Methods and compositions for increasing the efficiency of targeted gene modification using oligonucleotide-mediated gene repair

Abstract

To provide improved methods for modifying genes in plant cells, and plants and seeds derived therefrom.SOLUTION: The invention relates to increased efficiency of targeted gene mutation by combining a gene repair oligonucleotide with an approach that enhances availability of components of a target cell gene repair mechanism. Disclosed is a method for introducing a gene repair oligonucleobase (GRON)-mediated mutation into a target deoxyribonucleic acid (DNA) sequence in a plant cell. The method comprises the steps of culturing the plant cell under conditions that increase one or more cellular DNA repair processes prior to, and / or coincident with, delivery of a GRON into the plant cell; and / or delivery of a GRON greater than 55 bases in length into the plant cell, the GRON optionally comprising two or more mutation sites for introduction into the target DNA.SELECTED DRAWING: Figure 1

Description

[Technical Field]

[0001] This application was filed on March 15, 2013, and is incorporated herein by reference. This application claims priority to U.S. Provisional Patent Application No. 61 / 801,333 filed on Oct. 1, 2002.

[0002] The present invention generally involves targeting modifications to specific locations in a genome or other nucleotide sequence. The present invention further relates to novel methods for improving the efficiency of targeting. The present invention relates to target DNA that has been modified, mutated or revealed by the techniques described herein. Also related are cells, tissues, and organisms modified by the methods of the invention. [Background technology]

[0003] The following discussion of the background of the invention is provided solely to assist the reader in understanding the present invention. and is not an admission that it describes or constitutes prior art prior to the present invention. .

[0004] Modification of genomic DNA has been a key advancement in biotechnology in general, and biotechnology in particular. It is central to the advancement of technology-based medicine. The method is desirable for research and possibly gene therapy applications. Using triplex-forming oligonucleotides (TFOs) that bind sequence-specifically to double-stranded DNA Such TFOs mediate directed mutagenesis. Delivery of mutagenic chemicals such as benzoyl peroxidase (Havre et al., Proc Nat'l Acad Sci,USA90:7879-7883,1993;Havre e t al.,J Virol67:7323-7331,1993;Wang et a l.,Mol Cell Biol15:1759-1768,1995;Takasu gi et al.,Proc Nat'l Acad Sci,USA88:5 602-5606,1991;Belousov et al., Nucleic Ac ids Res25:3440-3444,1997), or induce error-prone repair. (Wang et al., Science 271 :802-805,1996).

[0005] Another strategy for genome modification is the induction of homologous recombination between a foreign DNA fragment and a target gene. This technique has been successfully used to target and disrupt selected genes in mammalian cells. This allows for the generation of transgenic mice with specific gene knockouts. (Capeechi et al., Science 244:1288-129 2,1989, U.S. Patent No. 4,873,191 to Wagner). However, The technique relies on the introduction of a selectable marker to allow for the isolation of the desired recombinants. In the absence of selection, homologous and heterologous transfected DNA in a typical gene transfer experiment The ratio of cointegration is low, usually in the range of 1:1000 or less (Sedivy et al. al.,Gene Targeting,WHFreeman and Co.,N (New York, 1992). This low efficiency of homologous integration makes it unsuitable for experimental or genetic purposes. The use of gene transfer for gene therapy is limited. The frequency of homologous recombination is affected by UV irradiation and Target site damage caused by selected carcinogens (Wang et al., Mol Cell Biol 8:196-202, 1988) and by site-specific endonucleases Aase (Sedivy et al., Gene Targeting, WHFre eman and Co.,New York,1992;Rouet et al., Proc Nat'l Acad Sci,USA91:6064-6068,1 994;Segal et al.,Proc Nat'l Acad Sci,US .A.92:806-810,1995). DNA damage induced by the target psoralen photoadducts occurs within the extrachromosomal vector and (Segal et al., Proc Nat'l Acad Sci,USA92:806-810,1995;Faruqi e t al., Mol Cell Biol 16:6820-6828, 1996, Gla (U.S. Patent No. 5,962,426 to zer).

[0006] Other studies have been conducted to determine the parameters that affect recombination in mammalian cells. In general, linear donor fragments are more susceptible to recombination than their circular counterparts. (Folger et al., Mol Cell Biol 2:1372-13 78, 1982). Recombination occurs when a stretch of contiguous homology between both the donor and target sites is reached. It is also affected by the short fragments, which appear to be poor substrates for recombination (Rub nitz et al., Mol Cell Biol4:2253-2258,198 4) Nevertheless, several recent attempts have been made to use DNA or DNA fragments for gene correction. The focus is on the use of short fragments of / RNA hybrids (Kunzelmann et al. t al., Gene Ther3:859-867, 1996).

[0007] Use the sequence-specific binding properties of TFOs to deliver a series of different molecules to target sites in DNA For example, diagnostic methods for triple-stranded interactions include Fe-EDTA, DNA cleavage, and We used TFO coupled with a blocking agent (Moser et al., Science 238 :645-650, 1987). Others have used monococcal nuclease and streptococcal nuclease. Biologically active enzymes such as enzymes have been conjugated to TFOs and demonstrated site-specific cleavage of DNA. (Pei et al., Proc Nat'l Acad Sci, USA8 7:9858-9862,1990;Landgraf et al.,Biochem (Istry 33:10607-10615, 1994). Furthermore, site-specific DNA damage and mutagenesis was performed using psoralen (Havre et al., Proc Nat'l Acad Sci,USA90:7879-7883,1993;Takasug i et al., Proc Nat'l Acad Sci, USA88:56 02-5606, 1991) or alkylating agents (Belousov et al., N ucleic Acids Res25:3440-3444,1997;Posvic et al., J Am Chem Soc112:9428-9430, 1990) The method can be carried out using a TFO in combination with either

[0008] WIPO Patent Application WO / 2001 / 025460 describes: (1) determining at least one of the target DNA sequences; a first homologous region having a sequence identical to the sequence of the first fragment of at least 6 base pairs, and a target D a second homolog having a sequence identical to the sequence of a second fragment of at least 6 base pairs of the NA sequence; a first homologous region containing at least one nucleic acid base heterologous to the target DNA sequence; A recombinant oligonucleobase containing a region and an intervening region linked to a second homologous region is introduced into a plant. (2) culturing the microspores to generate embryos. and (3) culturing the microspores, for example, to generate somatic embryos and then planting the embryos. The step of regenerating the target DNA sequence generates a target DNA sequence between the first fragment and the second fragment. Mutation of a target DNA sequence in a plant, including generating a mutant plant from an embryo. In various embodiments of the present invention, a recombinant oligonucleic acid is used. The bases are MDON, and each homologous region contains at least 6 RNA-type nucleotides. A segment, the intervening region being at least 3 nucleotides in length, and the first and second or the second RNA segment contains at least eight contiguous 2'-substituted ribonucleotides. do. Summary of the Invention [Problem to be solved by the invention]

[0009] One of the main goals of biological research is the targeted modification of the genome. Methods for gene delivery into animal cells are well developed, but modifications and / or modifications may be necessary. The frequency of this recombination is limited (Hanson et al., Mol Cell Biology o15:45-51 1995). As a result, gene modification is a time-consuming process. Many methods are available to enhance modification and / or recombination between donor and genomic DNA. However, current techniques allow for a low rate of modification and / or They often show discrepancies in the rates of modification and / or recombination, and This hinders research and gene therapy technologies. [Means for solving the problem]

[0010] The present invention provides a method for targeting modifications to specific locations in a genome or other nucleotide sequence. Novel methods and compositions for improving the efficiency of thrombin synthesis are provided. In addition, nucleic acids that induce specific changes to the genome are combined with various methods to target the modifications. The availability of components of the natural repair system present in a cell can be increased.

[0011] In a first aspect, the present invention provides a method for detecting a gene encoding a target deoxyribonucleic acid (DNA) sequence in a plant cell. This invention relates to a method for introducing gene repair oligonucleobase (GRON)-mediated mutations. These methods are particularly useful for delivering GRONs into plant cells and / or for delivering GRONs longer than 55 bases in length. Transfection of GRONs, optionally containing two or more mutation sites, for introduction into target DNA. Prior to and / or concurrently with delivery of the compound to the cell, one or more cellular DNA repair proteins may be administered. The method includes culturing plant cells under conditions that enhance the process.

[0012] In certain embodiments, the conditions that increase one or more cellular DNA repair processes include: Introduction of one or more sites into plant cell DNA that are targets of GRON or base excision repair. One or more sites into plant cell DNA that are targets of entry, GRON, or non-homologous end joining Introduction of DNA fragments into plant cells, which are targets for GRON- or microhomology-mediated end joining Introduction of one or more sites into A. plant cells that are targets for GRON or homologous recombination Introduction of one or more sites into the NA and targeting it to facilitate GRON or repair. The method includes one or more of the introduction of one or more sites into the plant cell DNA.

[0013] As described later in this specification, GRONs for use in the present invention are conventional RNA and one or more of the following modifications from DNA nucleotides: one or more abasic site nucleotides, one or more 8'oxo-dA and / or 8'oxo-dG nucleotides, an inverted base at its 3' end, one or more 2'O-methyl nucleotides, one or more, and preferably 2, 3, 4, 5, 6, 7, 8, or , 9, 10, or more 2'O-methyl RNA nucleotides, Intercalating dyes, 5' end cap, Phosphothioate modification, methylphosphonate modification, locked nucleic acid (LNA) modification, O- (2-Methoxyethyl) (MOE) modification, diPS modification, and peptide nucleic acid (PNA) modification a backbone modification selected from the group consisting of: one or more interstrand crosslinks, one or more covalently attached fluorescent dyes, preferably at the 5' or 3' end of GRON; It may contain one or more bases that increase hybridization energy. This list is not meant to be limiting.

[0014] As described later herein, in certain embodiments, the quality and conversion efficiency of GRON The whole GRON is synthesized using nucleotide multimers, such as dimers, trimers, and tetramers. Or it can be improved by synthesizing a part of it and improving its purity. can.

[0015] In certain embodiments, the target deoxyribonucleic acid (DNA) sequence is present in the plant cell genome. The plant cells may be non-transgenic or transgenic and contain the target D The NA sequence may be a transgene or an endogenous gene in the plant cell.

[0016] In certain embodiments, the conditions that increase one or more cellular DNA repair processes include: Before or simultaneously with the delivery of GRON to the plant cell, single-stranded or double-stranded GRON into the plant cell This involves the introduction of one or more compounds that induce DNA cleavage. Exemplary compounds are described herein. will be described later.

[0017] The methods and compositions described herein are generally applicable to plants. Nora, sunflower, corn, tobacco, sugar beet, cotton, maize, wheat, barley, rice , alfalfa, barley, sorghum, tomatoes, mangoes, peaches, apples, pears, and yams Goats, bananas, melons, potatoes, carrots, lettuce, onions, soybeans, soybean seeds, Corn, legumes, chickpeas, field peas, legumes, lentils, turnips, Swede, Brussels sprouts, lupine, cauliflower, kale, peas, poppies Ra, pine, eucalyptus, grape, citrus, triticale, alfalfa, rye , oats, lawn and fodder, flax, rapeseed, mustard, cucumber, morning glory, balsam, Pepper, eggplant, marigold, lotus, cabbage, daisy, carnation, chi The plant species may be selected from the group consisting of tulips, irises, and lilies. have demonstrated the ability to express mitochondrial DNA in bacterial, fungal and mammalian cells and their organelles (e.g., mitochondria). It is not limited to only the endothelium and chloroplasts, but also to all other living systems, including these. can also be applied in part.

[0018] In certain embodiments, the method comprises the step of extracting a plant cell from a plant having a mutation introduced by GRON. The method may further include the step of regenerating a plant and may include the step of collecting seeds from the plant.

[0019] In a related aspect, the present invention provides a method for treating a pulmonary artery disease (PAD) caused by a pulmonary artery disease (PAD) introduced by GRON according to the methods described herein. Plant cells containing genomic modifications introduced by GRON according to the methods described herein. Plants containing genomic modifications or those introduced by GRON according to the methods described herein. The present invention relates to seeds containing the modified genome.

[0020] Other embodiments of the present invention are described in the detailed description, exemplary embodiments, and claims below. This becomes clear from the surrounding area. [Brief explanation of the drawings]

[0021] [Figure 1] FIG. 1 shows the conversion of BFP to GFP mediated by phosphothioate (PS)-labeled GRON (with 3 PS moieties at each end of the GRON) and 5′Cy3 / 3′idC-labeled GRON. [Figure 2] FIG. 1 shows an RNA / DNA-containing GRON, referred to herein as an "Okazaki fragment GRON." DETAILED DESCRIPTION OF THE INVENTION

[0022] Targeted gene modification mediated by oligonucleotides has been developed over the past few years. specificity of short stretches of DNA to result in deletions, short insertions, and point mutations These methods have been shown to be worthy of use in DNA engineering. First, nucleic acids are bound to the cellular proteins, which then undergo DNA repair / recombination events. anneals to its complementary strand in double-stranded DNA in a process mediated by protein factors This annealing removes the mismatch in the center (in the case of a point mutation). It generates base pairs and stimulates the endogenous protein machinery to carry out the second step in the repair process, Chromoplast sequences and further localization of their organelles (e.g., mitochondria and chloroplasts) This newly introduced destabilization most likely initiates heterologous modification. The mismatch induces DNA repair mechanisms, triggering a second repair event that results in the final correction of the target site. The methods of the present invention increase the availability of DNA repair components and thus target nucleic acids. By providing a novel method to increase the efficiency and reproducibility of gene repair-mediated modifications to These methods will be improved.

[0023] definition To facilitate understanding of the present invention, several terms are defined below.

[0024] As used herein, the terms "nucleic acid sequence," "nucleotide sequence," and "polynucleotide sequence" refer to "Sequence" refers to an oligonucleotide or polynucleotide, and fragments or portions thereof. and a gel that may be single-stranded or double-stranded and represents the sense or antisense strand. Refers to DNA or RNA of either human or synthetic origin.

[0025] As used herein, the terms "oligonucleotide" and "oligomer" refer to a probe or or amplimers, and At most about 201 nucleotides, preferably about 15-30 nucleotides, and more preferably It refers to a nucleic acid sequence of approximately 20 to 25 nucleotides.

[0026] As used herein, the terms "DNA modifying molecule" and "DNA modifying reagent" refer to a molecule that modifies the genome of a cell. It can recognize and specifically bind to a nucleic acid sequence in the genome, and The DNA sequence can be modified, and the recognition and specific binding of the DNA modification molecule to the nucleic acid sequence can be achieved. The term "tRNA" as used herein with respect to DNA modifying molecules refers to molecules that are protein-independent. "Protein-independent" means that the DNA-modifying molecule recognizes and / or specifically associates with a nucleic acid sequence. The specific binding does not require the presence and / or activity of proteins and / or enzymes. DNA modification molecules are triplex-forming oligonucleotides intended to facilitate gene conversion. including, but not limited to, nucleotides, peptide nucleic acids, polyamides, and oligonucleotides. These are exemplary of the DNA modifying molecules of the present invention. The nucleic acid sequences of the prior art used for homologous recombination are protein-dependent. Column [Wong and Capecchi,Molec.Cell.Biol.7:22 94-2295, 1987]. The term "tan" as used herein with respect to molecules "Protein-dependent" means that the molecule relies on a protein for recognition and / or specific binding to a nucleic acid sequence. This means that it requires the presence and / or activity of proteins and / or enzymes. The modified molecule is capable of reacting with proteins and / or other molecules to recognize and / or specifically bind to nucleic acid sequences. Methods for determining whether a compound is required for the presence and / or activity of a specific enzyme are known in the art. It is within the scope of current techniques [e.g., Dennis et al. Nucl. Acids Res. 27:4734-4742, 1999]. For example, DNA modifying molecules may be Incubated in vitro with nucleic acid sequences in the absence of other proteins and / or enzymes. By detecting specific binding between a DNA modification molecule and a nucleic acid sequence, We demonstrate that DNA modification molecules are protein-independent. The absence of specific binding between nucleic acid sequences indicates that DNA modification molecules are protein-dependent and Demonstrate that the drug requires the use of other factors.

[0027] "Triplex-forming oligonucleotides" (TFOs) are oligonucleotides that bind to double-stranded DNA or RNA helices. DNA or RNA sequences that can bind to the major groove of a nucleic acid to form a triple helix. Although the TFO is not limited to any particular length, the preferred length of the TFO is 2 00 nucleotides or less, more preferably 100 nucleotides or less, even more preferably 5 to 50 nucleotides, even more preferably 10 to 25 nucleotides, and most preferably The length of the double-stranded DNA is about 15-25 nucleotides. A certain degree of sequence specificity is required between the Similarly, triple helices can be formed, but no particular degree of specificity is required. As long as the specific degree of avidity or affinity exists between the TFO and the double-stranded helix, Affinity is not required for the nucleotide sequence to which the TFO specifically binds. While not intended to be limiting in length, in one embodiment, the length of the nucleotide to which the TFO specifically binds is The octide sequence is 1 to 100, more preferably 5 to 50, even more preferably 10 to 25, and most preferably 15 to 25 nucleotides. It is defined as a double-stranded nucleic acid containing an oligonucleotide bound to a target sequence within the double-stranded nucleic acid. "Double helix" nucleic acids include double-stranded DNA, double-stranded RNA, and a combination of DNA and RNA. The double-stranded nucleic acid may be any double-stranded nucleic acid, including mixed double-stranded nucleic acids. The double-stranded nucleic acid is not limited to any particular length. However, in a preferred embodiment, the double-stranded nucleic acid is greater than 500 bp, more preferably greater than 500 bp. Preferably, it has a length of more than 1 kb, and most preferably more than about 5 kb. In some applications, the double-stranded nucleic acid is a cellular or genomic nucleic acid. The tides can bind to the target sequence in a parallel or antiparallel format.

