mouse Optic Nerve Clamp Injury Model

[0122] The construction procedure is as follows:

[0123] 1) Five-week-old male C57BL / 6 mice were selected and anesthetized with 1% pentobarbital sodium injection (10 μl / g) by intraperitoneal injection. After anesthesia, oxybucaine hydrochloride, a corneal surface anesthetic, was instilled into the left eyeball and the mouse was placed under a dissecting microscope. An object of appropriate size was placed under the mouse's head to ensure that the mouse's head was horizontal.

[0124] 2) The lateral canthus was chosen as the surgical route. First, the conjunctiva was lifted with fine forceps, and the eyeball was pulled outward. Then, a small incision was made in the lateral canthus conjunctiva with Venus scissors, and the retrobulbar tissue was bluntly separated downward and backward to expose the optic nerve. The operation must be performed gently and carefully to avoid damaging the retrobulbar artery.

[0125] 3) Carefully peel off the optic nerve sheath membrane and hold the optic nerve 1 mm retrobulbar with Dumont #5 self-closing forceps for 5 seconds. Avoid damaging the intrathecal blood vessels to avoid affecting the blood supply and return to the fundus. In the control group, the optic nerve was exposed but not clamped.

[0126] 4) The wound was disinfected, and erythromycin ointment was applied to the edge of the incision. The blood supply to the fundus was observed, and mice showing pale retinal arteries or lens damage were excluded from the group and replaced with new mice.

[0127] 6. Detection of Porf-2 gene expression in normal and injured mouse retina

[0128] Five-week-old C57BL / 6 male mice were randomly divided into a control group (normal) and a 7-day injury group, which was prepared according to the content of Part 5 above and obtained by sacrificing the mice on day 7 after modeling.

[0129] Retinal tissue from the control and each injury group (uninjured side) was collected, frozen, and then immunofluorescent double staining for Porf-2 and TUJ1 proteins (using antibodies against Porf-2 and TUJ1) was performed using immunofluorescence histochemistry. Finally, Porf-2 expression in the retina was confirmed by imaging with a laser confocal fluorescence microscope and quantitative fluorescence analysis. Figure 2 shows the results of immunofluorescent analysis of Porf-2 expression at different time points (after injury).

[0130] Retinal tissue from the normal control group and each injury group (uninjured side) was collected, total RNA was extracted, and Porf-2 expression in the retina was detected using reverse transcription PCR (RT-PCR) and qPCR. Figure 3 shows the analysis results of Porf-2 expression levels at different time points (after injury) obtained by qPCR.

[0131] Comparing the results of Figures 2 and 3, the Porf-2 expression obtained by immunofluorescence detection and qPCR detection showed similar trends, and in both cases, it was revealed that the expression level of the Porf-2 gene increased 7 days after injury.

[0132] 7. Efficacy Data - Verification of the Effect of Injecting the Adeno-Associated Virus of this Example into the Vitreous Cavity of a Mouse Model

[0133] In summary, the adeno-associated virus of this example (i.e., the adeno-associated virus obtained in Part 4 above, i.e., the adeno-associated virus containing a recombinant adeno-associated virus vector expressing shRNA4) was injected into the vitreous cavity of a mouse model to interfere with the expression of the Porf-2 gene in RGC cells. Based on this, a mouse optic nerve injury model was constructed to simulate axonal injury. After two weeks, CTB-555 was injected into the vitreous cavity to track axonal regeneration. At the same time, TUJ1 immunofluorescence staining was performed to observe the survival and visual recovery of RGCs. The specific experimental procedure is as follows:

