Pre-mRNA splice-switching or modulating oligonucleotides containing bicyclic scaffold moieties with improved characteristics for the treatment of genetic disorders

Abstract

The present invention provides antisense splice-switching oligonucleotides with improved characteristics that enhance their clinical applicability for treating, ameliorating, preventing and / or delaying neuromuscular disorders such as DMD. [Selection diagram] None

Description

[Technical Field]

[0001] The present invention relates to the field of antisense oligonucleotides, more particularly splice-switching oligonucleotides, for the treatment of genetic disorders, more particularly neuromuscular disorders. The present invention particularly relates to the use of oligonucleotides with improved characteristics that enhance their clinical applicability, as further defined herein. [Background technology]

[0002] Antisense oligonucleotides (AONs) are in (pre)clinical development for numerous diseases and conditions, including cancer, inflammatory conditions, cardiovascular disease, and neurodegenerative and neuromuscular disorders. Their mechanisms of action are directed at various targets, such as RNase H-mediated degradation of target RNA in the nucleus or cytoplasm, splice regulation (exon inclusion or skipping) in the nucleus, or translation inhibition by steric hindrance of ribosomal subunit binding in the cytoplasm. Splice-regulatory or splice-switching oligonucleotides (SSOs) were first described for the correction of aberrant splicing in human β-globin pre-mRNA (Dominski and Kole, 1993) and are currently being used in a variety of diseases, including, but not limited to, cystic fibrosis (CFTR gene, Friedman et al., 1999), breast cancer (BRCA1 gene, Uchikawa et al., 2007), prostate cancer (FOLH1 gene, Williams et al., 2009), and cancers of the genotype 1 (FOLH1). et al., 2006), inflammatory diseases (IL-5R alpha and MyD88 genes, Karras et al., 2001, Vickers et al., 2006), ocular albinism type 1 (OA1 gene, Vetrini et al., 2006), ataxia telangiectasia (ATM gene, Du et al., 2007), nevoid basal cell carcinoma syndrome (PTCH1 gene, Uchikawa et al., 2007), methylmalonic acidemia (MUT gene, Rincon et al., 2007), preterm labor (C OX-2 gene, Tyson-Capper et al., 2006), atherosclerosis (APOB gene, Khoo et al., 2007), propionic acidemia (PCCA, PCCB genes, Rincon et al., 2007), leukemia (c-myc and WT1 genes, 2004, Giles et al., 1999), dystrophic epidermolysis bullosa (COL7A1 gene, Goto et al., 2006), familial hypercholesterolemia, and leukemia. telomerase (APOB gene, Disterer et al., 2013), laser-induced choroidal neovascularization and corneal transplant rejection (KDR gene, Uehara et al., 2013), hypertrophic cardiomyopathy (MYBPC3 gene, Gedicke-Hornung et al., 2013), Usher syndrome (USH1C gene, Lentz et al., 2013), Fukuyama congenital muscular dystrophy (FKTN gene, Taniguchi-Ikeda et al., 2011),It has been investigated for various genetic disorders, including laser-induced choroidal neovascularization (FLT1 gene, Owen et al., 2012), cancer (STAT3 and bcl-X genes, Zammarchi et al., 2011; Mercatante et al., 2002), and Hutchinson-Gilford progeria (LMNA gene, Osorio et al., 2011), Miyoshi myopathy (DYSF gene, Wein et al., 2010), spinocerebellar ataxia type 1 (ATXN1 gene, Gao et al., 2008), Alzheimer's disease / FTDP-17 tauopathy (MAPT gene, Peacey et al., 2012), myotonic dystrophy (CLC1 gene, Wheeler et al., 2007), and Huntington's disease (Evers et al., 2014). However, splice-switching AONs are making the most rapid progress in treating the neuromuscular disorders Duchenne muscular dystrophy (DMD) and spinal muscular dystrophy (spinal muscular atrophy (SMA)).

[0003] Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are the most common childhood forms of muscular dystrophy. DMD is a severe, fatal neuromuscular disorder that results in dependence on wheelchair assistance before the age of 12, and patients often die of respiratory or cardiac failure before the age of 13. It is caused by frameshift deletions (approximately 67%) or duplications (approximately 7%) of one or more exons in the 2.24 Mb DMD gene, which result in the absence of functional dystrophin, or by point mutations (approximately 25%). BMD is also caused by mutations in the DMD gene, which maintain the open reading frame and produce a semi-functional dystrophin protein, typically resulting in a much milder phenotype and a longer lifespan. Over the past decade, specific splicing modifications to restore the disrupted reading frame of a transcript have emerged as a promising therapy for DMD (van Ommen et al., 2008; Yokota et al., 2007; van Deutekom et al., 2007; Goemans et al., 2011; Voit et al., 2014; Cirak et al., 2011). The use of highly sequence-specific splice-switching antisense oligonucleotides (AONs) that bind to exons adjacent to or containing mutations and interfere with their splicing signals can induce skipping of those exons during processing of DMD pre-mRNA. Although a truncated transcript is generated, the open reading frame is restored, and a protein similar to that seen in BMD patients is produced. AON-induced exon skipping offers a mutation-specific, and therefore personalized, therapeutic approach for DMD patients. Skipping of one specific exon may be therapeutic for many patients with various mutations, as most mutations cluster around exons 45-55. Skipping of exon 51 applies to the largest subset of patients (approximately 13%), including those with deletions of exons 45-50, 48-50, 50, or 52. The applied AONs are chemically modified to resist endonucleases, exonucleases, and RNase H, and to promote RNA binding and duplex stability.Various AON chemistries, including 2'-O-methyl phosphorothioate RNA (2OMePS; Voit et al., 2014), phosphorodiamidate morpholino (PMO; Cirak et al., 2011), tricyclic DNA (tcDNA; Goyenvalle et al., 2015), and peptide nucleic acid (PNA; Gao et al., 2015), are currently being investigated to induce corrective exon skipping for DMD. Although AONs are typically poorly taken up by healthy muscle fibers, the lack of dystrophin in DMD and the resulting pathology, characterized by activated satellite cells and damaged, and therefore more permeable, fiber membranes, actually promotes better uptake. In studies in the dystrophin-deficient mdx mouse model, 2'-O-methyl phosphorothioate RNA oligonucleotides indeed demonstrated up to 10-fold higher uptake in various muscle groups compared to wild-type mice (Heemskerk et al., 2010). Recent Phase I / II results using both 2'-O-methyl phosphorothioate RNA and phosphorodiamidate morpholino AONs in DMD patients confirm the presence of AONs in muscle biopsies, but the various chemical modifications appear to result in differential uptake by and distribution within muscle. Furthermore, in both studies, the levels of de novo dystrophin after treatment remain limited, motivating the field to develop oligonucleotides with improved characteristics that enhance therapeutic index and clinical applicability.

[0004] Spinal muscular atrophy (SMA) is an autosomal recessive disease affecting 1 in 6,000 newborns. It is caused by mutations in the survival motor neuron gene 1 (SMN1). This results in the progressive loss of motor neurons in the spinal cord and subsequent atrophy of voluntary muscles. Clinical severity varies depending on the naturally occurring level of exon 7 inclusion in the nearly identical SMN2 gene and the copy number of SMN2. In SMN2, a C>T transition at the exon 7 splicing enhancer site usually results in an unstable exon 7-skipped isoform and insufficient levels of the full-length isoform (Khoo and Krainer, 2009). However, effective SMN2 exon 7 inclusion can be achieved by blocking an intron splicing silencer in the 5' region of intron 7 (ISS-N1; Singh et al., 2006; Hua et al., 2008) using a splice-switching AON. Based on successful mouse studies ( Hua et al., 2010 , 2011 ; Passini et al., 2011 ), we identified a candidate AON (ISIS-SMN Rx、 ISIS 396443 or nusinersen) is currently in clinical development by IONIS Pharmaceuticals (Carlbad, CA). Rx Direct injection of a single 9 mg dose of SSO resulted in widespread distribution in the central nervous system and some improvement in motor function in children with SMA (Swoboda et al., 2014; Chiriboga et al., 2016). However, systemic SSO delivery may be necessary to reduce cardiac pathology and increase peripheral motor neuron function and, consequently, survival.

[0005] The clinical efficacy of systemically administered AONs, such as splice-switching AONs, depends on several factors, including the route of administration, biostability, biodistribution, tissue distribution, uptake by target cells, and routing to the desired intracellular location (nucleus). These factors are determined, at least in part, by the chemical structure of the AON. Part of the present invention demonstrates that specific chemical modifications in the AON scaffold can lead to AONs that exhibit improved characteristics for the potential treatment of genetic disorders.

[0006] In conclusion, there is a need for AONs with optimized chemical characteristics to enhance the therapeutic applicability of AONs, such as splice-switching AONs, for genetic disorders such as DMD, BMD, or SMA. Summary of the Invention

[0007] Oligonucleotides In a first aspect, the present invention provides oligonucleotides comprising 2'-substituted monomers, preferably 2'-substituted RNA monomers and bicyclic nucleic acid (BNA) scaffold modifications, comprising 5-methylpyrimidine bases, or consisting of 2'-substituted monomers linked by phosphorothioate backbone linkages, preferably consisting of 2'-substituted RNA monomers, for use as drugs for treating diseases or conditions caused by splice modulation, for example, exon skipping or exon inclusion, both of which are forms of splice switching.Preferred diseases in this context include Duchenne muscular dystrophy, Becker muscular dystrophy, and spinal muscular atrophy. [Brief explanation of the drawings]

[0008] [Figure 1A]Figure 1 shows the effect of implementing 5' and / or 3' BNA scaffold-modified nucleotides on AON-induced DMD exon 51 skipping (A) and dystrophin production (B) in DMD patient (exon 48-50 deletion) muscle cell cultures compared to AONs of the same sequence without the BNA modification based on SEQ ID NO: 452. In this case, the BNA modification is LNA (the SEQ ID NO shown in the figure corresponds to the SEQ ID NO for which the BNA scaffold modification as shown results in an LNA monomer). (A): The average exon 51 skipping percentage was determined by RT-ddPCR analysis of triplicate RNA samples; error bars indicate standard deviation. AON (800 nM or 4 μM). (B): Mean chemiluminescence values ​​(area under the curve (AUC) obtained from electropherograms) were measured by Simple Western Capillary immunoassay; HC = healthy control muscle samples loaded with high vs. low protein concentrations, NT = untreated samples, AON concentration 800 nM. [Figure 1B] Figure 1 shows the effect of implementing 5' and / or 3' BNA scaffold-modified nucleotides on AON-induced DMD exon 51 skipping (A) and dystrophin production (B) in DMD patient (exon 48-50 deletion) muscle cell cultures compared to AONs of the same sequence without the BNA modification based on SEQ ID NO: 452. In this case, the BNA modification is LNA (the SEQ ID NO shown in the figure corresponds to the SEQ ID NO for which the BNA scaffold modification as shown results in an LNA monomer). (A): The average exon 51 skipping percentage was determined by RT-ddPCR analysis of triplicate RNA samples; error bars indicate standard deviation. AON (800 nM or 4 μM). (B): Mean chemiluminescence values ​​(area under the curve (AUC) obtained from electropherograms) were measured by Simple Western Capillary immunoassay; HC = healthy control muscle samples loaded with high vs. low protein concentrations, NT = untreated samples, AON concentration 800 nM. [Figure 2A]Figure 2 shows the effect of implementing 5' and / or 3' BNA scaffold-modified nucleotides on AON-induced DMD exon 51 skipping in DMD patient (exon 48-50 deletion) muscle cell cultures compared to AONs of the same sequence without the BNA modification based on SEQ ID NO: 452. The BNA modification in A is CRN (SEQ ID NOs: 453C and 455C shown in the figure relate to SEQ ID NOs: 453 and 455, where the BNA scaffold modification as shown results in a CRN monomer). The BNA modification in B is 2'-amino-2'-deoxy LNA, referred to in this application as 2'-amino-LNA (SEQ ID NO: 456A shown in the figure relates to SEQ ID NO: 456, where the BNA scaffold modification as shown results in a 2'-amino-LNA monomer). The average exon 51 skipping percentage was determined by RT-ddPCR analysis of triplicate RNA samples; error bars indicate standard deviation; AON concentrations were 800 nM (B) or 4 μM (A,B). [Figure 2B] Figure 2 shows the effect of implementing 5' and / or 3' BNA scaffold-modified nucleotides on AON-induced DMD exon 51 skipping in DMD patient (exon 48-50 deletion) muscle cell cultures compared to AONs of the same sequence without the BNA modification based on SEQ ID NO: 452. The BNA modification in A is CRN (SEQ ID NOs: 453C and 455C shown in the figure relate to SEQ ID NOs: 453 and 455, where the BNA scaffold modification as shown results in a CRN monomer). The BNA modification in B is 2'-amino-2'-deoxy LNA, referred to in this application as 2'-amino-LNA (SEQ ID NO: 456A shown in the figure relates to SEQ ID NO: 456, where the BNA scaffold modification as shown results in a 2'-amino-LNA monomer). The average exon 51 skipping percentage was determined by RT-ddPCR analysis of triplicate RNA samples; error bars indicate standard deviation; AON concentrations were 800 nM (B) or 4 μM (A,B). [Figure 3]Figure 3 shows the effect of implementing 5' and / or 3' BNA scaffold-modified nucleotides on AON-induced DMD exon 51 skipping in a hDMD mouse model after 12 weeks of IV treatment (100 mg / kg AON weekly). The BNA modification in this case is LNA (the SEQ ID NO shown in the figure corresponds to the SEQ ID NO for which the BNA scaffold modification as shown results in an LNA monomer). The average exon 51 skipping percentage was determined by RT-ddPCR analysis of muscle RNA samples. [Figure 4] Figure 4 shows the effect of implementing at least one BNA scaffold-modified nucleotide on AON-induced DMD exon 51 skipping in DMD patient (exon 48-50 deletion) muscle cell cultures compared to AONs of the same sequence without BNA modification based on SEQ ID NO: 452 (all at 800 nM). In this case, the BNA modification results in an LNA (the SEQ ID NO shown in the figure corresponds to the SEQ ID NO for which the BNA scaffold modification as shown results in an LNA monomer). The average fold increase in exon 51 skipping levels over SEQ ID NO: 452 is based on RT-ddPCR analysis of triplicate RNA samples. [Figure 5A] Figure 5 shows the effect of implementing 5' and 3' BNA scaffold-modified nucleotides on AON-induced DMD exon 44 skipping (A, SEQ ID NO: 29), exon 45 skipping (B, SEQ ID NO: 3185), and exon 53 skipping (C, SEQ ID NO: 863) in healthy human muscle cells compared to AONs of the same sequence without BNA scaffold modifications (SEQ ID NO: 26 (exon 44), SEQ ID NO: 6049 (exon 45), and SEQ ID NO: 860 (exon 53). In this case, the BNA modification results in an LNA (the SEQ ID NO shown in the figure corresponds to the SEQ ID NO for which the BNA scaffold modification as shown results in an LNA monomer). The average exon skipping percentage was determined by RT-ddPCR analysis of RNA samples (n=6), and error bars indicate the standard deviation. AONs (800 nM or 4 μM). [Figure 5B]Figure 5 shows the effect of implementing 5' and 3' BNA scaffold-modified nucleotides on AON-induced DMD exon 44 skipping (A, SEQ ID NO: 29), exon 45 skipping (B, SEQ ID NO: 3185), and exon 53 skipping (C, SEQ ID NO: 863) in healthy human muscle cells compared to AONs of the same sequence without BNA scaffold modifications (SEQ ID NO: 26 (exon 44), SEQ ID NO: 6049 (exon 45), and SEQ ID NO: 860 (exon 53). In this case, the BNA modification results in an LNA (the SEQ ID NO shown in the figure corresponds to the SEQ ID NO for which the BNA scaffold modification as shown results in an LNA monomer). The average exon skipping percentage was determined by RT-ddPCR analysis of RNA samples (n=6), and error bars indicate the standard deviation. AONs (800 nM or 4 μM). [Figure 5C] Figure 5 shows the effect of implementing 5' and 3' BNA scaffold-modified nucleotides on AON-induced DMD exon 44 skipping (A, SEQ ID NO: 29), exon 45 skipping (B, SEQ ID NO: 3185), and exon 53 skipping (C, SEQ ID NO: 863) in healthy human muscle cells compared to AONs of the same sequence without BNA scaffold modifications (SEQ ID NO: 26 (exon 44), SEQ ID NO: 6049 (exon 45), and SEQ ID NO: 860 (exon 53). In this case, the BNA modification results in an LNA (the SEQ ID NO shown in the figure corresponds to the SEQ ID NO for which the BNA scaffold modification as shown results in an LNA monomer). The average exon skipping percentage was determined by RT-ddPCR analysis of RNA samples (n=6), and error bars indicate the standard deviation. AONs (800 nM or 4 μM). DETAILED DESCRIPTION OF THE INVENTION

[0009] For oligonucleotides as described in this application, when the characteristics of a monomer are not specified or are not clear from the context, the corresponding characteristics from the RNA monomer should be inferred.

[0010] As such, in this aspect, the present invention provides a method for producing a pharmaceutical composition comprising: i) Ia) at least one 2'-substituted monomer and optionally a phosphorothioate backbone linkage; or Ib) only 2'-substituted monomers linked by phosphorothioate backbone linkages and / or by phosphodiester linkages; ii) 5-methylcytosine and / or 5-methyluracil bases, and iii) at least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification; The present invention provides an oligonucleotide comprising:

[0011] Preferably, the monomers are or are derived from RNA monomers. Such oligonucleotides are referred to herein as oligonucleotides according to the invention. As such, preferred oligonucleotides according to the invention are: i) Ia) at least one 2'-substituted monomer, preferably an RNA monomer or a 2'-O-substituted RNA monomer, optionally with a phosphorothioate backbone linkage; or Ib) 2'-substituted monomers, preferably only RNA monomers or 2'-O-substituted RNA monomers, linked by phosphorothioate backbone linkages and / or by phosphodiester linkages, ii) 5-methylcytosine and / or 5-methyluracil bases, and iii) at least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification; Includes:

[0012] Preferred oligonucleotides according to the invention have an oligonucleotide length of less than 34 nucleotides. The oligonucleotides may have 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Such oligonucleotides may also be identified as having 10 to 33 nucleotides. More preferred oligonucleotides according to the invention have a length of 16, 17, 18, 19, 20, 21, or 22 nucleotides and may be identified as having 16 to 22 nucleotides.

[0013] In another embodiment, the oligonucleotides of the invention are 16 to 25 nucleotides in length. In another embodiment, the oligonucleotides of the invention are 16 to 24 nucleotides in length. In another embodiment, the oligonucleotides of the invention are 16 to 22 nucleotides in length. In another embodiment, the oligonucleotides of the invention are 16, 18, 20, or 22 nucleotides in length. In another embodiment, the oligonucleotides of the invention are 21, 22, 24, or 25 nucleotides in length. In another embodiment, the oligonucleotides of the invention are 18, 22, 24, or 25 nucleotides in length.

[0014] In another embodiment, the oligonucleotide is 16-25 nucleotides in length and is intended to skip exon 44, 45, 51, or 53 of the dystrophin pre-mRNA. In another embodiment, the oligonucleotide is 16-24 nucleotides in length and is intended to skip exon 44, 51, or 53 of the dystrophin pre-mRNA. In another embodiment, the oligonucleotide is 16-22 nucleotides in length and is intended to skip exon 51 of the dystrophin pre-mRNA. In another embodiment, the oligonucleotide is 16, 18, 20, or 22 nucleotides in length and is intended to skip exon 51 of the dystrophin pre-mRNA. In another embodiment, the oligonucleotide is 20 or 23 nucleotides in length and is intended to skip exon 44 of the dystrophin pre-mRNA. In another embodiment, the oligonucleotide is 21, 22, 24, or 25 nucleotides in length and is intended to skip exon 45 of the dystrophin pre-mRNA. In another embodiment, the oligonucleotide is 18, 22, 24 or 25 nucleotides in length and is intended to skip exon 53 of the dystrophin pre-mRNA. Throughout this application, references to dystrophin are preferably interpreted as references to human dystrophin.

[0015] Encompassed by (i)(Ia) above are oligonucleotides that contain at least one 2'-substituted monomer, preferably a 2'-substituted RNA monomer, and that do not contain phosphorothioate backbone linkages. Such oligonucleotides may have a backbone that contains only phosphodiester linkages. Similarly, included are oligonucleotides that contain at least one 2'-substituted monomer, preferably a 2'-substituted RNA monomer, and one or more phosphorothioate backbone linkages.

[0016] Encompassed by (i)(lb) above are oligonucleotides containing only backbone linkages that are phosphorothioate backbone linkages, with no monomers other than 2'-substituted RNA monomers. Similarly, included are oligonucleotides containing only backbone linkages that are phosphodiester backbone linkages, with no monomers other than 2'-substituted RNA monomers.

[0017] As known to those skilled in the art, oligonucleotides, such as RNA oligonucleotides, generally consist of repeating monomers. These monomers are most often nucleotides or nucleotide analogs. The most common naturally occurring nucleotides in RNA are adenosine monophosphate, cytidine monophosphate, guanosine monophosphate, thymidine monophosphate, and uridine monophosphate. These consist of a pentose sugar ribose, a 5'-linked phosphate group, and a 1'-linked base linked by a phosphate ester. The sugar connects the base and the phosphate and is therefore often referred to as the scaffold of the nucleotide. Modifications in the pentose sugar are therefore often referred to as scaffold modifications. For severe modifications, the original pentose sugar may be replaced in its entirety with another moiety that similarly connects the base and the phosphate. Therefore, while the pentose sugar is often the scaffold, it is understood that the scaffold is not necessarily a pentose sugar.

[0018] The bases, sometimes called nucleobases, are generally adenine, cytosine, guanine, thymine, or uracil or derivatives thereof. Cytosine, thymine, and uracil are pyrimidine bases and are generally linked to the scaffold via their 1-nitrogen. Adenine and guanine are purine bases and are generally linked to the scaffold via their 9-nitrogen.

[0019] A nucleotide is generally connected to an adjacent nucleotide by condensation of its 5'-phosphate moiety to the 3'-hydroxyl moiety of an adjacent nucleotide monomer. Similarly, its 3'-hydroxyl moiety is generally connected to the 5'-phosphate of an adjacent nucleotide monomer. This forms a phosphodiester bond. The phosphodiester and the scaffold form an alternating copolymer. The base is grafted to this copolymer, i.e., to the scaffold moiety. Due to this feature, the alternating copolymer formed by the linked monomers of an oligonucleotide is often referred to as the backbone of the oligonucleotide. Because phosphodiester bonds connect adjacent monomers together, they are often referred to as backbone linkages. If the phosphate group is instead modified to be a similar moiety such as phosphorothioate, it is understood that such moiety is still referred to as the backbone linkage of the monomer. This is referred to as a backbone linkage modification. In general terms, therefore, the backbone of an oligonucleotide consists of alternating scaffolds and backbone linkages.