[0028] "Peptide nucleic acid," "polyamide," or "PNA" refers to a nucleic acid whose phosphate backbone is N-aminoethyl It is a nucleic acid with a glycine-based polyamide structure. According to the rule, PNAs have higher affinity for complementary nucleic acids than their native counterparts. PNA forms a very stable triple helix structure with DNA at the following stoichiometric ratio: (PNA) 2. DNA. Peptide nucleic acids and polyamides can be of any specific length. Although not required, the preferred length of peptide nucleic acids and polyamides is 200 nucleotides or less. More preferably 100 nucleotides or less, and most preferably 5 to 50 nucleotides in length The length of the nucleotide sequence to which the peptide nucleic acid and polyamide specifically bind is limited. While not intended to be limiting, in one embodiment, peptide nucleic acids and polyamides are specifically The nucleotide sequence to be bound is 1 to 100, more preferably 5 to 50, and even more preferably is 5 to 25, and most preferably 5 to 20 nucleotides.

[0029] The term "cell" refers to a single cell. The term "cells" refers to a population of cells. A population is one Similarly, a population may contain more than one cell type. In the present invention, there is no limit to the number of cell types that a cell population may contain.

[0030] The terms "synchronize" or "synchronized" or "synchronized" when referring to a sample of cells Synchronized cells or synchronized cell populations are those that exist in a cell population at the same stage of the cell cycle. It refers to multiple cells treated with a single antibody. It is not necessary for all cells in a sample to be synchronized. A small percentage of cells may be out of sync with the majority of cells in the sample. A preferred range for some cells is 10-100%, and a more preferred range is 30-100%. Furthermore, the cells do not have to be a pure population of one cell type. In this respect, the nuclei may be contained within a pool of cells that are different from other cell types within the sample. , only one cell type may be synchronized or may exist at different stages of the cell cycle. .

[0031] The term "synchronized cells" when referring to single cells is used to refer to cells in a different cell cycle stage than the cells prior to manipulation. This means that cells have been manipulated to exist at a certain stage of the cell cycle. "Controlled cells" refers to the presence of cells before manipulation compared to control cells (e.g., cells in the absence of manipulation). Cells engineered to alter (i.e., lengthen or shorten) the duration of the cell cycle phase in which they occur Refers to...

[0032] The term "cell cycle" refers to the physiological and morphological changes that a cell undergoes as it divides (i.e., grows). The cell cycle generally consists of three stages: interphase, prophase, metaphase, anaphase, and It is recognized that the cell cycle consists of a period called "telophase" and a period called "prophase." "M (mitosis phase)", "S (synthesis phase)", "G0", "G1 (gap 1)" and " G2 (Gap 2) is a period in which the cell cycle continues. Includes any ongoing periods present.

[0033] The term "cell cycle arrest" refers to the cessation of cell cycle progression in a cell or population of cells. Cell cycle inhibition is typically achieved by the inhibition of certain agents (chemicals, proteins, or other substances) that interfere with aspects of cell physiology. It is induced by exposure of cells to other factors (e.g., erythrocyte proliferation, erythrocyte motility, and erythrocyte motility) and prevents progression of the cell cycle.

[0034] "Growth" or "cell proliferation" refers to the repeated division of a cell into two daughter cells, thereby growing the population. refers to the ability of a parent cell to produce an overall increase in cells in an organism or culture. The nutrient solution may be present in a culture device.

[0035] The term "DNA-modifiable" or "DNA-modifying means" refers to a method for modifying a nucleotide sequence of a target DNA segment. capable of inducing or assisting in inducing changes to the nucleotide sequence refers to the procedure and endogenous or exogenous agents or reagents that target DNA segments. Such changes can be made by deletion, addition, or substitution of one or more bases in the The change in DNA sequence can have a functional effect on any gene encoded by the target sequence. Furthermore, it is not required to induce any particular change in any particular portion or percentage of cells. No changes to the NA are required.

[0036] The term "nucleotide sequence of interest" refers to a sequence of interest whose manipulation by a person skilled in the art is for any reason desirable. This refers to any nucleotide sequence that may be thought of as These include structural genes (e.g., reporter genes, selectable marker genes, oncogenes, drug resistance genes) coding sequences for genes (e.g., sex genes, growth factors) and the mRNA or protein products Non-coding regulatory sequences (e.g., promoter sequences, enhancer sequences, polyadenylation sequences) that do not These include, but are not limited to, transcriptional sequences, termination sequences, and regulatory RNAs such as miRNAs. do not have.

[0037] "Amino acid sequence," "polypeptide sequence," "peptide sequence," and "peptide" are used herein. They are used interchangeably herein to refer to a sequence of amino acids.

[0038] As used herein, a "target sequence" is preferably greater than 8 nucleotides in length, but not greater than 201 nucleotides. refers to a double-stranded nucleic acid that contains a sequence less than a nucleotide in length. In some embodiments, the target sequence The length of the target sequence is preferably 8 to 30 bases. Defined by a nucleotide sequence.

[0039] As used herein, a "purine-rich sequence" or "polypurine sequence" refers to a sequence that is present in the double helix core. When referring to the sequence of nucleotides on one strand of a target sequence, it refers to more than 50% of the nucleotides in the target sequence. A nucleotide is defined as a contiguous sequence of nucleotides containing a purine base. A phosphorus-rich target sequence is one that contains more than 60% purine nucleotides, more preferably more than 75%. most preferably greater than 90% purine nucleotides, and and most preferably contains 100% purine nucleotides.

[0040] As used herein, a "pyrimidine-rich sequence" or a "polypyrimidine sequence" refers to a double When referring to the nucleotide sequence on one strand of a helical nucleic acid sequence, more than 50% of the target sequence Nucleotides are defined as a contiguous sequence of nucleotides containing pyrimidine bases. On the other hand, pyrimidine-rich target sequences contain more than 60% pyrimidine nucleotides, and and more preferably contains more than 75% pyrimidine nucleotides. In some embodiments, the sequences preferably contain greater than 90% pyrimidine nucleotides. Preferably, in another embodiment, 100% pyrimidine nucleotides are most preferred. .

[0041] "Variants" of the first nucleotide sequence may be used in hybridization assays (e.g., one or more deletions, insertions, or deletions that are detectable by the use of ELISA or DNA sequencing a nucleotide sequence that differs from the first nucleotide sequence (by having an insertion or substitution) Included within this definition is a sequence that is a sequence that is a nucleotide ... For example, the detection of alterations or modifications that result from the hybridization assay. (1) capable of hybridizing to a first nucleotide sequence when contained in a genome; (2) modification of the pattern of restriction fragments that can be generated (i.e., RFLP analysis); A selected portion of the first nucleotide sequence is hybridized to a sample of genomic DNA containing the nucleotide sequence. Inability to redistribute (e.g., using allele-specific oligonucleotide probes) (3) hybridization with a locus other than the normal chromosomal locus for the first nucleotide sequence; Detecting inappropriate or unexpected hybridization, such as redox (e.g., fluorescence in situ hybridization to metaphase chromosome distribution) (e.g., using FISH). An example of a variant is a mutated wild-type sequence.

[0042] As used herein, the terms "nucleic acid" and "unmodified nucleic acid" refer to the well-known 4-deoxyribonucleic acid Refers to any one of the bases (i.e., guanine, adenine, cytosine, and thymine) The term "modified nucleic acid" refers to a nucleic acid whose structure has been altered relative to the structure of an unmodified nucleic acid. Examples of such modifications include base substitutions, covalent modifications, alkylation of amino and nitrogen rings, and saturation of double bonds.

[0043] As used herein, the terms "mutation" and "modification" and their grammatical equivalents When used in reference to nucleic acid sequences, are used interchangeably to refer to deletions, insertions, substitutions, strand breaks, and A "deletion" refers to the introduction of one or more nucleotides in a nucleic acid sequence. An "insertion" or "addition" is defined as a change in the sequence of one or more nucleotides. A "substitution" is a change in a nucleic acid sequence in which one or more nucleotides have been replaced. It results from the exchange of one or more nucleotides with a molecule that is different from the nucleotide. For example, cytosine, adenine, guanine, or uridine can be exemplified by the replacement of thymine. As shown, one nucleic acid can be exchanged for a different nucleic acid. e.g., C to T or T to C nucleotide substitutions) or purine to purine (e.g. , G to A or A to G nucleotide substitutions) are called transitions, while pyrimidines amine to purine or purine to pyrimidine (e.g., G to T or G to C or A) A transversion (from thymine to T or A to C) is called a transversion. As exemplified by the exchange of Recall, one nucleic acid can be exchanged for a modified nucleic acid. Mutations can result in mismatches. The term "mismatch" refers to the mismatch between the respective nucleic acids. refers to the non-covalent interaction between two nucleic acids present on different polynucleic acid sequences, which is called base pairing. The partially complementary sequences 5'-AGT-3' and 5'-AAT Regarding the -3', there is a GA mismatch (transition). "Adduct formation" or "adduct formation" refers to the formation of a bond (preferably 10% to 100%, more preferably 5%). 0% to 100%, and most preferably 75% to 100%) DNA replication and / or A mutation that alters one or more nucleotides in the DNA sequence, resulting in a decrease in transcription levels. Refers to covalent or non-covalent bonds between molecules.

[0044] The term "strand break" when referring to a double-stranded nucleic acid sequence can refer to a single-strand break and / or a double-strand break. A single-strand break (nick) refers to an interruption in one of the two strands of a double-stranded nucleic acid sequence. This is in contrast to a double-strand break, which refers to a disruption in both strands of a double-stranded nucleic acid sequence. Ablation can occur directly (e.g., by treatment with ionizing radiation or certain chemicals) or by induced ablation. is introduced into a double-stranded nucleic acid sequence indirectly (e.g., by enzymatic cleavage at the nucleobases). It is possible.

[0045] The terms "mutated cell" and "modified cell" refer to a cell that has at least one It refers to a cell containing a modification.

[0046] The term "portion," when used in reference to a nucleotide sequence, refers to that nucleotide A fragment of a sequence. A fragment is anything from 5 nucleotide residues to the entire nucleotide sequence minus one nucleic acid. It can range in size from residue to residue.

[0047] A DNA molecule is said to have a "5' end" and a "3' end." The 5' phosphate of the tidopentose ring is unidirectionally linked to its neighboring 3' phosphate via a phosphodiester bond. Mononucleotides react to form oligonucleotides in a manner that binds to oxygen. Therefore, the 5' phosphate is attached to the 3' oxygen of the mononucleotide pentose ring. If the 3' oxygen atom is not bound to the oligonucleotide, the end of the oligonucleotide is called the "5' end." When the 5' phosphate of the pentose ring of another mononucleotide is not bound to the oligonucleotide, The end of the nucleic acid is referred to as the "3' end." As used herein, a nucleic acid sequence is a sequence of a multimeric oligonucleotide. Even within a peptide, it can be said to have a 5' end and a 3' end. In either a circular or a circular DNA molecule, discontinuous elements are designated as "upstream" or "downstream" elements. This term refers to the 5' or 3' element of a DNA strand. The promoter and the transcription of the associated gene proceed in the ' to 3' direction. Enhancer elements are commonly located 5' or upstream of the coding region. Therefore, enhancers, even when located 3' of the promoter element and the coding region, -elements can exert their effect. Transcription termination and polyadenylation signals are Located 3' or downstream of the region.

[0048] As used herein, the term "recombinant DNA molecule" refers to a molecule joined together by means of molecular biology techniques. A DNA molecule is a molecule made up of segments of DNA.

[0049] As used herein, the term "recombinant protein" or "recombinant polypeptide" refers to a recombinant protein or polypeptide. It refers to a protein molecule expressed using a DNA molecule.

[0050] As used herein, the terms "vector" and "vehicle" refer to a vector that transfers DNA from one cell to another. The terms "transfer" and "transfer-transfer" are used interchangeably to refer to a nucleic acid molecule that transfers a segment or segments.

[0051] As used herein, the terms "in operable combination," "in operable order," and "operable" "Operably linked" refers to the induction of transcription of a given gene and / or the production of a desired protein molecule. These terms refer to the joining of nucleic acid sequences in a manner that produces a nucleic acid molecule that can be synthesized. It also refers to the combination of amino acid sequences in such a way as to produce a functional protein.

[0052] As used herein, the term "transfection" refers to the introduction of foreign DNA into a cell. Calcium phosphate-DNA coprecipitation, DEAE-dextran mediated transfection transfection, polybrene-mediated transfection, electroporation, microinjection fusion, liposome fusion, lipofection, protoplast fusion, retrovirus infection dyeing, biolistics (i.e., particle bombardment), etc. Transfection can be carried out by a variety of means known to those skilled in the art.

[0053] As used herein, the terms "complementary" or "complementarity" refer to those related by the base-pairing rules. Concatenated "polynucleotide" (which is an interchangeable term referring to a sequence of nucleotides) and is used when referring to an "oligonucleotide." For example, the sequence "5'-CAGT -3' is complementary to the sequence 5'-ACTG-3'. Complementarity can be "partial" or " "Partial" complementarity can be "total" complementarity, where one or more complements are found according to the base-pairing rules. "Total" or "perfect" complementarity between nucleic acids occurs when the bases of the nucleic acids do not match. Under the rules of pairing, each individual nucleobase matches with another base. The degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands. This can have an impact on amplification reactions and detection methods that depend on binding between nucleic acids. For convenience, the terms "polynucleotide" and "oligonucleotide" will be used interchangeably. "Nucleoside" includes molecules containing nucleosides.

[0054] The terms "homology" and "homologous" as used herein in reference to nucleotide sequences refers to the degree of complementarity with another nucleotide sequence. A double-stranded nucleic acid sequence such as a cDNA or genomic clone may have a similar sequence identity. When used in reference to a gene that is substantially homologous to a target gene, the term "substantially homologous" is intended to encompass sequences that are substantially homologous to a target gene under the low stringency conditions described above. Any nucleic acid that can hybridize to one or both strands of a double-stranded nucleic acid sequence under Refers to a nucleic acid sequence (e.g., a probe). A nucleotide sequence that is "identical" is one that hybridizes to a target nucleic acid sequence as a perfectly complementary sequence. A nucleotide sequence that at least partially inhibits the target sequence. Inhibition of hybridization occurs under conditions of low stringency. tion assays (Southern or Northern blots, solution hybridization, etc.) Substantially homologous sequences or probes can be tested using low stringency. The binding of a perfectly homologous sequence to a target sequence under the conditions of the assay (i.e., hybridization) Low stringency conditions allow for non-specific binding. Low stringency conditions are not acceptable conditions, and low stringency conditions may result in the binding of two sequences to each other. The absence of non-specific binding requires that the interaction be specific (i.e., selective). , of a second target sequence that lacks even a partial percentage of complementarity (e.g., less than about 30% identity). The absence of nonspecific binding can be tested by using a probe with a second non-complementary does not hybridize with the target.

[0055] Low stringency conditions utilize probes of approximately 100 to approximately 1000 nucleotides in length. When using 5×SSPE (43.8 g / L NaCl, 6.9 g / L NaH2PO4·H 2O and 1.85 g / l EDTA, adjusted to pH 7.4 with NaOH), 0.1% SD S, 5x Denhardt's reagent (50x Denhardt's reagent contains 5g of Ficol per 500ml) l(Type400, Pharmacia), 5g BSA(FractionV;Sig ma)) and 100 μg / ml denatured salmon sperm DNA at 68°C. Binding or hybridization with 2.0x SSPE, 0.1% SDS, and then This includes conditions equivalent to washing in a solution at room temperature.

[0056] Additionally, conditions that promote hybridization under high stringency conditions ( For example, increasing the temperature of the hybridization and / or washing steps, Such techniques (such as the use of formamide in the lysis solution) are well known in the art. High stringency conditions, when used in reference to nucleic acid hybridization, When using a probe of about 100 to about 1000 nucleotides in length, 5×SSPE, 1% A solution consisting of 100 μg / ml SDS, 5× Denhardt's reagent, and 100 μg / ml denatured salmon sperm DNA was used. Binding or hybridization at 68°C in 0.1% SSPE and and washing at 68°C in a solution containing 0.1% SDS.

[0057] Low stringency conditions, length and nature of probe (DNA, RNA, base composition) , and the nature of the target (e.g., DNA, RNA, base composition, etc., present in solution or in a fixed state). and the concentration of salts and other components (e.g., formamide, dextran sulfate, polysorbate with or without polyethylene glycol), as well as low-stringency conditions that are different but equivalent to those mentioned above. Hybridization conditions can be varied to achieve optimal hybridization conditions. Many comparable conditions are available, including factors such as the composition of the ionization solution. is well known in the art.

[0058] The term "equivalent" refers to a hybridization sequence that is relative to the hybridization conditions of interest. When referring to hybridization conditions, the hybridization conditions and the target hybridization sequence are The hybridization conditions are such that the nucleic acid sequences with the same percentage of homology are hybridized. For example, the hybridization conditions of interest may result in Hybridization of the first nucleic acid sequence with another nucleic acid sequence having 50% to 70% homology to the sequence. Therefore, different hybridization conditions may be used to achieve this other hybridization. The hybridization conditions also include the use of another nucleic acid having 50% to 70% homology with the first nucleic acid sequence. If the sequence results in hybridization of the first nucleic acid sequence with the hybridizing enzyme of interest, This can be said to be equivalent to the ionization conditions.

[0059] As used herein, the term "hybridization" refers to the process by which strands of nucleic acid are joined together by base pairing. using any process that allows the complementary strand to join and form a hybridization complex. Used to refer to the pairing of complementary nucleic acids. The strength of the association (i.e., the strength of the association between nucleic acids) is a function of the degree of complementarity between the nucleic acids, the related sequence, and the degree of complementarity between the nucleic acids. Stringency conditions, Tm of the hybrid formed, and G:C ratio in the nucleic acid Affected by factors.

[0060] As used herein, the term "hybridization complex" refers to a hybridization complex of complementary G and C bases. formed between two nucleic acid sequences by the formation of hydrogen bonds between and between complementary A and T bases These hydrogen bonds are further stabilized by base stacking interactions. Two complementary nucleic acids can be aligned in an antiparallel configuration with hydrogen bonds. The complexes are either in solution (e.g., Cot or Rot assays) or in a single molecule present in solution. Nucleic acid sequences and solid supports (e.g., Southern and Northern blotting, dot blots) Nylon membrane or nitrocellulose filter used in FI In situ hybridization, including SH (fluorescence in situ hybridization) between different nucleic acid sequences immobilized on a glass slide used in DNA synthesis It can be done.