[0134] 7-1. Intravitreal injection of adeno-associated virus 1) Three-week-old male C57BL / 6 mice were taken and anesthetized with 1% pentobarbital sodium injection (10 μl / g) by intraperitoneal injection. After anesthesia, a compound tropicamide eye drop was instilled into the left eyeball to dilate the pupil. 2) Insert the needle of a microsyringe at a 45° angle approximately 1 mm from the corneoscleral edge, taking care not to damage the lens or retina, and withdraw 2 μl of vitreous humor before removing the syringe. This will be useful for the subsequent injection into the vitreous cavity and will prevent an increase in intraocular pressure due to the injection. 3) Using the microsyringe, the needle was reinserted through the original opening, and 2 μl of the prepared virus solution (adeno-associated virus solution in this example) was slowly injected into the vitreous cavity of the experimental mice. After the injection, the needle was withdrawn after 5 minutes to allow the virus to fully penetrate the vitreous cavity, thereby preventing backflow. For the control group of mice, an interference control virus, i.e., an adeno-associated virus obtained by the virus packaging method described in Part 4 above, was injected into the vitreous cavity against the interference control plasmid (RNAi-NC) constructed in Part 3 above. 4) After surgery, tobramycin-dexamethasone ointment was applied to prevent infection, and the mice were transferred to an incubator. After waking from anesthesia, they were returned to their cages. Mice were carefully observed after surgery, and any mice showing cloudy lenses, massive bleeding in the vitreous cavity, or extensive retinal detachment were excluded.

[0135] 7.2 Detection of adeno-associated virus infection efficacy by immunofluorescence staining of retinal sections / whole mounts Two weeks after viral expression, retinal section immunofluorescence staining and whole-mount retinal immunofluorescence staining were performed, respectively.

[0136] The procedure for immunofluorescent staining of retinal sections was as follows. 1) After anesthesia, the experimental mice were perfused using pre-chilled PBS, flushing the systemic blood vessels from the left ventricle. Wait 3-5 min until all blood has been flushed out, then perfuse for 5-10 min using pre-chilled 4% PFA (1x PBS). 2) The eyeball and optic nerve were gently separated and removed using microscissors and microtweezers, and the surrounding soft tissue was carefully removed. A small hole was then drilled in the center of the cornea using a needle. The trimmed tissue was fixed in 4% PFA at 4°C for 2 hours. It was then rinsed twice with PBS. The tissue was then placed in a 30% sucrose solution and dehydrated in a refrigerator at 4°C for 48 hours. 3) The remaining water on the tissue was carefully removed by suction using filter paper, and the cornea and lens were removed, leaving only the eyecup. The eyecup was thoroughly immersed and embedded in OCT, and frozen sections were prepared in a refrigerator at -80°C. 4) A freezing slicer was used with the body and freezing head both set to -20°C. 30 minutes before use, the tissue was transferred from a -80°C refrigerator to the slicer and thawed. Both the retina and optic nerve were sliced ​​vertically, with the retina sliced ​​at 20 μm per layer and the optic nerve sliced ​​at 14 μm per layer. The slices were attached to anti-detachment glass slides and stored at -20°C until use. 5) Retinal frozen sections were selected, baked in an oven at 37°C for 20 minutes, and washed three times with 1x PBS to remove residual OCT. 6) An appropriate amount of blocking solution was added to the sections, and they were blocked at room temperature for 2 hours. The blocking solution was then removed by aspiration. Primary antibodies (Porf-2 1:100, TUJ1 1:300) were added and incubated overnight at 4°C. 7) The next day, the sections were removed from the 4°C refrigerator and allowed to restorable at room temperature for 30 minutes. The primary antibody was removed by aspiration, and the sections were washed three times with 1x PBST for 10 minutes each. 8) The corresponding fluorescent secondary antibody and DAPI (secondary antibody 1:500, DAPI 1:1000) were added and incubated at room temperature for 2 hours in the dark. Then, the sections were washed three times with 1x PBST for 10 minutes each. 9) The PBST remaining on the slide glass was removed by suction, and after drying it slightly, an appropriate amount of a fluorescence quencher was added dropwise to block it. 10) Observation was performed using a laser confocal fluorescence microscope and photographs were taken.