[0020] In another embodiment, the nucleobase is adenine, cytosine, guanine, thymine, or uracil. In another embodiment, the nucleobase is adenine, cytosine, guanine, or uracil. In another embodiment, the nucleobase is a modified form of adenine, cytosine, guanine, thymine, or uracil. In another embodiment, the modified nucleobase is hypoxanthine, pseudouracil, pseudocytosine, 1-methylpseudouracil, orotic acid, agmatidine, lysidine, 2-thiouracil, 2-thiothymine, 5-halouracil, 5-halomethyluracil, 5-trifluoromethyluracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, pseudoisocytidine, N4-ethylcytosine, N2-cyclopentylguanine (cPent-G), N2-cyclopentyl-2-aminopurine (cPent-AP), or N2-propyl-2-aminopurine (Pr-AP). In another embodiment, the modified nucleobase is hypoxanthine, pseudouracil, pseudocytosine, 1-methylpseudouracil, orotic acid, agmatidine, lysidine, 2-thiouracil, 2-thiothymine, 5-halouracil, 5-halomethyluracil, 5-trifluoromethyluracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, or 5-hydroxymethylcytosine.

[0021] The oligonucleotides of the present invention comprise or consist of 2'-substituted phosphorothioate monomers, preferably 2'-substituted phosphorothioate RNA monomers, 2'-substituted phosphate RNA monomers, or 2'-substituted mixed phosphate / phosphorothioate RNA monomers. Such oligonucleotides comprise 2'-substituted RNA monomers connected via or by phosphorothioate or phosphate backbone linkages or mixtures thereof, or consist of 2'-substituted phosphorothioate RNA, 2'-substituted phosphate RNA, or mixtures thereof. Preferably, such oligonucleotides consist of 2'-substituted phosphorothioate RNA monomers, 2'-substituted phosphate RNA monomers, or mixtures thereof. The 2'-substituted RNA is preferably 2'-F, 2'-O-methyl, or 2'-O-(2-methoxyethyl). The 2'-O-(2-methoxyethyl) moiety is often referred to as 2'-MOE. More preferably, the 2'-substituted RNA monomer is a 2'-O-methyl RNA monomer. Such chemistry is well known to those skilled in the art. In a preferred embodiment of this aspect, there is provided an oligonucleotide according to the invention, wherein the 2'-substituted monomer is a 2'-substituted RNA monomer, a 2'-F monomer, a 2'-amino monomer, a 2'-O-substituted monomer, a 2'-O-methyl monomer, or a 2'-O-(2-methoxyethyl) monomer, preferably a 2'-O-methyl monomer. Preferably, the 2'-substituted monomer is a 2'-substituted RNA monomer, such as a 2'-O-methyl RNA monomer.

[0022] Throughout this application, oligonucleotides comprising 2'-O-methyl monomers or 2'-O-methyl RNA monomers and phosphorothioate, phosphate, or mixed phosphate / phosphorothioate backbone linkages may be replaced by oligonucleotides comprising 2'-O-methyl phosphorothioate RNA, 2'-O-methyl phosphate RNA, or 2'-O-methyl phosphate / phosphorothioate RNA, respectively. Throughout this application, oligonucleotides consisting of 2'-O-methyl RNA monomers linked by or connected via phosphorothioate, phosphate, or mixed phosphate / phosphorothioate backbone linkages may be replaced by oligonucleotides consisting of 2'-O-methyl phosphorothioate RNA, 2'-O-methyl phosphate RNA, or 2'-O-methyl phosphate / phosphorothioate RNA.

[0023] Furthermore, the oligonucleotides of the present invention contain base modifications that increase the binding affinity to the target strand, increase the melting temperature of the resulting duplex of the oligonucleotide with its target, and / or reduce immunostimulatory effects, and / or increase biostability, and / or improve biodistribution and / or tissue distribution and / or cellular uptake and transport. In a more preferred embodiment, the oligonucleotides of the present invention contain 5-methylpyrimidines. The 5-methylpyrimidines are selected from 5-methylcytosine and / or 5-methyluracil and / or thymine, which is identical to 5-methyluracil. "Thymine" and "5-methyluracil" may be used interchangeably throughout the text. Preferably, the oligonucleotides of the present invention contain at least one 5-methylcytosine or 5-methyluracil base. Therefore, in a preferred embodiment of the present invention, the above-mentioned oligonucleotides are provided, in which all cytosine bases are 5-methylcytosine bases and / or all uracil bases are 5-methyluracil bases. This relates to oligonucleotides that contain 5-methylcytosine but not unsubstituted cytosine or uracil, to oligonucleotides that contain 5-methyluracil but not unsubstituted cytosine or uracil, to oligonucleotides that contain both 5-methylcytosine and 5-methyluracil but not unsubstituted cytosine or uracil, to oligonucleotides that contain 5-methylcytosine but not unsubstituted cytosine and also unsubstituted uracil, or to oligonucleotides that contain 5-methyluracil but not unsubstituted uracil and also unsubstituted cytosine.

[0024] The oligonucleotides of the present invention comprise scaffold modifications that increase the binding affinity to the target strand, increase the melting temperature of the resulting duplex of the oligonucleotide with its target, and / or reduce the immunostimulatory effect, and / or increase biostability, and / or improve biodistribution and / or tissue distribution and / or cellular uptake and transport. Scaffold modifications that result in bicyclic nucleic acid (BNA) monomers are encompassed by the present invention. Bicyclic scaffolds are generally pentose-derived scaffolds that have been chemically modified to conformationally restrict the scaffold and improve the above-mentioned effects. Examples of bicyclic scaffolds include scaffolds in which a first ring, such as a pentose ring, forms a spirane with an additional cyclic moiety, resulting in both rings sharing only one atom; scaffolds in which a first ring, such as a pentose ring, is fused with an additional cyclic moiety, resulting in both rings sharing two adjacent atoms; and scaffolds in which a first ring, such as a pentose ring, forms a bridged compound through a moiety that is connected to the first cyclic moiety by two non-adjacent atoms. Such non-adjacent atoms are called bridgehead atoms. A bridged compound contains multiple rings, each of which overlaps over at least three atoms. A compound with two rings that overlap over only two atoms is a fused compound. In some bridged compounds, the smallest connection between the two bridgehead atoms is called a bridging or bridge moiety. In other bridged compounds, when one ring is a distinctive ring, such as the pentose ring of a nucleotide, the moiety that is not constitutive of that distinctive ring is called a bridging moiety. It follows that the nomenclature of bridged bicyclic compounds is context-dependent. [ka]

[0025] Bicyclic compounds may contain additional rings. Bicyclic compounds of the present invention are at least bicyclic, and the two rings form a spirane, a fused system, or a bridged system, or a combination thereof. The present invention does not encompass scaffold modifications in which two independent rings are linked by an acyclic linker so as not to form a spirane, a fused compound, or a bridged compound. Preferred bicyclic compounds are fused compounds or bridged compounds. In a more preferred embodiment, the bicyclic nucleic acid monomer (BNA) is a bridged nucleic acid monomer. As described herein, both "bridged" and "bicyclic" nucleic acid monomers refer to nucleotides having modified scaffolds that enhance the melting temperature of the oligonucleotide for an RNA target compared to a non-BNA nucleotide-containing control oligonucleotide.

[0026] In a preferred embodiment, each occurrence of said bicyclic nucleic acid (BNA) scaffold modification is selected from the group consisting of a conformationally restricted nucleotide (CRN) monomer, a locked nucleic acid (LNA) monomer, a xylo-LNA monomer, an α-LNA monomer, an α-L-LNA monomer, a β-D-LNA monomer, a 2'-amino-LNA monomer, a 2'-(alkylamino)-LNA monomer, a 2'-(acylamino)-LNA monomer, a 2'-N-substituted-2'-amino-LNA monomer, a 2'-thio-LNA monomer, a (2'-O,4'-C) constrained ethyl (cEt) BNA monomer, a (2'-O,4'-C) constrained methoxyethyl (cMOE) BNA monomer, a 2',4'-BNA NC (NH) monomer, 2',4'-BNA NC (N-Me) monomer, 2',4'-BNA NCOligonucleotides according to the invention are provided which yield monomers independently selected from the group consisting of (N-Bn) monomers, ethylene-bridged nucleic acid (ENA) monomers, carba LNA (cLNA) monomers, 3,4-dihydro-2H-pyran nucleic acid (DpNA) monomers, 2'-C-bridged bicyclic nucleotide (CBBN) monomers, heterocyclic bridged BNA monomers (e.g., triazolyl- or tetrazolyl-linked), amide-bridged BNA monomers, urea-bridged BNA monomers, sulfonamide-bridged BNA monomers, bicyclic carbocyclic nucleotide monomers, TriNA monomers, α-L-TriNA monomers, bicyclic DNA (bcDNA) monomers, F-bcDNA monomers, tricyclic DNA (tcDNA) monomers, F-tcDNA monomers, oxetane nucleotide monomers, 2'-amino-LNA-derived locked PMO monomers, guanidine-bridged nucleic acid (GuNA) monomers, spirocyclopropylene-bridged nucleic acid (scpBNA) monomers, and derivatives thereof. The present invention also encompasses the introduction of two or more distinct scaffold BNA modifications into the oligonucleotide, where each occurrence of the BNA scaffold modification is a conformationally restricted nucleotide (CRN) monomer, a locked nucleic acid (LNA) monomer, a xylo-LNA monomer, an α-L-LNA monomer, a β-D-LNA monomer, a 2'-amino-LNA monomer, a 2'-(alkylamino)-LNA monomer, a 2'-(acylamino)-LNA monomer, a 2'-N-substituted-2'-amino-LNA monomer, a (2'-O,4'-C) constrained ethyl (cEt) LNA monomer, a (2'-O,4'-C) constrained methoxyethyl (cMOE) BNA monomer, a 2',4'-BNA NC (NH) monomer, 2',4'-BNA NCMore preferably, the BNA scaffold modification results in a monomer independently selected from the group consisting of an (N-Me) monomer, an ethylene-bridged nucleic acid (ENA) monomer, a 2'-C-bridged bicyclic nucleotide (CBBN) monomer, and derivatives thereof. In preferred embodiments, the BNA scaffold modification results in an LNA monomer, an ENA monomer, a cEt BNA monomer, an oxo-CBBN monomer, a 2'-amino-LNA monomer, or a cMOE BNA monomer. In highly preferred embodiments, the BNA scaffold modification results in an LNA monomer, an ENA monomer, a cEt BNA monomer, or a cMOE BNA monomer. Most preferably, the BNA scaffold modification results in an LNA monomer.

[0027] Throughout this application, any monomer containing a BNA scaffold modification may be replaced by any other monomer containing a BNA modification, preferably while preserving its nucleobase or modified nucleobase. In other words, the scaffold modification may be exchanged while preserving the sequence of the oligonucleotide. As a non-limiting example, an LNA monomer containing adenine may be replaced by an ENA monomer containing adenine.

[0028] Exemplary structures of monomers containing these BNA scaffold modifications are shown below, where B is a base as defined herein above, X is a variable such as a heteroatom or methylene moiety, X2 is a hydroxyl moiety or another 2'-substitution as defined herein above, and L is a backbone linkage as defined herein above. In the literature, the names of such modifications are often arbitrary and not amenable to uniform conversion; in this application, the names provided below shall refer to the structures provided below. For comparison, the cyclic scaffold of a conventional RNA monomer is shown first. In the structures shown below, the monomer is usually represented as the 3'-terminal monomer. When chirality is not indicated, each enantiomer is referred to individually. The present invention is not limited to this type of monomer, which is provided for illustrative purposes. Heteroatoms contained in the cyclic moiety can be replaced by other heteroatoms. [ka] TIFF0007817791000003.tif187149

[0029] The following is a non-comprehensive overview of literature references for the BNA scaffold modifications shown above: cEt (2'-O,4'-C constrained ethyl) LNA (doi:10.1021 / ja710342q), cMOE (2'-O,4'-C constrained methoxyethyl) LNA (Seth et al., J. Org. Chem. 2010, 75, 1569-1581), 2',4'-BNA NC (NH), 2',4'-BNA NC(N-Me), ethylene-bridged nucleic acid (ENA) (doi:10.1093 / nass / 1.1.241), carba LNA (cLNA) (doi:10.1021 / jo100170g), DpNA (Osawa et al., J. Org. Chem., 2015, Vol. 80 (No. 21), pp. 10474-10481), 2'-C-bridged bicyclic nucleotides (CBBN, e.g., as in WO 2014 / 145356 (MiRagen Therapeutics)), heterocyclic bridged LNA (e.g., as in WO 2014 / 126229 (Mitsuoka Y et al.)), amide bridged LNA (e.g., as in WO 2014 / 126229 (Mitsuoka Y et al.)), Org. Biomol. Chem. 2015, Vol. 13, p. 3757), urea-bridged LNA (e.g., Nishida et al. Chem. Commun. 2010, Vol. 46, p. 5283), sulfonamide-bridged LNA (e.g., as in WO 2014 / 112463 (Obika S et al.)), bicyclic carbocyclic nucleosides (e.g., as in WO 2015 / 142910 (Ionis Pharmaceuticals)), TriNA (Hanessian et al., J. Org. Chem. 2013, Vol. 78(18), pp. 9064-9075), α-L-TriNA, bicycloDNA (bcDNA) (Bolli et al., Chem Biol. March 1996; Vol. 3(3): pp. 197-206), F-bcDNA (DOI: 10.1021 / jo402690j), tricyclic DNA (tcDNA) (Murray et al., Nucl. Acids Res. 2012, Vol. 40, No. 13, pp. 6135-6143), F-tcDNA (doi: 10.1021 / acs.joc.5b00184), oxetane nucleotide monomers (Nucleic Acids Res. 2004, Vol. 32, pp. 5791-5799), scpNA (Horiba et al., J. Org. Chem. 2016, doi: 10.1021 / acs.joc.6b02036), GuNA (Shrestha et al., Chem. Commun. 2014, doi:10.1039 / C3CC46017G).For anything not mentioned above, reference is made to WO 2011 / 097641 (ISIS / Ionis Pharmaceuticals) and WO 2016 / 017422 (Osaka University), the entire contents of which are incorporated herein by reference.

[0030] The oligonucleotide of the present invention comprising BNA and 5-methylcytosine and / or 5-methyluracil bases means that at least one of the cytosine nucleobases of the oligonucleotide is modified by replacing the hydrogen at position 5 of the pyrimidine ring with a methyl group, i.e., in combination with 5-substituted cytosine, at least one of the scaffolds of the oligonucleotide is modified by replacing with BNA, and / or at least one of the uracil nucleobases of the oligonucleotide is modified by replacing the proton at position 5 of the pyrimidine ring with a methyl group (i.e., 5-methyluracil).In the context of the present invention, the expression "replacement of hydrogen at position 5 of the pyrimidine ring with a methyl group" can be replaced with the expression "replacement of pyrimidine with 5-methylpyrimidine", and pyrimidine refers to only uracil, only cytosine, or both. When the oligonucleotide contains 1, 2, 3, 4, 5, 6, 7, 8, 9 or more cytosines and / or uracils, at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or more cytosines and / or uracils, respectively, are modified in this manner. Preferably, all cytosines and / or uracils are modified in this manner or replaced by 5-methylcytosines and / or 5-methyluracils, respectively. Needless to say, the present invention can therefore be applied to oligonucleotides containing at least one cytosine or uracil, respectively, in their sequence.

[0031] Since RNA / RNA duplexes are extremely stable, oligonucleotides according to the present invention preferably comprise RNA monomers. Preferably, RNA oligonucleotides comprise modifications that provide additional properties to RNA, such as resistance to endonucleases, exonucleases, and RNase H, increased hybridization ability, increased stability (e.g., in body fluids), increased or decreased mobility, increased activity, reduced toxicity, increased intracellular transport, increased cellular uptake, tissue specificity, etc. Furthermore, it is preferred that mRNA complexed with the oligonucleotides of the present invention is not susceptible to RNase H cleavage. Preferred modifications have been identified above.

[0032] Therefore, the present invention provides an oligonucleotide comprising a BNA, which comprises or consists of 2'-O-methyl phosphorothioate RNA monomers, with or without 5-methylpyrimidine bases.This oligonucleotide consists of 2'-O-methyl RNA monomers connected via phosphorothioate or phosphate backbone, and all of its cytosines and / or all of its uracils are independently replaced by 5-methylcytosines and / or 5-methyluracils, most preferably at least one 2'-O-methyl scaffold is replaced by BNA.Therefore, the oligonucleotide of the present invention, in addition to having at least one BNA scaffold modification: at least one, and preferably all, cytosines substituted with 5-methylcytosine; at least one, preferably all, cytosines substituted with 5-methylcytosine and at least one uracil substituted with 5-methyluracil, At least one uracil substituted with 5-methyluracil may have:

[0033] In a preferred embodiment of this aspect, there is provided an oligonucleotide as described above, wherein said oligonucleotide comprises 1, 2, 3, 4, 5 or 6 monomers comprising a bicyclic nucleic acid (BNA) scaffold modification, preferably a bridged nucleic acid scaffold modification.

[0034] In these embodiments, it is preferred that at least one BNA scaffold modification be included in the terminal monomer of the oligonucleotide, preferably the 5'-terminal monomer. Most preferred is that both terminal monomers comprise a BNA scaffold. As such, a more preferred embodiment of this aspect provides an oligonucleotide in accordance with the present invention, wherein at least one bicyclic nucleic acid (BNA) scaffold modification is included in the terminal monomer of the oligonucleotide, preferably the 5'-terminal monomer of the oligonucleotide, more preferably both terminal monomers of the oligonucleotide. Other preferred embodiments require that the terminal monomer and its adjacent monomer each comprise a BNA scaffold. In such cases, the first two monomers or the last two monomers of the oligonucleotide each comprise a BNA scaffold. This can be combined in some way, for example, so that the first and last two monomers or the first two and last monomers all comprise a BNA scaffold. When an oligonucleotide in accordance with the present invention comprises a terminal monomer comprising a BNA scaffold, it is preferred that an additional monomer having a BNA scaffold is either at the other end or adjacent to the terminal monomer having a BNA scaffold.

[0035] A preferred embodiment of this aspect provides an oligonucleotide of the invention, wherein said oligonucleotide comprises a BNA modification selected from the set consisting of: A single BNA scaffold modification at the 5' end of the monomer, A single BNA scaffold modification at the 3' end of the monomer, two BNA scaffold modifications, one in the 5'-end monomer and one in the 3'-end monomer; two BNA scaffold modifications, one closest to the 5' end in each of the two monomers; two BNA scaffold modifications, one closest to the 3' end in each of the two monomers; 3-7 BNA scaffold modifications, one in the 5'-terminal monomer and one in the 3'-terminal monomer, and 1-5 BNA scaffold modifications in non-terminal residues; 3-6 BNA scaffold modifications, one in the 5'-terminal monomer and one in the 3'-terminal monomer, and 1-4 BNA scaffold modifications in non-terminal residues; 3-5 BNA scaffold modifications, one in the 5'-terminal monomer and one in the 3'-terminal monomer, and 1-3 BNA scaffold modifications in non-terminal residues; three or four BNA scaffold modifications, one in the 5'-terminal monomer and one in the 3'-terminal monomer, and one or two BNA scaffold modifications in non-terminal residues; three BNA scaffold modifications, one in the 5'-terminal monomer, one in the 3'-terminal monomer, and one BNA scaffold modification in a non-terminal residue; 4-6 BNA scaffold modifications, one in the 5'-terminal monomer and one in the 3'-terminal monomer, and 2-4 BNA scaffold modifications in non-terminal residues; Four or five BNA scaffold modifications, one in the 5'-terminal monomer, one in the 3'-terminal monomer, and two to three BNA scaffold modifications in non-terminal residues.

[0036] The oligonucleotides according to the invention are selected from the group consisting of SEQ ID NOs: 8, 14, 20, 26, 32, 38, 44, 50, 56, 62, 68, 74, 80, 86, 92, 98, 104, 110, 116, 122, 128, 134, 140, 146, 152, 158, 164, 170, 176, 182, 188, 194, 200, 206, 212, 218, 224, 230, 236, 242, 248, 254, 260, 266, 272, 278, 284, 290, 296, 302, 308, 314, 320, 326, 332, 338, 344, 350, 356, 362, 368, 370, 372, 376, 378, 380, 382, ​​384, 386, 388, 390, 400, 406, 408, 410, 412, 414, 416, 420, 426, 430, 436, 440, 442, 448, 450, 456, 456, 462, 468, 470, 472, 476, 480, 482, 484, 490, 500, 502, 504, 506, 5 74, 380, 386, 392, 398, 404, 410, 416, 422, 428, 434, 440, 446, 452, 458, 464, 470, 476, 482, 488, 494, 500, 506, 512, 518, 524, 530, 536, 542, 548, 554, 56 0, 566, 572, 578, 584, 590, 596, 602, 608, 614, 620, 626, 632, 638, 644, 650, 656, 662, 668, 674, 680, 686, 692, 698, 704, 710, 716, 722, 728, 734, 740, 746 , 752, 758, 764, 770, 776, 782, 788, 794, 800, 806, 812, 818, 824, 830, 836, 842, 848, 854, 860, 866, 872, 878, 884, 890, 896, 902, 908, 914, 920, 926, 932 ,938,944,950,956,962,968,974,980,986,992,998,1004,1010,1016,1022,1028,1034,1040,1046,1052,1058,1064,1070,1076,1082,1088,1094, 1100, 1106, 1112, 1118, 1124, 1130, 1136, 1142, 1148, 1154, 1160, 1166, 1172, 1178, 1184, 1190, 1196, 1202, 1208, 1214, 1220, 1226, 1232, 1238, 1244, 1250, 1256, 1262, 1268, 1274, 1280, 1286, 1292, 1298, 1304, 1310, 1316, 1322, 1328, 1334, 1340, 1346, 1352, 1358, 1364, 1370, 1376, 1382, 1388, 1394,Preferably, at least one BNA scaffold modification is included in the oligonucleotide when the oligonucleotide comprises or consists of a sequence represented by: 1400, 1406, 1412, 1418, 1424, 1430, 1436, 1442, 1448, 1454, 1460, 1466, 1472, 1478, 1484, 1490, 1496, 1502, 1508, 1514, 1520, 1526, 1532, 1538, 1544, 1550, 1556, 1562, 1568, 1574, or 1580.

[0037] The oligonucleotides according to the invention are selected from the group consisting of SEQ ID NOs: 9, 15, 21, 27, 33, 39, 45, 51, 57, 63, 69, 75, 81, 87, 93, 99, 105, 111, 117, 123, 129, 135, 141, 147, 153, 159, 165, 171, 177, 183, 189, 195, 201, 207, 213, 219, 225, 231, 237, 243, 249, 255, 261, 267, 273, 279, 285, 291, 297, 303, 309, 315, 321, 327, 333, 339, 345, 351, 357, 363, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 400, 401, 402, 403, 404, 405, 406, 407, 408, 410, 411, 412, 413, 414, 415, 416, 417, 418, 420, 4 75, 381, 387, 393, 399, 405, 411, 417, 423, 429, 435, 441, 447, 453, 459, 465, 471, 477, 483, 489, 495, 501, 507, 513, 519, 525, 531, 537, 543, 549, 555, 56 1, 567, 573, 579, 585, 591, 597, 603, 609, 615, 621, 627, 633, 639, 645, 651, 657, 663, 669, 675, 681, 687, 693, 699, 705, 711, 717, 723, 729, 735, 741, 747 , 753, 759, 765, 771, 777, 783, 789, 795, 801, 807, 813, 819, 825, 831, 837, 843, 849, 855, 861, 867, 873, 879, 885, 891, 897, 903, 909, 915, 921, 927, 933 , 939, 945, 951, 957, 963, 969, 975, 981, 987, 993, 999, 1005, 1011, 1017, 1023, 1029, 1035, 1041, 1047, 1053, 1059, 1065, 1071, 1077, 1083, 1089, 1095, 1101, 1107, 1113, 1119, 1125, 1131, 1137, 1143, 1149, 1155, 1161, 1167, 1173, 1179, 1185, 1191, 1197, 1203, 1209, 1215, 1221, 1227, 1233, 1239, 1245, 1251, 1257, 1263, 1269, 1275, 1281, 1287, 1293, 1299, 1305, 1311, 1317, 1323, 1329, 1335, 1341, 1347, 1353, 1359, 1365, 1371, 1377, 1383, 1389, 1395,1401, 1407, 1413, 1419, 1425, 1431, 1437, 1443, 1449, 1455, 1461, 1467, 1473, 1479, 1485, 1491, 1497, 1503, 1509, 1515, 1521, 1527, 1533, 1539, 1545, 1551, 1557, 1563, 1569, or 1575, it is preferred that only the 5'-terminal monomer of the oligonucleotide contains a BNA scaffold modification.