[0061] As used herein, the term "Tm" is used to refer to the "melting temperature." is the temperature at which a population of double-stranded nucleic acid molecules is halved and dissociates into single strands. The equations for determining the nucleotide sequence of a nucleic acid are well known in the art. When present in aqueous solution at 1M NaCl, a simple estimate of the Tm value is given by the equation: Tm = 81.5 +0.41(%G+C) (e.g., Anderson et al. nd Young, Quantitative Filter Hybridizati (See Nucleic Acid Hybridization, 1985) Other references include more sophisticated methods that take into account structural and sequence characteristics for Tm calculations. nothing.

[0062] As used herein, the term "stringency" refers to the degree to which nucleic acid hybridization occurs. The conditions under which the reaction is carried out, such as temperature, ionic strength, and the presence of other compounds, such as organic solvents. Stringency is typically from about Tm°C to about 2°C above Tm. 0°C to 25°C lower. As will be understood by those skilled in the art, stringent Identifying or detecting identical polynucleotide sequences using hybridization or to identify or detect similar or related polynucleotide sequences. can be done.

[0063] The terms "specific binding," "binding specificity," and grammatical equivalents thereof refer to the first When referring to the linkage of a nucleotide sequence to a second nucleotide sequence, the second nucleotide sequence the interaction between the first nucleotide sequence and the second nucleotide sequence compared to the interaction between the first nucleotide sequence and the third nucleotide sequence. Specific binding refers to the preferential interaction between the nucleotide sequences of a given molecule. Specific binding does not require absolute specificity of binding. In other words, the term "specific binding" refers to the binding of a second nucleotide sequence to a second nucleotide sequence. In the absence of an interaction between the second nucleotide sequence and the third nucleotide sequence, It does not require that the first nucleotide sequence interact with the second nucleotide sequence. The level of interaction between the nucleotide sequence and the second nucleotide sequence is It is sufficient to exceed the level of interaction between the nucleotide sequence and the third nucleotide sequence. The "specific binding" of a first nucleotide sequence to a second nucleotide sequence is The interaction between the nucleotide sequence and the second nucleotide sequence is It also means that it depends on the presence of a specific internal structure. A sequence is generally not a nucleic acid or nucleotide sequence, but rather a sequence on or within a first nucleotide sequence. For example, a second nucleotide sequence binds to a specific structure in the first nucleotide sequence. If the structure is specific for structure "A" present on or within a nucleotide sequence, the structure containing A is A second nucleotide sequence bound to the first nucleotide sequence by the presence of a third nucleic acid sequence The amount of sequence is reduced.

[0064] As used herein, the term "amplifiable nucleic acid" refers to a nucleic acid that can be amplified by any amplification method. "Amplifiable nucleic acid" typically includes a "sample template." It is intended that...

[0065] The terms "heterologous nucleic acid sequence" or "heterologous DNA" are used interchangeably to refer to a heterologous nucleic acid sequence to which it is naturally linked. The nucleotide sequence linked to the nucleic acid sequence that is not present or that is linked at a different position from the original Heterologous DNA is not endogenous to the cell into which it is introduced, but is obtained from another cell. Additionally, but not necessarily, such heterologous DNA may be expressed in a manner normally produced by the cell in which it is expressed. Examples of heterologous DNA include reporter genes and proteins that are not expressed in the target cell. gene, transcriptional and translational regulatory sequences, selectable marker proteins (e.g., those conferring drug resistance) Proteins such as lactic acid bacteria (called lactic acid bacteria) are also included.

[0066] "Amplification" is defined as the production of additional copies of a nucleic acid sequence and is well known in the art. It is commonly performed using polymerase chain reaction techniques (Dieffenbach C W and GS Dveksler (1995) PCR Primer, a Labo ratory Manual,Cold Spring Harbor Press,P As used herein, the term "polymerase chain reaction" (" PCR (polymerase chain reaction) is a method for isolating target sequence segments in a mixture of genomic DNA without cloning or purification. The method for increasing the concentration of hydroxybenzoates is described in detail in K. B. Mullis, U.S. Patent Nos. 4,683,195 and 4,683,202 The length of the amplified segment of the desired target sequence is determined by the length of the two oligonucleotide primers. This length is determined by their relative positions to each other and is therefore a controllable parameter. Due to the iterative nature of the process, this method is referred to as "polymerase chain reaction" (herein). The desired amplified segment of the target sequence is concentrated (in terms of concentration) in the mixture. As these become the dominant sequences, they are said to be "PCR amplified."

[0067] PCR allows the synthesis of one copy of a specific target sequence in genomic DNA into several different The method (e.g., hybridization with a labeled probe, preparation of a biotinylated primer) Incorporation of dCTP or dCTP into the amplified segment followed by detection with an avidin-enzyme conjugate detectable by incorporation of 32P-labeled deoxynucleotide triphosphates such as dATP In addition to genomic DNA, the appropriate set of primer molecules can amplify up to 100% of the target DNA. Any oligonucleotide sequence can be amplified by PCR. The amplified segments thus generated are themselves efficient templates for subsequent PCR amplification.

[0068] One such preferred method, particularly for commercial applications, is the widely used TaqMan Based on real-time PCR technology, allele-specific PCR and blocking A combination of reagents (ASB-PCR) suppresses the amplification of the wild-type allele. DNA or RNA extracted from any tissue type, including paraffin-embedded tumor samples ASB-PCR can be used to detect either germline or somatic mutations. A single point substitution, insertion, or mutation can be performed in 1000-fold excess over the background of the wild-type allele. A set of reagent design rules has been developed that allows for sensitive and selective detection of insertions or deletions. are. (Morlan J, Baker J, Sinicropi D Mutati on Detection by Real-Time PCR: A Simple, Ro bust and Highly Selective Method.PLoS ON E4(2):e4584,2009)

[0069] The terms "reverse transcription polymerase chain reaction" and "RT-PCR" refer to the process of reverse transcribing an RNA sequence. to generate a mixture of cDNA sequences, and then transfect the mixture without cloning or purification. This refers to a method for increasing the concentration of a desired segment of a transcript of a cDNA sequence. PCR amplification of the desired segment of transcribed DNA using a primer ( The RNA is reverse transcribed using, for example, an oligo-dT primer.

[0070] As used herein, the term "primer" refers to a primer that may be present in its native form in a purified restriction enzyme digest. conditions that induce the synthesis of primer extension products complementary to the nucleic acid strand, whether produced by synthesis or by cleavage. under suitable conditions (i.e., appropriate temperature and pH, nucleotides, DNA polymerase, etc.) An oligonucleotide that can act as a starting point for synthesis when placed in a The primer is preferably single-stranded for maximum amplification efficiency, but alternatively If double stranded, the primer may be partially purified prior to use in preparing extension products. It is first treated to separate its strands. Primers are oligodeoxyribonucleotides. Preferably, the primer is sufficiently amplifiable to prime the synthesis of extension products in the presence of an inducing agent. The exact length of the primers depends on the temperature, the source of primers, and the It depends on many factors, including the law.

[0071] As used herein, the term "probe" refers to a probe that is intended to be present in its native form in a purified restriction enzyme digest. to another oligonucleotide of interest, whether generated synthetically, recombinantly, or by PCR amplification. an oligonucleotide (i.e., a sequence of nucleotides) that can hybridize to the A probe may be single-stranded or double-stranded. A probe is a probe for a specific gene sequence. Any probe used in the present invention may be any suitable probe. The antibody may be labeled with any "reporter molecule" and thus may be an enzyme (e.g., ELISA, and enzyme-based histochemical assays), including but not limited to fluorescent, radioactive, and luminescent systems It is contemplated that the present invention can be detected by any detection system, including the above. It is not intended to be limited to any particular detection system or label.

[0072] As used herein, the terms "restriction endonuclease" and "restriction enzyme" refer to, respectively, breaks double- or single-stranded DNA at or near a specific nucleotide sequence It refers to a bacterial enzyme that creates a slit in the endothelial cell membrane, e.g., Kim et al., 1996, P roc.Nat'l.Acad.Sci.USA,6:1 156-60 As mentioned above, the endonucleases of type IIS restriction endonucleases (e.g., FokI) The domain can be used.

[0073] As used herein, the term "oligonucleotide having a nucleotide sequence encoding a gene" refers to a A "nucleotide" is a nucleic acid sequence comprising the coding region of a gene, i.e., a nucleic acid that encodes a gene product. The coding region may exist in either cDNA, genomic DNA, or RNA form. When present in DNA form, oligonucleotides may be single-stranded (i.e., the sense strand) or It may be double-stranded or double-stranded. "nucleotides" are those that regulate the accurate initiation of transcription and / or the accurate processing of the primary RNA transcript. If necessary, enhancers, promoters, splice junctions, etc. The gene may contain appropriate regulatory elements such as transcription, polyadenylation signals, etc. The coding region of the present invention may contain endogenous enhancers, splice junctions, intervening sequences, polyadenylation sequences, and the like. It may contain a denylation signal, etc.

[0074] Transcriptional control signals in eukaryotes include "enhancer" elements. - from an array of short DNA sequences that specifically interact with cellular proteins involved in transcription (Maniatis, T. et al., Science236:1237,198 7) Enhancer elements are found in plants, yeast, insect and mammalian cells, and viruses. Individual enhancers have been isolated from a variety of eukaryotic sources, including genes in the human genome. The choice of the source will depend on which cell type is used to express the protein of interest.

[0075] The presence of "splicing signals" in expression vectors allows for high levels of recombinant transcripts. Splicing signals often result in the expression of the target gene from the primary RNA transcript. It mediates the removal of the nucleotide and consists of a splice donor and an acceptor donor site (S ambrook, J. et al., Molecular Cloning: A Lab oratory Manual,2nded.,Cold Spring Harbor Laboratory Press, New York, pp.16.7-16.8, 1989). Commonly used splice donor and acceptor donor sites are SV It is a splice junction derived from 16S RNA of 40.

[0076] Efficient expression of recombinant DNA sequences in eukaryotic cells requires efficient termination and amplification of the resulting transcripts. It requires the expression of a signal that induces polyadenylation. It is found downstream of the adenylation signal and is several hundred nucleotides long. The term "poly A site" or "poly A sequence" refers to the site that terminates and polyadenylates the nascent RNA transcript. The DNA sequence shown here induces both transcription and transcription. Transcripts lacking a poly(A) tail are unstable and rapidly degrade. Efficient polyadenylation of recombinant transcripts is desirable because they are degraded. The polyA signal utilized in the present invention may be "heterologous" or "endogenous." A heterologous signal is a signal that is naturally found at the 3' end of the coding region of a given gene in the genome. A seed poly(A) signal is a signal isolated from one gene and placed at the 3' end of another gene. is.

[0077] As used herein, the terms "promoter," "promoter element," or "promoter" refer to The "motor sequence" is placed at the 5' end of the oligonucleotide sequence (i.e., located above When the oligonucleotide sequence is transcribed, it can control the transcription of the oligonucleotide sequence into mRNA. Typically, a promoter is an oligonucleotide that controls its transcription into mRNA. Located 5' (i.e., upstream) of a nucleotide sequence and specifically bound by RNA polymerase and provides the site for transcription initiation.

[0078] The term "promoter activity" when referring to a nucleic acid sequence refers to the ability of an oligonucleotide to be transduced into mRNA. It refers to the ability of a nucleic acid sequence to initiate transcription of a nucleic acid sequence.

[0079] The term "tissue-specific" when applied to a promoter refers to the expression of the same oligonucleotide in different tissues. Selection of oligonucleotide sequences for specific types of tissue in the relative absence of oligonucleotide expression. The tissue specificity of a promoter can be determined by, for example, For example, a reporter gene and a promoter sequence are operably linked to generate a reporter construct. The reporter construct is then integrated into each tissue of the resulting transgenic animals. A reporter construct is introduced into the genome of a plant or animal, and transgenic plants or The reporter gene is detected in different tissues of an animal (e.g., mRNA, transcription factor, etc.). (detecting the activity of a protein, or a protein encoded by a reporter gene) Selectivity does not have to be absolute. A higher level of reporter gene expression in one or more tissues is associated with a higher level of reporter gene expression. By detecting the expression of the promoter gene, the promoter was identified in tissues where higher levels of expression were detected. This indicates that the compound is specific.

[0080] The term "cell type specific" when applied to a promoter refers to the ability of a promoter to express the same gene in different types of cells within the same tissue. The expression of an oligonucleotide in a specific type of cell in the relative absence of expression of the same oligonucleotide sequence. The term "cell type specific" refers to a promoter capable of directing the selective expression of a nucleic acid sequence. "Differential," when applied to promoters, refers to the differentiation of oligonucleotides in a region within a tissue. It also refers to a promoter that is capable of promoting selective expression. Again, selectivity is not absolute. The cell type specificity of a promoter can be determined by methods well known in the art, e.g. For example, immunohistochemical staining methods described herein can be used to assess this. Specifically, tissue sections are embedded in paraffin and paraffin sections are then extracted to identify the genes whose expression is related to the promoter. specific for the polypeptide product encoded by the oligonucleotide sequence controlled by As an alternative to paraffin sections, samples can be cryosectioned. For example, sections can be frozen before and during sectioning to prevent damage caused by residual paraffin. This avoids potential interference. The secondary antibody (enzyme-conjugated) binds to the sectioned tissue (e.g., with avidin / biotin) and This allows for detection of specific binding by immunofluorescence and microscopy.

[0081] The terms "selective expression," "selectively expressed," and their grammatical equivalents are used in two places. For example, "selective expression" refers to a comparison of the relative levels of expression in the target region. When used in relation to tissues, the expression level of the same gene in different tissues and the Substantially higher expression levels of the gene of interest in specific tissues compared to the respective cell populations or refers to a substantially greater number of cells expressing the gene within that tissue (i.e., selectivity (Selective expression does not have to be absolute.) Selective expression refers to the expression of a gene of interest in a specific tissue and It does not require, but can include, the complete absence of expression of the same gene in another tissue. As used herein, "selective expression" when referring to a cell type refers to the selective expression of a gene in another cell type. expression level and the number of cells expressing it in a specific cell type, respectively. a substantially higher expression level of the gene of interest, or a substantially higher number of cells expressing it. Point.

[0082] The term "adjacent" when used in reference to two or more nucleotide sequences means one or is either in the absence of intervening sequences that do not contain multiple regulatory elements, or in the presence of intervening sequences that do not contain multiple regulatory elements. This means that the nucleotide sequences are linked in tandem.

[0083] As used herein, the terms "nucleic acid molecule code," "nucleotide code," "DNA sequence" "Code" and "DNA code" refer to the deoxyribonucleic acid sequences along a strand of deoxyribonucleic acid. The order of these deoxyribonucleotides determines the order or sequence of the nucleotides. The DNA sequence determines the order of amino acids along the peptide (protein) chain. Encodes an amino acid sequence.

[0084] The term "isolated" when used in reference to nucleic acids, such as "isolated oligonucleotides," refers to the origin of the nucleic acid. refers to a nucleic acid sequence that has been separated from at least one contaminant nucleic acid normally associated with the source of the nucleic acid. An isolated nucleic acid is a nucleic acid that exists in a form or setting different from that in which it is found in nature. Non-isolated nucleic acids include those found in the state they exist in nature, such as DNA and RNA. For example, a given DNA sequence (e.g., a gene) is expressed in a host cell culture medium near neighboring genes. RNA sequences, such as specific mRNA sequences that code for specific proteins, are found on chromosomes. , found in cells as a mixture with many other mRNAs that code for numerous proteins However, an isolated nucleic acid encoding a polypeptide of interest may be used, e.g., to identify the polypeptide of interest. nucleic acid in cells that normally express the gene, where the nucleic acid is a different dye than that of the cell of origin. Nucleic acid sequences that are present in an intrachromosomal or extrachromosomal location or that are otherwise different from those found in nature adjacent to the array. The isolated nucleic acid or oligonucleotide may be present in single-stranded or double-stranded form. The isolated nucleic acids can be purified (if desired) using various techniques (e.g., hybridization, dot blotting, etc.). This can be easily confirmed by the use of isolated nucleic acids or oligonucleotides. When using oligonucleotides to express proteins, the oligonucleotides can be either the sense strand or the coding strand. The oligonucleotide may contain at least one strand (i.e., the oligonucleotide may be single-stranded). Alternatively, the oligonucleotide may contain both a sense and an antisense strand (i.e., The oligonucleotide may be double-stranded).

[0085] As used herein, the term "purified" or "to purify" refers to the removal of one or more components from a sample. or removal of multiple (undesirable) components. For example, recombinant polynucleotides in bacterial host cells. When expressing peptides, host cell proteins are removed, thereby reducing the amount of protein in the sample. The polypeptide is purified by enriching the proportion of recombinant polypeptide.

[0086] As used herein, the term "substantially purified" refers to substances that have been removed from their native environment, or simply purified. isolated or separated and at least 60% free from other components with which they were originally associated, preferably or 75% free, and more preferably 90% free, of nucleic acid or amino acid sequences Thus, an "isolated polynucleotide" refers to a substantially purified polynucleotide. It is a nucleotide.

[0087] As used herein, the term "coding region" when used in reference to a structural gene Encodes the amino acids found in a nascent polypeptide as a result of translation of an mRNA molecule The coding region generally refers to the nucleotide sequence that encodes the initiator methyltransferase. The nucleotide triplet "ATG" coding for onion is at the 5' end, and the stop code The 3' end is bounded by one of three triplets (i.e., TAA, TAG, TGA) that specify the sequence. exists in.

[0088] A "coding sequence" refers to a sequence that is transcribed and / or translated into mRNA and / or polypeptides. a nucleic acid sequence or its complementary sequence that can generate a peptide or a fragment thereof; A coding sequence refers to a portion of a sequence in genomic DNA or in a premature primary RNA transcript. , which contain exons that are joined together by the cell's biochemical machinery to form mature mRNA. The sense strand is the complementary strand of such a nucleic acid, from which the coding sequence can be deduced. .