[0137] The procedure for whole-mount retinal immunofluorescence staining was as follows. 1) After anesthesia, the experimental mice were perfused using pre-chilled PBS, flushing the systemic blood vessels from the left ventricle. After waiting 3-5 min until all blood had been flushed out, pre-chilled 4% PFA (1x PBS) was used instead and perfused for 5-10 min. 2) The eyeball and optic nerve were gently separated and removed using microscissors and microtweezers, and the surrounding soft tissue was carefully removed. A small hole was then drilled in the center of the cornea using a needle. The trimmed tissue was fixed in 4% PFA at 4°C for 2 hours. It was then rinsed twice with PBS. The tissue was then placed in a 30% sucrose solution and dehydrated in a refrigerator at 4°C for 48 hours. 3) After dehydration, the tissue was removed and the intact retina was carefully dissected and isolated in PBS. The procedure must be carried out gently and carefully to avoid damaging the retina. After isolating the retina, it was washed three times for 10 minutes each in 1x PBS. 4) The retina was placed in a 24-well plate containing blocking solution and blocked for 2 hours at room temperature. After blocking, the blocking solution was removed by aspiration, and primary antibody (TUJ1 1:300) was added and incubated at 4°C for 48 hours. 5) After 2 days, the whole-mount retinas were removed from the 4°C refrigerator and allowed to recover at room temperature for 30 minutes. The primary antibody was then removed by aspiration. The retinas were then washed three times with 1x PBST for 10 minutes each. 6) The corresponding fluorescent secondary antibody and DAPI (secondary antibody 1:500, DAPI 1:1000) were added and incubated at room temperature for 2 hours in the dark. Then, the sections were washed three times with 1x PBST for 10 minutes each. 7) With the GCL layer facing up, the retina was carefully cut into petal shapes using scissors along the four directions: temporal, nasal, dorsal, and ventral, and then placed flat on a glass slide. 8) The PBST remaining on the slide and whole-mount retina was removed by suction, and after slight drying, an appropriate amount of a fluorescence quencher was added dropwise to block the retina. 9) Observation was performed using a laser confocal fluorescence microscope and photographs were taken.

[0138] Immunofluorescence detection of retinal sections showed that large areas of the vitreous cavity of both experimental and control mice were effectively infected. Immunofluorescence detection of whole-mount retina showed that optic ganglion cells were effectively infected with the virus and highly expressed eGFP, indicating that AAV2 viruses (including the adeno-associated virus obtained in Part 4 above and the interference control virus) can effectively infect RGC cells.

[0139] 7-3. qPCR detection of Porf-2 knockout efficiency in retinal tissue using the adeno-associated virus of this example Two weeks after viral expression, retinal tissues from each group were collected for qPCR detection to verify whether Porf-2 gene expression was effectively knocked down in the retinal tissues of the experimental mice. The qPCR procedure was the same as that in Part 6 above. Referring to Figure 4, two weeks after viral expression, the Porf-2 expression levels in the experimental and control groups were analyzed by qPCR. As can be seen from Figure 4, at the mRNA level, the expression level of the Porf-2 gene in the experimental group was significantly reduced by about 50% compared to the control group. This indicates that the expression level of the Porf-2 gene in the retinal tissue of the experimental mice administered with the adeno-associated virus of this example (including the recombinant adeno-associated virus vector expressing shRNA4) was significantly reduced, verifying that the adeno-associated virus obtained in this example can effectively knock down the Porf-2 gene in retinal cells.

[0140] 7-4. Detection of the effect of Porf-2 gene knockdown on optic nerve axon regeneration after optic nerve injury by tracing regenerating axons Two weeks after the virus expression, the experimental and control mice were subjected to optic nerve clamp injury according to the method in Part 5 above (establishment of mouse optic nerve clamp injury model). Two weeks after optic nerve injury, regenerated axons were traced. Before the procedure, the neural tracer was prepared by dissolving CTB-555 powder in pre-chilled PBS to a final concentration of 2 μg / μl and storing it in a refrigerator at -20°C. Care was taken to avoid light and repeated freezing and thawing during use and storage. Step 1): Two weeks after the optic nerve injury, the mouse was again anesthetized with 1% pentobarbital sodium injection (10 μl / g) via intraperitoneal injection. After the mouse was anesthetized, a compound tropicamide eye drop was instilled into the left eye to dilate the pupil. Step 2): Insert the needle of the microsyringe at a 45° angle approximately 1 mm from the corneoscleral edge, taking care not to damage the lens or retina, and withdraw 1.5 μl of vitreous humor before removing the syringe. This will aid in the subsequent injection into the vitreous cavity and prevent an increase in intraocular pressure due to the injection. Step 3): Using the microsyringe, the needle was reinserted through the original needle port and 1.5 μl of the prepared CTB-555 solution was slowly injected into the vitreous cavity of the mouse. After the injection, the needle was removed after 5 minutes to allow the reagent to fully penetrate the vitreous cavity, thereby preventing backflow. Tobramycin-dexamethasone ointment was applied postoperatively to prevent infection, and the mouse was placed in an incubator to recover from anesthesia before being returned to its cage. Careful postoperative observation was performed, and any mice exhibiting lens opacity, massive vitreous cavity bleeding, or extensive retinal detachment were excluded. Step 4): After 3 days, when the tracer had been sufficiently tracked, the mice were killed by anesthesia and the materials were collected. Step 5): The number of axons was counted at positions 0.1, 0.2, 0.5, 1.0, and 1.5 mm away from the injury site. Axons on the CTB mark after the injury site were considered regenerated axons. Regenerated axons at different positions from the injury point were counted, and the average number was calculated for the same number of sections in each optic nerve layer. Referring to FIG. 5, the results of counting axonal regeneration at different distances from the injury site in the experimental and control groups are shown. As can be seen from Figure 5, the number of regenerated axons in the experimental group was significantly higher than that in the control group at different distances. Axon regeneration could be extended up to 1.5 mm. The results in Figure 5 demonstrate that knockdown of the Porf-2 gene in retinal tissue using the adeno-associated virus (AAV) of this example (containing a recombinant AAV vector expressing shRNA4) can promote the regeneration of optic nerve axons after injury.