[0038] The oligonucleotides according to the invention are selected from the group consisting of SEQ ID NOs: 10, 16, 22, 28, 34, 40, 46, 52, 58, 64, 70, 76, 82, 88, 94, 100, 106, 112, 118, 124, 130, 136, 142, 148, 154, 160, 166, 172, 178, 184, 190, 196, 202, 208, 214, 220, 226, 232, 238, 244, 250, 256, 262, 268, 274, 280, 286, 292, 298, 304, 310, 316, 322, 328, 334, 340, 346, 352, 358, 364, 370, 376, 382, ​​388, 394, 400, 406, 412, 418, 424, 430, 436, 442, 448, 454, 460, 466, 472, 478, 484, 490, 496, 502, 508, 514, 520, 526, 532, 538, 544, 550, 556, 5 62, 568, 574, 580, 586, 592, 598, 604, 610, 616, 622, 628, 634, 640, 646, 652, 658, 664, 670, 676, 682, 688, 694, 700, 706, 712, 718, 724, 730, 736, 742, 74 8, 754, 760, 766, 772, 778, 784, 790, 796, 802, 808, 814, 820, 826, 832, 838, 844, 850, 856, 862, 868, 874, 880, 886, 892, 898, 904, 910, 916, 922, 928, 934 , 940, 946, 952, 958, 964, 970, 976, 982, 988, 994, 1000, 1006, 1012, 1018, 1024, 1030, 1036, 1042, 1048, 1054, 1060, 1066, 1072, 1078, 1084, 1090, 1096 , 1102, 1108, 1114, 1120, 1126, 1132, 1138, 1144, 1150, 1156, 1162, 1168, 1174, 1180, 1186, 1192, 1198, 1204, 1210, 1216, 1222, 1228, 1234, 1240, 1246 , 1252, 1258, 1264, 1270, 1276, 1282, 1288, 1294, 1300, 1306, 1312, 1318, 1324, 1330, 1336, 1342, 1348, 1354, 1360, 1366, 1372, 1378, 1384, 1390, 1396,1402, 1408, 1414, 1420, 1426, 1432, 1438, 1444, 1450, 1456, 1462, 1468, 1474, 1480, 1486, 1492, 1498, 1504, 1510, 1516, 1522, 1528, 1534, 1540, 1546, 1552, 1558, 1564, 1570, or 1576, it is preferred that only the 3'-terminal monomer of the oligonucleotide comprises a BNA scaffold modification.

[0039] The oligonucleotides according to the invention are selected from the group consisting of SEQ ID NOs: 11, 17, 23, 29, 35, 41, 47, 53, 59, 65, 71, 77, 83, 89, 95, 101, 107, 113, 119, 125, 131, 137, 143, 149, 155, 161, 167, 173, 179, 185, 191, 197, 203, 209, 215, 221, 227, 233, 239, 245, 251, 257, 263, 269, 275, 281, 287, 293, 299, 305, 311, 317, 323, 329, 335, 341, 347, 353, 359, 365, 371, 377, 383, 389, 395, 401, 407, 413, 419, 425, 431, 437, 443, 449, 455, 461, 467, 473, 479, 485, 491, 497, 503, 509, 515, 521, 527, 533, 539, 545, 551, 557, 5 63, 569, 575, 581, 587, 593, 599, 605, 611, 617, 623, 629, 635, 641, 647, 653, 659, 665, 671, 677, 683, 689, 695, 701, 707, 713, 719, 725, 731, 737, 743, 74 9, 755, 761, 767, 773, 779, 785, 791, 797, 803, 809, 815, 821, 827, 833, 839, 845, 851, 857, 863, 869, 875, 881, 887, 893, 899, 905, 911, 917, 923, 929, 935 , 941, 947, 953, 959, 965, 971, 977, 983, 989, 995, 1001, 1007, 1013, 1019, 1025, 1031, 1037, 1043, 1049, 1055, 1061, 1067, 1073, 1079, 1085, 1091, 1097 , 1103, 1109, 1115, 1121, 1127, 1133, 1139, 1145, 1151, 1157, 1163, 1169, 1175, 1181, 1187, 1193, 1199, 1205, 1211, 1217, 1223, 1229, 1235, 1241, 1247 , 1253, 1259, 1265, 1271, 1277, 1283, 1289, 1295, 1301, 1307, 1313, 1319, 1325, 1331, 1337, 1343, 1349, 1355, 1361, 1367, 1373, 1379, 1385, 1391, 1397,1403, 1409, 1415, 1421, 1427, 1433, 1439, 1445, 1451, 1457, 1463, 1469, 1475, 1481, 1487, 1493, 1499, 1505, 1511, 1517, 1523, 1529, 1535, 1541, 1547, 1553, 1559, 1565, 1571, or 1577, it is preferred that both the 5'-terminal monomer and the 3'-terminal monomer of the oligonucleotide comprise a BNA scaffold modification.

[0040] The oligonucleotides according to the invention are selected from the group consisting of SEQ ID NOs: 12, 18, 24, 30, 36, 42, 48, 54, 60, 66, 72, 78, 84, 90, 96, 102, 108, 114, 120, 126, 132, 138, 144, 150, 156, 162, 168, 174, 180, 186, 192, 198, 204, 210, 216, 222, 228, 234, 240, 246, 252, 258, 264, 270, 276, 282, 288, 294, 300, 306, 312, 318, 324, 330, 336, 342, 348, 354, 360, 366, 372, 378, 384, 390, 396, 402, 408, 414, 420, 426, 432, 438, 444, 450, 456, 462, 468, 474, 480, 486, 492, 498, 504, 510, 516, 522, 528, 534, 540, 546, 552, 558, 5 64, 570, 576, 582, 588, 594, 600, 606, 612, 618, 624, 630, 636, 642, 648, 654, 660, 666, 672, 678, 684, 690, 696, 702, 708, 714, 720, 726, 732, 738, 744, 75 0, 756, 762, 768, 774, 780, 786, 792, 798, 804, 810, 816, 822, 828, 834, 840, 846, 852, 858, 864, 870, 876, 882, 888, 894, 900, 906, 912, 918, 924, 930, 936 , 942, 948, 954, 960, 966, 972, 978, 984, 990, 996, 1002, 1008, 1014, 1020, 1026, 1032, 1038, 1044, 1050, 1056, 1062, 1068, 1074, 1080, 1086, 1092, 1098 , 1104, 1110, 1116, 1122, 1128, 1134, 1140, 1146, 1152, 1158, 1164, 1170, 1176, 1182, 1188, 1194, 1200, 1206, 1212, 1218, 1224, 1230, 1236, 1242, 1248 , 1254, 1260, 1266, 1272, 1278, 1284, 1290, 1296, 1302, 1308, 1314, 1320, 1326, 1332, 1338, 1344, 1350, 1356, 1362, 1368, 1374, 1380, 1386, 1392, 1398,1404, 1410, 1416, 1422, 1428, 1434, 1440, 1446, 1452, 1458, 1464, 1470, 1476, 1482, 1488, 1494, 1500, 1506, 1512, 1518, 1524, 1530, 1536, 1542, 1548, 1554, 1560, 1566, 1572, or 1578, it is preferred that only the two most 5'-terminal monomers of the oligonucleotide both comprise a BNA scaffold modification.

[0041] The oligonucleotides according to the invention are selected from the group consisting of SEQ ID NOs: 13, 19, 25, 31, 37, 43, 49, 55, 61, 67, 73, 79, 85, 91, 97, 103, 109, 115, 121, 127, 133, 139, 145, 151, 157, 163, 169, 175, 181, 187, 193, 199, 205, 211, 217, 223, 229, 235, 241, 247, 253, 259, 265, 271, 277, 283, 289, 295, 301, 307, 313, 319, 325, 331, 337, 343, 349, 355, 361, 367, 373, 379, 385, 391, 397, 403, 409, 415, 421, 427, 433, 439, 445, 451, 457, 463, 469, 475, 481, 487, 493, 499, 505, 511, 517, 523, 529, 535, 541, 547, 553, 559, 5 65, 571, 577, 583, 589, 595, 601, 607, 613, 619, 625, 631, 637, 643, 649, 655, 661, 667, 673, 679, 685, 691, 697, 703, 709, 715, 721, 727, 733, 739, 745, 75 1, 757, 763, 769, 775, 781, 787, 793, 799, 805, 811, 817, 823, 829, 835, 841, 847, 853, 859, 865, 871, 877, 883, 889, 895, 901, 907, 913, 919, 925, 931, 937 , 943, 949, 955, 961, 967, 973, 979, 985, 991, 997, 1003, 1009, 1015, 1021, 1027, 1033, 1039, 1045, 1051, 1057, 1063, 1069, 1075, 1081, 1087, 1093, 1099 , 1105, 1111, 1117, 1123, 1129, 1135, 1141, 1147, 1153, 1159, 1165, 1171, 1177, 1183, 1189, 1195, 1201, 1207, 1213, 1219, 1225, 1231, 1237, 1243, 1249 , 1255, 1261, 1267, 1273, 1279, 1285, 1291, 1297, 1303, 1309, 1315, 1321, 1327, 1333, 1339, 1345, 1351, 1357, 1363, 1369, 1375, 1381, 1387, 1393, 1399,1405, 1411, 1417, 1423, 1429, 1435, 1441, 1447, 1453, 1459, 1465, 1471, 1477, 1483, 1489, 1495, 1501, 1507, 1513, 1519, 1525, 1531, 1537, 1543, 1549, 1555, 1561, 1567, 1573, or 1579, it is preferred that only the two most 3'-terminal monomers of the oligonucleotide both comprise a BNA scaffold modification.

[0042] When an oligonucleotide according to the invention comprises or consists of a sequence represented by a SEQ ID NO: other than SEQ ID NO: 1580, said oligonucleotide preferably comprises 5-methylcytosine in place of cytosine, and said oligonucleotide preferably comprises at least one 2'-O-methyl phosphorothioate monomer, more preferably comprises only 2'-O-methyl phosphorothioate monomers. When an oligonucleotide according to the invention comprises or consists of a sequence represented by SEQ ID NO: 1580, said oligonucleotide preferably comprises cytosine in place of 5-methylcytosine, and said oligonucleotide preferably comprises at least one 2'-O-methyl phosphorothioate monomer, more preferably comprises only 2'-O-methyl phosphorothioate monomers. Whenever a SEQ ID NO: refers to T or U, said monomer comprises a BNA scaffold modification, and said monomer (i.e., said reference) may optionally be replaced by U or T, respectively. Whenever a SEQ ID NO: refers to C or 5-methyl-C, said monomer comprises a BNA scaffold modification, said reference may optionally be replaced by 5-methyl-C or C, respectively.

[0043] Throughout this application, BNA scaffold modifications may always be included in an oligonucleotide unless explicitly stated otherwise. However, for ease of reading, this will not always be explicitly spelled out. This means that whenever an oligonucleotide is said to comprise or consist of only a particular type of monomer, this does not exclude the presence of a BNA scaffold modification when it is described as being present. For example, an oligonucleotide consisting of only 2'-O-methyl RNA monomers may nevertheless contain a monomer with a BNA scaffold modification. This will be clear from the context (e.g., when an AON is said to consist of only one monomer, it still further includes the BNA scaffold modification).

[0044] In a preferred embodiment of this aspect, an oligonucleotide according to the present invention is provided, wherein the oligonucleotide is complementary, preferably reverse complementary, or binds to, targets, or hybridizes with at least a portion of an exon and / or non-exon region, or preferably comprises or consists of a sequence that is complementary to, binds to, targets, or hybridizes with at least a portion of an exon recognition sequence (ERS), exon splicing silencer (ESS), intron splicing silencer (ISS), SR protein binding site, or another splicing element, signal, or structure. It is understood that when such an oligonucleotide is complementary, it may also be reverse complementary. In the present application, the term "complementary" encompasses both forward-complementary and reverse-complementary sequences, as will be clear to those skilled in the art from the context.

[0045] In this regard, preferred sequences to which the oligonucleotides according to the invention are complementary, bind to, target, or hybridize are dystrophin exons, such as dystrophin pre-mRNA exons 2 to 78. Preferred dystrophin exons are exons 2 to 78, more preferably exons 10 to 60, and most preferably exons 44 to 55, and preferred non-exonic regions are introns 1 to 78. More preferred exons to which the oligonucleotides are complementary, bind to, target, or hybridize are dystrophin pre-mRNA exons 44, 45, 51, 52, 53, and 55. Preferred exons to which the oligonucleotides are complementary, bind to, target, or hybridize are dystrophin pre-mRNA exons 44, 45, 51, 52, 53, and 55. Such oligonucleotides hybridize to at least a portion of a dystrophin pre-mRNA exon selected from exons 44, 45, 51, 52, 53, and 55, and most preferably have a length of 10 to 33 nucleotides, more preferably 16 to 22 nucleotides. Thus, in a preferred embodiment, an oligonucleotide according to the present invention is provided, wherein the oligonucleotide is complementary, preferably reverse complementary, to at least a portion of an exon and / or non-exon region, and the at least a portion of the exon and / or non-exon region has a length of 10 to 33 nucleotides, preferably 16 to 22 nucleotides. More preferably, the at least a portion of the exon and / or non-exon region has a length of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Thus, it is preferred that at least part of the exon and / or non-exon region has a length of at most 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 or 10 nucleotides, most preferably 16, 17, 18, 19, 20, 21 or 22 nucleotides.

[0046] Furthermore, in this context, other preferred sequences to which the oligonucleotides according to the invention are complementary to, bind to, target or hybridize are SMN2 splicing regulatory elements, preferably, for example, those in introns 6 and 7, more preferably, for example, the splicing silencer ISS-N1 in intron 7.

[0047] Thus, in a preferred embodiment, there is provided an oligonucleotide according to the present invention, wherein said exon and / or non-exon region is in the DMD gene or in the SMN gene. The SMN gene may be the SMN1 gene or the SMN2 gene, preferably the SMN2 gene.

[0048] The oligonucleotide of the present invention is preferably represented by a nucleotide sequence comprising or consisting of a sequence capable of binding to, targeting, or being complementary to a portion of an exon of dystrophin pre-mRNA. The binding or targeting portion may be at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, 98%, or up to 100% of the length of the oligonucleotide of the present invention. The oligonucleotide may be represented by a nucleotide sequence, which comprises a sequence that binds to, targets, or is complementary to at least a portion of dystrophin pre-mRNA as defined herein, as well as additional sequences flanking each of them. In a more preferred embodiment, the length of the binding or targeting portion of the oligonucleotide is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. Several types of sequences flanking each of them may be used. The sequences located at each end are preferably used to modify the binding of proteins to the oligonucleotide or to modify the thermodynamic properties of the oligonucleotide, and more preferably to modify the target RNA binding affinity. In another preferred embodiment, the additional sequences located at each end are complementary to a sequence of dystrophin pre-mRNA that is not present in the exon. Preferably, such sequences located at each end are capable of binding to or targeting a sequence comprising or consisting of a branching site and / or a splice site acceptor or donor consensus sequence of the exon. In a preferred embodiment, such sequences located at each end are capable of binding to or targeting a sequence comprising or consisting of a sequence of an intron of dystrophin pre-mRNA adjacent to the exon.

[0049] A preferred oligonucleotide of the present invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 8 to 1580 or 1592 to 1607, or a nucleotide sequence comprising or consisting of a fragment of SEQ ID NOs: 8 to 1580 or 1592 to 1607, preferably, the oligonucleotide is represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 453 to 613, 1592 to 1605, or 1607, or a nucleotide sequence comprising or consisting of SEQ ID NOs: 453 to 613, 1592 to 1605, or 1607, more preferably, the oligonucleotide is represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 453, ... or by a nucleotide sequence comprising or consisting of SEQ ID NO: 453, and are represented by a nucleotide sequence comprising or consisting of 455, 456, 459, 461, 462, 465, 467, 468, 471, 473, 474, 486, 483, 1592, 1593, 1594, 1595, 1596, 1597, 1598, 1599, 1600, 1601, 1602, 1603, 1604, 1605 or 1607. Preferably, within the context of the present invention, a fragment of a SEQ ID NO means a nucleotide sequence comprising or consisting of at least 10 consecutive nucleotides from said SEQ ID NO.

[0050] More preferred oligonucleotides of the present invention are those represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 8 to 1580, 1592 to 2099, or 3000 to 6048, or by a nucleotide sequence comprising or consisting of a fragment of SEQ ID NOs: 8 to 1580, 1592 to 2099, or 3000 to 6048; more preferably, the oligonucleotide is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 455, 459, 4528, 4531, 4532, 4533, 4535, 4542, 4548, or 4568, or by a nucleotide sequence comprising or consisting of a fragment of SEQ ID NO: 455, 459, 4528, 4531, 4532, 4533, 4535, 4542, 4548, or 4568.

[0051] More preferred oligonucleotides of the present invention are those represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 8 to 1580, 1592 to 2099, or 3000 to 6048, or by a nucleotide sequence comprising or consisting of a fragment of SEQ ID NOs: 8 to 1580, 1592 to 2099, or 3000 to 6048, and preferably those represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 453, 455, 456, 459, 461, 462, 465, 467, 468, 471, 473, 474, 483, or 486, or by a nucleotide sequence comprising or consisting of SEQ ID NOs: 453, 455, 456, 459, 461, 462, 465, 467, 468, 471, 473, 474, 483 or 486 fragment, more preferably the oligonucleotide is represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 452 to 613, 4528 to 4572, or by a nucleotide sequence comprising or consisting of SEQ ID NOs: 452 to 613, 4528 to 4572, and most preferably the oligonucleotide is represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 455, 459, 4528, 4531, 4532, 4533, 4535, 4542, 4548, or 4568, or by a nucleotide sequence comprising or consisting of SEQ ID NOs: 455, 459, 4528, 4531, 4532, 4533, 4535, 4542, 4548, or 4568.

[0052] Preferred AONs are those in which the oligonucleotide comprises a pre-mRNA splicing modulation, preferably the pre-mRNA splicing modulation alters protein production or composition, preferably the pre-mRNA splicing modulation comprises exon skipping or exon inclusion, most preferably the pre-mRNA splicing modulation comprises exon skipping, which pre-mRNA splicing modulation is preferably used in connection with a therapeutic application as defined hereinafter.

[0053] The purpose of pre-mRNA splicing modulation can be to alter the production of a protein, most often the protein encoded by that RNA. This production can be altered by increasing or decreasing the level of said production. This production can also be altered by altering the composition of the protein actually produced, for example, when pre-mRNA splicing modulation results in the inclusion or exclusion of one or more exons and a protein with a different amino acid sequence. Such a protein with a different amino acid sequence preferably has more functionality, or better functionality, or at least one altered property than the protein produced as a result of the disease or condition.

[0054] In the case of DMD, pre-mRNA splicing modulation may be applied to skip one or more specific exons in the dystrophin pre-mRNA to restore the open reading frame of the transcript and induce the expression of a shorter but (more) functional dystrophin protein, with the ultimate goal of interfering with the disease process. A similar strategy may be used to interfere with the process of BMD. In the case of SMA, pre-mRNA splicing modulation may be applied to enhance the inclusion of exon 7 in the SMN2 gene and increase the level of motor neuron protein survival, thereby reducing motor neuron loss in the spinal cord and subsequent voluntary muscle atrophy. As such, in a preferred embodiment, an oligonucleotide according to the present invention is provided, which induces pre-mRNA splicing modulation, and which alters the production of a protein associated with a disease or condition, preferably Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), or spinal muscular atrophy (SMA).

[0055] The AON is intended for use in modulating the splicing of a therapeutic pre-mRNA. The AON is preferably an oligonucleotide complementary to a specific sequence of a dystrophin or SMN2 pre-mRNA derived from the coding strand of an individual's DNA. The oligonucleotide binds to or targets the sequence of the pre-mRNA. In the context of the present invention, the therapeutic pre-mRNA may also be referred to as the affected pre-mRNA of a gene involved in a genetic disease. Thus, modulating the splicing of the therapeutic pre-mRNA allows for the treatment of the genetic disease.

[0056] In the case of DMD or BMD, pre-mRNA splicing modulation may be applied to skip one or more specific exons in the dystrophin pre-mRNA to restore the open reading frame of the transcript and induce the expression of a shorter but (more) functional dystrophin protein, with the ultimate goal of slowing or even halting disease progression.

[0057] In a preferred embodiment, the oligonucleotides of the present invention are used to induce exon skipping in dystrophin pre-mRNA in cells, organs, tissues, and / or individuals. Exon skipping results in a mature dystrophin mRNA that does not contain the skipped exon, and therefore, if the exon encodes an amino acid, can lead to the expression of a shorter protein product. Preferably, the skipping of at least one exon is induced by binding of the AON to a sequence within a specific exon, including a splicing regulatory element, a splice site, and / or an intron branch site sequence.

[0058] In a preferred embodiment, the present invention also encompasses oligonucleotides, sometimes referred to as multi-skipping, suitable for skipping multiple exons. Such oligonucleotides according to the present invention are capable of binding to a region of a first exon and a region of a second exon within the same pre-mRNA, the region of the second exon having at least 50% identity with the region of the first exon. Preferably, these oligonucleotides are capable of inducing skipping of the first and second exons of the pre-mRNA. Skipping of additional exon(s) is also induced, preferably located between the first and second exons. The resulting transcript of the pre-mRNA in which the exon has been skipped is in-frame. More details about such oligonucleotides are provided in WO2014007620.

[0059] As defined herein, DMD pre-mRNA preferably refers to the pre-mRNA of the DMD gene encoding the dystrophin protein. Mutated DMD pre-mRNA corresponds to the pre-mRNA of a BMD or DMD patient, which has a mutation compared to the wild-type DMD pre-mRNA of an unaffected person, resulting in an abnormal protein (BMD) or the absence of functional dystrophin (DMD) (its reduced level). DMD pre-mRNA is also referred to as dystrophin pre-mRNA. The DMD gene may also be referred to as the dystrophin gene. Dystrophin and DMD may be used interchangeably throughout this application.

[0060] Preferably, patient refers to a patient with DMD or BMD, as defined herein below, or a patient who is prone to developing DMD or BMD due to their genetic background. In the case of DMD patients, the oligonucleotides used preferably correct a single mutation present in the patient's DMD gene and generate a protein that resembles a BMD protein. Preferably, the protein results in functional or semi-functional dystrophin, as defined herein below. In the case of BMD patients, the oligonucleotides used preferably correct a single mutation present in the patient's BMD gene and generate a dystrophin that is more functional than the dystrophin originally present in the BMD patient.