[0089] "Non-coding sequences" refer to sequences that are not transcribed into amino acids in vivo, or transcribed into nucleotides. The sequence of the nucleic acid where A does not interact to replace or attempt to replace an amino acid or its complementary sequence, or a portion thereof. Non-coding sequences include genomic DNA or The intron sequences in the premature primary RNA transcript and the promoter, enhancer, This includes both gene-associated sequences such as silencers.

[0090] As used herein, the term "structural gene" or "structural nucleotide sequence" refers to a gene that is a structural protein. It refers to a DNA sequence that encodes an RNA or protein that does not regulate the expression of offspring. A "regulatory gene" or "regulatory sequence" refers to a gene that produces a product (e.g., a transcription factor) that controls the expression of another gene. It is a structural gene that encodes a transcription factor.

[0091] As used herein, the term "control element" refers to a gene that controls some aspect of the expression of a nucleic acid sequence. For example, a promoter is a genetic element that regulates the expression of an operably linked coding region. It is a regulatory element that facilitates the initiation of transcription. Other regulatory elements include splicin These include transcription signals, polyadenylation signals, and termination signals.

[0092] As used herein, the term "peptide transcription factor binding site" or "transcription factor binding site" means , which bind to protein transcription factors and thereby regulate some aspects of the expression of nucleic acid sequences. Refers to nucleotide sequences, e.g., Sp-1 and AP1 (activator protein 1) ) binding sites are examples of peptide transcription factor binding sites.

[0093] As used herein, the term "gene" refers to a deoxyribonucleic acid sequence comprising the coding region of a structural gene. "Gene" means a sequence of a nucleotide that corresponds to the length of a full-length mRNA. It may also contain untranslated sequences located adjacent to the coding region at both the 5' and 3' ends, such as The sequences that are located 5' of the coding region and present on the mRNA are called 5' untranslated sequences. The sequence that is located 3' or downstream of the coding region and present on the mRNA is called the 3' untranslated sequence. The term "gene" encompasses both cDNA and genomic forms of a gene. A clone or gene contains non-coding regions called "introns" or "intervening regions" or "intervening sequences." It contains a coding region interrupted by introns. introns are segments of a gene that are transcribed sequentially, and introns contain regulatory elements such as enhancers. Introns can be removed or "spliced ​​out" from the nuclear or primary transcript. Introns are removed and therefore not present in the messenger RNA (mRNA) transcript. mRNA acts during translation to determine the sequence of amino acids in a nascent polypeptide. specifies the order.

[0094] In addition to containing introns, genomic genes also contain sequences present on the RNA transcript. These sequences may also include sequences located at both the 5' and 3' ends of the nucleic acid. These flanking sequences are referred to as untranslated sequences or regions (these flanking sequences correspond to the untranslated sequences present on the mRNA transcript). The 5' flanking region regulates or controls the transcription of the gene. The 3'-adjacent region may contain regulatory sequences such as promoters and enhancers that affect the transcription of the target gene. The junction region may contain sequences that direct the termination of transcription, post-transcriptional cleavage, and polyadenylation. .

[0095] "Non-human animal" refers to any animal that is not a human, such as a rodent, a non-human primate, Ovine, Bovine, Ruminant, Lagomorph, Pig, Caprine, Equine, Canine, Feline, Bird, etc. The preferred non-human animals are selected from the order Rodents. "Animals" include amphibians (e.g., Xenopus), reptiles, and insects (e.g., Drosophila melanogaster). refers to the genus Eriocheirus, and other non-mammalian species.

[0096] As used herein, the term "transgenic" refers to the somatic and / or genetic modification of a plant or animal. or from another organism, inserted integrated into the genome of either the germline or A "transgene" refers to an organism or cell that contains the DNA of a plant or Partially or completely heterologous (i.e., not naturally occurring) or endogenous sequences in the animal (i.e., sequences found naturally in animals) and are naturally occurring in plant or animal genomes It refers to a DNA sequence inserted at a different position from that of the existing sequence. Transgenic plants or animals containing the transgene are within the scope of the present invention. As used herein, "transgenic" refers to a gene that is produced by the method of the present invention through homologous recombination, TF One or more genes are modified and transformed by mutation or similar methods and / or "knocked out" (non-functional or low-level functional) For example, in some embodiments, the term "knockout" refers to an animal that has undergone a mutation. In some cases, transgenic organisms or cells may contain exogenous promoters and / or coding regions. Contains insert DNA containing

[0097] "Transformed cells" are those that have the ability to grow in cell culture for many generations, grow in soft agar, Cells that have acquired the ability to inhibit cell proliferation through cell-cell contact or Transformation in this context refers to the introduction of foreign genetic material into a cell or organism. Any well-known method that allows for the successful introduction of nucleic acids into cells, resulting in expression of the introduced nucleic acid. Transformation can be carried out by transfection, Microinjection, electroporation, nucleofection and lipofection These include, but are not limited to, methods such as transfection (liposome-mediated gene transfer) and Transformation can be carried out using any expression vector. For example, the use of baculoviruses to introduce foreign nucleic acids into insect cells is contemplated. "Transformation" also includes methods such as P-element mediated germline transformation of whole insects. Furthermore, transformed refers to cells that have been transformed naturally, usually by genetic mutation.

[0098] As used herein, "exogenous" refers to a protein whose encoding gene is normally expressed in the cell. Furthermore, "exogenous" means that the normal (i.e., native) levels of the gene are not present. It refers to a gene that is transfected into cells to enhance expression of a gene.

[0099] Peptide and nucleotide sequences may be "endogenous" or "heterologous" (i.e., foreign). The term "endogenous" does not include any modifications to the sequence in which it occurs in nature. The term "heterologous" refers to a sequence that is naturally found in the cell into which it is introduced. For example, heterologous DNA refers to sequences that are not native to the cell to which they are attached. or it is linked or engineered into a linked state with a nucleic acid sequence linked at a different position from the original. Heterologous DNA contains a nucleotide sequence that is not naturally found or naturally occurring in the cell into which it is introduced. It also includes nucleotide sequences that contain some modification of the existing sequence. Although it cannot be said that heterologous DNA contains heterologous RNA and and heterologous proteins. Examples of heterologous DNA include reporter genes, transcription and Translational control sequences, selectable marker proteins (e.g., proteins that confer drug resistance) Examples include DNA sequences that encode

[0100] construct The nucleic acid molecules disclosed herein (e.g., site-specific nucleases, or CRIS) The guide RNA of the PR can be used in the generation of recombinant nucleic acid constructs. In embodiments, the nucleic acid molecules of the present disclosure are incorporated into nucleic acid constructs, e.g., expression vectors for expression in a plant of interest. For example, the construct can be integrated into the host genome and used in the preparation of a set of not be under the control of a promoter when integrated When the construct is maintained in its location within the host genome, this expression may be transient. do.

[0101] The expression cassette may contain a site-specific nuclease or guide RNA as disclosed herein. The cassette may contain a control sequence operably linked to the sequence. The cassette is co-transformed into an organism. Alternatively, multiple expression cassettes may contain at least one additional gene. Gene(s) may be provided.

[0102] Multiple constraints for insertion of site-specific nuclease coding sequences under the transcriptional control of regulatory regions A nucleic acid construct can be provided that contains a selectable marker gene. The nucleic acid molecule encoding the gene may be contained separately.

[0103] Any promoter may be used in generating the nucleic acid construct. The nucleic acid sequences may be native or similar to the plant host nucleic acid sequences disclosed herein, or foreign or Furthermore, the promoter may be a natural sequence, or alternatively a synthetic sequence. If the promoter is "foreign" or "heterologous" to the plant host, the promoter may be It is believed that the chimeric gene is not found in the plant from which it is introduced. The vector comprises a coding sequence operably linked to a transcription initiation region that is heterologous to the coding sequence.

[0104] The site-specific nuclease sequences disclosed herein can be expressed using heterologous promoters. It is possible to express it.

[0105] Promoters that confer constitutive, tissue-preferred, or inducible expression in plants, or other promoters Any promoter, such as a promoter, can be used to control the expression of the site-specific nuclease sequence. Constitutive promoters can be used in the preparation of constructs for the The core promoter of the yn7 promoter and the promoters of WO99 / 43838 and U.S. Pat. Another constitutive promoter, the core CaMV35S promoter, disclosed in No. 72,050 - (Odell et al. Nature 313:810-812; 1985), rice Actin promoter (McElroy et al., Plant Cell 2:16 3-171, 1990), ubiquitin promoter (Christensen et al. l., Plant Mol. Biol. 12:619-632, 1989 and Chri stensen et al.,Plant Mol.Biol.18:675-689 , 1992), pEMU promoter (Last et al., Theor. Appl Genet. 81:581-588, 1991), MAS promoter (Velten et al., EMBOJ.3:2723-2730, 1984), ALS promoter (U.S. Patent No. 5,659,026). Other constitutive promoters include, for example, For example, U.S. Patent Nos. 5,608,149, 5,608,144, and 5,604,12 No. 1, No. 5,569,597, No. 5,466,785, No. 5,399,680 Nos. 5,268,463, 5,608,142 and 6,177,61 Including promoter No. 1.

[0106] Site-specific expression of nucleases in specific plant tissues using tissue-preferred promoters Such tissue-preferred promoters include leaf-preferred promoters. There are root-preferred promoters, seed-preferred promoters, and stem-preferred promoters. Tissue-preferential promoters include, but are not limited to, Yamamoto e t al.,Plant J.12(2):255-265,1997;Kawamat aet et al., Plant Cell Physiol.38(7):792- 803,1997;Hansen et al.,Mol.Gen Genet.254 (3):337-343,1997;Russell et al.,Transgen ic Res.6(2):157-168,1997;Rinehart et al. ,Plant Physiol.112(3):1331-1341,1996;Van Camp et al.,Plant Physiol.112(2):525-53 5,1996;Canevascini et al.,Plant Physiol. 112(2):513-524,1996;Yamamoto et al.,Plan t Cell Physiol.35(5):773-778,1994;Lam,Re sults Probl.Cell Differ.20:181-196,1994; Orozco et al. Plant Mol Biol. 23(6):1129-1 138,1993;Matsuoka et al.,Proc Nat'l.Acad .Sci.USA90(20):9586-9590,1993 and Guevara- Garcia et al., Plant J.4(3):495-505, 1993. There is a promoter.

[0107] The nucleic acid construct may also include a transcription termination region. If a transcription termination region is used, the optional termination region For example, the termination region may be obtained from another source (such as a In the constructs of the present disclosure, the promoter may be derived from a foreign or heterologous source. Examples of termination regions that can be utilized for the octopine synthase and nopaline synthase are A. tumefaciens T synthase termination region, It contains the termination region derived from the i-plasmid. Guerineau et al., Mol. G en.Genet.262:141-144,1991;Proudfoot,Cell 64:671-674,1991;Sanfacon et al., Genes De v.5:141-149,1991;Mogen et al.,Plant Cell 2:1261-1272,1990;Munroe et al.,Gene91:15 1-158, 1990; Ballas et al., Nucleic Acids R es.17:7891-7903, 1989; and Joshi et al., Nuc See also Leic Acids Res. 15:9627-9639, 1987.

[0108] With respect to any aspect, embodiment, method and / or composition disclosed herein: The nucleic acid can be optimized for enhanced expression in transformed plants. The nucleic acid encoding the specific nuclease protein is engineered to use plant-preferred codons for improved expression. For example, the Ca mpbell and Gowri,(Plant Physiol.92:1-11, 1990). Methods are available in the art for the synthesis of plant-preferred genes. For example, U.S. Patent No. 5,380,831 and U.S. Patent No. 5,436,391, and Murray et al., Nucleic Acids Res. 17:47 See 7-498,1989.

[0109] Additionally, other sequence modifications can be made to the nucleic acids disclosed herein. Other sequence modifications are known to enhance gene expression in the cellular host. polyadenylation signals, exon / intron splice site signals, transposon signals Sequences encoding nucleotide-like repeat units and other such sequences that may be deleterious to gene expression. The GC content of a sequence is determined by the circumferential expression of the sequence in the host cell. It may also be adjusted to the average level of the target cell host, calculated by reference to known genes. Additionally, the sequence can be modified to avoid predicted hairpin secondary mRNA structures. .

[0110] Other nucleic acid sequences may be used in preparing the constructs of the present disclosure, for example, to Such nucleic acid sequences may also enhance expression of the maize AdhI, Intron 1 of the gene (Callis et al., Genes and Development 1:1183-1200, 1987), and tobacco mosaic Virus (TMV), maize yellows virus and alfalfa mosaic virus There is a leader sequence (W-sequence) of cids Res.15:8693-8711,1987 and Skuzeski et al. al., Plant Mol. Biol. 15:65-79, 1990). Maize yield The first intron from the condensed type 1 locus controls the expression of the gene in the chimeric gene construct. It has been shown to enhance the solubility of hydroxybenzoates. No. 3,874 discloses the use of specific introns in gene expression constructs, llie et al.(Plant Physiol.106:929-939,19 94) also showed that introns are useful for regulating gene expression in a tissue-specific manner. To further enhance or optimize site-specific nuclease gene expression, The plant expression vectors disclosed herein contain matrix attachment regions (MARs). Therefore, the transformed vectors in such modified expression systems can also contain DNA sequences that The plant cells may exhibit overexpression or constitutive expression of the nucleotide sequences of the present disclosure. do.

[0111] The expression constructs disclosed herein are intended to deliver site-specific nuclease sequences to chloroplasts. Such nucleic acid sequences may also include nucleic acid sequences capable of inducing expression in plant cells. Contains a chloroplast targeting sequence that encodes a chloroplast transit peptide that directs the target gene product to the plastid. Such transit peptides are known in the art. "Operably linked" refers to a nucleic acid sequence encoding a transit peptide (i.e., a chloroplast targeting sequence). ) are contiguous and in the same reading frame as disclosed herein. For example, Von Heijne et al.,Plant Mol.Biol.Rep.9:104-1 26,1991;Clark et al.,J.Biol.Chem.264:175 44-17550,1989;Della-Cioppa et al.,Plant Physiol.84:965-968,1987;Romer et al.,Bio chem.Biophys.Res.Commun.196:1414-1421,19 93 and Shah et al., Science 233:478-481, 1986 See.

[0112] Chloroplast targeting sequences are well known in the art and include ribulose-1,5-bisphosphate capsaicin. Rubisco (de Castro Silva Filho e t al.,Plant Mol.Biol.30:769-780,1996;Sch nell et al., J. Biol. Chem. 266(5):3335-3342 , 1991), 5-(enolpyruvyl)shikimate-3-phosphate synthase (EPSPS )(Archer et al., J. Bioenerg. Biomemb. 22(6) :789-810,1990), tryptophan synthase (Zhao et al., J. Biol. Chem. 270(11):6081-6087, 1995), Plast cyanine (Lawrence et al., J. Biol. Chem. 272(33) :20357-20363,1997), chorismate synthase (Schmidt et al.,J.Biol.Chem.268(36):27447-27457,199 3), and light-absorbing chlorophyll a / b-binding protein (LHBP) (Lamppa et al., J. Biol. Chem. 263:14996-14999, 1988) Von Heijne et al., Plant M ol.Biol.Rep.9:104-126,1991;Clark et al., J.Biol.Chem.264:17544-17550,1989;Della-C ioppa et al.,Plant Ohysiol.84:965-968,19 87;Romer et al.,Biochem.Biophys.Res.Comm un.196:1414-1421, 1993 and Shah et al., Scie See also nce233:478-481,1986.

[0113] With respect to any aspect, embodiment, method and / or composition disclosed herein: A nucleic acid construct is prepared to contain a mutant site-specific nuclease-encoding sequence from plant cell chloroplasts. Expression of the sequence can be induced. Methods for transforming chloroplasts are known in the art. For example, Svab et al., Proc. Nat'l. Acad. Sci .USA87:8526-8530,1990;Svab and Maliga,Pr. oc.Nat'l.Acad.Sci.USA90:913-917,1993;Sva b and Maliga, EMBOJ. 12:601-606, 1993. The method involves particle gun delivery of DNA containing a selectable marker and homologous recombination. Furthermore, the nuclear code and the plastid genome are targeted to the plastid genome. Silent plastid-mediated transfer genes by tissue-preferential expression of a plastid-targeted RNA polymerase. Plastid transformation can be achieved by transactivation of genes. The system is described in McBride et al., Proc. Nat'l. Acad. Sci. USA 91:7301-7305, 1994.

[0114] Nucleic acids of interest targeted to chloroplasts are identified by the codon usage between the plant nucleus and this organelle. These differences can be taken into account and optimized for expression in chloroplasts. The nucleic acid of interest can be synthesized using preferred codons. See U.S. Patent No. 5,380,831, incorporated herein by reference.

[0115] The nucleic acid construct is used to transform plant cells and to produce a gene encoding a site-specific nuclease. Transgenic plants containing the desired trait can be regenerated. Recombinant vectors and methods are available. See, e.g., U.S. Pat. No. 6,753,458, A n,G.et al.,Plant Physiol.,81:301-305,198 6;Fry, J. et al., Plant Cell Rep.6:321-325, 1987;Block, M., Theor. Appl Genet. 76:767-77 4,1988;Hinchee et al.,Stadler.Genet.Symp .203212.203-212,1990;Cousins ​​et al.,Aust .J.Plant Physiol.18:481-494,1991;Chee,P. P.and Slightom,JL,Gene.118:255-260,199 2;Christou et al.,Trends.Biotechnol.10:2 39-246,1992;D'Halluin et al.,Bio / Technol .10:309-314,1992;Dhiret et al.,Plant Phy siol.99:81-88,1992;Casas et al.,Proc.Nat ’l.Acad.Sci.USA90:11212-11216,1993;Chris tou,P.,In Vitro Cell.Dev.Biol.-Plant29P: 119-124,1993;Davies,et al.,Plant Cell Re p.12:180-183,1993;Dong,J.A.and Mc Hughen ,A.,Plant Sci91:139-148,1993;Franklin,C. I.and Trieu,T.N.,Plant Physiol.102:167,1 993;Golovkin et al.,Plant Sci.90:41-52,1 993;Guo Chin Sci.Bull.38:2072-2078;Asano et al.,Plant Cell Rep.13,1994;Ayeres N. M.and Park,W.D.,Crit.Rev.Plant.Sci.13:21 9-239,1994;Barcelo et al.,Plant.J.5:583- 592,1994;Becker et al.,Plant.J.5:299-307 ,1994;Borkowska et al.,Acta.Physiol Plan t。16:225-230,1994;Christou,P.,Agro.Food. Ind.Hi Tech.5:17-27,1994;Eapen et al.,Pl ant Cell Rep.13:582-586,1994;Hartman et al.,Bio-Technology12:919923,1994;Ritala et al., Plant. Mol. Biol. 24:317-325, 1994 and Wan,YCand Lemaux,PG,Plant Physiol.10 4:3748, 1994. Using homologous recombination, the construct is transformed into plant cells. It is also possible to do so.