[0141] 7-5. Detection of the effect of Porf-2 gene knockdown on RGC cell survival after optic nerve injury Two weeks after viral expression, optic nerve clamp injury was performed on the experimental and control mice according to the method in Part 5 above (establishment of mouse optic nerve clamp injury model). Two weeks after optic nerve injury, whole-mount retinal immunofluorescence staining (see Section 7.2 above) was performed to label surviving RGC cells using TUJ1 fluorescent staining. One field was randomly selected within each quadrant of the whole-mount retina, and the number of TUJ1-stained RGCs was counted using Image J software to verify the effect of Porf-2 gene knockdown on the survival of RGC cells after injury. Referring to FIG. 6, the survival results of RGC cells are shown, which were analyzed after immunofluorescence staining of whole-mount retinas. As can be seen from Figure 6, the survival rate of RGCs in the control group was approximately 20%, while the survival rate in the experimental group was approximately 40%, which was significantly higher than that of the control group (P<0.01). This indicates that knockdown of the Porf-2 gene in retinal tissue using the adeno-associated virus (AAV) of this example (containing a recombinant AAV vector expressing shRNA4) can improve the survival rate of RGC cells after optic nerve injury.

[0142] 7-6. Effect of Porf-2 gene knockdown on visual function recovery after optic nerve injury Virus was injected into the vitreous cavity according to Section 7.1 above. Two weeks after viral expression, experimental and control mice underwent optic nerve clamp injury according to Section 5 above (construction of the mouse optic nerve clamp injury model). The mice were then subjected to OCT detection and pupillary light reflex detection to observe changes in their visual function.

[0143] A.OCT detection method is as follows: 1) Spectral-domain optical coherence tomography (SD-OCT, Micron IV; Phoenix Research Laboratories, Pleasanton, CA, USA) was performed before optic nerve injury and 7, 14, 21, and 28 days after injury, respectively. "Before optic nerve injury" refers to mice injected with adeno-associated virus (AAV) as described in Section 7-1 above, 2 weeks after viral expression. "7, 14, 21, and 28 days after injury" refers to mice injected with AAV as described in Section 7-1 above, 2 weeks after viral expression, and then optic nerve clamp injury as described in Section 5 above, 7, 14, 21, and 28 days after injury, respectively. 2) Mice were anesthetized by intraperitoneal injection of pentobarbital sodium (100 mg / kg), and their pupils were dilated with 0.5% tropicamide and 0.5% phenylephrine hydrochloride eye drops. 3) During imaging, the cornea was kept moist with 2.5% hydroxypropamide eye drops. 4) Radial volume scans (centered on the optic disc, 1.2 mm diameter) were performed, with each volume consisting of 100 b-scans and 1000 a-scans. 5) Images were analyzed using InSight software, version 1.1.5207 (Phoenix Research Laboratories). 6) Four images (scans 1, 26, 51, and 76 at 0°, 45°, 90°, and 135° in the mouse face image) were used to measure retinal thickness. 7) For each selected image, vertical calipers were placed on either side of the optic nerve head, 500 μm from the center of the optic nerve head. 8) Measure the thickness of the ganglion cell complex layer (GCC) with a caliper. The ganglion cell complex layer (GCC) is composed of three layers: the nerve fiber layer (NFL), the ganglion cell layer (GCL), and the inner plexiform layer (IPL), the innermost layer of the retina. 9) The GCC thickness of each retina was calculated as the average of a total of eight measurements.