[0061] As defined herein, functional dystrophin is preferably wild-type dystrophin, corresponding to the protein having the amino acid sequence as identified in SEQ ID NO: 1. As defined herein, semi-functional dystrophin is preferably BMD-like dystrophin, having an active binding domain in its N-terminal portion (the first 240 amino acids at the N-terminus), a cysteine-rich domain (amino acids 3361 to 3685), and a C-terminal domain (the last 325 amino acids at the C-terminus), each of which domains corresponds to the protein present in wild-type dystrophin, as known to those skilled in the art. The amino acids shown herein correspond to the amino acids of wild-type dystrophin represented by SEQ ID NO: 1. In other words, functional or semi-functional dystrophin is dystrophin that exhibits, at least to some extent, the activity of wild-type dystrophin. "At least to some extent" preferably means at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% of the corresponding activity of wild-type functional dystrophin. In this context, the activity of functional dystrophin is preferably binding to actin and to the dystrophin-associated glycoprotein complex (DGC or DAPC) (Ehmsen J et al., 2002).

[0062] Association of dystrophin with actin and with the DGC or DAPC complexes can be visualized by either co-immunoprecipitation using total protein extracts or immunofluorescence analysis of cross sections using different antibodies reactive with different members of the complexes, obtained from control (non-DMD) biopsies from suspected dystrophic muscles before and / or after treatment, as known to those skilled in the art.

[0063] Individuals or patients with Duchenne muscular dystrophy usually have a mutation in the gene encoding dystrophin (DMD or dystrophin gene) that prevents the synthesis of the complete protein; i.e., a premature stop codon prevents the synthesis of the C-terminus. In Becker muscular dystrophy, the dystrophin gene also contains a mutation compared to the wild-type, but the mutation usually does not result in a premature stop codon, and the C-terminus is normally synthesized. As a result, a functional or semi-functional dystrophin protein is synthesized that has at least the same activity in kind, but not necessarily in the same amount, as the wild-type protein. The genomes of BMD patients usually encode dystrophin proteins that contain an N-terminal portion (the first 240 amino acids at the N-terminus), a cysteine-rich domain (amino acids 3361 to 3685), and a C-terminal domain (the last 325 amino acids at the C-terminus), but in most cases, the central rod domain is shorter than that of wild-type dystrophin (Monaco et al., 1988). Antisense oligonucleotide-induced exon skipping for the treatment of DMD is preferably directed to overcome the premature termination in pre-mRNA by skipping exons in the central rod domain, correcting the open reading frame and allowing the synthesis of the remainder of the dystrophin protein, including the C-terminus; nevertheless, the protein is somewhat smaller as a result of the smaller rod domain. In a preferred embodiment, an individual with DMD treated with an oligonucleotide as defined herein is provided with dystrophin that exhibits at least some of the activity of wild-type dystrophin. If the individual is a Duchenne patient or suspected to be a Duchenne patient, functional or semi-functional dystrophin is the dystrophin of an individual with BMD; usually, the dystrophin can interact with both actin and DGC or DAPC, but its central rod domain may be shorter than that of wild-type dystrophin (Monaco et al., 1988). The central rod domain of wild-type dystrophin contains 24 spectrin-like repeats.For example, the central rod domain of dystrophin as provided herein can contain 5-23, 10-22, or 12-18 spectrin-like repeats and can bind to actin and to the DGC.

[0064] The use of the oligonucleotides of the present invention to alleviate one or more symptoms of Duchenne muscular dystrophy or Becker muscular dystrophy in an individual can be assessed by any of the following assays: prolongation of time to loss of ambulation, improvement in muscle strength, improvement in ability to lift weights, improvement in time to stand up from the floor, improvement in 9-meter walking time, improvement in time to climb four floors, improvement in lower limb function grade, improvement in pulmonary function, improvement in cardiac function, and improvement in quality of life. Each of these assays is known to those skilled in the art. For example, the publication of Manzur et al. (2008) provides a detailed description of each of these assays. For each of these assays, preferably, as soon as there is a detectable improvement or prolongation in the parameter measured in the assay, it means that one or more symptoms of Duchenne muscular dystrophy or Becker muscular dystrophy have been alleviated in an individual using the oligonucleotides of the present invention. A detectable improvement or prolongation is a statistically significant improvement or prolongation as described in Hodgetts et al. (2006). Alternatively, alleviation of one or more symptoms of Duchenne muscular dystrophy or Becker muscular dystrophy can be assessed by measuring improvement in muscle fiber function, integrity, and / or survival. In preferred methods, one or more symptoms of a DMD or BMD patient are alleviated and / or one or more characteristics of one or more muscle cells obtained from a DMD or BMD patient are improved. Such symptoms or characteristics can be assessed at the cellular level, tissue level, or in the patient itself.

[0065] Reduction of one or more characteristics of muscle cells obtained from a patient can be assessed in myoblasts or muscle cells obtained from a patient by any of the following assays: reduced calcium uptake by muscle cells, reduced collagen synthesis, altered morphology, altered lipid biosynthesis, reduced oxidative stress, and / or improved muscle fiber function, integrity, and / or survival. These parameters are typically assessed using immunofluorescence and / or histochemical analysis of cross-sections of muscle biopsies.

[0066] Improved muscle fiber function, integrity, and / or survival can be assessed using at least one of the following assays: a detectable decrease in creatine kinase in the blood, a detectable decrease in muscle fiber necrosis in a biopsy cross-section of a muscle suspected to be dystrophic, and / or a detectable increase in uniformity of muscle fiber diameter in a biopsy cross-section of a muscle suspected to be dystrophic. Each of these assays is known to those of skill in the art.

[0067] Creatine kinase can be detected in the blood as described in Hodgetts et al. (2006). A detectable decrease in creatine kinase can mean a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more decrease compared to the concentration of creatine kinase in the same DMD or BMD patient before treatment.

[0068] A detectable reduction in muscle fiber necrosis is preferably assessed in a muscle biopsy, more preferably using a biopsy cross-section, as described in Hodgetts et al. (2006). A detectable reduction in necrosis can be a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more reduction in the area in which necrosis is identified using a biopsy cross-section. Reduction is measured by comparison to necrosis as assessed in the same DMD or BMD patient before treatment.

[0069] A detectable increase in muscle fiber diameter uniformity is preferably assessed in muscle biopsy cross sections, more preferably as described in Hodgetts et al. (2006). The increase is measured by comparison to the muscle fiber diameter uniformity in the same DMD or BMD patient before treatment.

[0070] Preferably, the oligonucleotides of the invention provide the individual with a functional or semi-functional dystrophin protein (usually in the case of DMD) and are capable of at least somewhat reducing the production of abnormal dystrophin protein in the individual (usually in the case of BMD).

[0071] Reducing the production of abnormal dystrophin mRNA or abnormal dystrophin protein preferably means that 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less of the initial amount of abnormal dystrophin mRNA or abnormal dystrophin protein is still detectable by RT-PCR (mRNA) or immunofluorescence or Western blot analysis (protein). Abnormal dystrophin mRNA or protein is also referred to herein as less functional (compared to wild-type functional dystrophin protein as defined herein above) or nonfunctional dystrophin mRNA or protein. A nonfunctional dystrophin protein is preferably a dystrophin protein that cannot bind to actin and / or members of the DGC protein complex. A nonfunctional dystrophin protein or dystrophin mRNA typically does not have or encode a dystrophin protein with the C-terminus of an intact protein. Detection of functional or semi-functional dystrophin mRNA or protein can be performed as for abnormal dystrophin mRNA or protein.

[0072] Once a DMD patient is provided with functional or semi-functional dystrophin protein, at least part of the cause of DMD is eliminated.Therefore, it is expected that the symptoms of DMD will then be at least partially alleviated or the rate at which symptoms worsen will be reduced, resulting in a slower decline.Increasing skipping frequency also increases the level of functional or semi-functional dystrophin protein produced in the muscle cells of DMD or BMD individuals.

[0073] Spinal muscular atrophy (SMA) is a genetic and often fatal disorder caused by loss of the SMN protein, encoded by the survival motor neuron (SMN) gene. The SMN genes, SMN1 and SMN2, are located on chromosome 5, and SMA is caused by loss of SMN1 from both chromosomes. SMN2, which is nearly identical to SMN1, is less effective at providing SMN protein. SMN1 encodes the ubiquitously expressed 38-kDa SMN protein, which is required for snRNP assembly, a process essential for cell survival. SMN1 and SMN2 differ by a critical C-to-T mutation at position 6 of exon 7 (C6U in the SMN2 transcript). C6U does not alter the coding sequence but is sufficient to cause exon 7 skipping in SMN2, leading to an unstable truncated protein, SMNΔ7. The severity of SMA is influenced by the efficiency with which several copies of SMN2 are used to produce the SMN protein. In SMA patients, SMN2 generally fails to compensate for the loss of SMN1 due to exon 7 skipping, which produces an unstable truncated protein, SMNΔ7, that cannot ensure cell viability. Currently, available treatments for SMA consist of prevention and management of the secondary effects of chronic motor unit loss. No drugs are available for the treatment or prevention of SMA. Antisense technology for splice switching could be used to provide novel therapeutic agents for SMA treatment. Effective drugs could alter the splicing of SMN2 pre-mRNA and are likely to be therapeutically useful. Another molecular mechanism of SMA may be a point mutation (E134K).

[0074] Preferred AONs enhance the level of SMN2 mRNA containing exon 7 in cells relative to SMN2 mRNA lacking exon 7. Preferred AONs are preferably of appropriate length and complementary to a region within the SMN2 gene (more preferably as defined below) so that the AON specifically hybridizes to the region, thereby enhancing the level of SMN2 mRNA containing exon 7 in cells relative to SMN2 mRNA lacking exon 7. Preferred AONs comprise or consist of SEQ ID NOs: 1400-1579. More preferred AONs comprise or consist of SEQ ID NO: 1490. In the case of SMA, pre-mRNA splicing modulation can be applied to increase functional SMN2 levels by including one or more exons, preferably exon 7, in the SMN2 pre-mRNA and increasing the expression of SMN2 mRNA or protein containing exon 7. This has the ultimate goal of slowing or even halting disease progression.

[0075] In a preferred embodiment, AONs are used to induce exon 7 inclusion into SMN pre-mRNA, preferably SMN2 pre-mRNA, in cells, organs, tissues, and / or individuals. Preferably, exon inclusion results in a mature SMN mRNA containing the otherwise skipped exon 7, and thus may lead to the expression of more functional protein product. Preferably, inclusion of at least one exon, preferably exon 7, is induced by binding of the AON to specific sequences, including splicing regulatory elements, splice sites, and / or intron branch site sequences, preferably sequences within an intron.

[0076] As defined herein, SMN1 pre-mRNA preferably refers to the pre-mRNA of the SMN1 gene that encodes SMN protein.As defined herein, SMN2 pre-mRNA preferably refers to the pre-mRNA of the SMN2 gene that encodes SMN protein.When discussing the pre-mRNA of a subject suffering from SMA, SMN2 pre-mRNA can also be named SMN pre-mRNA, because in SMA patients, SMN1 gene does not exist, and therefore all SMN pre-mRNAs are SMN2 pre-mRNA.In this case, SMN2 gene can also be named SMN gene.

[0077] Preferably, patient refers to a patient with SMA, as defined herein, or a patient who is predisposed to developing SMA due to their genetic background. In the case of SMA patients, the oligonucleotides used preferably promote the inclusion of exon 7, as present in the patient's SMN2 gene, to generate a functional SMN protein rather than an SMNΔ7 protein, which preferably results in a functional or semi-functional SMN protein, as defined herein below. In the case of SMA patients, the oligonucleotides used preferably suppress or reduce the effect of a mutation, as present in the patient's SMN2 gene, resulting in an increase in the level of SMN protein, which is often more functional than the SMNΔ7 protein originally present in the SMA patient. Preferably, the ratio of SMN protein to SMNΔ7 protein is shifted toward functional SMN protein. Preferred molar ratios of SMN protein to SMNΔ7 protein detected after treatment are 5:4, 5:3, 5:2, 5:1, or 10:1. Most preferably, SMNΔ7 protein is no longer detectable or is detectable only in trace amounts.

[0078] As defined herein, a functional SMN protein is preferably wild-type SMN, corresponding to a protein having the amino acid sequence as identified in SEQ ID NO: 1581. A functional SMN protein preferably includes exon 7, which is identified in SEQ ID NO: 1584. In other words, a functional or semi-functional SMN protein is one that exhibits, at least to some extent, the activity of a wild-type SMN protein. "At least to some extent" preferably means at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% of the corresponding activity of a wild-type functional SMN protein. In this context, preferred activities of a functional SMN protein relate to telomerase regeneration, transcriptional regulation, and cellular trafficking, as known to those skilled in the art. More preferred activities of a functional SMN protein are the formation of functional snRNP assemblies and interaction with Sm proteins (Smith proteins).

[0079] Functional SMN binds to the Arg- and Gly-rich C-terminal tails of the Sm D1 and D3 proteins (Selenko et al., 2001). For example, in vitro binding assays can be performed to study this interaction by expressing the C-terminus of Sm D1 and Sm D3 as glutathione-S-transferase (GST) fusion proteins and pull-down experiments using isolated SMN protein. Less functional SMN exhibits little or no interaction. Such assays can be performed using total protein extracts. Alternatively, SMN containing exon 7 can be detected by immunofluorescence analysis of biopsy sections using various antibodies that interact with the region encoded by exon 7, or with portions of that region, or with a fold present only in SMN containing exon 7. Comparison with non-SMA (control) biopsies may be appropriate, as known to those skilled in the art.

[0080] In a preferred embodiment, an individual with SMA who is being treated with an AON as defined herein is provided with an SMN protein that exhibits, at least to some extent, the activity of a wild-type SMN protein as normally encoded by the SMN1 gene. If the individual is or is suspected of being an SMA patient, more preferably, the functional SMN protein is an SMN protein that includes exon 7 as normally encoded by the SMN1 gene.

[0081] The use of AONs to alleviate one or more symptoms of SMA in an individual can be assessed by any of the following assays: improvement in weight gain in the subject, improvement in motor activity in the subject, and increased survival time of either the subject or motor neuron cells and increased production of functional SMN. Each of these parameters is known to those of skill in the art and can be routinely assayed. For each of these assays, as soon as there is a detectable improvement or prolongation of the parameter measured in the assay, it is preferable that the use of an oligonucleotide in accordance with the present invention has alleviated one or more symptoms of SMA in an individual. Preferably, the detectable improvement or prolongation is a statistically significant improvement or prolongation. Alternatively, the alleviation of one or more symptoms of SMA can be assessed by measuring improvement in muscle function, integrity, and / or survival. In a preferred method, one or more symptoms of an SMA patient are alleviated and / or one or more characteristics of one or more muscle cells obtained from an SMA patient are improved. Such symptoms or characteristics can be assessed at the cellular level, tissue level, or in the patient themselves.

[0082] Reduction in one or more characteristics of motor neuron cells obtained from a patient can be assessed in cells obtained from a patient by any of the following assays: reduced calcium uptake, reduced snRNP production, reduced collagen synthesis, altered morphology, altered lipid biosynthesis, reduced oxidative stress, and / or improved muscle function, integrity, and / or survival. These parameters are typically assessed using immunofluorescence and / or histochemical analysis of cross-sections of biopsies, such as muscle biopsies.

[0083] A detectable increase in motor neuron survival is preferably assessed in muscle biopsies using biopsy sections. A detectable increase in survival can be a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more increase over known or historical rates of survival compared to untreated control samples. The increase is measured by comparison to survival as assessed in the same SMA patient prior to treatment.

[0084] A detectable increase in motor neuron survival can be assessed using methods known to those skilled in the art, for example as described in Lunn et al., 2004.

[0085] Preferably, the AON provides said individual with functional or semi-functional SMN protein and is capable of at least somewhat reducing the production of abnormal SMN protein, such as SMNΔ7, in said individual.

[0086] Preferably, reducing the production of aberrant SMN mRNA or aberrant SMN protein means that 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less of the initial amount of aberrant SMN mRNA or aberrant SMN protein is still detectable by RT-PCR (mRNA) or immunofluorescence or Western blot analysis (protein). Aberrant SMN mRNA or protein is also referred to as less functional (compared to wild-type functional SMN protein as defined herein above) or non-functional SMN mRNA or protein. Preferably, a non-functional SMN protein is an SMN protein that cannot bind to Sm proteins and / or does not promote or interfere with snRNP assembly. Non-functional SMN protein or SMN mRNA typically does not have or encode the amino acid sequence encoded by exon 7. Detection of functional or semi-functional SMN mRNA or protein can be performed on aberrant SMN mRNA or protein.

[0087] Once an SMA patient is provided with functional or semi-functional SMN protein, at least part of the cause of SMA is eliminated. Therefore, it is then expected that the symptoms of SMA will be at least partially alleviated or that the rate at which symptoms worsen will be reduced, resulting in a slower decline. Increased inclusion frequency also increases the levels of functional or semi-functional SMN protein produced in the cells of SMA individuals.

[0088] Exons and introns contain one or more specific sequences, including splicing regulatory elements, which have been shown to be effective targets for antisense oligonucleotides. One embodiment, therefore, provides an oligonucleotide for providing functional or semi-functional dystrophin or SMN protein to the individual, the oligonucleotide comprising a sequence that specifically binds to and / or blocks these splicing regulatory elements in a dystrophin or SMN2 pre-mRNA exon or intron. Furthermore, splice sites are other targets for the oligonucleotides of the invention, since only an exon is included in the resulting mRNA when both splice sites are recognized by the spliceosome complex. One embodiment, therefore, provides an oligonucleotide for providing functional or semi-functional dystrophin or SMN protein to the individual, the oligonucleotide comprising a sequence that specifically binds to and / or blocks one or both of the splice sites of an exon in a dystrophin or SMN2 pre-mRNA. Typically, a splice site of an exon comprises one, two, three, or more nucleotides present in the exon and one, two, three, or more nucleotides present in an adjacent or nearby intron. In one embodiment, oligonucleotides are used that bind only to intron regions of dystrophin or SMN2 pre-mRNA. However, this is not necessary: ​​it is also possible to use oligonucleotides that target or bind to intron-specific sequences as well as exon-specific sequences. Of course, oligonucleotides do not necessarily bind to the entire sequence of a dystrophin or SMN2 exon or intron. Oligonucleotides that specifically bind to a portion of such an exon or intron are preferred. Preferably, oligonucleotides are used that are complementary to, bind to, or target at least a portion of an exon and / or intron, said portion having at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.

[0089] Splicing of pre-mRNA occurs by two consecutive transesterification reactions involving an intron branch point and a splice site of an adjacent intron. Therefore, oligonucleotides are preferably used for exon skipping, and the oligonucleotides contain sequences that bind to such branch points and / or splice sites. The splice sites and / or branch points are preferably present in the dystrophin pre-mRNA.

[0090] Because splice sites contain consensus sequences, the use of oligonucleotide moieties or functional equivalents thereof containing sequences capable of binding to splice sites carries the risk of promiscuous hybridization. Hybridization of the oligonucleotide with splice sites other than the site of the exon to be skipped can easily interfere with the accuracy of the splicing process. To overcome these and other potential problems associated with the use of oligonucleotides that bind to splice sites, the most preferred embodiment provides an oligonucleotide for providing the individual with a functional or semi-functional dystrophin or SMN protein, wherein the oligonucleotide or functional equivalent thereof binds to a specific portion of a dystrophin pre-mRNA exon or SMN2 pre-mRNA exon or intron. Exons usually contain coding sequences that are more specific than non-coding intron sequences. Preferably, the oligonucleotide binding to a specific portion of a dystrophin pre-mRNA exon can specifically block, interfere with, and / or inhibit the structure of splicing regulatory sequences and / or predicted exon(s) in the dystrophin or SMN2 pre-mRNA. Interfering with such splicing regulatory sequences and / or structures has the advantage that such elements are located within the exon. Therefore, the risk of sequence-related off-target effects is limited. In the case of exon skipping, it is possible to mask the exon from the splicing apparatus by providing an oligonucleotide inside the exon to be skipped. The inability of the splicing apparatus to recognize the exon to be skipped therefore leads to the exon's exclusion from the final mRNA. In the case of exon inclusion, for example, increased exon inclusion can be achieved by providing an oligonucleotide to block an intron splicing silencer (ISS). Hybridization of the AON with the ISS region can replace a trans-acting negative repressor and / or unwind a cis-acting RNA stem-loop that interferes with the binding of U1 small nuclear RNA at the 5' splice site of the exon to be included.These embodiments do not directly interfere with the enzymatic process of the splicing machinery (joining of exons), which is believed to allow the method to be more specific and / or reliable.

[0091] In the context of the present invention, the oligonucleotide of the present invention may include a functional equivalent of the oligonucleotide. Further equivalents of the oligonucleotide preferably refer to oligonucleotides as defined herein in which one or more nucleotides have been replaced, while retaining the activity of the functional equivalent at least to some extent. The activity of the oligonucleotide, including the functional equivalent of the oligonucleotide, is preferably to provide functional or semi-functional dystrophin or SMN protein. Therefore, the activity of the oligonucleotide, including the functional equivalent of the oligonucleotide, is preferably assessed by quantifying the amount of functional or semi-functional dystrophin or SMN protein. Functional or semi-functional dystrophin is preferably defined herein as dystrophin capable of binding to actin and members of the DGC (or DAPC) protein complex. The activity of the functional equivalent of the oligonucleotide is preferably assessed by RT-PCR and sequencing (at the RNA level; for detecting specific exon skipping (DMD) or inclusion (SMA)), or by immunofluorescence and Western blot analysis (at the protein level; for detecting protein restoration). Preferably, the activity is retained to at least some extent if the functional equivalent exhibits at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95% or more of the corresponding activity of the oligonucleotide from which it is derived. Throughout this application, when the term oligonucleotide is used, it may be substituted by its functional equivalent as defined herein. Throughout this application, when the term oligonucleotide is used, it may be substituted by antisense oligonucleotide as defined herein, unless otherwise specified.

[0092] Thus, the use of an oligonucleotide according to the present invention, or a functional equivalent thereof, represented by a nucleotide sequence comprising or consisting of a sequence that is complementary to, binds to, targets or hybridizes to a dystrophin or SMN2 pre-mRNA exon or intron, comprising 2'-O-methyl monomers, preferably 2'-O-methyl RNA monomers, or consisting of 2'-O-methyl RNA, optionally comprising phosphorothioates, and at least one BNA scaffold modification with or without 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) bases, is expected to have a positive effect on at least one of the parameters of said oligonucleotide, as defined herein above, when compared to its counterpart that does not comprise any BNA scaffold modification with / without 5-methylcytosine and / or 5-methyluracil as set out herein above, and is therefore expected to show improved therapeutic results in DMD or BMD or SMA cells of patients and / or in DMD or BMD or SMA patients. Such a therapeutic result may be characterized as alleviating one or more symptoms of DMD or BMD or SMA. Such a therapeutic result may also be, or may be characterized as: reducing the rate of increase or worsening of one or more of the symptoms; and / or reducing one or more characteristics of muscle cells obtained from the patient; and / or providing said individual with a functional or semi-functional dystrophin or SMN protein; and / or reducing motor neuron loss in the spinal cord and / or Reducing voluntary muscle atrophy and / or at least somewhat reducing the production of abnormal dystrophin protein in said individual. Each of these characteristics has been previously defined herein.