[0116] The term "wild-type" when referring to peptide and nucleotide sequences refers to sequences that are naturally occurring. peptides having peptide and nucleotide sequence characteristics when isolated from a source The term refers to the sequence of a gene or nucleotide (locus / gene / allele), respectively. The native peptide and nucleotide sequences are those most frequently observed in the population, Thus, the peptide sequence and nucleotide sequence are optionally in their "normal" or "wild-type" form, respectively. "Wild type" refers to a sequence at one or more specific nucleotide positions. sequence, or a sequence at one or more specific codon positions, or one or more specific It can also refer to the sequence in amino acid positions.

[0117] A "consensus sequence" is a sequence of at least 25% identical amino acids or nucleotides. amino acids or nucleotides containing functionally equivalent amino acids or nucleotides with respect to the sequence of A sequence of identical or functionally equivalent amino acids or nucleotides. The nodes do not need to be adjacent.

[0118] As used herein, the term "rapeseed" refers to plants of the genus Brassica. Exemplary Brassica Species These include B.carinata, B.elongate, e), B.fruticulosa, B.juensea ncea), B. napus, B. narinosa , B. nigra, B. oleracea, B. peri B. perviridis, B. rapa (synthetic beech pestris (synB.campestris), B.rupes tris), B. septiceps, and B. urnefo Examples include, but are not limited to, B. tournefortii.

[0119] The nucleobases are, in certain preferred embodiments, purines, pyrimidines, or derivatives thereof. Nucleosides are bases that are derivatives or analogs of nucleosides. Nucleosides contain a pentose furanosyl moiety. containing nucleobases, such as optionally substituted ribosides or 2'-deoxyribosides Nucleosides can be linked by one of several linking moieties, which are May or may not contain phosphorous. Bonded by unsubstituted phosphodiester bonds. Such nucleosides are called nucleotides. As used herein, the term "nucleobase" refers to Peptide nucleic acid bases, peptide nucleic acid subunits, and morpholine nucleobases, and Includes nucleosides and nucleotides.

[0120] An oligonucleobase is a polymer containing nucleobases, at least a portion of which has a complementary sequence. It is preferable that the nucleic acid be capable of hybridizing with the DNA having the amino acid sequence by Watson-Crick base pairing. The oligonucleobase chain preferably has a single-stranded 5'-end and 3'-end, which are the terminal nucleobases of the polymer. A particular oligonucleobase chain can contain all types of nucleobases. The nucleobase compounds are complementary and hybridize by Watson-Crick base pairing. A ribonucleotide is a compound containing one or more oligonucleobase chains that can be The 2' carbon is methylene substituted with hydroxy, alkyloxy, or halogen. Deoxyribonucleotides include ribonucleotides other than ribonucleotides. It is a nucleobase and includes all nucleobases that do not contain a pentose furanosyl moiety.

[0121] In certain embodiments, the oligonucleobase chain portion comprises an oligonucleobase chain and an oligonucleobase chain. The oligonucleobase chain portion may include both the 3'-end and the 5'-end segments or regions. and when the oligonucleobase strand portion is extended with a chain, the 3' end of the strand portion and 5' ends are also the 3' and 5' ends of the strand.

[0122] As used herein, the term "gene repair oligonucleobase" refers to a mixed double-stranded oligonucleobase. nucleotides, non-nucleotide-containing molecules, single-stranded oligodeoxynucleotides and other genes The oligonucleobase containing repair molecule is shown.

[0123] As used herein, the term "codon" refers to a pointer in a polypeptide chain during protein synthesis. The gene coding for the signal that determines whether to insert a specific amino acid or terminate protein synthesis. A sequence of three adjacent nucleotides (either RNA or DNA) that constitutes a code. The term "codon" refers to the triplet of nucleotides in the messenger RNA into which the original DNA is transcribed. It is also used to refer to the corresponding (and complementary) sequence of an octide.

[0124] As used herein, the term "homology" refers to sequence similarity between proteins and DNA. The term "homology" or "homologous" refers to a degree of identity. Partial or complete homology A partially homologous sequence has less than 100% sequence identity when compared to another sequence. It is a sequence with identity.

[0125] "Heterozygous" refers to a group of individuals with different loci at one or more loci on homologous chromosomal segments. As used herein, "heterozygous" refers to having one or more alleles. A sample, cell, cell population or organism in which different alleles at multiple loci are detectable Heterozygous samples can also be used to identify individuals who have been identified by techniques known in the art, such as nucleic acid sequencing. The sequence can also be determined by methods known in the art, for example, by sequencing electrophoresis. The profile shows two peaks at one locus, and the two peaks are approximately the same size. If one peak is If the peak is smaller than the other but at least about 25% the size of the larger peak, the sample is In some embodiments, the minor peak can be characterized as a heterozygote. In other embodiments, the minor peak is at least about 15% of the major peak. In other embodiments, the minor peak is at least about 10% of the major peak. In other embodiments, a minimal amount of small peaks are detected.

[0126] As used herein, "homozygous" refers to one or more mutations in homologous chromosomal segments. "Homozygous" refers to having identical alleles at one or more loci. Also refers to a sample, cell, cell population, or organism in which the same allele at a locus is detectable Homozygous samples can be analyzed by any method known in the art, such as by nucleic acid sequencing. For example, sequencing electropherograms can be used to determine the sequence of a sequence. If a particular locus shows one peak, the sample is "homozygous" for that locus. " can be called.

[0127] The term "hemizygous" refers to a cell or organism in which the second allele is deleted and therefore genetically distinct. As used herein, "gene" refers to a gene or gene segment that occurs only once in a given gene. A "hemizygosity" is an allele at one or more loci that is present only once in a genotype. It can also refer to a sample, cell, cell population or organism in which a gene is detectable.

[0128] As used herein, the term "zygosity" refers to the state in which a sample, cell population, or organism is zygotic. Heterozygous, homozygous, as determined by tests known in the art and described herein. The term "zygosity of a nucleic acid" refers to the state of a nucleic acid that is considered to be in a zygotic or hemizygous state. Means determining whether a source is considered heterozygous, homozygous, or hemizygous "Zygosity" can refer to a difference of one nucleotide in the sequence. Now, we will classify the zygosity of a sample for a single mutation as homozygous wild type, heterozygous (i.e. i.e., one wild-type allele and one mutant allele), homozygous mutant, or or hemizygous (i.e., one copy of either the wild-type or mutant allele) They can be classified as follows.

[0129] The term "RTDS" as used herein refers to The Ra pid Trait Development System™ (RTDS) RTDS allows precise modifications to gene sequences without the introduction of foreign genes or control sequences. It is a site-specific gene modification system that is effective when used in

[0130] As used herein, the term "about" refers to a quantity that is plus or minus 10%. For example, "about 3%" includes 2.7 to 3.3%, and "about 10%" includes 9 to 11%.

[0131] Repair oligonucleotides The present invention generally involves targeting modifications to specific locations in a genome or other nucleotide sequence. The present invention further relates to novel methods for improving the efficiency of targeting. The present invention further relates to target DNA that has been modified, mutated or revealed by the techniques described above. The present invention relates to cells, tissues, and organisms modified by the methods of the present invention. The Rapid Trait Development System Compositions related in part to RTDS™ (Cibus US LLC) and Based on the development of methods.

[0132] RTDS utilizes the cell's own gene repair system to repair foreign DNA and gene expression. Targeted gene expression by specifically modifying gene sequences in situ without inserting regulatory sequences. This procedure involves precise modification of gene sequences, while the genome The remaining part remains unchanged. In contrast to conventional transgenic GMOs, the foreign gene There is no genetic integration and no foreign genetic material remains in the plant. The gene sequence modifications introduced by the gene are not inserted randomly; the affected gene is The brain remains in place so that random, uncontrollable, or harmful patterns do not emerge.

[0133] The RTDS that influences this modification is involved in both DNA and modified RNA bases, as well as other chemicals. A chemically synthesized oligonucleotide that can be composed of chemical moieties and that targets a target gene location. It is designed to hybridize to form mismatched base pairs (multiple mismatches are possible). The mismatched base pair acts as a signal to target the cell's own natural gene repair system to that site. It acts to correct (substitution, insertion or deletion) the specified nucleotide(s) in the gene. After the forward process is completed, the RTDS molecule is degraded and the gene currently being modified or repaired is released. It is expressed under the gene's normal endogenous regulatory mechanisms.

[0134] The methods and compositions disclosed herein are directed to the conformational and chemical properties described in detail below. It is carried out or made using "gene repair oligonucleobases" (GRONs) with biological properties. As contemplated herein, a "gene repair oligonucleobase" can be a "recombinable oligonucleobase." "RNA / DNA chimeric oligonucleotides," "chimeric oligonucleotides," "Mixed double-stranded oligonucleotides" (MDONs), "RNADNA oligonucleotides" Nucleotide (RDO), Gene Targeting Oligonucleotide, Genoplast, Single-stranded modified oligonucleotide, "single-stranded oligodeoxynucleotide mutator "Single strand mutation vector" (SSOMV), "double strand mutation vector," and "heteroduplex mutation vector" It has also been described in published scientific journals and patent documents under other names, including "heterologous vectors." Gene repair oligonucleobases are delivered via microcarriers (biolistic delivery systems). Barry), microfiber, polyethylene glycol (PEG)-mediated uptake, Ele These include, but are not limited to, microporation, and microinjection. It can be introduced into plant cells using any method commonly used in the art, including can.

[0135] In one embodiment, the gene repair oligonucleobase comprises a 2'-hydroxyl and a fluoro, Mixed dimers can be obtained by substitution of chloro or bromo functional groups or by placement of substituents on the 2'-O. A mixed duplex in which the RNA-type nucleotides in the stranded oligonucleotides are RNase resistant Suitable substituents are those taught by Kmiec II. Other substituents include those described in U.S. Pat. No. 5,334,711 (Sproat). and patent publications EP629387 and EP679657 (Summary In particular, there are substituents taught by Martin Applications, are incorporated herein by reference. As used herein, the term "ribonucleotide" refers to a ribonucleotide that is 2'-fluoro, chloro or bromo derivatives or Martin Applicat ions or ribonucleotides with T-OH substituted with the substituents described in Sproat The nucleotide is referred to as a "T-substituted ribonucleotide." As used herein, the term "R "NA-type nucleotide" refers to a nucleotide having an unsubstituted phosphodiester bond or Km Mixed double-stranded oligonucleotides with arbitrary non-natural linkages taught by iecII refers to a T-hydroxyl or 2'-substituted nucleotide linked to another nucleotide of the As used herein, the term "deoxyribonucleotide" refers to an unsubstituted phosphodiester. Stereo bonds or any non-natural bonds taught by KmiecI or KmiecII T, which can bind to other nucleotides in the gene repair oligonucleotide base by binding It means a nucleotide having an -H.

[0136] In certain embodiments of the invention, the gene repair oligonucleobase is an unsubstituted phosphodiester The mixed double-stranded oligonucleotides (MDONs) are linked only by bonds. In embodiments, the linkages are substituted phosphodiesters, phosphodiester derivatives, and Kmiec In yet another embodiment, the bond is a non-phosphorous bond as taught by I. Each RNA-type nucleotide in the mixed double-stranded oligonucleotide is a 2'-substituted nucleotide Particularly preferred embodiments of 2'-substituted ribonucleotides are 2'-fluoro, T- Methoxy, 2'-propyloxy, 2'-allyloxy, 2'-hydroxyethyloxy 2'-Methoxyethyloxy, T-Fluoropropyloxy and 2'-Trifluorooxy The preferred 2'-substituted ribonucleotides are propyloxy-substituted ribonucleotides. Preferred embodiments include 2'-fluoro, 2'-methoxy, 2'-methoxyethyloxy, and and 2'-allyloxy substituted nucleotides. In another embodiment, the mixed double-stranded oligo The nucleotides are joined by unsubstituted phosphodiester bonds.

[0137] Mixed double-stranded oligonucleotides containing only type 1 2'-substituted RNA nucleotides Although (MDON) is more conveniently synthesized, the method of the present invention can be used to synthesize more than one type of RNA-type nucleoside. This can be done with mixed double-stranded oligonucleotides containing nucleotides. The function of the nucleotide is determined by the introduction of a deoxynucleotide between two RNA-type trinucleotides. These sequences are unlikely to be affected by interventions induced by RNA segments, hence the term RNA segmentation. The term "intervening RNA segments" encompasses terms such as "intervening RNA segments." In an alternative embodiment, the RNA segment is an engineered RNase resistant Mixed double-stranded oligonucleotides may contain both substituted and unsubstituted 2'-OH nucleotides. Preferably, the sequence is less than 100 nucleotides, and more preferably less than 85 nucleotides. The first strand portion and the second strand portion have fewer nucleotides than the first strand portion, but have more than 50 nucleotides. The moieties base pair according to Watson-Crick rules. The strands of the oligonucleotide are divided into a first strand and a second strand, each having one 3' end and one A single-stranded hexanucleotide is a segment of a single oligonucleotide strand with a 5' end. The 3' and 5' ends are covalently linked by a linker such as a penta- or tetranucleotide. The 3' end can be protected by the addition of a "hairpin cap" The 5'-terminal nucleotide is base-paired with the adjacent nucleotide according to the Watson-Crick rule. Further, a second hairpin cap is formed between the first strand portion and the second strand portion. -The base pairs at the 3' and 5' ends are located farther away from the base pairing site to ensure stable base pairing according to the Crick rule. It can be located at the junction between one strand portion and a second strand portion.

[0138] The first and second strand portions contain two regions that are homologous to two segments of the target gene. The homologous region is the nucleotide sequence of the RNA segment. containing one or more DNA-type nucleotides of the linked DNA segment may contain DNA-type nucleotides that are not present in the intervening DNA segment. The two homologous regions may differ in sequence from the target gene, called the "heterologous region." The heterologous regions are separated by regions with sequence and are adjacent to each other. The mismatched nucleotides may be adjacent. or alternatively, by one or two nucleotides that are homologous to the target gene. Alternatively, the heterologous region may be separated by an insert or 1, 2, 3 or 5 Alternatively, the sequence of the mixed double-stranded oligonucleotide may contain up to 10 nucleotides. is 1, 2, 3 or 5 or less nucleotides from a mixed double-stranded oligonucleotide Only the deletion of the target gene sequence may differ from the target gene sequence. The length and location of the heterologous region are , where no nucleotides of the mixed duplex oligonucleotide are present within the heterologous region, but the deletion The distance between the fragments of the target gene that are complementary to the two homologous regions is considered to be minutes long. is the same as the length of the heterologous region in which one or more substitutions are considered. If the homologous regions contain a sequence similar to that of the complementary homologous fragments in the gene, the homologous regions are further away from the complementary homologous fragments in the gene, resulting in a mixed double-stranded When the heterologous region encodes a deletion, the deletion is separated by a The opposite is true.

[0139] The RNA segments of the mixed double-stranded oligonucleotides each have a homologous region, i.e. These segments are preferred. or at least 13 RNA-type nucleotides, and preferably 16 to 25 RNA-type nucleotides nucleotides, or even more preferably 18 to 22 RNA-type nucleotides, or Most preferably, the homologous region contains a total of 20 nucleotides. The RNA segments are spaced apart and adjacent to, or "attached to," intervening DNA segments In one embodiment, each nucleotide of the heterologous region is a nucleotide of the intervening DNA segment. The intervening DNA segment contains a heterologous region of mixed double-stranded oligonucleotides. The segment is called a "mutator segment."

[0140] In another embodiment of the present invention, the gene repair oligonucleobase (GRON) is a single-stranded oligonucleotide. The SSOMV is a nucleotide mutator vector (SSOMV), which is International Patent Application PCT / USOO / 23457, which is incorporated herein by reference; U.S. Patent Nos. 6,271,360, 6,479,292, and 7,060, 500. The sequence of SSOMV is disclosed in U.S. Pat. No. 5,756,325, Same No. 5,871,984, Same No. 5,760,012, Same No. 5,888,983, Same No. No. 5,795,972, No. 5,780,296, No. 5,945,339, No. Nos. 6,004,804 and 6,010,907, and International Publication Nos. WO98 / 49350, WO99 / 07865, WO99 / 58723, WO99 / 58 702, and the mutator vector described in WO99 / 40789. The sequence of the SSOMV contains the desired genetic modification, called the mutator region. It contains two regions that are homologous to the target sequence, separated by a region that is homologous to the target sequence. -regions that are the same length as the sequences separating the homologous regions in the target sequence but have different sequences Such a mutator region may cause a substitution. Alternatively, homologous regions in SSOMVs may be adjacent to each other, while having the same sequence. The regions in the target gene that are separated by one, two or more nucleotides. SSOMV induces deletion of the SSOMV-absent nucleotide from the target gene. Finally, sequences in the target gene that are identical to the homologous regions are adjacent in the target gene, but They may be separated by one, two or more nucleotides in the SSOMV sequence. Such SSOMVs cause insertions in the sequence of the target gene.