[0144] B. The method for detecting the pupillary light reflex is as follows: 1) This dynamic pupil diameter measurement and analysis device was provided by the research group of Academician Yang Xiong of the Fudan University School of Medicine. This device allows digital photography and automatic analysis of changes in pupil diameter while the mice are awake. 2) Four weeks after nerve injury, the experimental and control mice underwent a pupillary light reflex test to analyze changes in the mice's pupils. 3) Before detection, the mouse was dark-adapted for 24 hours. During detection, the mouse's head was fixed and the position between the camera and the pupil was adjusted so that the pupil was in the center of the screen, and clear and stable pupil images were obtained. 4) 1 w / m 2 The pupil size before and after pupil contraction was detected, and pupil contraction amplitude (CA) was calculated. 5) The captured video was converted into images for analysis.

[0145] The statistical results of the quantification of GCC thickness obtained by OTC detection described above showed that 28 days (4 weeks) after optic nerve injury, the GCC thickness was approximately 30.14 ± 1.82 μm in control mice (injected with an interference control virus) and approximately 40.78 ± 2.57 μm in experimental mice (injected with the adeno-associated virus of this example). The experimental data were significantly higher than the control data (p < 0.05, significant difference), suggesting that knockdown of the Porf-2 gene in retinal tissue using the adeno-associated virus of this example (containing a recombinant adeno-associated virus vector expressing shRNA4) can prevent thinning of the ganglion cell complex layer after optic nerve injury.

[0146] The results of the pupil light reflex test showed that the pupil constriction rate 28 days (4 weeks) after optic nerve injury was 53.88±3.13% in the control group mice (injected with the interference control virus) and 73.70±2.54% in the experimental group mice (injected with the adeno-associated virus of this example). The experimental group data was significantly higher than the control group data (p<0.05, significant difference). This suggests that knockdown of the Porf-2 gene in retinal tissue using the adeno-associated virus of this example (containing a recombinant adeno-associated virus vector expressing shRNA4) can promote the recovery of visual function after optic nerve injury.

[0147] Although this specification is described according to embodiments, each embodiment does not include only one independent technical solution, and such description of the specification is for the purpose of clarity only, and those skilled in the art should take the specification as a whole, and should understand that the technical solutions in each embodiment may also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

[0148] The above detailed description is merely a specific description of the possible embodiments of the present invention, and is not used to limit the protection scope of the present invention; all equivalent embodiments or modifications made without departing from the technical spirit of the present invention should be included in the protection scope of the present invention.

Claims

1. Use of an expression vector for an interfering nucleic acid of the Porf-2 gene in the preparation of a drug for treating / ameliorating optic nerve damage diseases, the therapeutic / ameliorating drug is a drug injected into the vitreous cavity of the eyeball that promotes regeneration of optic nerve axons after optic nerve injury and improves the survival rate of RGC cells after optic nerve injury; the expression vector is a recombinant adeno-associated virus vector obtained by cloning a gene fragment encoding an shRNA into the coding region of a virus vector; The shRNA is enzymatically cleaved in the cell to become siRNA, which further targets the Porf-2 gene in the optic nerve tissue and knocks down the expression of the Porf-2 gene in the optic nerve tissue, The DNA sequence corresponding to the sense strand of the siRNA is shown in SEQ ID NO: 13, and the DNA sequence corresponding to the antisense strand of the siRNA is shown in SEQ ID NO:

14. Use of an expression vector for an interfering nucleic acid of the Porf-2 gene, characterized in that:

2. The recombinant adeno-associated virus vector is obtained by inserting a gene fragment encoding the shRNA into the coding region between the ITR sequences at both ends of the adeno-associated virus vector.

2. The use according to claim 1 .

3. The adeno-associated virus vector is a serotype AAV2 vector.

3. The use according to claim 2.

Images