[0093] Preferably, the oligonucleotide is represented by a nucleotide sequence that comprises or consists of a sequence that binds to, targets, or is complementary to at least a portion of a dystrophin or SMN2 pre-mRNA, and the oligonucleotide has a length of at least 10 nucleotides, although the length of the oligonucleotide may be at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides.

[0094] One preferred embodiment provides an oligonucleotide to provide said individual with a functional or semi-functional dystrophin or SMN protein, said oligonucleotide or a functional equivalent thereof being represented by a sequence comprising: a sequence that binds to, targets, hybridizes to, or is complementary to a region of a dystrophin or SMN2 pre-mRNA exon that hybridizes to another portion of the dystrophin or SMN2 pre-mRNA exon (closed structure); and A sequence that binds to, targets, hybridizes to, or is complementary to a region of a dystrophin or SMN2 pre-mRNA exon that is not hybridized in the dystrophin or SMN2 pre-mRNA (open conformation).

[0095] For this embodiment, reference is made to patent application WO 2004 / 083446. RNA molecules exhibit strong secondary structures, mostly due to base pairing of complementary or partially complementary stretches within the same RNA. This structure in RNA has long been thought to play a role in RNA function. Without wishing to be bound by theory, it is believed that the secondary structure of exon RNA plays a role in structuring the splicing process. This structure allows exons to be recognized as parts that need to be included in mRNA. In one embodiment, oligonucleotides can interfere with the structure of an exon, thus interfering with the splicing apparatus of said exon, masking the exon from the splicing apparatus and thereby inducing skipping of said exon. Many oligonucleotides indeed have this ability, and some have been found to be more efficient than others. Without wishing to be bound by theory, it is believed that overlap with the open structure improves the invasion efficiency of the oligonucleotide (i.e., increases the efficiency with which the oligonucleotide can enter the structure), while overlap with the closed structure subsequently increases the efficiency of interfering with the secondary structure of the exonic RNA. It is understood that the length of partial complementarity to both the closed and open structures is not extremely limited. The inventors have observed high efficiency using compounds containing oligonucleotides with variable lengths of complementarity in either structure. The term (reverse) complementary is used herein to refer to a stretch of nucleic acid that can hybridize with a stretch of another nucleic acid under physiological conditions. The antisense strand is generally said to be complementary to the corresponding sense strand. In this context, an antisense oligonucleotide is complementary to its target. Hybridization conditions are defined hereinafter. Therefore, it is not absolutely necessary that all bases in the region of complementarity be capable of pairing with bases in the opposite strand. For example, when designing an antisense oligonucleotide, one may attempt to incorporate residues that do not base-pair with bases in the complementary strand. Mismatches can be tolerated to a certain extent if, under the cellular environment, the stretch of nucleotides is capable of hybridizing with a complementary portion.

[0096] In a preferred embodiment, the complementary portion of the antisense oligonucleotide (either to the open structure or to the closed structure) comprises at least three, more preferably at least four, consecutive nucleotides. The complementary regions are preferably designed so that, when combined, they are specific for an exon in the pre-mRNA. Such specificity can be achieved using complementary regions of various lengths, depending on the actual sequences in other (pre-)mRNAs in the system. The risk that one or more other pre-mRNAs will also be able to hybridize with the oligonucleotide decreases as the size of the oligonucleotide increases. It is clear that antisense oligonucleotides containing mismatches in the region of complementarity but retaining the ability to hybridize with the targeted region in the pre-mRNA can be used in the present invention. However, it is preferred that at least the complementary portion does not contain such mismatches, as these typically have higher efficiency and specificity than oligonucleotides containing such mismatches in one or more complementary regions. Higher hybridization avidity (ie, increasing the number of interactions with the opposite strand) is believed to be favorable for increasing the efficiency of the process by interfering with the splicing mechanism of the system.

[0097] For AONs suitable for inducing single exon skipping, complementarity is preferably 90-100%. Generally, this allows for one or two mismatches in a 20-nucleotide oligonucleotide or one to four mismatches in a 40-nucleotide oligonucleotide. Thus, we may have one, two, three, four, or five mismatches in a 10-50 nucleotide oligonucleotide. Preferably, there are zero, one, or two mismatches in a 10-50 nucleotide oligonucleotide.

[0098] For so-called multi-skipping AONs (AONs capable of binding to a region of a first exon and to a region of another exon (i.e., a second exon) within the same pre-mRNA, where the region of the second exon has at least 50% identity with the region of the first exon), there is preferably at least 80% complementarity to the region of the first exon and at least 45% complementarity to the region of the second exon. The antisense oligonucleotide is preferably at least 85%, 90%, 95%, or 100% complementary to the region of the first exon, and more preferably at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% complementary to the region of the second exon. However, it is preferred that complementarity is not necessarily measured over the entire length of the oligonucleotide.

[0099] For such so-called multi-skipping AONs, the region of the first exon must be at least The region of the first exon may be 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, or up to 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or more nucleotides. The region of the first exon may also be defined as at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the length of the exon. The region of the first exon may be referred to as the region of identity.

[0100] For such so-called multi-skipping AONs, the region of the second exon must be at least The length of the second exon may be 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, or up to 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or more nucleotides. The region of the second exon may be defined as at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the length of the exon. The region of the second exon may be referred to as the region of identity. Further preferred features of the so-called multi-skipping AONs are described in WO2014007620.

[0101] The structures (i.e., open and closed structures) are best analyzed in relation to the pre-mRNA in which the exons reside. Such structures can also be analyzed in the actual RNA. However, it is now possible to successfully predict the secondary structure of RNA molecules (at the lowest energy cost) using structural modeling programs. Non-limiting examples of suitable programs are RNA structure version 4.5 or RNA mfold version 3.5 (Zuker et al., 2003). A person skilled in the art will be able to predict the likely structure of an exon, given a nucleotide sequence, with reasonable reproducibility. The best predictions are obtained when such a modeling program is provided with the exon and the intron sequences flanking each end. Modeling the structure of the entire pre-mRNA is usually not necessary.

[0102] The open and closed structures of the oligonucleotides are preferably adjacent to each other. Thus, annealing of the oligonucleotide with the open structure is believed to induce the opening of the closed structure as soon as annealing proceeds to this closed structure. Through this action, the previously closed structure adopts a different conformation. However, when potential (cryptic) splice acceptor and / or donor sequences exist within the targeted exon, a novel exon inclusion signal sometimes occurs, specifying a different (new) exon, i.e., an exon with a different 5' end, a different 3' end, or both. This type of activity is within the scope of the present invention, since the targeted exon is excluded from the mRNA. The presence of a novel exon containing part of the targeted exon in the mRNA does not change the fact that the targeted exon is excluded as such. The inclusion of the novel exon may be seen as only an occasional side effect. When exon skipping is used to restore (part of) the dystrophin open reading frame that is disrupted as a result of a mutation, there are two possibilities. One is that the novel exon is functional in restoring the reading frame, while in other cases the reading frame is not restored. When selecting compounds containing oligonucleotides for restoring the dystrophin reading frame by exon skipping, it is of course clear that under these conditions only those compounds containing those oligonucleotides that actually result in exon skipping that restores the dystrophin open reading frame, with or without the neo-exon, are selected.

[0103] Further provided is an oligonucleotide for providing the individual with a functional or semi-functional dystrophin protein, wherein the oligonucleotide or its functional equivalent is an oligonucleotide as described above, i.e., comprising 2'-O-methyl monomers, consisting of 2'-O-methyl monomers, preferably 2'-O-methyl RNA monomers, optionally comprising phosphorothioates, further comprising a BNA scaffold with or without 5-methylpyrimidines (i.e., 5-methylcytosine and / or 5-methyluracil), and represented by a nucleotide sequence comprising a sequence that is complementary to, binds to, targets, or hybridizes with a serine-arginine (SR) protein binding site in the RNA of an exon of dystrophin pre-mRNA. In patent application WO 2006 / 112705, the inventors disclosed the existence of a correlation between the efficiency of exon-internal antisense oligonucleotides in inducing exon skipping and the presence of a predicted SR binding site in the target pre-mRNA of the AON (e.g., by ESEfinder). Thus, in one embodiment, oligonucleotides are created, which includes determining a (putative) binding site of SR (Ser-Arg) protein in the RNA of a dystrophin exon, and producing corresponding compounds comprising oligonucleotides that are complementary to, bind to, target, or hybridize with the RNA, and at least partially overlap with the (putative) binding site. The term "at least partially overlap" is defined herein to include only a single nucleotide of the SR binding site, as well as overlapping multiple nucleotides of the binding site, and completely overlapping the binding site. Preferably, this embodiment further includes determining from the secondary structure of the RNA a region that hybridizes with another part of the RNA (closed structure) and a region in the structure that does not hybridize (open structure), and then creating oligonucleotides that at least partially overlap with the (putative) binding site, and that overlap at least a portion of the closed structure and at least a portion of the open structure.In this way, we increase the chance of obtaining an oligonucleotide that can interfere with exon inclusion from pre-mRNA to mRNA. The first selected SR binding region may not have the required open-closed structure, in which case another (second) SR protein binding site is selected, which is then tested for the presence of an open-closed structure. This process continues until a sequence containing an SR protein binding site and a (partially overlapping) open-closed structure is identified. This sequence is then used to design an oligonucleotide that is complementary to the sequence.

[0104] This method for making antisense oligonucleotides can also be carried out by reversing the described order, that is, first preparing oligonucleotides, including determining the region that assumes a structure (closed structure) that hybridizes with another part of the RNA from the secondary structure of the RNA obtained from dystrophin exon and the region that does not hybridize (open structure) in this structure, and then preparing oligonucleotides in which at least a part of the oligonucleotide is complementary to the closed structure and at least another part of the oligonucleotide is complementary to the open structure.This is then followed by determining whether the SR protein binding site at least overlaps with the open / closed structure.In this way, the method of WO2004 / 083446 is improved.In yet another embodiment, the selection is carried out simultaneously.

[0105] Without wishing to be bound by any theory, it is currently believed that the use of oligonucleotides directed at or targeted to SR protein binding sites results (at least in part) in impaired binding of SR proteins to their binding sites, resulting in disrupted or impaired splicing.

[0106] Preferably, the open / closed structure and the SR protein binding site partially overlap, and even more preferably, the open / closed structure completely overlaps with the SR protein binding site, or the SR protein binding site completely overlaps with the open / closed structure, allowing for improved disruption of exon inclusion.

[0107] In addition to sequential splice and branch site intronic sequences, many (but not all) exons contain splicing regulatory sequences, such as, but not limited to, exonic splicing enhancer (ESE) sequences, to facilitate the recognition of true splice sites by the spliceosome (Cartegni et al., 2002; Cartegni et al., 2003). A subgroup of splicing factors, called SR proteins, can bind to these ESEs and recruit other splicing factors, such as U1 and U2AF, to (weakly defined) splice sites. The binding sites of the four most abundant SR proteins (SF2 / ASF, SC35, SRp40, and SRp55) have been extensively analyzed, and these results are implemented in ESEfinder, a web resource that predicts potential binding sites for these SR proteins (Cartegni et al., 2002; Cartegni et al., 2003). In embodiments in which the AON is for exon skipping, there is a correlation between the efficacy of the AON and the presence or absence of SF2 / ASF, SC35, and SRp40 binding sites in the site targeted by the AON. In a preferred embodiment, the present invention therefore provides oligonucleotides as described above that are complementary to, target, or bind to a binding site of an SR protein. The SR protein is preferably SF2 / ASF, SC35, or SRp40. In embodiments in which the AON is for exon inclusion, there is a correlation between the efficacy of the AON and the presence of a U1 small nuclear RNA binding site, a heterogeneous nuclear ribonucleoprotein (hnRNP) binding site, or a small nuclear ribonucleoprotein (snRNP) in the site targeted by the AON. In a preferred embodiment, the present invention provides oligonucleotides as described above that are complementary to, target, or bind to a binding site of a snRNA, such as U1 small nuclear RNA, snRNP, or hnRNP.

[0108] In one embodiment, DMD patients are provided with functional or semi-functional dystrophin proteins or functional equivalents thereof by using the above-described oligonucleotides, i.e., oligonucleotides comprising 2'-O-methyl monomers, preferably 2'-O-methyl RNA monomers, or consisting of 2'-O-methyl RNA, containing at least one BNA scaffold with or without 5-methylpyrimidine (i.e., 5-methylcytosine and / or 5-methyluracil) bases, and capable of specifically binding to or targeting regulatory RNA sequences required for the correct splicing of dystrophin exons in transcripts. Several cis-acting RNA sequences are required for the correct splicing of exons in transcripts. In particular, elements such as exonic splicing enhancers (ESEs), exon recognition sequences (ERSs), and / or exonic splicing silencers (ESSs), and / or intronic splicing silencers (ISSs) are identified to regulate the specific and efficient splicing of constitutive and alternative exons. Sequence-specific antisense oligonucleotides (AONs) that bind to, target, or are complementary to the elements are used to disrupt their regulatory function, causing exons to be skipped or included, as shown for DMD or SMA. Thus, in one preferred embodiment, oligonucleotides or functional equivalents thereof that are complementary to, bind to, or target exonic splicing enhancers (ESEs), exon recognition sequences (ERSs), and / or exonic splicing silencers (ESSs), and / or intronic splicing silencers (ISSs) are used.

[0109] In a preferred embodiment, an oligonucleotide of the invention suitable for inducing single-exon skipping comprises or consists of a sequence complementary to, binding to, targeting, or hybridizing with at least a portion of dystrophin pre-mRNA exon 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55, said portion having at least 10 nucleotides. However, said portion may also have at least 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides. For the dystrophin exons identified above, the inventors provide stretches of nucleotides (SEQ ID NOS: 2-7) taken from said exons to which the oligonucleotide preferably binds, is complementary to, targets, or hybridizes.

[0110] In a preferred embodiment, the oligonucleotides of the invention suitable for so-called multi-skipping as defined herein above induce skipping of the following dystrophin exons: exons 8 to 19, exons 9 to 22, exons 9 to 30, exons 10 to 18, exons 10 to 30, exons 10 to 42, exons 10 to 47, exons 10 to 57, exons 10 to 60, exons 11 to 23, exons 13 to 30, exons 23 to 42, exons 34 to 53, exons 40 to 53, exons 44 to 56, exons 45 to 51, exons 45 to 53, exons 45 to 55, exons 45 to 60 or exons 56 to 60. Such so-called multi-skipping oligonucleotides of the present invention preferably comprise or consist of a sequence capable of binding to, targeting, hybridizing with, and / or being reverse-complementary to a region of the first exon of dystrophin pre-mRNA, such that the reverse-complementary portion is at least 30% of the length of the oligonucleotide of the present invention, more preferably at least 40%, even more preferably at least 50%, even more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98%, and most preferably up to 100%. In this context, the first exon is preferably exon 8, 9, 10, 11, 13, 23, 34, 40, 44, 45, or 56 of dystrophin pre-mRNA as defined herein. The oligonucleotide may further comprise sequences flanking each end. In a more preferred embodiment, the length of the reverse complementary portion of the oligonucleotide is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides, and several types of sequences flanking each end may be used.Preferably, the sequences flanked at each end are used to modify the binding of proteins to the oligonucleotide or to modify the thermodynamic properties of the oligonucleotide, more preferably to modify the target RNA binding affinity. In another preferred embodiment, the additional sequences flanked at each end are reverse complementary to a site of the dystrophin pre-mRNA that is not present in the exon.

[0111] Preferred oligonucleotides are i) Ia) at least one 2'-substituted monomer, preferably an RNA monomer or a 2'-O-substituted RNA monomer and optionally a phosphorothioate backbone linkage, or Ib) 2'-substituted monomers, preferably only RNA monomers or 2'-O-substituted RNA monomers, linked by phosphorothioate backbone linkages and / or by phosphodiester linkages, ii) 5-methylcytosine and / or 5-methyluracil bases and iii) at least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification; Includes From SEQ ID NOs: 2 to 7, more preferably Exon 44 skipping or at least for skipping 5'-GCGAUUUGACAGAUCUGUUGAGAAAUGGCGGCGUUUUCAUUAUGAUAUAAAGAUAUUUAAUCAGUGGCUAACAGAAGCUGAACAGUUUCUCAGAAAGACACAAAUUCCUGAGAAUUGGGAACAUGCUAAAUACAAAUGGUAUCUUAAG-3' (SEQ ID NO: 2) Exon 45 skipping or at least for skipping 5'-GAACUCCAGGAUGGCAUUGGGCAGCGGCAAACUGUUGUCAGAACAUUGAAUGCAACUGGGGAAGAAAUAAUUCAGCAAUCCUCAAAAACAGAUGCCAGUAUUCUACAGGAAAAAUUGGGAAGCCUGAAUCUGCGGUGGCAGGAGGUCUGCAAACAGCUGUCAGACAGAAAAAAGAG-3' (SEQ ID NO: 3) Exon 51 skipping or at least for skipping 5'-CUCCUACUCAGACUGUUACUCUGGUGACACAACCUGUGGUUACUAAGGAAACUGCCAUCUCCAAACUAGAAAUGCCAUCUUCCUUGAUGUUGGAGGUACCUGCUCUGGCAGAUUUCAACC GGGCUUGGACAGAACUUACCGACUGGCUUUCUCUGCUUGAUCAAGUUAUAAAAUCACAGAGGGUGAUGGUGGUGACCUUGAGGAUAUCAACGAGAUGAUCAUCAAGCAGAAG-3' (SEQ ID NO: 4) Exon 52 skipping or at least for skipping 5'-GCAACAAUGCAGGAUUUGGAACAGAGGCGUCCCCAGUUGGAAGAACUCAUUACCGCUGCCCAAAAUUUGAAAAACAAGACCAGCAAUCAAGAGGCUAGAACAAUCAUUACGGAUCGAA-3' (SEQ ID NO: 5) Exon 53 skipping or at least the skipping mechanism 5'-UUGAAAGAAUUCAGAAUCAGUGGGAUGAAGUACAAGAACACCUUCAGAACCGGAGGCACAGUUGAAUGAAAUUAAAGGAUUCAACACAAUGGCUGGAAGCUAAGGAAGAAGCUGAGCAGGUCUUAGGACAGGCCAGAGCCAAGCUUGAGUCAUGGAAGGAGGGUCCCUAUACAGUAGAUGCAAUCCAAAAGAAAAUCACAGAAACCAAG-3' (SEQ ID NO: 6) Exon 55 skipping or at least for skipping 5'-GGUGAGUGAGCGAGAGGCUGCUUUGGAAGAAACUCAUAGAUUACUGCAACAGUUCCCCCUGGACCUGGAAAAGUUUCUUGCCUGGCUUACAGAAGCUGAAACAACUGCCAAUGUCCUACAGGAUGCUACCCGUAAGGAAAGGCUCCUAGAAGACUCCAAGGGAGUAAAAGAGCUGAUGAAACAAUGGCAA-3' (SEQ ID NO: 7) Binds to, is complementary to, targets, or hybridizes to a contiguous stretch of at least 10 nucleotides and up to 33 nucleotides of at least one of the following exonic nucleotide sequences selected from:

[0112] Another preferred oligonucleotide is i) Ia) at least one 2'-substituted monomer, preferably an RNA monomer or a 2'-O-substituted RNA monomer and optionally a phosphorothioate backbone linkage, or Ib) 2'-substituted monomers, preferably only RNA monomers or 2'-O-substituted RNA monomers, linked by phosphorothioate backbone linkages and / or by phosphodiester linkages, ii) 5-methylcytosine and / or 5-methyluracil bases and iii) at least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification; Including, From SEQ ID NOs: 6065 to 6070, more preferably At least for exon 44 skipping 5'-CUUAAGAUACCAUUUGUAUUUAGCAUGUUCCCAAUUCUCAGGAAUUUGUGUCUUUCUGAGAAACUGUUCAGCUUCUGUUAGCCACUGAUUAAAUAUCUUUAUAUCAUAAUGAAAACGCCGCCAUUUCUCAACAGAUCUGUCAAAUCGC-3' (SEQ ID NO: 6065) At least for exon 45 skipping 5'-CUCUUUUUUCUGUCUGACAGCUGUUUGCAGACCUCCUGCCACCGCAGAUUCAGGCUUCCCAAUUUUUCCUGUAGAAUACUGGCAUCUGUUUUUGAGGAUUGCUGAAUUUUUUCCCCAGUUGCAUUCAAUGUUCUGACAACAGUUUGCCGCUGCCCAAUGCCAUCCUGGAGUUC-3' (SEQ ID NO: 6066) At least for exon 51 skipping 5'-CUUCUGCUUGAUGAUCAUCUCGUUGAUUCCUCAAGGUCACCCACCAUCACCCUCUGUGAUUUUAUAACUUGAUCAAGCAGAGAAAGCCAGUCGGUAAGUUCUGUCCAAGCCCGGUUGAAA UCUGCCAGAGCAGGUACCUCCAACAUCAAGGAAGAUGGCAUUUCUAGUUUGGAGAUGGCAGUUUCCUUAGUAACCACAGGUUGUGUCACCAGAGUAACAGUCUGAGUAGGAG-3' (SEQ ID NO: 6067) At least for exon 52 skipping 5'-UUCGAUCCGUAAUGAUUGUUCUAGCCUCUUGAUUGCUGGUCUUGUUUUCAAAUUUUGGGCAGCGGUAAUGAGUUCUUCCAACUGGGGACGCCUCUGUUCCAAAUCCUGCAUUGUUGC-3' (SEQ ID NO: 6068) At least for exon 53 skipping 5'-CUUGGUUUCUGUGAUUUUCUUUUGGAUUGCAUCUACUGUAUAGGGACCCUCCUUCCAUGACUCAAGCUUGGCUCUGGCCUGUCCUAAGACCUGCUCAGCUUCUUCCUUAGC UUCCAGCCAUUGUGUUGAAUCCUUUAACAUUUCAUUCAACUGUUGCCUCCGGUUCUGAAGGUGUUCUUGUACUUCAUCCCACUGAUUCUGAAUUCUUUCAA-3' (SEQ ID NO: 6069) At least for exon 55 skipping 5'-UUGCCAUUGUUUCAUCAGCUCUUUUACUCCCUUGGAGUCUUCUAGGAGCCUUUCCUUACGGGUAGCAUCCUGUAGGACAUUGGCAGUUGUUCAGCUUCUGUAAGCCAGGCAAGAAACUUUUCCAGGUCCAGGGGGAACUGUUGCAGUAAUCUAUGAGUUUCUUCCAAAGCAGCCUCUCGCUCACUCACC-3' (SEQ ID NO: 6070) The nucleotide sequence comprises a contiguous stretch of at least 10 nucleotides and up to 33 nucleotides of at least one of the following nucleotide sequences selected from:

[0113] In a preferred embodiment, the oligonucleotide according to the present invention comprises or consists of a nucleotide sequence represented by SEQ ID NO: 8 to 271, SEQ ID NO: 1608 to 2099, or SEQ ID NO: 3000 to 3184. These oligonucleotides are preferably for skipping exon 44 of dystrophin pre-mRNA.