[0141] The nucleotides of SSOMV are deoxyribonucleotides linked by unmodified phosphodiester bonds. ribonucleotides, but one 3'- and / or 5'-terminal nucleotide or alternatively, two 3'- and / or 5'-terminal internucleotide bonds Nucleotides as used herein may be phosphorothioates or phosphoramidates. The internucleotide bond is the bond between the nucleotides of the SSOMV, and is the bond between the 3'-terminal nucleotide or the 5'-terminal nucleotide. 'does not include the bond between the terminal nucleotide and the blocking substituent. The length of the SSOMV is 21–55 deoxynucleotides, and therefore the length of the homologous region is at least 20 deoxynucleotides in length and has at least two regions of homology Both should each be 8 deoxynucleotides in length.

[0142] SSOMV to be complementary to either the coding or non-coding strand of the target gene. When the desired mutation is a single base substitution, Preferably, both the nucleotide and the target nucleotide are pyrimidines. To the extent that results are consistent, the mutator nucleotide and the target nucleotide in the complementary strand are It is particularly preferred that both of the amino acids be pyrimidines. Each of the C and T nucleotides in the complementary strand encodes a natural mutation, i.e., a C or T nucleotide in the complementary strand. The mutator nucleotide is a mismatch, an SSOMV.

[0143] Improved efficiency The present invention provides a method for increasing the efficacy of target gene conversion using repair oligonucleotides. Several techniques for this purpose are described, which can be used alone or in combination with each other. These include: 1. Repair oligonucleotides that direct DNA repair mechanisms to the target (mismatch) site Introduction of modifications. A. Oligonucleotides (e.g., within 10 bases, and more preferably within the desired mismatch) Base excision repair (BE) is achieved by introducing one or more abasic sites at the base of the base excision site. R), which induces the BER mechanism to repair oligonucleotides. d Spacer (basic furan) modified oligonucleotides are directed to the vicinity of the target site. For example, Takeshita et al., J. Biol. Chem., 262: It can be prepared as described in J. Chem. Soc. 1987, 10171-79. B. Single stranded, either into or with an oligonucleotide or by the inclusion of compounds that induce double-strand breaks, non-homologous end joining (NHEJ), myelin Damage occurs that is repaired by chromosomal-mediated end joining (MMEJ) and homologous recombination. For example, bleomycin family antibiotics, zinc finger, FokI (or or any type IIS class restriction enzyme) and other nucleases to repair oligonucleotides. Covalently attach the repair oligonucleotide to the 3' or 5' end of the target gene to target the repair oligonucleotide. It is possible to introduce a double-strand break near the site of the bleomycin family of antibiotics. The substances are bleomycin, zeocin, phleomycin, tallysomycin, pepleomycin These are DNA-cleaving glycopeptides, including ribosomal glycopeptides and others. C. Oligonucleotides (e.g., within 10 bases, and more preferably within the desired mismatch) By introducing one or more 8' oxo dA or dG into the nucleotide sequence (5 bases at the nucleotide site), This causes damage similar to that produced by reactive oxygen species. For example, Kim et al., J. Biochem See Mol. Biol. 37:657-62, 2004. 2. Increased stability of repair oligonucleotides: Oligonucleotides for creating a 3' blocked end on the repair oligonucleotide Introduction of an inverted base (idC) at the 3' end of the nucleotide. Hybridization sequences at the 5' and / or 3' ends of the repair oligonucleotide One or more 2'O-methyl nucleotides or bases that increase the coupling energy Introduction (see, for example, WO2007 / 073149). Multiple 2'O-methyl RNA nucleotides at the 5' end of the repair oligonucleotide The introduction of a DNA base that provides the desired mismatch site results in Okazaki fragmentation. This produces a nucleotide-like nucleic acid structure. Conjugates (5' or 5') such as acridine, psoralen, ethidium bromide, and scybrinogen 3') Intercalating dye. T / A clamp, cholesterol component, SIMA(HEX), ribo C and amidite Introduction of a 5'-end cap such as Phosphothioate, 2'O-methyl, methylphosphonate, locked nucleic acid (LNA), backbone modifications such as (MOE) (methoxyethyl), diPS and peptide nucleic acid (PNA). Repair oligonucleotides, such as interstrand cross-linking reagents like cisplatin and mitomycin C, Cross-linking of nucleotides. Fluorescent dyes such as Cy3, DY547, Cy3.5, Cy3B, Cy5 and DY647 Combination with. 3. Repair oligonucleotides by incorporating bases that increase hybridization energy. Increasing the hybridization energy of oligonucleotides (e.g., WO2007 / 0 See 73149). 4. Nucleotide multimers (dimers, trimers, tetramers) as building blocks for synthesis Improved quality of repair oligonucleotide synthesis by using Fewer coupling steps and easier separation of the full-length product from its building blocks. Glass. 5. Long chain repair, preferably with two or more target mutations in the repair oligonucleotide Oligonucleotides (i.e., greater than 55 nucleotides in length, preferably 75-300 nucleotides in length, more preferably at least 100 nucleotides in length, even more preferably is at least 150 nucleotides in length, and most preferably at least 200 nucleotides Use of (length).

[0144] Examples of the above techniques are given in the table below.

[0145] [Table 1] JPEG0007814451000002.jpg236161JPEG0007814451000003.jpg136160

[0146] The aforementioned modifications include methylation, 5' intercalating dyes, modifications to the 5' and 3' ends, backbone modifications, cross-linking bridgers, cyclization, and "capping," and analogs such as inosine and one or more It may also include well-known nucleotide modifications, such as substitutions of naturally occurring nucleotides. Modifications of the peptides include acridine, amine, biotin, cascade blue, cholesterol, and C y3@, Cy5@, Cy5.5@, Davoil, Digoxigenin, Dinitrophenyl, Eda lance, 6-FAM, fluorescein, 3'-glyceryl, HEX, IRD-700, IR D-800, JOE, psoralen phosphate, rhodamine, ROX, thiol (SH), Spacer, TAMRA, TET, AMCA-S'', SE, BODIPY°, Marina Blue@, Pacific Blue@, Oregon Green@, Rhodamine Green@, Rhoda Contains the addition of Ming Red@, Rhodol Green@, and Texas Red@. The peptide backbone modifications include methylphosphonate, 2'-OMe methylphosphonate RNA, and phosphodiesterase. Base modifications include 2-amino-dA, 2'-OMeRNA, and 2'-amino-dA. , 2-aminopurine, 3'-(ddA), 3'dA (cordycepin), 7-deaza-dA , 8-Br-dA, 8-oxo-dA, N6-Me-dA, abasic site (d spacer) , biotin-dT, 2'-OMe-5Me-C, 2'-OMe-propynyl-C, 3'-( 5-Me-dC), 3'-(ddC), 5-Br-dC, 5-1-duc, 5-Me-d C, 5-F-dC, carboxy-dT, convertible dA, convertible dC, convertible dG, Convertible dT, convertible dU, 7-deaza-dG, 8-Br-dG, 8-oxo-dG, O 6-Me-dG, S6-DNP-dG, 4-methyl-indole, 5-nitroindole , 2'-OMe-inosine, 2'-dl, o6-phenyl-dl, 4-methyl-indo 2'-deoxynebularine, 5-nitroindole, 2-aminopurine, dP(purine (pyrimidine analog), dK (pyrimidine analog), 3-nitropyrrole, 2-thio-dT, 4 -Thio-dT, Biotin-dT, Carboxy-dT, O4-Me-dT, O4-Triazo 2'-OMe-propynyl-dT, 2'-OMe-propynyl-U, 5-Br-dU, 2'-dU, 5-Fd The term refers to peptide nucleic acids (PN A) A pseudopeptide whose backbone consists of N-(2-aminoethyl)-glycine units instead of sugars. PNAs also include DNA analogs that are peptides. PNAs mimic the behavior of DNA and bind to complementary nucleic acid strands. The neutral backbone of PNAs results in stronger binding and higher specificity than is typically obtained. In addition, powerful biomolecular tools, antisense and antigenic substances, molecular probes and bio The unique chemical, physical, and biological properties of PNAs are utilized to create nucleotide sensors. It is being done.

[0147] Oligonucleobases can include nicks, gaps, modified oligonucleotides may have backbones, modified nucleotides such as abasic nucleotides, or other chemical moieties. In a further embodiment, at least one strand of the oligonucleobase may comprise at least Another modified nucleotide, for example, 2'-O-methyl, such as MOE (methoxyethyl), modified nucleotides, nucleotides with 5'-phosphorothioate groups, cholesteryl Terminal nucleotides conjugated with derivatives, 2'-deoxy-2'-fluoro modified nucleotides , 2'-deoxy-modified nucleotides, locked nucleotides, abasic site nucleotides (The nucleobases are either missing or have hydroxyl groups instead) (e.g., Glen Research, http: / / www.glenresearch.co m / GlenReports / GR21-14.html), 2'-amino-modified Nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidite Various salts, mixed salts and free acid forms, including nucleotides containing unnatural bases and nucleotides containing unnatural bases. Also included.

[0148] Preferred modified oligonucleotide backbones include, for example, phosphorothioates, chiral phosphonates, Thioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters Esters, methyl and 3'-alkylene phosphonates, 5'-alkylene phosphonates and other alkyl phosphonates, including chiral phosphonates, phosphinates, 3'- Aminophosphoramidites and aminoalkylphosphoramidites, thionophosphoramidites phosphoramidites, including thionoalkylphosphonates, thionoalkylphosphotrimethylsilanes, esters, selenophosphates and boranophosphates with normal 3'-5' linkages, These 2'-5' linked analogs, as well as analogs of one or more nucleotides with inverted polarity, The interatomic bonds are 3'-3', 5'-5', or 2'-2'. Preferred oligonucleotides have one 3' most internucleotide linkage at the 3' most internucleotide linkage. -3' linkage, i.e., abasic (nucleobase is missing or instead It contains one inverted nucleoside residue (with a hydroxyl group at the base). A potential application is the addition of nucleotides to the termini of antisense oligonucleotides with phosphorothioate backbones. The addition of a 3'-3' bond. A 3'-3' bond consists of two 5'-OH ends and no 3'- By creating oligonucleotides with OH termini, exonuclease degradation can be prevented. The reverse bond further stabilizes the antisense oligonucleotide against By using "holamidites," it is possible to introduce These reagents contain a phosphoramidite group at the 5'-OH position and a 3'- The H position has a dimethoxytrityl (DMT) protecting group. Usually, the DMT protecting group is located at the 5'-O The hydroxyl group is present at the H position and the phosphoramidite group is present at the 3'-OH position.

[0149] Examples of modified bases include 2-aminopurine, 2'-amino-butyrylpyrene-uridine, 2 '-aminouridine, 2'-deoxyuridine, 2'-fluoro-cytidine, 2'-fluoro Uridine, 2,6-diaminopurine, 4-thiouridine, 5-bromouridine , 5-fluoro-cytidine, 5-fluorouridine, 5-indo-uridine, 5-methyl -cytidine, inosine, N3-methyl-uridine, 7-deaza-guanine, 8-aminohetero xyl-amino-adenine, 6-thio-guanine, 4-thio-thymine, 2-thio-thymine , 5-iodo-uridine, 5-iodo-cytidine, 8-bromo-guanine, 8-bromo- Adenine, 7-deaza-adenine, 7-diaza-guanine, 8-oxo-guanine, 5, 6-dihydro-uridine, and 5-hydroxymethyl-uridine, but these are not the only These synthetic units are commercially available (e.g., Glen Research). It can be incorporated into DNA by chemical synthesis.

[0150] Examples of sugar moiety modifications are 3'-deoxygenation, 2'-fluorogenation, and arabinosidation. These include, but should not be construed as being limited to, the following: Incorporation is also possible through chemical synthesis.

[0151] Examples of 5'-end modifications include 5'-amination, 5'-biotinylation, and 5'-fluoresceination. , 5'-tetrafluorofluoresceination, 5'-thiolation, and 5'-dabsylation However, it should not be construed as being limited to these.

[0152] Examples of 3'-terminal modifications include 3'-amination, 3'-biotinylation, 2,3-dideoxylation, 3'-thiolated, 3'-dabsylated, 3'-carboxylated, and 3'-cholesterolized However, this should not be construed as being limited to these.

[0153] In a preferred embodiment, the oligonucleobase is linked to the 5' terminal carbon via a linker. The chemical nature of the linker can determine its length. The length is not critical other than the length, which should preferably be at least 6 atoms long, and the linker The compound must be flexible. Biotin, cholesterol or other steroids A variety of non-toxic substituents, or non-intercalating cationic fluorescent dyes, can be used. Particularly preferred reagents for making oligonucleobases are available from Glen Research, Ste. Cy3™ and These reagents are sold under the trademark Cy5 and are suitable for attachment to oligonucleotides. By incorporation, 3,3,3',3'-tetramethyl N,N'-isopropyl substituted indo Blocking to generate monocarbocyanine and indodicarbocyanine dyes, respectively Phosphoramidites. Cy3 is particularly preferred. Indocarbocyanine is N-oxya When the oligonucleotide is alkyl substituted, it is converted to an oligonucleotide as a phosphodiester with a 5'-terminal phosphate. It can be conveniently attached to the 5' end of a co-deoxynucleotide. When the Cy3 phosphoramidite is used as directed, the resulting 5' modification is a blocking substitution. The group and linker are collectively N-hydroxypropyl, N'-phosphatidylinositol, The compound is 3,3,3',3'-tetramethylindomonocarbocyanine. Other dyes that can be used include rhodamine 6G, tetramethylrhodamine, and sulforhodamine 101. , Merocyanine 540, Atto 565, Atto 55026, Cy3.5, Dy 547 , Dy548, Dy549, Dy554, Dy555, Dy556, Dy560, mSt There are rawberry and mCherry.

[0154] In a preferred embodiment, the indocarbocyanine dye is Without being limited by theory, these substituents are what allow the dye to become an intercalating dye. The identity of the substituents at these positions is not critical.

[0155] The oligo designs described herein are directed to zinc finger nucleases, transcription factors, and transcription factors. ption Activator-Like Effector Nucleases( TALENs) or Clustered Regularly Interspaced d Partial division by Short Palindromic Repeats (CRISPRs) Other methods, including but not limited to gene targeting using site-specific homologous recombination, include: In combination with DNA editing or recombinant techniques, they may also be useful as more efficient donor templates. do.

[0156] The present invention generally relates to the efficient modification of genomic cellular DNA and / or the efficient modification of genomic cellular DNA. Without being limited to any particular application, the methods of the present invention relate to methods for recombining DNA into , for example, when introducing a modification into the genome of a cell for the purpose of determining the effect of the modification on the cell. For example, modifications can be introduced into a nucleotide sequence encoding an enzyme, such that the modifications enhance the activity of the enzyme. to determine whether the enzyme activity of the enzyme is altered and / or to determine the location of the catalytic domain of the enzyme. Alternatively, modifications can be introduced into the coding sequence of the DNA-binding protein to enhance the transcriptional activity of the protein. It can be determined whether the DNA binding activity of the protein is altered, and therefore whether the protein A further alternative is to trace specific DNA binding regions within the non-coding regulatory sequences ( For example, modifications are introduced into promoters, enhancers, and regulatory RNA sequences (miRNAs, etc.). and modifying the expression level of a second sequence operably linked to a non-coding regulatory sequence. This is desirable, for example, to define specific sequences that have regulatory activity. There is a good chance.

[0157] One strategy for effecting targeted gene disruption is via site-specific endonuclease-induced disruption of the target gene. This is due to the generation of single- or double-stranded DNA breaks caused by endonucleases. The study explores more conventional gene targets, such as those in algae, plants, and large animal models, including humans. It is most often used to disrupt targeted genes in organisms traditionally not susceptible to the effects of chemotherapeutic methods. For example, zinc finger nucleases for treating and preventing HIV infection. There are currently ongoing human clinical trials. Furthermore, endonuclease engineering has been shown to It is currently used in attempts to disrupt genes that result in undesirable phenotypes.

[0158] Homing endonucleases, also known as meganucleases, are those large Due to the cleavage site (e.g., greater than 14 bp), the double stranded fragments are highly specific in genomic DNA. These are sequence-specific endonucleases that generate strand breaks. Specificity of taming endonucleases enables precise targeting of induced DNA cleavage However, the cleavage sites of homing endonucleases are rare and do not naturally occur in target genes. The probability of finding an existing cleavage site is low.

[0159] One class of artificial endonucleases is the zinc finger endonucleases. Link finger endonucleases contain a nonspecific cleavage domain, typically the FokI domain. Zincfin engineered to bind to specific DNA sequences with a domain of nuclease Combining gar protein domains: Modular construction of zinc finger endonucleases Their structure makes them versatile platforms for generating site-specific double-strand breaks in the genome. One limitation of zinc finger endonucleases is their low specificity for the target site. Alternatively, the presence of multiple target sites in the genome may result in off-target cleavage events. The FokI endonuclease cleaves as a dimer, so it is difficult to cleave off-target sequences. One strategy to prevent cleavage events is to use zinc finger metalloproteinases that bind at adjacent 9 base pair sites. The design of the inn.

[0160] TALENs are targets used to induce single- and double-strand breaks at specific DNA sites. cleavable nucleases, which can then be used to create sequence changes at the cleavage site. Repair is performed by a mechanism.

[0161] The basic building blocks used to engineer the DNA binding domains of TALENs are xanthomonas Highly conserved naturally occurring TALEs encoded by Proteobacteria species DNA binding by TALENs occurs between the amino terminus of the repeat unit and the A highly conserved 33-35 amino acid sequence flanked at the carboxy terminus by another TALE-derived domain. It is mediated by an array of amino acid repeat units.

[0162] These TALE repeat units bind specifically to single bases of DNA, and their identity is determined by the repeat unit. Two hypervariable residues are typically found at positions 12 and 13 of the desired target nucleic acid. The number of repeat units in the corresponding array, the number of repeat units selected to match the target nucleic acid sequence, To maximize target site selectivity, the target nucleic acid should be 15-20 nucleotides in length. Cleavage of the target nucleic acid typically occurs within 50 base pairs of TALEN binding. Computer programs for TALEN recognition site design are described in the art. See, for example, Cermak et al., Nucleic Acids R See es.2011 July;39(12):e82.