[0114] In a preferred embodiment, the oligonucleotide according to the present invention comprises or consists of a nucleotide sequence represented by SEQ ID NOs: 272 to 451 or 3185 to 4527. These oligonucleotides are preferably intended to skip dystrophin pre-mRNA exon 45.

[0115] In a preferred embodiment, the oligonucleotide according to the present invention comprises or consists of the nucleotide sequence represented by SEQ ID NO: 452 to 613 or SEQ ID NO: 4528 to 4572. In a more preferred embodiment, the oligonucleotide according to the present invention comprises or consists of the nucleotide sequence represented by SEQ ID NO: 455, 459, 4528, 4531, 4532, 4533, 4535, 4542, 4548, or 4568. These oligonucleotides are preferably intended to skip dystrophin pre-mRNA exon 51.

[0116] In a preferred embodiment, the oligonucleotide according to the present invention comprises or consists of a nucleotide sequence represented by SEQ ID NOs: 842 to 1159 or 4573 to 6048. These oligonucleotides are preferably intended to skip dystrophin pre-mRNA exon 53.

[0117] In a preferred embodiment, the oligonucleotides according to the present invention comprise or consist of the nucleotide sequences represented by SEQ ID NOs: 614 to 841. These oligonucleotides are preferably intended to skip dystrophin pre-mRNA exon 52.

[0118] In a preferred embodiment, the oligonucleotides according to the present invention comprise or consist of the nucleotide sequences represented by SEQ ID NOs: 1160 to 1399. These oligonucleotides are preferably intended to skip dystrophin pre-mRNA exon 55.

[0119] SEQ ID NOs: 6065 to 6070 represent reverse complementary sequences to SEQ ID NOs: 2 to 7. In a more preferred embodiment, the oligonucleotide according to the present invention has a length of 10 to 33 nucleotides, i) 2'-substituted monomers, preferably only RNA monomers or 2'-O-substituted RNA monomers, linked by phosphorothioate backbone linkages and / or by phosphodiester linkages; ii) 5-methylcytosine bases and iii) at least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification; Including, It comprises a continuous stretch of at least 10 nucleotides and up to 33 nucleotides of at least one of the nucleotide sequences selected from SEQ ID NOs: 6065 to 6070, preferably the nucleotide sequence of SEQ ID NO: 6067.

[0120] In an even more preferred embodiment, the oligonucleotide according to the invention has a length of 10 to 33 nucleotides, i) only 2'-substituted monomers, preferably 2'-O-substituted RNA monomers, linked by phosphorothioate backbone linkages; ii) 5-methylcytosine bases and iii) at least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification; Including, The oligonucleotide comprises a contiguous stretch of at least 10 nucleotides and up to 33 nucleotides of at least one of the nucleotide sequences selected from SEQ ID NOs: 6065-6070, preferably the nucleotide sequence of SEQ ID NO: 6067. In a more preferred embodiment, such an oligonucleotide has at least two monomers that contain a BNA scaffold modification.

[0121] In these embodiments, the continuous stretch is preferably at least 16 to 26 nucleotides, or 16 to 25 nucleotides in length. In another embodiment, the continuous stretch is 16 to 24 nucleotides in length. In another embodiment, the continuous stretch is 16 to 22 nucleotides in length. In another embodiment, the continuous stretch is 16, 18, 20 or 22 nucleotides in length. In another embodiment, the continuous stretch is 21, 22, 24 or 25 nucleotides in length. In another embodiment, the continuous stretch is 18, 22, 24 or 25 nucleotides in length. Preferably, the oligonucleotide of the invention consists of the continuous stretch.

[0122] More preferred oligonucleotides comprise at least one 2'-substituted monomer and optionally only 2'-substituted monomers linked by phosphorothioate backbone linkages or by phosphorothioate backbone linkages and / or by phosphodiester linkages, comprise 5-methylcytosine and / or 5-methyluracil bases, comprise at least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification, and are represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 8-1580 or 1592-1607, or a nucleotide sequence comprising or consisting of a fragment of SEQ ID NOs: 8-1580 or 1592-1607. More preferred oligonucleotides comprise at least one 2'-substituted monomer and optionally only 2'-substituted monomers linked by phosphorothioate backbone linkages or by phosphorothioate backbone linkages and / or by phosphodiester linkages, contain 5-methylcytosine and / or 5-methyluracil bases, comprise at least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification, and are represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 8-1580, 1592-2099, or 3000-6048, or a nucleotide sequence comprising or consisting of a fragment of SEQ ID NOs: 8-1580, 1592-2099, or 3000-6048. Such oligonucleotides preferably have a length of 16 to 30 nucleotides, more preferably 16 to 24 nucleotides, and most preferably 19, 22, or 22 nucleotides. More preferred oligonucleotides are as described above, including SEQ ID NOs: 9 to 13, 15 to 19, 21 to 25, 27 to 31, 33 to 37, 39 to 43, 45 to 49, 51 to 55, 57 to 61, 63 to 67, 69 to 73, 75 to 79, 81 to 85, 87 to 91, 93 to 97, 99 to 103, 105 to 109, 111 to 115, 117-121, 123-127, 129-133, 135-139, 141-145, 147-151, 153-157, 159-163, 165-169, 171-175, 177-181, 183-187, 189-193, 195-199, 201-205, 207-211, 213-217, 219-223,225~229、231~235、237~241、243~247、249~253、255~259、261~265、267~271、273~277、279~283、285~289、291~295、297~301、303~307、309~313、315~319、321~325、327~331、333~337、339~343、345~349、351~355、357~361、363~367、369~373、375~379、381~385、387~391、393~397、399~403、405~409、411~415、417~421、423~427、429~433、435~439、441~445、447~451、453~457、459~463、465~469、471~475、477~481、483~487、489~493、495~499、501~505、507~511、513~517、519~523、525~529、531~535、537~541、543~547、549~553、555~559、561~565、567~571、573~577、579~583、585~589、591~595、597~601、603~607、609~613、615~619、621~625、627~631、633~637、639~643、645~649、651~655、657~661、663~667、669~673、675~679、681~685、687~691、693~697、699~703、705~709、711~715、717~721、723~727、729~733、735~739、741~745、747~751、753~757、759~763、765~769、771~775、777~781、783~787、789~793、795~799、801~805、807~811、813~817、819~823、825~829、831~835、837~841、843~847、849~853、855~859、861~865、867~871、873~877、879~883、885~889、891~895、897~901、903~907、909~913、915~919、921~925、927~931、933~937、939~943、945~949、951~955、957~961、963~967、969~973、975~979、981~985、987~991、993~997、999~1003、1005~1009、1011~1015、1017~1021、1023~1027、1029~1033、1035~1039、1041~1045、1047~1051、1053~1057、1059~1063、1065~1069、1071~1075、1077~1081、1083~1087、1089~1093、1095~1099、1101~1105、1107~1111、1113~1117、1119~1123、1125~1129、1131~1135、1137~1141、1143~1147、1149~1153、1155~1159、1161~1165、1167~1171、1173~1177、1179~1183、1185~1189、1191~1195、1197~1201、1203~1207、1209~1213、1215~1219、1221~1225、1227~1231、1233~1237、1239~1243、1245~1249、1251~1255、1257~1261、1263~1267、1269~1273、1275~1279、1281~1285、1287~1291、1293~1297、1299~1303、1305~1309、1311~1315、1317~1321、1323~1327、1329~1333、1335~1339、1341~1345、1347~1351、1353~1357、1359~1363、1365~1369、1371~1375、1377~1381、1383~1387、1389~1393、1395~1399、1401~1405、1407~1411、1413~1417、1419~1423、1425~1429、1431~1435、1437~1441、1443~1447、1449~1453、1455~1459、1461~1465、1467~1471、1473~1477、1479~1483、1485~1489、1491~1495、1497~1501、1503~1507、1509~1513、1515~1519、1521~1525、1527~1531、1533~1537、1539~1543、1545~1549、1551~1555、1557~1561、1563~1567、1569~1573、1575~1579、1592 to 2099, or 3000 to 6048, or by a nucleotide sequence comprising or consisting of SEQ ID NOs: 9 to 13, 15 to 19, 21 to 25, 27 to 31, 33 to 37, 39 to 43, 45 to 49, 51 to 55, 57 to 61, 63 to 67, 69 to 73, 75 to 79, 81 to 85, 87 to 91, 93 to 97, 99 to 103, 105 to 109, 111 to 115, 117 to 121, 123 to 127, 129 to 133, 135 to 139, 141 to 145, 147 to 151, 153 to 157, 159 to 163, 165 to 169, 171 to 175, 177 to 180, 81, 183-187, 189-193, 195-199, 201-205, 207-211, 213-217, 219-223, 225-229, 231-235, 237-241, 243-247, 249-253, 255-259, 261-265, 267-271, 2 73-277, 279-283, 285-289, 291-295, 297-301, 303-307, 309-313, 315-319, 321-325, 327-331, 333-337, 339-343, 345-349, 351-355, 357-361, 363-366 7, 369-373, 375-379, 381-385, 387-391, 393-397, 399-403, 405-409, 411-415, 417-421, 423-427, 429-433, 435-439, 441-445, 447-451, 453-457, 45 9-463, 465-469, 471-475, 477-481, 483-487, 489-493, 495-499, 501-505, 507-511, 513-517, 519-523, 525-529, 531-535, 537-541, 543-547, 549-553 , 555–559, 561–565, 567–571, ​​573–577, 579–583, 585–589, 591–595, 597–601, 603–607, 609–613, 615–619, 621–625, 627–631, 633–637, 639–643, 645 ~649, 651~655, 657~661, 663~667, 669~673, 675~679, 681~685, 687~691, 693~697, 699~703, 705~709, 711~715, 717~721, 723~727, 729~733, 735~739,741~745、747~751、753~757、759~763、765~769、771~775、777~781、783~787、789~793、795~799、801~805、807~811、813~817、819~823、825~829、831~835、837~841、843~847、849~853、855~859、861~865、867~871、873~877、879~883、885~889、891~895、897~901、903~907、909~913、915~919、921~925、927~931、933~937、939~943、945~949、951~955、957~961、963~967、969~973、975~979、981~985、987~991、993~997、999~1003、1005~1009、1011~1015、1017~1021、1023~1027、1029~1033、1035~1039、1041~1045、1047~1051、1053~1057、1059~1063、1065~1069、1071~1075、1077~1081、1083~1087、1089~1093、1095~1099、1101~1105、1107~1111、1113~1117、1119~1123、1125~1129、1131~1135、1137~1141、1143~1147、1149~1153、1155~1159、1161~1165、1167~1171、1173~1177、1179~1183、1185~1189、1191~1195、1197~1201、1203~1207、1209~1213、1215~1219、1221~1225、1227~1231、1233~1237、1239~1243、1245~1249、1251~1255、1257~1261、1263~1267、1269~1273、1275~1279、1281~1285、1287~1291、1293~1297、1299~1303、1305~1309、1311~1315、1317~1321、1323~1327、1329~1333、1335~1339、1341~1345、1347~1351、1353~1357、1359~1363、1365~1369、1371~1375、1377~1381、1383~1387、1389~1393, 1395~1399, 1401~1405, 1407~1411, 1413~1417, 1419~1423, 1425~1429, 1431~1435, 1437~1441, 1443~1447, 1449~1453, 1455~1459, 1461~1465, 1467, and is represented by a nucleotide sequence comprising or consisting of a fragment of 1471, 1473 to 1477, 1479 to 1483, 1485 to 1489, 1491 to 1495, 1497 to 1501, 1503 to 1507, 1509 to 1513, 1515 to 1519, 1521 to 1525, 1527 to 1531, 1533 to 1537, 1539 to 1543, 1545 to 1549, 1551 to 1555, 1557 to 1561, 1563 to 1567, 1569 to 1573, 1575 to 1579, 1592 to 2099, or 3000 to 6048. Within the context of the present invention, a fragment of SEQ ID NO: 8 to 1580 or SEQ ID NO: 1592 to 2099 or SEQ ID NO: 3000 to 6048 preferably means a nucleotide sequence comprising or consisting of at least 10 consecutive nucleotides taken from said SEQ ID NO:.

[0123] More preferred oligonucleotides include at least one 2'-substituted monomer, preferably only RNA monomers and optionally 2'-substituted monomers linked by phosphorothioate backbone linkages and / or by phosphodiester linkages, include 5-methylcytosine and / or 5-methyluracil bases, and include at least one monomer containing a bicyclic nucleic acid (BNA) scaffold modification, and are selected from the group consisting of SEQ ID NOs: 8-1580 or SEQ ID NOs: 8-1581. and having a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides, represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 8 to 1580, or SEQ ID NOs: 1592 to 2099, or SEQ ID NOs: 3000 to 6048, or by a nucleotide sequence comprising or consisting of a fragment of SEQ ID NOs: 8 to 1580, or SEQ ID NOs: 1592 to 2099, or SEQ ID NOs: 3000 to 6048.

[0124] Preferred sequences are SEQ ID NOs: 452 to 613, 1592 to 1605, and 1607, and more preferably SEQ ID NOs: 453 to 457, 459 to 463, 465 to 469, 471 to 475, 477 to 481, 483 to 487, 489 to 493, 495 to 499, 501 to 505, 507 to 511, 513 to 517, 519 to 523, 525 to 529, 531 to 535, 537 to 541, 543 to 547, 549 to 553, 555 to 559, 561 to 565, 567 to 571, and 573 to 577, 579 to 583, 585 to 589, 591 to 595, 597 to 601, 603 to 607, 609 to 613, 1592 to 1605, and 1607, and even more preferably SEQ ID NOs: 453, 455, 456, 459, 461, 462, 465, 467, 468, 471, 473, 474, 483, 486, 1592, 1593, 1594, 1595, 1596, 1597, 1598, 1599, 1600, 1601, 1602, 1603, 1604, 1605 or 1607. The most preferred sequences are SEQ ID NOs: 455, 459, 4528, 4531, 4532, 4533, 4535, 4542, 4548 and 4568.

[0125] In a preferred embodiment, the oligonucleotide is for skipping exon 44 of dystrophin pre-mRNA, represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 8 to 271 or 1608 to 2099 or 3000 to 3184, and comprises one or more of the following: at least one 2'-substituted monomer; at least one phosphorothioate backbone linkage; 2'-substituted monomers only, Phosphorothioate backbone linkages only, Only 2'-substituted monomers linked by phosphorothioate backbone linkages 5-methylcytosine and / or 5-methyluracil bases, Only 5-methylcytosine bases instead of cytosine bases, At least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification.

[0126] Preferably, the oligonucleotide comprises only 2'-substituted monomers, only phosphorothioate backbone linkages, and at least one monomer comprising a BNA scaffold modification, and the oligonucleotide comprises SEQ ID NOs: 9-13, 15-19, 21-25, 27-31, 33-37, 39-43, 45-49, 51-55, 57-61, 63-67, 69-73, 75-79, 81-85, 87-91, 93-97, 99-103, 105-109, 111-115, 117-121, 123-127, 130-132, 132-134, 134-136, 136-138, 138-139, 140-142, 142-143, 144-145, 146-147, 148-149, 150-151, 152-153, 154-155, 156-157, 158-159, 160-161, 162-163, 164-165, 166-167, 168-169, 170-172, 173-174, 175-176, 177-178, 179-200, 178-201, 179-202, 180-182, 181-183, 182-184, 183-185, 184-186, 185-187, 186-188, 187- More preferably, the oligonucleotide is represented by a nucleotide sequence comprising or consisting of 29 to 133, 135 to 139, 141 to 145, 147 to 151, 153 to 157, 159 to 163, 165 to 169, 171 to 175, 177 to 181, 183 to 187, 189 to 193, 195 to 199, 201 to 205, 207 to 211, 213 to 217, 219 to 223, 225 to 229, 231 to 235, 237 to 241, 243 to 247, 249 to 253, 255 to 259, 261 to 265, or 267 to 271. The oligonucleotide preferably has a length of 10 to 33 nucleotides, and most preferably a length of 16 to 22 nucleotides.

[0127] In a preferred embodiment, the oligonucleotide is for skipping exon 45 of dystrophin pre-mRNA, represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 272 to 451 or 3185 to 4527, and comprises one or more of the following: at least one 2'-substituted monomer at least one phosphorothioate backbone linkage; 2'-substituted monomers only, Phosphorothioate backbone linkages only, Only 2'-substituted monomers linked by phosphorothioate backbone linkages 5-methylcytosine and / or 5-methyluracil bases, Only 5-methylcytosine bases instead of cytosine bases, At least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification.

[0128] The oligonucleotide preferably contains only 2'-substituted monomers, only phosphorothioate backbone linkages, and at least one monomer containing a BNA scaffold modification. The oligonucleotide preferably contains SEQ ID NOs: 273-277, 279-283, 285-289, 291-295, 297-301, 303-307, 309-313, 315-319, 321-325, 327-331, 333-337, 339-343, 345-349, 351-355, 357-361, 363-367, 368-369, 370-371, 372-373, 373-374, 375-376, 377-378, 378-379, 380-381, 382-383, 384-385, 386-387, 388-389, 389-400, 390-401, 402-403, 404-405, 406-407, 408-409, 410-411, 412-413, 414-415, 416-417, 418-419, 420-421, 422-423, 424-425, 426-427, 428-429, 430-431, 432-433, 434-435, 436-437, 438-439, 440-441, 442-443, More preferably, it is represented by a nucleotide sequence comprising or consisting of 69 to 373, 375 to 379, 381 to 385, 387 to 391, 393 to 397, 399 to 403, 405 to 409, 411 to 415, 417 to 421, 423 to 427, 429 to 433, 435 to 439, 441 to 445, or 447 to 451. The oligonucleotide preferably has a length of 10 to 33 nucleotides, and most preferably a length of 16 to 22 nucleotides.

[0129] In a preferred embodiment, the oligonucleotide is for skipping exon 51 of dystrophin pre-mRNA, represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 452 to 613 or SEQ ID NOs: 1592 to 1605 or SEQ ID NOs: 4528 to 4572, and comprises one or more of the following: at least one 2'-substituted monomer; at least one phosphorothioate backbone linkage; 2'-substituted monomers only, Phosphorothioate backbone linkages only, Only 2'-substituted monomers linked by phosphorothioate backbone linkages 5-methylcytosine and / or 5-methyluracil bases, Only 5-methylcytosine bases instead of cytosine bases, At least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification.

[0130] The oligonucleotide preferably contains only 2'-substituted monomers, only phosphorothioate backbone linkages, and at least one monomer containing a BNA scaffold modification. The oligonucleotide preferably contains SEQ ID NOs: 453 to 457, 459 to 463, 465 to 469, 471 to 475, 477 to 481, 483 to 487, 489 to 493, 495 to 499, 501 to 505, 507 to 511, 513 to 517, 519 to 523, 525 to 529, 531 to 535, 537 to 541, 543 to 547, More preferably, the nucleotide sequence is represented by a nucleotide sequence including or consisting of 549 to 553, 555 to 559, 561 to 565, 567 to 571, 573 to 577, 579 to 583, 585 to 589, 591 to 595, 597 to 601, 603 to 607, 609 to 613, 1592 to 1605, or 1607, and is represented by SEQ ID NO: 45 Even more preferred are SEQ ID NO: 1. Most preferred are SEQ ID NOs: 592, 1593, 1594, 1595, 1596, 1597, 1598, 1599, 1600, 1601, 1602, 1603, 1604, 1605 or 1607, and even more preferred are SEQ ID NOs: 455, 459, 4528, 4531, 4532, 4533, 4535, 4542, 4548 and 4568. Preferably, the oligonucleotides have a length of 10 to 33 nucleotides, most preferably 16 to 22 nucleotides.

[0131] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1592 (TCAAGGAAGAUGGCAUUUCU), is for skipping exon 51 of dystrophin pre-mRNA, comprises a BNA scaffold modification in the 5'-end monomer and not in the other monomers, comprises 5-methylcytosine instead of cytosine, comprises only phosphorothioate linkages, and further comprises only 2'-O-methyl RNA monomers.

[0132] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1593 (TCAAGGAAGAUGGCAUUUCT), is for skipping exon 51 of dystrophin pre-mRNA, comprises a BNA scaffold modification in the 5'-end monomer and in the 3'-end monomer but not in the other monomers, comprises 5-methylcytosine instead of cytosine, comprises only phosphorothioate linkages, and further comprises only 2'-O-methyl RNA monomers.

[0133] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1594 (TCAAGGAAGAUGGCAUUUCU), is for skipping exon 51 of dystrophin pre-mRNA, comprises a BNA scaffold modification in the 5'-end monomer and its adjacent monomers, but not in any other monomers, contains 5-methylcytosine instead of cytosine, contains only phosphorothioate linkages, and further comprises only 2'-O-methyl RNA monomers.

[0134] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1595 (TCAAGGAAGAUGGCAUUUCUAG), is for skipping exon 51 of dystrophin pre-mRNA, comprises a BNA scaffold modification in the 5'-end monomer and not in the other monomers, comprises 5-methylcytosine instead of cytosine, comprises only phosphorothioate linkages, and further comprises only 2'-O-methyl RNA monomers.

[0135] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1596 (TCAAGGAAGAUGGCAUUUCUAG), is for skipping exon 51 of dystrophin pre-mRNA, comprises BNA scaffold modifications in the 5'-end monomer and in the 3'-end monomer but not in the other monomers, comprises 5-methylcytosine instead of cytosine, comprises only phosphorothioate linkages, and further comprises only 2'-O-methyl RNA monomers.

[0136] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1597 (TCAAGGAAGAUGGCAUUUCUAG), is for skipping exon 51 of dystrophin pre-mRNA, comprises a BNA scaffold modification in the 5'-end monomer and its adjacent monomers, but not in any other monomers, comprises 5-methylcytosine instead of cytosine, comprises only phosphorothioate linkages, and further comprises only 2'-O-methyl RNA monomers.

[0137] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1598 (AAGGAAGAUGGCAUUUCU), is for skipping exon 51 of dystrophin pre-mRNA, comprises a BNA scaffold modification in the 5'-end monomer and not in the other monomers, comprises 5-methylcytosine instead of cytosine, comprises only phosphorothioate linkages, and further comprises only 2'-O-methyl RNA monomers.

[0138] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1599 (AAGGAAGAUGGCAUUUCT), is for skipping exon 51 of dystrophin pre-mRNA, comprises BNA scaffold modifications in the 5'-end monomer and in the 3'-end monomer but not in the other monomers, comprises 5-methylcytosine instead of cytosine, comprises only phosphorothioate linkages, and further comprises only 2'-O-methyl RNA monomers.

[0139] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1600 (AAGGAAGAUGGCAUUUCU), is for skipping exon 51 of dystrophin pre-mRNA, comprises a BNA scaffold modification in the 5'-end monomer and its adjacent monomers, but not in any other monomers, contains 5-methylcytosine instead of cytosine, contains only phosphorothioate linkages, and further comprises only 2'-O-methyl RNA monomers.

[0140] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1601 (GGAAGAUGGCAUUUCU), is for skipping exon 51 of dystrophin pre-mRNA, comprises a BNA scaffold modification in the 5'-end monomer and not in the other monomers, comprises 5-methylcytosine instead of cytosine, comprises only phosphorothioate linkages, and further comprises only 2'-O-methyl RNA monomers.