[0163] Once designed to match the desired target sequence, TALENs are recombinantly expressed and exogenously expressed. It is introduced into protoplasts as a native protein or from a plasmid within the protoplast. It is possible to express it.

[0164] Another class of artificial endonucleases is the engineered meganucleases. Homing endonucleases can modify the specificity of existing homing endonucleases. In one method, the amino acid sequence of the naturally occurring homing endonuclease is Mutations are introduced into the sequence, and the resulting engineered homing endonucleases are then screened. Alternatively, chimeric proteins can be synthesized by cleaving the target binding site. The homing endonucleases were then fused to the recognition sites of two different homing endonucleases. A novel recognition site consisting of half sites of each homing endonuclease. The manipulation is performed by creating a position.

[0165] Other DNA modifying molecules can be used in targeted gene recombination. The nucleic acid can be used to induce modifications to the genome of one or more target cells. (See, for example, U.S. Pat. No. 5,929,299 to Ecker, which is incorporated herein by reference.) (See, e.g., 986,053). Briefly, a synthetic method comprising at least a partial peptide backbone is Nucleotides are used to target homologous genomic nucleotide sequences. Double-stranded DNA or via mutagenic chemicals linked to peptide nucleic acids. A sequence modification and / or recombination occurs. Target specificity is determined by the target sequence and the It is determined by the degree of sequence homology between the genome sequences.

[0166] Furthermore, the present invention is not limited to the specific methods used herein to perform modifications of genomic sequences. Indeed, several methods are contemplated. For example, triple helix-forming oligonucleotides TFOs can be synthesized synthetically, e.g., For example, it can be produced by PCR or by use of a gene synthesizer. TFOs can be isolated from genomic DNA if the appropriate native sequence is found. Mutagenic chemicals such as, but not limited to, psoralens or chlorambucil TFOs can be used in several ways, including the combination of re et al., Proc Nat'l Acad Sci, USA90:7 879-7883,1993;Havre et al., J Virol67:732 3-7331,1993;Wang et al.,Mol Cell Biol 15 :1759-1768,1995;Takasugi et al.,Proc Nat 'l Acad Sci,USA88:5602-5606,1991;Belo usov et al., Nucleic Acids Res 25:3440-344 4, 1997). Furthermore, for example, TFOs can be bound to donor double-stranded DNA. It is possible (e.g., Chan et al., J Biol Chem 272:115 41-11548, 1999). TFO is sufficient to induce error-prone repair. It can also act by binding with affinity (Wang et al., Science nce271:802-805,1996).

[0167] The methods of the present invention are not limited by the nature or type of DNA repair reagent used. Such DNA repair agents release radicals, which result in DNA strand breaks. Alternatively, the agent may alkylate DNA to form adducts that can block replication and transcription. In another alternative, the reagent creates crosslinks or molecules that inhibit cellular enzymes, causing strand scission. Examples of DNA repair reagents that bind to oligonucleotides to form TFOs include carbazole, naphthalenediimide (NDI), transplatin, bleomycin, Cyclopropapyrrolic indole analogs and phenanthrodihydrodioxins In particular, indolocarbazoles are topoisomerase I inhibitors. Inhibition of these enzymes leads to strand breaks and DNA-protein adduct formation. [Arimondo et al.,Bioorganic and Medicine al Chem. 8, 777, 2000]. NDI is a photocatalytic molecule that can oxidize guanine. It is an oxidizing agent, which can cause mutations at the site of guanine residues [Nun ez, et al., Biochemistry, 39, 6190, 2000]. TFO It was shown that transplatin reacts with DNA in triple-stranded targets when combined with the reagent. This reaction leads to the formation of DNA adducts that are mutagenic [Col umbier,et al.,Nucleic Acids Research,24: 4519, 1996]. Bleomycin is a widely used radiomimetic drug. A cleavage agent. It binds to the oligonucleotide and in that form is active as a cleavage agent. It has been shown that there is [Sergeyev, Nucleic Acids Research arch23,4400,1995;Kane,et al.,Biochemistr. y,34,16715,1995]. The cyclopropapyrrolic indole analogue is TF It has been shown to bind to O and alkylate DNA in triple-stranded target sequences. Therefore, alkylated DNA contains chemical adducts that are mutagenic [Lukhtan ov,et al.,Nucleic Acids Research,25,5077 , 1997]. Phenanthodihydrodioxin releases radical species upon photoactivation. They are shielded quinones that bind to TFOs and induce breaks in double-stranded DNA upon photoactivation. It has been shown that the te Chem.9,555,1998].

[0168] Other methods of inducing modification and / or recombination are contemplated by the present invention. This embodiment provides an affinity between a foreign DNA fragment and a target gene or to a target site. Induction of homologous recombination by the use of peptide nucleic acids (PNAs) with apecchi et al.,Science244:1288-1292,1989 Yet another approach involves sequence-specific DNA recognition and targeting by polyamides (e.g., For example, Dervan et al., Curr Opin Chem Biol 3:68 8-693,1999;Biochemistry38:2143-2151,1999 ), and nucleases with site-specific activity (e.g., zinc finger proteins). These include the use of proteins, TALENs, meganucleases and / or CRISPRs.

[0169] The present invention is not limited to any particular modification and / or recombination frequency. , resulting in a modification frequency of 0.2% to 3% in the target nucleotide sequence. Any (i.e., between 0% and 100%) modification and / or recombination frequency is within the scope of the present invention. The modification and / or recombination frequency is intended to be within the range of The method used to induce the gene, the cell type used, the specific target gene, and if present, In addition, the mutations and / or recombinations detected depend on the DNA mutagenesis reagent used. The method used to extract all modifications and / or compositions may be compromised due to limitations in detection methods. Furthermore, some modification and / or recombination events cannot be detected. are silent and give no detectable indication that modification and / or recombination has occurred The inability to detect silent modifications and / or recombination events may be due to the lack of modifications and For these and other reasons, Therefore, the present invention is not limited to any particular modification and / or recombination frequency. In another embodiment, the modification and / or recombination frequency is between 0.01% and 100%. In yet another embodiment, the modification and / or recombination frequency is between 0.01% and 50%. In other studies, the modification and / or recombination frequency is between 0.1% and 10%. In embodiments, the modification and / or recombination frequency is between 0.1% and 5%.

[0170] As used herein, the term "mutation frequency" refers to the frequency of mutations at a target site in the genome of a cell. When referring to a population of cells treated with a DNA modifying molecule capable of introducing DNA in the treated population containing a mutation at the target site compared to the total number of cells treated with the modified molecule For example, the number of cells that have been infected with a gene that is designed to introduce a mutation at a target site in the genome of a cell. For the population of cells treated with the psoralen-binding DNA-modifying molecule TFO, 5% mutations were observed. The frequency of TFO-psoralen-treated cells was 5 out of 100 cells treated with TFO-psoralen. It means that it contains a mutation.

[0171] The present invention is not limited to any precision modification and / or recombination of DNA in cells, It is contemplated that some embodiments of may require greater precision depending on the desired results. For example, specific sequence changes (e.g., specific base changes) that require gene repair can be identified by This requires higher precision compared to the generation of gene knockouts, which only require disruption of the Using the methods of the present invention, higher levels of modification and / or or the accuracy of homologous recombination techniques.

[0172] Delivery of gene repair oligonucleobases into plant cells Any commonly known method used to transform plant cells can be used to prepare gene repair oligonucleotides. Exemplary methods can be used to deliver nucleic acid bases. Many methods are contemplated for transfecting cells with one or more DNA modifying reagents. Indeed, the present invention is not limited to any particular method. Methods for introducing decorative reagents are well known in the art and include microinjection. DNA coprecipitation, electroporation, passive adsorption, calcium phosphate-DNA coprecipitation, DEAE Dextran-mediated transfection, polybrene-mediated transfection, liposomes fusion, lipofection, nucleofection, protoplast fusion, retrovirus infection, biolistics (i.e., particle bombardment), etc. includes, but is not limited to:

[0173] To introduce large fragments of DNA into plant cells with cellulose cell walls by projection infiltration The use of metallic microcarriers (microspheres) is well known to those skilled in the art ( (hereinafter referred to as biolistic delivery). U.S. Patent Nos. 4,945,050 and 5,100,777 Nos. 92 and 5,204,253 are directed to microcarriers and devices for such projection. Here are some general techniques for chair selection.

[0174] Specific conditions for using microcarriers in the method of the present invention are set forth in International Publication WO 99 / 0999. In one exemplary technique, ice-cold microcarriers (60 mg / mL), mixed double-stranded oligonucleotide (60 mg / mL), 2.5 M CaCl and 0.1 M spermidine are added in this order, and the mixture is gently stirred and stirred for, e.g., 10 minutes. The microcarriers were then stirred and left at room temperature for 10 minutes, at which point the microcarriers were soaked in 5 volumes of ethanol. Dilute to 100%, centrifuge, and resuspend in 100% ethanol. / μL, mixed double-stranded oligonucleotide 14-17μg / mL, CaCl2 1.1-1 Good results were obtained with concentrations of 0.4M and spermidine 18-22mM in the adhesion solution. Microcarriers 8μg / μL, mixed double-stranded oligonucleotides 16.5μg / mL Optimal results were observed under conditions of 1.3M CaCl2 and 21 mM spermidine.

[0175] The present invention is carried out using microfibers to penetrate cell walls and membranes. Therefore, gene repair oligonucleobases can also be introduced into plant cells. U.S. Patent No. 5,302,523 to et al. discloses the Black Mexican Sweet Potato The use of silicon carbide fibers to facilitate the transformation of suspension cultures of L. locomotiveii is described. It can be used to introduce DNA for the transformation of plant cells using black fibers. Gene repair oligonucleotides for transmutation using any mechanical technique that can The group can be delivered.

[0176] An exemplary technique for microfiber delivery of gene repair oligonucleobases is as follows: Sterile microfibers (2 μg) were immersed in approximately 10 μg of mixed double-stranded oligonucleotides. The suspension culture was then suspended in 150 μL of plant culture medium containing leucine. The volume of packed cells and sterile fiber / nucleotide suspension was mixed for 10 minutes and plated. Depending on the individual trait, the selective medium may be applied immediately or delayed for up to approximately 120 hours. Use.

[0177] In an alternative embodiment, electroporation of protoplasts derived from plant parts By using this method, gene repair oligonucleobases can be delivered to plant cells. According to the technique described, protoplasts are formed by enzymatic treatment of plant parts, particularly leaves. For example, Gallois et al, 1996, in Methods in Mol ecular Biology55:89-107,Humana Press,Tot owa, NJ; Kipp et al., 1999, in Methods in Molecular Biology133:213-221, Humana Pres. See Eppendorf, Totowa, NJ. Prior to electroporation, protoplasts were grown in growth medium. It is not necessary to culture in the ground. Exemplary conditions for electroporation are 3 times, 0 10 suspensions, 5 protoplasts, and 0.6–4 μg / m in a total volume of 0.3 mL L is the gene repair oligonucleobase concentration.

[0178] In an alternative embodiment, the membrane modifier polyethylene glycol is prepared according to techniques well known to those skilled in the art. In another alternative embodiment, the nucleic acid is taken up by plant protoplasts in the presence of methyltransferase. by injecting it into plant cells or protoplasts using a black capillary. Gene repair oligonucleobases can be delivered.

[0179] In an alternative embodiment, the nucleic acid is embedded in microbeads composed of calcium alginate. and then taken up by plant protoplasts in the presence of the membrane modifier polyethylene glycol ( See, e.g., Sone et al., 2002, Liu et al., 2004) .

[0180] In an alternative embodiment, the nucleic acid is solidified in water and then bombarded in the form of microparticles. and introducing the vector into plant cells (see, e.g., Gilmore, 1991, U.S. Patent No. 5,219,777). No. 46; see Brinegar et al.).

[0181] In an alternative embodiment, the nucleic acid bound to the nanoparticles is transferred to cells in a suspension containing the nanoparticles. by incubation (e.g., Pasupathy et al., 2008 (see ), or by delivering them into intact cells via particle bombardment. or by co-incubation with protoplasts (e.g. See, for example, Torney et al., 2007), and then introduced into whole plant cells.

[0182] In an alternative embodiment, the nucleic acid is complexed with a penetrating peptide and co-incubated Delivery to cells (e.g., Chugh et al., 2008, WO20081482 23 A1; see Eudes and Chugh).

[0183] In an alternative embodiment, nucleic acids are introduced into whole cells via electroporation (e.g., He et al.,1998,US2003 / 0115641Al,Dobres et al.).

[0184] In an alternative embodiment, nucleic acids are added to the cells of the dried embryo by immersing them in a solution containing nucleic acids. (e.g., Topfer et al., 1989, Senaratna e t al., 1991).

[0185] Plant selection In various embodiments, the plants disclosed herein grow as trees or shrubs. Any woody plant species, any herbaceous plant species, or any plant species that grows to produce edible fruit, seeds, or vegetables. any species that produces flowers of a colored or fragrant variety, The plants may be dicotyledonous, monocotyledonous or gymnosperm species. For example, the plants may be Unless specifically mentioned, canola, sunflower, corn, tobacco, sugar beet, wheat ta, maize, wheat, barley, rice, alfalfa, barley, sorghum, tomato, Mango, peach, apple, pear, strawberry, banana, melon, potato, carrot, lettuce onion, soybean, soybean seeds, sugarcane, legumes, chickpea, field pea -, legumes, lentils, turnips, swedes, Brussels sprouts, lupins, californians Lavender, kale, pea, poplar, pine, eucalyptus, grape, citrus, Wheat, alfalfa, rye, oats, grass and fodder, flax, rapeseed, mustard Na, cucumber, morning glory, balsam, pepper, eggplant, marigold, lotus, cabbage vines, daisies, carnations, tulips, irises, lilies, and nut-bearing plants The plant species may be selected from the group consisting of:

[0186] Plants and plant cells can be cultured using methods commonly known in the art, e.g., by decontamination. Plants or plant cells were grown in the presence of herbicides and compared to growth rates in the absence of herbicides. Testing for resistance or tolerance to herbicides by measuring growth rate This can be done.

[0187] As used herein, substantially normal growth of a plant, plant organ, plant tissue or plant cell. The corresponding plant, plant organ, plant tissue, or plant expressing wild-type AHAS protein is At least 35%, at least 50%, or at least at least 60%, or at least 75% of a plant, plant organ, plant tissue, or plant It is defined as the rate of cell growth or cell division.

[0188] As used herein, substantially normal development of a plant, plant organ, plant tissue or plant cell in the corresponding plant, plant organ, plant tissue, or plant cell expressing the wild-type protein. one or more events occurring in a plant, plant organ, plant tissue or plant cell that are substantially the same as those occurring in a plant, plant organ, plant tissue or plant cell is defined as the occurrence of multiple occurrence events.

[0189] In certain embodiments, the plant organs provided herein include leaves, stems, roots, shoots, flower buds, and the like. , meristem, embryo, cotyledon, endosperm, sepals, petals, pistil, carpel, stamen, anther, microspore, Pollen, pollen tubes, ovules, ovaries and fruits, or sections, slices or plates obtained therefrom Plant tissues include, but are not limited to, callus tissue, underground tissue, vascular tissue, Storage tissue, meristem, leaf tissue, shoot tissue, root tissue, gall tissue, plant tumor tissue, and living tissue Plant cells include, but are not limited to, isolated cells with cell walls, These include, but are not limited to, aggregates of various sizes and protoplasts. do not have.

[0190] The herbicide is applied to the plants and the curve given by a similar non-tolerant plant treated in the same way is compared. When comparing the dose / response curves, which are shifted to the right, the plants are effectively "tolerant" to the relevant herbicide. Such a dose / response curve would have "dose" plotted on the X-axis and "dose" on the Y-axis. With plotted "kill rate," "herbicide efficacy," etc. Tolerant plants are more susceptible to a given herbicide's efficacy. They may require larger amounts of herbicide to produce fruit than similar non-tolerant plants. Plants that are "resistant" are typically used in areas where pesticides are sprayed to kill field weeds. When herbicides are applied at the concentrations and rates used, little, if any, necrosis, dissolution, or yellowing occurs. or other damage. Plants that are resistant to herbicides are also herbicide tolerant.

[0191] Plant creation Tissue culture of various tissues of plant species and the regeneration of plants therefrom is known. , Propagation of canola varieties by tissue culture is either: Chuong et al. .,“A Simple Culture Methods for Brassica hypocotyls Protoplasts,”Plant Cell Repo rts4:4-6,1985;Barsby,TLet al., “A Rapid and Efficient Alternative Procedure for the Regeneration of Plants from Hypocot yl Protoplasts of Brassica napus,”Plant Cell Reports (Spring, 1996); Kartha, K., et a l., “In vitro Plant Formation from Stem E xplants of Rape, “Physiol.Plant,31:217-22 0,1974;Narasimhulu, S., et al., “Species Sp ecific Shoot Regeneration Response of Co tyledonary Explants of Brassicas,”Plant Cell Reports (Spring 1988); Swanson, E., “Mic rospore Culture in Brassica,”Methods in Molecular Biology,Vol.6,Chapter17,p.159, 1990, but is not limited to any of these.