[0141] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1602 (GGAAGAUGGCAUUUCT), is for skipping exon 51 of dystrophin pre-mRNA, comprises BNA scaffold modifications in the 5'-end monomer and in the 3'-end monomer but not in the other monomers, comprises 5-methylcytosine instead of cytosine, comprises only phosphorothioate linkages, and further comprises only 2'-O-methyl RNA monomers.

[0142] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1603 (GGAAGAUGGCAUUUCU), is for skipping exon 51 of dystrophin pre-mRNA, comprises a BNA scaffold modification in the 5'-end monomer and its adjacent monomers, but not in other monomers, contains 5-methylcytosine instead of cytosine, contains only phosphorothioate linkages, and further comprises only 2'-O-methyl RNA monomers.

[0143] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1604 (TCAAGGAAGAUGGCAU), is for skipping exon 51 of dystrophin pre-mRNA, comprises a BNA scaffold modification in the 5'-end monomer and not in the other monomers, comprises 5-methylcytosine instead of cytosine, comprises only phosphorothioate linkages, and further comprises only 2'-O-methyl RNA monomers.

[0144] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1605 (TCAAGGAAGAUGGCAU), is for skipping exon 51 of dystrophin pre-mRNA, comprises a BNA scaffold modification in the 5'-end monomer and its adjacent monomers, but not in other monomers, contains 5-methylcytosine instead of cytosine, contains only phosphorothioate linkages, and further comprises only 2'-O-methyl RNA monomers.

[0145] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1607 (CUCCAACAUCAAGGAAGAUGGCAUUUCUAG), is for skipping exon 51 of dystrophin pre-mRNA, does not comprise BNA scaffold modifications in any of the monomers, comprises cytosines, comprises only phosphorothioate linkages and further comprises only 2'-O-methyl RNA monomers.

[0146] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1607 (CUCCAACAUCAAGGAAGAUGGCAUUUCUAG), is for skipping exon 51 of dystrophin pre-mRNA, comprises at least one BNA scaffold modification in any monomer, preferably either only in the 5'-terminal monomer, only in the 3'-terminal monomer, both in the 5'-terminal and 3'-terminal monomers, the two most 5'-terminal monomers or the two most 3'-terminal monomers, comprises cytosine, comprises only phosphorothioate linkages and further comprises only 2'-O-methyl RNA monomers.

[0147] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 455 (TCAAGGAAGAUGGCAUUUCT), is for skipping exon 51 of dystrophin pre-mRNA, comprises BNA scaffold modifications in the 5'-end monomer and in the 3'-end monomer but not in the other monomers, comprises 5-methylcytosine instead of cytosine, comprises only phosphorothioate linkages, and further comprises only 2'-O-methyl RNA monomers.

[0148] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 459 (TCAAGGAAGAUGGCAUUUCUAG), is for skipping exon 51 of dystrophin pre-mRNA, comprises a BNA scaffold modification in the 5'-end monomer and not in the other monomers, comprises 5-methylcytosine instead of cytosine, comprises only phosphorothioate linkages, and further comprises only 2'-O-methyl RNA monomers.

[0149] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 4528 (TCAAGGAAGAUGGCAUUUCUAG), is for skipping exon 51 of dystrophin pre-mRNA, comprises BNA scaffold modifications in the 5'-terminal monomer, its adjacent monomer and its 3'-terminal monomer, but not in any other monomer, contains 5-methylcytosine in place of cytosine, contains only phosphorothioate linkages, and further comprises only 2'-O-methyl RNA monomers.

[0150] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 4531 (TCAAGGAAGAUGGCAUUUCUAG), is for skipping exon 51 of dystrophin pre-mRNA, comprises BNA scaffold modifications in the 5'-terminal monomer, in its adjacent monomers, in the 13th monomer from the 5'-terminal end and in its 3'-terminal monomer, but not in any other monomer, contains 5-methylcytosine in place of cytosine, contains only phosphorothioate linkages and further comprises only 2'-O-methyl RNA monomers.

[0151] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 4532 (TCAAGGAAGAUGGCAUUUCUAG), is for skipping exon 51 of dystrophin pre-mRNA, comprises BNA scaffold modifications in the 5'-terminal monomer, in its adjacent monomers, in the 9th monomer from the 5'-terminal end and in its 3'-terminal monomer, but not in any other monomer, contains 5-methylcytosine in place of cytosine, contains only phosphorothioate linkages and further comprises only 2'-O-methyl RNA monomers.

[0152] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 4533 (TCAAGGAAGAUGGCAUUUCUAG), is for skipping exon 51 of dystrophin pre-mRNA, comprises BNA scaffold modifications in the 5'-terminal monomer, its adjacent monomers, the 9th monomer from the 5'-terminal end, the 13th monomer from the 5'-terminal end and its 3'-terminal monomer, but not in any other monomer, contains 5-methylcytosine in place of cytosine, contains only phosphorothioate linkages and further comprises only 2'-O-methyl RNA monomers.

[0153] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 4535 (TCAAGGAAGAUGGCAUUUCT), is for skipping exon 51 of dystrophin pre-mRNA, comprises a BNA scaffold modification in the 5'-terminal monomer, in its adjacent monomers and in its 3'-terminal monomer, but not in any other monomer, comprises 5-methylcytosine instead of cytosine, comprises only phosphorothioate linkages and further comprises only 2'-O-methyl RNA monomers.

[0154] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 4542 (TCAAGGAAGAUGGCAUUUCT), is for skipping exon 51 of dystrophin pre-mRNA, comprises BNA scaffold modifications in the 5'-terminal monomer, in the 13th monomer from the 5'-terminus thereof and in the 3'-terminal monomer, but not in any other monomer, comprises 5-methylcytosine instead of cytosine, comprises only phosphorothioate linkages, and further comprises only 2'-O-methyl RNA monomers.

[0155] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 4548 (CAAGGAAGAUGGCAUUUCT), is for skipping exon 51 of dystrophin pre-mRNA, comprises BNA scaffold modifications in the 5'-terminal monomer, in its adjacent monomer, in the 8th monomer from the 5'-terminal end, in the 12th monomer from the 5'-terminal end and in the 3'-terminal monomer, but not in any other monomer, contains 5-methylcytosine in place of cytosine, contains only phosphorothioate linkages and further comprises only 2'-O-methyl RNA monomers.

[0156] Thus, in a preferred embodiment, the oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 4568 (GGUAAGUUCUGUCCAAGC), is for skipping exon 51 of dystrophin pre-mRNA, comprises BNA scaffold modifications in the 5'-terminal monomer, in its adjacent monomer, in the sixth monomer from the 5'-end and in its 3'-terminal monomer, but not in any other monomer, contains 5-methylcytosine in place of cytosine, contains only phosphorothioate linkages and further comprises only 2'-O-methyl RNA monomers.

[0157] In a preferred embodiment, the oligonucleotide is for skipping exon 52 of dystrophin pre-mRNA, represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 614-841, and comprises one or more of the following: at least one 2'-substituted monomer; at least one phosphorothioate backbone linkage; 2'-substituted monomers only, Phosphorothioate backbone linkages only, Only 2'-substituted monomers linked by phosphorothioate backbone linkages 5-methylcytosine and / or 5-methyluracil bases, Only 5-methylcytosine bases instead of cytosine bases, At least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification.

[0158] The oligonucleotide preferably contains only 2'-substituted monomers, only phosphorothioate backbone linkages, and at least one monomer containing a BNA scaffold modification. The oligonucleotide preferably contains SEQ ID NOs: 615-619, 621-625, 627-631, 633-637, 639-643, 645-649, 651-655, 657-661, 663-667, 669-673, 675-679, 681-685, 687-691, 693-697, 699-703, 705-709, 711-715, 717-721, 723-727, 729-733, 730-734, 735-736, 737-740, 738-741, 742-743, 743-745, 744-745, 745-749, 751-755, 757-761, 763-767, 769-773, 775-779, 781-785, 787-791, 793-797, 799-703, 805-809, 811-815, 821-825, 822-826, 823-827, 824-828, 825-830, 826-831, 827-832, 828-833, 829-834, 830-835, 831-836, 832-837, More preferably, the oligonucleotide is represented by a nucleotide sequence comprising or consisting of 35 to 739, 741 to 745, 747 to 751, 753 to 757, 759 to 763, 765 to 769, 771 to 775, 777 to 781, 783 to 787, 789 to 793, 795 to 799, 801 to 805, 807 to 811, 813 to 817, 819 to 823, 825 to 829, 831 to 835, or 837 to 841. The oligonucleotide preferably has a length of 10 to 33 nucleotides, and most preferably a length of 16 to 22 nucleotides.

[0159] In a preferred embodiment, the oligonucleotide is for skipping exon 53 of dystrophin pre-mRNA, represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 842 to 1159 or 4573 to 6048, and comprises one or more of the following: at least one 2'-substituted monomer; at least one phosphorothioate backbone linkage; 2'-substituted monomers only, Phosphorothioate backbone linkages only, Only 2'-substituted monomers linked by phosphorothioate backbone linkages 5-methylcytosine and / or 5-methyluracil bases, Only 5-methylcytosine bases instead of cytosine bases, At least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification.

[0160] The oligonucleotide preferably contains only 2'-substituted monomers, only phosphorothioate backbone linkages, and at least one monomer containing a BNA scaffold modification. The oligonucleotide preferably contains SEQ ID NOs: 843-847, 849-853, 855-859, 861-865, 867-871, 873-877, 879-883, 885-889, 891-895, 897-901, 903-907, 909-913, 915-919, 921-925, 927 ~931, 933~937, 939~943, 945~949, 951~955, 957~961, 963~967, 969~973, 975~979, 981~985, 987~991, 993~997, 999~1003, 1005~1009, 1011~1015, 1017~1021, 1 It is more preferable that the sequence be represented by a nucleotide sequence comprising or consisting of 1101 to 1105, 1107 to 1111, 1113 to 1117, 1119 to 1123, 1125 to 1129, 1131 to 1135, 1137 to 1141, 1143 to 1147, 1149 to 1153, or 1155 to 1159. The oligonucleotides preferably have a length of 10 to 33 nucleotides, most preferably 16 to 22 nucleotides.

[0161] In a preferred embodiment, the oligonucleotide is for skipping exon 55 of dystrophin pre-mRNA, represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 1160 to 1399, and comprises one or more of the following: at least one 2'-substituted monomer; at least one phosphorothioate backbone linkage; 2'-substituted monomers only, Phosphorothioate backbone linkages only, Only 2'-substituted monomers linked by phosphorothioate backbone linkages 5-methylcytosine and / or 5-methyluracil bases, Only 5-methylcytosine bases instead of cytosine bases, At least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification.

[0162] Preferably, the oligonucleotide comprises only 2'-substituted monomers, only phosphorothioate backbone linkages and at least one monomer containing a BNA scaffold modification. The oligonucleotides are selected from the group consisting of SEQ ID NOs: 1161 to 1165, 1167 to 1171, 1173 to 1177, 1179 to 1183, 1185 to 1189, 1191 to 1195, 1197 to 1201, 1203 to 1207, 1209 to 1213, 1215 to 1219, 1221 to 1225, 1227 to 1231, 1233 to 1237, 1239 to 1243, 1245 to 1249, 1251 to 1255, 1257 to 1261, 1263 to 1267, 1269 to 1273, 1275 to 1279, and 1281 to 1285. , 1287-1291, 1293-1297, 1299-1303, 1305-1309, 1311-1315, 1317-1321, 1323-1327, 1329-1333, 1335-1339, 1341-1345, 1347-1351, 1353-1357, 1359-1363, 1365-1369, 1371-1375, 1377-1381, 1383-1387, 1389-1393, or 1395-1399. The oligonucleotide preferably has a length of 10-33 nucleotides, and most preferably a length of 16-22 nucleotides.

[0163] In a preferred embodiment, the oligonucleotide is represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 1400-1579, is intended to encompass exon 7 of the SMN2 pre-mRNA, and comprises one or more of the following: at least one 2'-substituted monomer; at least one phosphorothioate backbone linkage; 2'-substituted monomers only, Phosphorothioate backbone linkages only, Only 2'-substituted monomers linked by phosphorothioate backbone linkages 5-methylcytosine and / or 5-methyluracil bases, Only 5-methylcytosine bases instead of cytosine bases, At least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification.

[0164] Preferably, the oligonucleotide comprises only 2'-substituted monomers, only phosphorothioate backbone linkages, and at least one monomer comprising a BNA scaffold modification. Most preferably, the oligonucleotide is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1606, without a BNA scaffold modification, or comprising or consisting of SEQ ID NO: 1490, and comprising a BNA scaffold modification in any monomer, preferably in only the 5'-terminal monomer, the 3'-terminal monomer, both the 5'-terminal and 3'-terminal monomers, the two most 5'-terminal monomers, or the two most 3'-terminal monomers. Preferably, the oligonucleotide has a length of 10 to 33 nucleotides, most preferably 16 to 22 nucleotides.

[0165] In a preferred embodiment, the oligonucleotide is for targeting intron 6 of the SMN2 pre-mRNA, represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 1400-1441, and comprises one or more of the following: at least one 2'-substituted monomer; at least one phosphorothioate backbone linkage; 2'-substituted monomers only, Phosphorothioate backbone linkages only, Only 2'-substituted monomers linked by phosphorothioate backbone linkages 5-methylcytosine and / or 5-methyluracil bases, Only 5-methylcytosine bases instead of cytosine bases, At least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification.

[0166] The oligonucleotide preferably comprises only 2'-substituted monomers, only phosphorothioate backbone linkages, and at least one monomer comprising a BNA scaffold modification. More preferably, the oligonucleotide is represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 1401-1405, 1407-1411, 1413-1417, 1419-1423, 1425-1429, 1431-1435, or 1437-1441. The oligonucleotide preferably has a length of 10-33 nucleotides, and most preferably a length of 16-22 nucleotides.

[0167] In a preferred embodiment, the oligonucleotide is for targeting intron 7 of the SMN2 pre-mRNA, represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 1442-1579, and comprises one or more of the following: at least one 2'-substituted monomer; at least one phosphorothioate backbone linkage; 2'-substituted monomers only, Phosphorothioate backbone linkages only, Only 2'-substituted monomers linked by phosphorothioate backbone linkages 5-methylcytosine and / or 5-methyluracil bases, Only 5-methylcytosine bases instead of cytosine bases, At least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification.

[0168] Preferably, the oligonucleotide comprises only 2'-substituted monomers, only phosphorothioate backbone linkages and at least one monomer containing a BNA scaffold modification. The oligonucleotides are more preferably represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 1443 to 1447, 1449 to 1453, 1455 to 1459, 1461 to 1465, 1467 to 1471, 1473 to 1477, 1479 to 1483, 1485 to 1489, 1491 to 1495, 1497 to 1501, 1503 to 1507, 1509 to 1513, 1515 to 1519, 1521 to 1525, 1527 to 1531, 1533 to 1537, 1539 to 1543, 1545 to 1549, 1551 to 1555, 1557 to 1561, 1563 to 1567, 1569 to 1573, and 1575 to 1579. The oligonucleotide most preferably comprises or consists of SEQ ID NO: 1490 and is represented by a nucleotide sequence comprising a BNA scaffold modification in any monomer, preferably in only the 5'-terminal monomer, only the 3'-terminal monomer, in both the 5'-terminal and 3'-terminal monomers, in the two most 5'-terminal monomers, or in the two most 3'-terminal monomers. The oligonucleotide preferably has a length of 10 to 33 nucleotides, more preferably 16 to 22 nucleotides, and most preferably 18 monomers.

[0169] In a preferred embodiment, an oligonucleotide according to the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 1606 (UCACUUUCAUAAUGCUGG), is for targeting intron 7 of the SMN2 pre-mRNA, does not contain BNA scaffold modifications in any of the monomers, contains 5-methylcytosines in place of cytosines, contains only phosphorothioate linkages, and further contains only 2'-O-methyl RNA monomers.

[0170] In a preferred embodiment, the oligonucleotide according to the present invention has improved parameters compared to a corresponding oligonucleotide that does not contain a bicyclic nucleic acid (BNA) scaffold modification. The inventors have discovered that the presence of a BNA containing 5-methylcytosine or 5-methyluracil in the oligonucleotide of the present invention has a positive effect on at least one of the parameters of the oligonucleotide. In this context, the parameters may include binding affinity and / or kinetics, exon skipping activity, biostability, (tissue) distribution, cellular uptake and / or transport, and / or immunogenicity of the oligonucleotide, as described below.

[0171] The binding affinity and kinetics depend on the thermodynamic properties of the oligonucleotide. These are determined at least in part by the melting temperature (Tm; calculated using, for example, an Oligonucleotide Property Calculator (e.g., accessible via the Internet at www.unc.edu / ~cail / biotool / oligo / index.html or, for example, eu.idtdna.com / analyzer / Applications / OligoAnalyzer / ) for single-stranded RNA of the oligonucleotide using a basic Tm and nearest neighbor model) and / or the free energy of the oligonucleotide-target exon complex (using RNA structure version 4.5 or RNA mfold version 3.5). If the Tm is increased, exon skipping activity usually increases, but if the Tm is too high, the oligonucleotide is predicted to be less sequence-specific. Acceptable Tm and free energy vary depending on the sequence of the oligonucleotide. Therefore, it is difficult to indicate a preferred range for each of these parameters.

[0172] Exon skipping activity is preferably measured by analyzing total RNA isolated from oligonucleotide-treated muscle cell cultures or muscle tissues by reverse transcriptase quantitative or digital droplet polymerase chain reaction (RT-qPCR or RT-ddPCR) (Aartsma-Rus et al., 2003; Spitali et al., 2013) using DMD gene-specific primers flanking each of the targeted exons. The proportion of shorter transcript fragments representing transcripts in which the targeted exon is skipped relative to the total transcript product is assessed (calculated as the percentage of exon skipping induced by the oligonucleotide). The shorter fragments can also be sequenced to determine the accuracy and specificity of the targeted exon skipping.

[0173] In certain embodiments, RNA regulatory activity can be an increase or decrease in the amount of a nucleic acid or protein. In certain embodiments, such activity can be a change in the ratio of splice variants of a nucleic acid or protein. Detection and / or measurement of antisense activity can be direct or indirect. In certain embodiments, antisense activity is assessed by observing changes in the phenotype of a cell or animal.

[0174] As used herein and as explained above, "modulation" can also refer to the perturbation of the quantity or quality of a function or activity compared to the function or activity prior to modulation. For example, modulation includes a change in gene expression, either an increase (stimulation or induction) or a decrease (inhibition or reduction). As a further example, modulation of expression can include perturbing splice site selection in pre-mRNA processing, resulting in a change in the amount of a particular splice variant present compared to the unperturbed state. As a further example, modulation includes perturbing protein translation.

[0175] Biodistribution and biostability are preferably determined, at least in part, by a validated hybridization-ligation assay adapted from Yu et al., 2002. In one embodiment, plasma or homogenized tissue samples are incubated with a specific capture oligonucleotide probe. After separation, DIG-labeled oligonucleotides are ligated to the complex, followed by detection using a peroxidase-linked anti-DIG antibody. Non-compartmental pharmacokinetic analysis is performed using the WINNONLIN software package (Model 200, Version 5.2, Pharsight, Mountainview, CA). Levels of oligonucleotide (μg) per mL of plasma or mg of tissue are monitored over time to determine the area under the curve (AUC), peak concentration (C max ), time to peak concentration (T max ), terminal half-life and absorption lag time (t lag ) is assessed. Such a preferred assay is disclosed in the experimental section.

[0176] Thus, preferred oligonucleotides of the invention have improved parameters, such as acceptable or reduced immunogenicity and / or better biodistribution and / or acceptable or improved RNA binding kinetics and / or thermodynamic properties, compared to corresponding oligonucleotides of the invention that differ only by the omission of the BNA scaffold modification, i.e., compared to oligonucleotides of the same sequence that contain 2'-O-methyl substituted monomers, 5'-methylcytosine and / or 5'-methyluracil, optionally also phosphorothioates, but without the BNA-modified scaffold. Each of these parameters can be assessed using assays known to those of skill in the art or, preferably, as disclosed herein.

[0177] Further chemical modifications of oligonucleotides Below are defined other chemistries and modifications of the oligonucleotides of the invention, which may be present in combination with the chemistries already defined for said oligonucleotides, i.e., the presence of at least one BNA scaffold modification with or without 5-methylcytosine and / or 5-methyluracil and / or oligonucleotides comprising or consisting of 2'-O-methyl monomers with optional phosphorothioate backbone linkages.

[0178] The preferred oligonucleotide of the present invention comprises or consists of an RNA molecule or a modified RNA molecule. In a preferred embodiment, the oligonucleotide is single-stranded. However, those skilled in the art will understand that a single-stranded oligonucleotide may form an internal double-stranded structure. However, this oligonucleotide is still referred to as a single-stranded oligonucleotide in the context of the present invention.

[0179] In addition to the above-mentioned modifications, the oligonucleotide of the present invention can comprise further modifications, such as different types of nucleic acid monomers or nucleotides, as described below.Different types of nucleic acid monomers can be used to prepare the oligonucleotide of the present invention.The oligonucleotide can have at least one backbone and / or scaffold modification and / or at least one base modification compared to RNA-based oligonucleotides.

[0180] Base modifications include modified versions of natural purine and pyrimidine bases (e.g., adenine, uracil, guanine, cytosine, and thymine), such as hypoxanthine, pseudouracil, pseudocytosine, 1-methylpseudouracil, orotic acid, agmatidine, lysidine, 2-thiopyrimidines (e.g., 2-thiouracil, 2-thiothymine), G-clamps and their derivatives, 5-substituted pyrimidines (e.g., 5-halouracil, 5-halomethyluracil, 5-trifluoromethyluracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, Super T, or modifications of bases such as those described in, for example, Kumar et al. J. Org. Chem. 2014, 79, 5047; Leszczynska et al. Org. Biol. Chem. 2014, 12, 1052), pyrazolo[1,5-a]-1,3,5-triazine C-nucleosides (e.g., as described in Lefoix et al. J. Org. Chem. 2014, 79, 3221), 7-deazaguanine, 7-deazaadenine, 7-aza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, boronated cytosines (e.g., as described in Niziol et al. Bioorg. Med. Chem. 2014, vol. 22, p. 3906), pseudoisocytidine, C(Pyc) (e.g., as in Yamada et al. Org. Biomol. Chem. 2014, vol. 12, p. 2255) and N4-ethylcytosine or derivatives thereof; N 2 -Cyclopentylguanine (cPent-G), N 2 -cyclopentyl-2-aminopurine (cPent-AP) and N 2The bases may include degenerate or universal bases (e.g., 1-deoxyribose, 1,2-dideoxyribose, 1-deoxy-2-O-methylribose, or (azaribose) pyrrolidine derivatives in which the ring oxygen is replaced with nitrogen), such as 2,6-difluorotoluene, 2-propyl-2-aminopurine (Pr-AP), carbohydrate-modified uracil (e.g., Kaura et al., Org. Lett. 2014, vol. 16, p. 3308), amino acid-modified uracil (e.g., Guenther et al., Chem. Commun. 2014, vol. 50, p. 9007), or derivatives thereof, and non-existent bases such as 2,6-difluorotoluene or abasic sites. Examples of Super A, Super G, and Super T derivatives can be found in U.S. Pat. No. 6,683,173 (Epoch Biosciences), the entire contents of which are incorporated herein by reference. cPent-G, cPent-AP, and Pr-AP have been shown to reduce immunostimulatory effects when incorporated into siRNA (Peacock H. et al., J. Am. Chem. Soc. 2011, vol. 133, p. 9200). Examples of modified bases are described, for example, in WO 2014 / 093924 (ModeRNA).