[0192] Further propagation of varieties can be achieved by tissue culture and regeneration. Tissue culture of tissues and the regeneration of plants therefrom is well known and widely published. For example, Komatsuda, T. et al., “Genotype se Interactions for Somatic Embryogenesi s in Soybean”,Crop Sci.31:333-337,1991;S tephens, PA, et al., “Agronomic Evaluatio n of Tissue-Culture-Derived Soybean Plan ts”,Theor.Appl.Genet.82:633-635,1991;Kom atsuda, T. et al., “Maturity and Germinat” ion of Somatic Embryos as Affected by Su Close and Plant Growth Regulators in Soy beans Glycine gracilis Skvortz and Glyci ne max(L.)Merr.”Plant Cell,Tissue and Or gan Culture,28:103-113,1992;Dhir,S.et al .,"Regeneration of Fertile Plants from P rotoplasts of Soybean(Glycine max L.Merr .);Genotypic Differences in Culture Resp onse”, Plant Cell Reports11:285-289,1992; Pandey, P. et al., “Plant Regeneration from Leaf and Hypocotyl Explants of Glycine wightii(W.and A.)VERDC.var.longicauda”,J apan J.Breed.42:1-5,1992;and Shetty,K.,e t al., “Stimulation of In Vitro Shoot Org anogenesis in Glycine max(Merrill.)by Al lantoin and Amides”, Plant Science 81:245- 251, 1992. Coll., published June 18, 1991. U.S. Patent No. 5,024,944 to Ins et al. and issued April 16, 1991 The disclosure of issued U.S. Patent No. 5,008,200 to Ranch et al. is hereby incorporated by reference. and the like, all of which are incorporated herein by reference in their entireties. [Example]

[0193] GRON length Sommer et al.,(Mol Biotechnol.33:115-22 , 2006) used a single nucleotide change to detect the chromatin in a green fluorescent protein (GFP) mutant. A reporter gene for detecting in vivo gene conversion, which converts blue and green fluorescence in vivo. This reporter system is described. GRON conversion after GRON length modification using Arabidopsis thaliana The efficiency of the ATP was evaluated and adapted for use in the following experiments.

[0194] In summary, for this and subsequent examples, multiple copies of the blue fluorescent protein gene were obtained. Pea-carrying Arabidopsis lines were generated by methods known to those skilled in the art (e.g., (See Clough and Brent, 1998). Root-derived meristem cultures were used in this study. The strains were established and used for protoplast isolation and culture (see, e.g., Mathur (See also et al., 1995). GRON delivery to protoplasts was This was achieved by polyethylene glycol (PEG)-mediated GRON incorporation into the Fu Similar to the method described by Jiwara and Kato (2007), A method using a well format was used. The protocol is briefly described below. The volumes given are those applied to individual wells of a 96-well dish.

[0195] 1. 5 x 10 in each well of a 96-well plate 6 6.25 μl of cells / ml GRON (80 μM) and 25 μl of Arabidopsis BFP transgenic root meristems Mix the tissue-derived protoplasts.

[0196] 2.31.25 μl of 40% PEG solution was added and the protoplasts were mixed.

[0197] 3. The treated cells were incubated on ice for 30 minutes.

[0198] 4. 200 μl of W5 solution was added to each well and the cells were mixed.

[0199] 5. Incubate the plate on ice for 30 minutes to deposit the protoplasts at the bottom of each well. Allowed to precipitate.

[0200] 6. 200 μl of medium above the precipitated protoplasts was removed.

[0201] Add 7.85 μl of culture medium (MSAP, Mathur et al., 1995). Ta.

[0202] 8. The plates were incubated for 48 hours in the dark at room temperature. The final concentration of RON is 8 μM.

[0203] At 48 hours after GRON delivery, samples were analyzed by flow cytometry to determine the green The protoplasts whose color and yellow fluorescence were different from those of the control protoplasts were detected (BF P0 indicates untargeted GRON with no change compared to the BFP target, and C is the coding strand design. , NC is the non-coding strand designation). One nucleotide C → T in the center of the BFP4 molecule. A nucleotide difference (coding strand) or a G→A nucleotide targeted mutation (non-coding strand). Green fluorescence indicates B Caused by the introduction of targeted mutations in the FP gene, resulting in the synthesis of GFP The results are shown in Figure 1.

[0204] The following table shows the blue fluorescent protein (BFP) gene designed for conversion to green fluorescence. , exemplary 101-mer and 201-mer BFP4 / NC5'-3PS / 3'-3PSGR The ON sequence is shown. (3PS indicates three phosphotransferases at the 5' and 3' ends of the oligo.) (showing the hydroxyl group bond).

[0205] [Table 2] [Example]

[0206] Conversion rate using 5'Cy3 / 3'idC-labeled GRON The purpose of this experimental system is to synthesize phosphothioates ( The purpose of this study was to compare the efficiency of 5'Cy3 / 3'idC labeled GRON with that of 5'Cy3 / 3'idC labeled GRON. 5'Cy3 / 3'idC-labeled GRON is a 5'Cy3 fluorophore (amidite). and 3'idC inverted base. Blue fluorescent protein (BFP) to green fluorescent Conversion was used to assess efficiency.

[0207] in individual Falcon tubes (labeled "Tube") or in a 96-well plate (labeled "9 PEG delivery of GRON into protoplasts in either a 6-well dish (labeled "6-well dish"). In all three experiments, the conversion of BFP to GFP was measured by cytometry. There was no significant difference between the different chemistries of GRON in the conversion efficiency to HCl (Figure 1). [Example]

[0208] 41-mer BFP4 / NC5'-3PS / 3'-3PSGRON and Okazaki fragment GR Comparison between ON The purpose of this experimental system is to investigate the effects of bleomycin family members, such as zeta- Page 11 11 inducing DNA breaks. With or without Osin™ (1 mg / ml), 3PS components are present at each end of GRON. Comparison of conversion efficiencies of phosphothioate (PS)-labeled GRON and "Okazaki fragment GRON" The design of these GRONs is shown in Figure 2. GRONs are PEG-treated. Arabidopsis BEP was delivered to protoplasts, and the conversion of BFP to GFP was observed 2 days after treatment. Samples treated with Zeocin (1 mg / ml) were measured by cytometry at 4 hours. were incubated with Zeocin on ice for 90 min before PEG treatment.

[0209] Generally, the presence of Zeocin (1 mg / ml) increased B The conversion of FP to GFP was increased (Table 2). NC Okazaki containing one 2'-OMe group on the first RNA base at the 5' end of the ON The fragment GRON contains one 2'-OMe in each of the first nine 5' RNA bases. Conversion of BFP to GFP compared to the NC Okazaki fragment GRON containing the .GAMMA. group was more effective in the 2000-2005 group (Figure 2 and Table 2).

[0210] In all experiments, the presence of 1 mg / ml Zeocin was measured by cytometry. In the conversion of BFP to GFP both in the presence and absence of the 41-mer BFP4 / NC5'3 7 containing PS / 3'3PS and one 5'2'-Ome group on the first 5' RNA base Monomeric Okazaki fragment BFP4 / NCGRON (denoted as BFP47 monomer (1)NC) There was no significant difference between the two (Figure 2 and Table 2). phleomycin, tallysomycin, pepleomycin and this family of antibiotics In the presence of other members of the Both CGRON and NCGRON with the design tested in this study show approximately the same activity. It is important to note that

[0211] [Table 3] [Example]

[0212] 41-mer, 101-mer, and 201-mer BFP4 / NC5'-3PS / 3'-3PS Comparison between GRON The purpose of this experiment was to generate 3 nucleotides at each end of GRONs of different lengths (with or without Zeocin). To compare the conversion efficiency of phosphothioate (PS)-labeled GRON with PS components. The 41-mer, 101-mer, and 201-mer are shown in Table 1. Again, cytometry The conversion rate of BFP to GFP in the presence of Zeocin (1 mg / ml) was measured by The general trend in all three experiments was that the presence and absence of Zeocin The increase in NCGRON length was proportional to the increase in BFP-4 / NC / 1 in the presence of zeocin. Except for 01 and BFP-4 / C / 101, which are almost identical to the 41-mer NCGRON, This is because BFP-4 / 41 coding and non-coding GRONs had a lower conversion rate. In contrast to all previous experiments using This asymmetry in conversion frequency was due to the BFP-4 / RON used in this experimental system. This also applied to 201GRON.

[0213] [Table 4] [Example]

[0214] CRISPR combined with GRON to improve transformation in plants. The CRISPR complex is constructed using three design components: Cas9, gRNA (guide RNA), and NA), and the target region (proto-spacer in the endogenous target gene) must be taken into consideration. It must be.

[0215] Cas9 - Arabidopsis or corn ubiquitin induced by 35S or corn ubiquitin, respectively Streptococcus pyogenes (Streptococcus pyogenes) s) Transient expression of the Cas9 gene from the codon. The optimized gene was obtained from Genewiz or D Synthesized by NA2.0. NB ensures that no hidden introns are generated. It must be. - RBCSE9 terminator according to G1155 - one SV40NLS (PKKRKV) as a C-terminal fusion - The vector backbone is based on our transient expression system G1155. do.

[0216] gRNA - LeCong et al.,2013 and Jinek et al.,201 The proposed use of chimeric tracer RNA-pre-creRNA follows LeCong et al. However, the original full-length tracer + pre-creRNA complex was significantly more efficient than the chimeric type. Therefore, one option is to use the full-length (89 bp) tracer RNA was used to create chimeras. - gRNA sequence ((N) 20 indicates the guide sequence). The bracketed sequence is the full-length 89b Includes p-type. NNNNNNNNNNNNNNNNNNNNGTTTTAGAGCTAGAAATAG CAAGTTAAAATAAGGCTAGTCCG(TTATGTTCTTGAAAAA AGTGAGTGGCACCGAGTCGGTGGTGCTTTTTT)

[0217] The following diagram from Cong et al shows the prototypical complex and the chimera:

[0218] [ka]

[0219] - gRNA is expressed under the AtU6RNApolIII promoter in Arabidopsis. In corn, the ZmU6 RNA pol III promoter is expressed in the These selections are based on Wang et al. 2008. - RBCSE9 terminator according to G1155 or Wang et al. A series of terminators according to 13 and one-component methods are shown below.

[0220] The U6 promoter sequence from Wang et al. target area - Guide sequence specificity is defined by the target region sequence, independent of the choice of model organism This is the Y66H locus of BFP. The PAM (NGG) sequence near Y66H is In addition, the 12 bp guide sequence at the 3' end contains the Y66H position ( The inclusion of a "seed sequence") ensures that the site will not be cut again after repair has been performed. This means:

[0221] [ka]

[0222] A vector backbone different from G1155 allows simultaneous delivery of Cas9 and gRNA This problem is avoided by using a one-component approach.

[0223] One-component method LeCong et al. (2013) proposed the use of polIIIU, as outlined below. 6. Express both gRNA and Cas9 as a single transient construct under the control of a promoter Thus, for a given grain, the guide insertion arrangement Multiple genes can be targeted by simply swapping sequences. Replace the EF1α promoter with a cereal-appropriate promoter (pMAS and At, Ubi and Zim). For the terminator, we use RBCSE9. The NLS used here is the single C-terminal SV40 NLS outlined above.

[0224] In the following constructs, a truncated gRNA without the tracer RNA region is used. The authors note that in humans, this is more effective than the full-length form at inducing Cas9. Therefore, we suggest using full-length gRNAs. In particular, in a later paper using CRISPR in yeast, DiCarlo et al. (2013) used the full-length cassette in the G1155 background. It can be cloned.

[0225] [ka]

[0226] Schematic of the expression vector for chimeric crRNA. , a guide sequence can be inserted between the two BbsI sites. The vector contains a partial guide repeat. It already contains the unit (gray) and partial tracer RNA (red) sequences. Posttranscriptional regulatory elements of Adchack hepatitis virus.

[0227] In vivo assay Temporary options - One method to confirm target recognition and nuclease activity in plants is TAL For EN, Zhang et al. (2013) used YFP single-stranded annealing The spacer sequence (target sequence) and PAM are YFP or an equivalent gene. It needs to be inserted into the gene. Temporary options The TALEN-BFP system can be used as a control. - The aforementioned techniques allow for the determination of the function of a given CRISPR system with respect to a given spacer sequence. current tools to confirm CRISPR activity in plants, but not as a proof of concept The key to this is the use of the GFP system. - the design used here for BFP → GFP, together with G1155, and Co-transformation into At without GRON is possible if the excision is sufficiently efficient. A decrease in GFP expression appears evident, possibly due to a decrease in the plasmid loading. It is likely that some optimization of the code will be required. - After activity is confirmed, genomic BFP targets are targeted with image- and sequence-based readouts do.

[0228] In vitro assays - To rapidly confirm the activity of the CRISPR system, Jinek et al. In vitro assays can be used according to the method of claim 12. Pre-prepared and purified S. pyogenes Cas9 was transfected with synthetic gRNA and recognition sequence-containing plus The success of the digestion was analyzed by gel electrophoresis and the digested plasmid was Search for. Detailed Protocol:

[0229] Plasmid DNA cleavage assay. Synthetic or in vitro transcribed tracer RNA and Preheat the DNA and crRNA to 95°C and cool slowly to room temperature before the reaction. The original or restriction enzyme digested linearized plasmid DNA (30 0 ng (approximately 8 nM)) was added to the Cas9 plasmid digestion medium with or without 10 mM MgCl2. Cutting buffer (20 mM HEPES pH 7.5, 150 mM KCl, 0.5 mM Purified Cas9 protein (50-500 nM) in 0.1 mM DTT, 0.1 mM EDTA and tracer RNA:crRNA duplex (50–500 nM, 1:1) at 37°C. The reaction was incubated for 60 minutes in 5x DNA load buffer containing 250 mM EDTA. The mixture was stopped with precipitation buffer and resolved by 0.8 or 1% agarose gel electrophoresis. , visualized by ethidium bromide staining. Before loading onto the agarose gel, the reaction was diluted with 5x SDS loading buffer ( The reaction was stopped with 30% glycerol, 1.2% SDS, 250 mM EDTA).

[0230] Trait targets in cereals Considering the flexibility of CRISPR recognition sequences, the 3'NGGPAM sequence defines It is not difficult to find potential protospacer sequences. ZmEPSPS

[0231] The following examples demonstrate suitable promoters for effecting DS cleavage at the catalytic site of ZmEPSPS. The rotospacer sequence (yellow) and PAM (blue) are shown, in this case at T97 and P101. Mutations in the cleaved oligonucleotides are known to cause glyphosate resistance. ODM mediates repair to bring about the desired change.

[0232] [ka]

[0233] The table below gives the protospacer sequences of the genes of interest in the crops of interest.

[0234] [Table 5]

[0235] The design constraint was to have an NGG sequence within the 12 base pair nucleotides to be modified by ODM. When this is the case, successful ODMs are often hard to find. This is important because it means that subsequent cleavage is not possible due to the altered spacer seed sequence. Jinek et al. (2012) showed that this impaired cleavage efficiency. did.

[0236] References

[0237] LeCong et al 2013 Science:vol.339no.612 1, pp. 819-823.

[0238] Jinek et al 2012 Science.337:816-21

[0239] Wang et al 2008 RNA14:903-913

[0240] Zhang et al 2013.Plant Physiol.161:20-2 7

[0241] Those skilled in the art will appreciate that the present invention carries out the objects and realizes the objects and advantages mentioned, as well as the advantages inherent therein. It will be readily apparent that the present invention is well adapted to obtain the objects and advantages thereof. The examples are representative of preferred embodiments, are illustrative, and are not intended to limit the scope of the invention. Don't think of it as such.

[0242] Various substitutions and modifications to the invention disclosed herein are within the scope and spirit of the invention. It will be readily apparent to those skilled in the art that modifications can be made without departing from the spirit thereof.

[0243] All patents and publications mentioned in this specification are understood to be within the skill of those skilled in the art to which this invention pertains. All patents and publications are listed with specific and individual references to each individual publication. and are incorporated herein by reference to the same extent as if incorporated by reference.

[0244] The invention as suitably illustratively described herein is not intended to be limiting unless specifically disclosed herein. The present invention may be practiced in the absence of one or more other elements or one or more other constraints. Thus, for example, in each instance herein, the terms "comprises," "essentially Both "target" and "consist" can be interchanged with either of the other two terms. The terms and expressions used are used as terms of description and not of limitation. In the use of such terms and expressions, any equivalent of the features shown and described, or It is not intended to exclude any of these, but various modifications may be made within the scope of the claimed invention. Positive is possible It will be appreciated that the present invention will be embodied in terms of preferred embodiments and optional features. While the present invention has been disclosed in a general sense, modifications and variations of the concepts disclosed herein are open to those skilled in the art. Such modifications and variations are within the scope of the present invention as defined by the appended claims. It should be understood that the range is considered to be within the range of

[0245] Other embodiments are within the scope of the following claims.

Claims

1. 1. A method for causing alteration of one or more target genes in a plant cell, comprising: The method comprises delivering to the plant cell or its protoplast a Clustered Regularly Interspaced Short Palindromic Repeats complex (CRISPR) nuclease, which induces single-strand or double-strand breaks in the genome of the plant cell, and a gene repair oligonucleobase (GRON) configured to mediate the introduction of one or more target gene changes into endogenous target genes in the genome of the plant cell; The GRON comprises one or more interstrand nucleobase bridges; the plant cell is non-transgenic with respect to the alteration of the target gene; Said one or more target gene changes are introduced into said endogenous target gene in the genome of said plant cell without said GRON being incorporated into said endogenous target gene.

2. 2. The method of claim 1, wherein the plant cell is of a species selected from the group consisting of canola, sunflower, corn, tobacco, sugar beet, cotton, maize, wheat, barley, rice, alfalfa, sorghum, tomato, mango, peach, apple, pear, strawberry, banana, melon, potato, carrot, lettuce, onion, soybean, soybean seed, sugarcane, legume, chickpea, field pea, legume, lentil, turnip, swede, Brussels sprout, lupine, cauliflower, kale, pea, poplar, pine, eucalyptus, grape, citrus, triticale, rye, oat, turf and forage, flax, rapeseed, mustard, cucumber, morning glory, balsam, pepper, eggplant, marigold, lotus, cabbage, daisy, carnation, tulip, iris, and lily.

3. The method of claim 1 or 2, wherein the method produces alterations in multiple target genes in the genome of the plant cell.

4. The method of any one of claims 1 to 3, wherein two or more guide RNAs are used.

5. 5. The method of claim 4, wherein the two or more guide RNAs are each complementary to a different target of genetic alteration.

6. The method of any one of claims 1-5, wherein the CRISPR nuclease functions as a nickase.

7. including the use of two or more CRISPR nucleases that are nickases, wherein the two or more CRISPR nucleases introduce cleavage into opposite strands of the target nucleic acid sequence or into the same strand; The method of claim 6.

8. 8. The method of any one of claims 1-7, further comprising regenerating a plant from said protoplasts.

9. 9. The method of claim 8, further comprising collecting seeds from the plant.

Images