[0181] Depending on their length, oligonucleotides of the invention may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34 base modifications. Also encompassed by the invention is the introduction of two or more distinct base modifications into the oligonucleotide.

[0182] In addition to the BNA scaffold modifications already described, scaffold modifications can also be made to 2'-O-modified RNAs, such as 2'-O-alkyl or 2'-O-(substituted) alkyl, for example, 2'-O-methyl, 2'-O-(2-cyanoethyl), 2'-O-(2-methoxy)ethyl (2'-MOE), 2'-O-(2-thiomethyl)ethyl, 2'-O-butyryl, 2'-O-propargyl, 2'-O-acetal esters (e.g., Biscans et al. Bioorg. Med. Chem. 2015, 23, 5360), 2'-O-allyl, 2'-O-(2S-methoxypropyl), 2'-O-(N-(aminoethyl)carbamoyl)methyl) (2'-AECM), 2'-O-(2-carboxyethyl), and carbamoyl derivatives (Yamada et al. Org. Biomol. Chem. 2014, Vol. 12, p. 6457), 2'-O-(2-amino)propyl, 2'-O-(2-(dimethylamino)propyl), 2'-O-(2-amino)ethyl, 2'-O-(2-(dimethylamino)ethyl), 2'-deoxy(DNA), 2'-O-(haloalkoxy)methyl (Arai K. et al. Bioorg. Med. Chem. 2011, Vol. 21, p. 6285) For example, 2'-O-(2-chloroethoxy)methyl (MCEM), 2'-O-(2,2-dichloroethoxy)methyl (DCEM), 2'-O-alkoxycarbonyl, for example, 2'-O-[2-(methoxycarbonyl)ethyl] (MOCE), 2'-O-[2-(N-methylcarbamoyl)ethyl] (MCE), 2'-O-[2-(N,N-dimethylcarbamoyl)ethyl] (DCME), 2'-O-[2-(methylthio)ethyl] ( Modified versions of the ribosyl moiety may include 2'-MTE), 2'-(ω-O-serinol), 2'-halo, e.g., 2'-F, FANA (2'-F arabinosyl nucleic acid), 2',4'-difluoro-2'-deoxy, carba- and aza-sugar modifications, 3'-O-substituted, e.g., 3'-O-methyl, 3'-O-butyryl, 3'-O-propargyl, 4'-substituted, e.g., 4'-aminomethyl-2'-O-methyl or 4'-aminomethyl-2'-fluoro, 5'-substituted, e.g., 5'-methyl, or CNA (Ostergaard et al. ACS Chem. Biol. 2014, 22, 6227) and derivatives thereof.

[0183] Oligonucleotides of the invention, depending on their length, can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 or 33 scaffold modifications in addition to at least one BNA scaffold modification. Also encompassed by the invention is the introduction of two or more distinct scaffold modifications into the oligonucleotide.

[0184] Other modifications include unlocked nucleic acid (UNA), cyclohexenyl nucleic acid (CeNA), F-CeNA, cyclohexanyl nucleic acid (CNA), ribo-cyclohexanyl nucleic acid (r-CNA), altritol nucleic acid (ANA), hexitol nucleic acid (HNA), fluorinated HNA (F-HNA), pyranosyl-RNA (p-RNA), 3'-deoxypyranosyl-DNA (p-DNA) and their derivatives. Examples of fluorinated nucleic acid analogs with furanose and non-furanose sugar rings are also included, and are described, for example, in Ostergaard et al., J.Org.Chem., 2014, vol. 79, p. 8877.

[0185] Oligonucleotides of the invention, in addition to at least one BNA scaffold modification, can, depending on their length, contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34 scaffold modifications. In preferred embodiments, oligonucleotides of the invention are fully 2'-O-methyl modified and contain 1, 2, 3, 4, 5, or 6 BNA scaffold modifications.

[0186] Oligonucleotides according to the present invention may contain backbone-linked modifications, including, but not limited to, phosphodiester modifications present in RNA, such as phosphorothioate (PS), chiral pure phosphorothioate, (R)-phosphorothioate, (S)-phosphorothioate, phosphorodithioate (PS2), phosphonoacetate (PACE), phosphonoacetamide (PACA), thiophosphonoacetate (thioPACE), thiophosphonoacetamide, phosphorothioate prodrugs, H-phosphonate, methylphosphonate, methylphosphonothioate, methylphosphate, methylphosphorothioate, ethylphosphate, ethylphosphorothioate, boranophosphate, boranophosphorothioate, methylboranophosphate, methylboranophosphorothioate, methylboranophosphonate, methylboranophosphonothioate, phosphate, phosphotriester, aminoalkylphosphotriester, and derivatives thereof. Other modifications include phosphorylguanidine, phosphoramidite, phosphoramidate, N3'→P5' phosphoramidate, phosphordiamidate, phosphorothiodiamidate, sulfamate, dimethylene sulfoxide, amide, sulfonate, siloxane, sulfide, sulfone, formacetyl, thioformacetyl, methyleneformacetyl, alkenyl, methylenehydrazino, sulfonamide, amide, triazole, oxalyl, carbamate, methyleneimino (MMI), and thioacetamide nucleic acid (TANA) and their derivatives. Examples of chiral pure phosphorothioate linkages are described, for example, in WO 2014 / 010250 or WO 2017 / 062862 (WaVe Life Sciences). Examples of phosphorylguanidine linkages are described in WO 2016 / 028187 (Noogen). Various salts, mixed salts and free base forms as well as 3'→3' and 2'→5' linkages are also included.

[0187] Depending on their length, oligonucleotides of the invention may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33 backbone linkage modifications. It is also encompassed by the invention to introduce two or more distinct backbone modifications into the oligonucleotide.

[0188] In a preferred embodiment, the oligonucleotide of the present invention comprises at least one phosphorothioate modification. In a more preferred embodiment, the oligonucleotide of the present invention is fully phosphorothioate modified. In another preferred embodiment, the oligonucleotide of the present invention comprises at least one phosphate.

[0189] Other chemical modifications of the oligonucleotides of the invention include the substitution of one or more of any of the hydrogen atoms with deuterium or tritium, examples of which can be found, for example, in WO 2014 / 022566 (Ased) or WO 2015 / 011694 (Celgene).

[0190] With the advent of nucleic acid mimicking technology, it has become possible to create molecules that have similar, and preferably identical, hybridization characteristics in kind, if not necessarily in amount, as the nucleic acids themselves. Such functional equivalents are, of course, also suitable for use in the present invention.

[0191] Those skilled in the art will understand that the scaffolds, bases and / or backbones may not each be modified in the same way, and several different modified scaffolds, bases and / or backbones may be combined in one single oligonucleotide of the invention.

[0192] In one embodiment, the oligonucleotide according to the invention has a length of 10 to 33 nucleotides, a) at least one monomer is represented by Formula I: [ka] [In the formula, B is a nucleobase, X is F, -NR 1 R 2 -OR, R is alkenyl or optionally substituted alkyl, and the optional substituents, if present, are halo, OR 1 , N.R. 1 R 2 or SR 1 and R 1 is H, alkyl, cycloalkyl, aryl, heterocycloalkyl, or heteroaryl, each independently optionally further substituted with halo, hydroxy, or alkyl; R 2 is H or alkyl, [ka] indicates the point of attachment to the rest of the oligonucleotide] and b) at least one monomer comprises a BNA scaffold modification and has Formula II [ka] [In the formula, B 1 is a nucleobase, ZY is -(CH2) n O-, -C(CH2CH2)O-, -CH2WCH2-, -(CH2) n NR 3 -, -CH2S(O m )-, -CH(CH3)O-, -CH(CH2OCH3)O-, -CH2N(R 3 )O-, -CH2CH2-, -C(O)NR 3 -, -CH=CHO-, -CH2SO2NR 3 - and -NHC(O)NH-; n is 1 or 2, m is 0, 1 or 2; W is O, S or NR 3 and R 3 is H, -C(O)R 4 , -C(=NH)NR 5 R 5 , benzyl, or optionally substituted alkyl, wherein the optional substituents, if present, are selected from halo and alkoxy; R 4 is alkyl, cycloalkyl or aryl, R 5 is H or alkyl, [ka] indicates the point of attachment to the rest of the oligonucleotide] and c) the monomers are linked by phosphorothioate backbone linkages and / or by phosphodiester backbone linkages; d) At least one nucleobase in the oligonucleotide is a 5-methylcytosine or 5-methyluracil base.

[0193] The term "residue of an oligonucleotide," as used herein, generally refers to an adjacent monomer. As will be understood by those skilled in the art, when a monomer of Formula I or Formula II is a terminal monomer, the remainder of the oligonucleotide can be -H. For a monomer of either Formula I or Formula II, both remainders can be adjacent monomers. In contrast, for a monomer of either Formula I or Formula II, at most one single remainder can constitute an end, and thus can be, for example, -H. As will be understood by those skilled in the art, an entire oligonucleotide has only two ends.

[0194] ZY is a divalent group. Such a divalent group is preferably attached to the 4'-position of the scaffold (near Z) with a bond on the left side of the original designation, and to the 2'-position of the scaffold (near Y) with a bond on the right side of the original designation. For example, if a divalent group is said to be -CH2-O-, it is preferred that -CH2- is attached to the 4'-position of the scaffold and -O- is attached to the 2'-position of the scaffold. This would form an LNA monomer.

[0195] Preferably, the oligonucleotide is for use in a method or composition according to the invention. The nucleobase is, under d), B or B 1 Or it may be another nucleobase.

[0196] In another embodiment, X is F or -OR. In another embodiment, X is F. In another embodiment, X is -OR. In another embodiment, X is F, -OCH3, or -O-CH2CH2OCH3. In another embodiment, X is -OCH3 or -O-CH2CH2OCH3. In another embodiment, X is -OCH3. In another embodiment, X is F or -OCH3. In another embodiment, X is F or -O-CH2CH2OCH3.

[0197] In another embodiment, R is unsubstituted alkyl. In another embodiment, R is CH or ethyl. In another embodiment, R is CH. In another embodiment, R is ethyl. In another embodiment, R is halo, OR 1 , N.R. 1 R 2 or SR 1 In another embodiment, R is alkyl substituted with OR 1 or NR 1 R 2 In another embodiment, R is alkyl substituted with OR 1 is alkyl substituted with

[0198] In another embodiment, R 1is H or unsubstituted alkyl. In another embodiment, R 1 is unsubstituted alkyl. In another embodiment, R 1 is CH3. In another embodiment, R 2 is H. In another embodiment, R 2 is alkyl. In another embodiment, R 2 is CH3.

[0199] In another embodiment, ZY is -(CH2) n O-, -C(CH2CH2)O-, -CH2WCH2-, -CH2NR 3 -, -CH2S(O m )-, -CH(CH3)O-, -CH(CH2OCH3)O-, -CH2CH2-, -C(O)NR 3 -, -CH=CHO-, -CH2SO2NR 3 In another embodiment, ZY is a divalent group selected from - and -NHC(O)NH-. n O-, -CH2WCH2-, -CH2NR 3 -, -CH(CH3)O-, -CH(CH2OCH3)O-, -CH2CH2- and -C(O)NR 3 In another embodiment, ZY is a divalent group selected from -(CH2) n O-, -CH2NR 3 -, -CH(CH3)O-, -CH(CH2OCH3)O-, -CH2CH2- and -C(O)NR 3 In another embodiment, ZY is selected from -(CH2) n O-, -CH2OCH2-, -CH2NR 3 CH2- and -CH2NR 3 In another embodiment, ZY is selected from -(CH2) nIn another embodiment, ZY is selected from -O-, -CH2OCH2-, -CH2NHCH2-, -CH2NH-, -CH2N(CH3)CH2-, and -CH2N(CH3)-. In another embodiment, ZY is selected from -CHO-, -CH2OCH2-, -CH2NHCH2-, and -CH2NH-. In another embodiment, ZY is selected from -CHO-, -CH2OCH2-, or -CH2NH-. In another embodiment, ZY is selected from -(CH2) n In another embodiment, ZY is selected from -O-, -CH(CH3)O-, and -CH(CH2OCH3)O-. n In another embodiment, ZY is -CH2CH2O-. In another embodiment, ZY is -CH2O-. In another embodiment, ZY is -CH2NH-.

[0200] In another embodiment, W is O, S, or NH. In another embodiment, W is O. In another embodiment, W is S. In another embodiment, W is O, NH, or NCH. In another embodiment, W is O or NH. In another embodiment, W is NH.

[0201] In another embodiment, R 3 is H, -C(O)R 4 or unsubstituted alkyl. In another embodiment, R 3 is H, -C(O)R 4 or CH3. In another embodiment, R 3 is H, —C(O)CH3 or CH3.

[0202] In another embodiment, R 4 is alkyl. In another embodiment, R 4 is CH3.

[0203] In another embodiment, R 5 is H. In another embodiment, R 5 is alkyl.

[0204] In another embodiment, X is F, —OCH or —O—CH CH OCH and Z is —(CH) n O-, -CH2OCH2-, -CH2NR 3 CH2- or -CH2NR 3 In another embodiment, X is F, —OCH or —O—CH CH OCH and Z is —(CH) n In another embodiment, X is F, -OCH or -O-CHCHOCH and ZY is -CHO-, -CHOCH-, -CHNHCH-, or -CHNH, -CHN(CH)CH-, or -CHN(CH)-. In another embodiment, X is F, -OCH or -O-CHCHOCH and ZY is selected from -CHO-, -CHOCH-, and -CHNH-. In another embodiment, X is F or -OCH and ZY is selected from -CHO-, -CHOCH-, and -CHNH-. In another embodiment, X is F or -OCH and ZY is selected from -CHO-, -CHOCH-, and -CHNH-. In another embodiment, X is F or -OCH and ZY is -CHO-.

[0205] In another embodiment, at least one B in the oligonucleotide is a 5-methylcytosine or 5-methyluracil base. 1 is a 5-methylcytosine or 5-methyluracil base. In another embodiment, all of the cytosine nucleobases in the oligonucleotide are 5-methylcytosine. In another embodiment, all of the uracil nucleobases in the oligonucleotide are 5-methyluracil.

[0206] In another embodiment, the oligonucleotide is 10 to 33 nucleotides in length, a) at least one monomer is represented by Formula I [In the formula, B is a nucleobase, X is F, -NR 1 R 2 -OR, R is optionally substituted alkyl, and the optional substituents, when present, are halo, OR 1 , N.R. 1 R 2 or SR 1 and R 1 is H, alkyl, cycloalkyl, aryl, heterocycloalkyl, or heteroaryl, each independently optionally further substituted with halo, hydroxy, or alkyl; R 2 is H or alkyl, [ka] indicates the point of attachment to the rest of the oligonucleotide] and b) at least one monomer comprises a BNA scaffold modification; c) the monomers are linked by phosphorothioate backbone linkages and / or by phosphodiester backbone linkages; d) At least one nucleobase in the oligonucleotide is a 5-methylcytosine or 5-methyluracil base.

[0207] In another embodiment, the oligonucleotide is 10 to 33 nucleotides in length, a) at least one monomer is represented by Formula I [In the formula, B is a nucleobase, X is F, -NR 1 R 2 -OR, R is optionally substituted alkyl, and the optional substituents, when present, are halo, OR 1 , N.R. 1 R 2 or SR 1 and R 1 is H, alkyl, cycloalkyl, aryl, heterocycloalkyl, or heteroaryl, each independently optionally further substituted with halo, hydroxy, or alkyl; R2 is H or alkyl, [ka] indicates the point of attachment to the rest of the oligonucleotide] and b) at least one monomer comprises a BNA scaffold modification and has Formula II [In the formula, B 1 and ZY are as defined above. and c) the monomers are linked by phosphorothioate backbone linkages and / or by phosphodiester backbone linkages; d) At least one nucleobase in the oligonucleotide is a 5-methylcytosine or 5-methyluracil base.

[0208] In another embodiment, the BNA scaffold modification is CRN, LNA, xylo-LNA, α-LNA, α-L-LNA, β-D-LNA, 2'-amino-LNA, 2'-(alkylamino)-LNA, 2'-(acylamino)-LNA, 2'-thio-LNA, cEt BNA, cMOE BNA, cLNA, amide-bridged LNA, 2',4'-BNA NC (NH), 2',4'-BNA NC (N-Me), 2',4'-BNA NC (N-Bn), CBBN, ENA, DpNA, sulfonamide-bridged BNA, urea-bridged BNA, bicyclic carbocyclic nucleotide, TriNA, α-L-TriNA, bcDNA, tcDNA, F-bcDNA, F-tcDNA, heterocyclic-bridged BNA, locked PMO derived from 2'-amino-LNA, GuNA, or scpNA.

[0209] In another embodiment, the BNA scaffold modification is CRN, LNA, xylo-LNA, α-LNA, α-L-LNA, β-D-LNA, 2'-amino-LNA, 2'-(alkylamino)-LNA, 2'-(acylamino)-LNA, 2'-thio-LNA, cEt BNA, cMOE BNA, cLNA, amide-bridged LNA, 2',4'-BNA NC (NH), 2',4'-BNA NC (N-Me), 2',4'-BNA NC (N-Bn), CBBN, ENA, DpNA, sulfonamide-bridged BNA, urea-bridged BNA. In another embodiment, BNA scaffold modification results in a monomer that is CRN, LNA, xylo-LNA, α-LNA, α-L-LNA, β-D-LNA, 2'-amino-LNA, or 2'-(alkylamino)-LNA. In another embodiment, BNA scaffold modification results in a monomer that is CRN, LNA, 2'-amino-LNA, or CBBN. In another embodiment, BNA scaffold modification results in a monomer that is CRN, LNA, or 2'-amino-LNA. In another embodiment, the BNA scaffold modification results in a monomer that is LNA, xylo-LNA, α-LNA, α-L-LNA, β-D-LNA, 2'-amino-LNA, 2'-(alkylamino)-LNA, 2'-(acylamino)-LNA, 2'-thio-LNA, cEt BNA, cMOE BNA, or cLNA. In another embodiment, the BNA scaffold modification results in a monomer that is LNA, 2'-amino-LNA, 2'-(alkylamino)-LNA, 2'-thio-LNA, cEt BNA, cMOE BNA, or cLNA. In another embodiment, the BNA scaffold modification results in a monomer that is LNA, 2'-amino-LNA, 2'-(alkylamino)-LNA, 2',4'-BNA NC (NH), 2',4'-BNA NC In another embodiment, the BNA scaffold modification is LNA, 2'-amino-LNA, 2',4'-BNA, or 2',4'-BNA. NC(NH), CBBN, or ENA. In another embodiment, BNA scaffold modification results in a monomer that is LNA, CBBN, or ENA. In another embodiment, BNA scaffold modification results in a monomer that is LNA or ENA. In another embodiment, BNA scaffold modification results in a monomer that is LNA.

[0210] In another embodiment, the BNA scaffold modification is 2',4'-BNA NC (NH), 2',4'-BNA NC (N-Me), 2',4'-BNA NC (N-Bn), CBBN, ENA, sulfonamide-bridged BNA, or urea-bridged BNA. In another embodiment, the BNA scaffold modification results in a monomer that is 2',4'-BNA. NC (NH), 2',4'-BNA NC This results in a monomer that is (N-Me), CBBN, or ENA.

[0211] In another embodiment, the oligonucleotide is 10 to 33 nucleotides in length, a) at least one monomer is represented by Formula I [In the formula, B is a nucleobase, X is F, —OCH or —O—CH CH OCH; [ka] indicates the point of attachment to the rest of the oligonucleotide] and b) at least one monomer comprises a BNA scaffold modification and has Formula II [In the formula, B 1 is a nucleobase, ZY is -(CH2) n O-, -C(CH2CH2)O-, -CH2WCH2-, -CH2NR 3-, -CH2S-, -CH(CH3)O-, -CH(CH2OCH3)O-, -CH2CH2-, -C(O)NR 3 -, -CH=CHO-, -CH2SO2NR 3 - and -NHC(O)NH-; n is 1 or 2, W is O, S or NR 3 and R 3 is H, -C(O)R 4 , -C(=NH)NR 5 R 5 , benzyl, or optionally substituted alkyl, wherein the optional substituents, if present, are selected from halo and alkoxy; R 4 is alkyl, cycloalkyl or aryl, R 5 is H or alkyl, [ka] indicates the point of attachment to the rest of the oligonucleotide] and c) the monomers are linked by phosphorothioate backbone linkages and / or by phosphodiester backbone linkages; d) At least one nucleobase in the oligonucleotide is a 5-methylcytosine or 5-methyluracil base.

[0212] In another embodiment, the oligonucleotide is 10 to 33 nucleotides in length, a) at least one monomer is represented by Formula I [In the formula, B is a nucleobase, X is F, —OCH or —O—CH CH OCH; [ka] indicates the point of attachment to the rest of the oligonucleotide] and b) one or two monomers contain a BNA scaffold modification and have the structure of Formula II [In the formula, B 1 is a nucleobase, ZY is -(CH2) n O-, -C(CH2CH2)O-, -CH2WCH2-, -CH2NR 3 -, -CH2S-, -CH(CH3)O-, -CH(CH2OCH3)O-, -CH2CH2-, -C(O)NR 3 -, -CH=CHO-, -CH2SO2NR 3 - and -NHC(O)NH-; n is 1 or 2, W is O, S or NR 3 and R 3 is H, -C(O)R 4 , -C(=NH)NR 5 R 5 , benzyl, or optionally substituted alkyl, wherein the optional substituents, if present, are selected from halo and alkoxy; R 4 is alkyl, cycloalkyl or aryl, R 5 is H or alkyl, indicates the point of attachment to the rest of the oligonucleotide] and c) the monomers are linked by phosphorothioate backbone linkages and / or by phosphodiester backbone linkages; d) At least one nucleobase in the oligonucleotide is a 5-methylcytosine or 5-methyluracil base.

[0213] In another embodiment, the oligonucleotide is 10-33 nucleotides in length and all monomers that do not contain a BNA scaffold modification ("non-BNA monomers") are modified monomers of Formula I. In another embodiment, the oligonucleotide is 10-33 nucleotides in length and has one or two non-BNA monomers of Formula I. In another embodiment, the oligonucleotide is 10-33 nucleotides in length and has one non-BNA monomer of Formula I.

[0214] In another embodiment, the oligonucleotide comprises 1, 2, 3, 4, 5, 6, or 7 monomers comprising a BNA scaffold modification. In another embodiment, the oligonucleotide comprises 1, 2, 3, 4, 5, 6, or 7 monomers comprising a BNA scaffold modification and having Formula II. In another embodiment, the oligonucleotide comprises 1, 2, 3, or 4 monomers comprising a BNA scaffold modification. In another embodiment, the oligonucleotide comprises 1, 2, 3, or 4 monomers comprising a BNA scaffold modification and having Formula II. In another embodiment, the oligonucleotide comprises 1, 2, or 3 monomers comprising a BNA scaffold modification. In another embodiment, the oligonucleotide comprises 1, 2, or 3 monomers comprising a BNA scaffold modification and having Formula II. In another embodiment, the oligonucleotide comprises 1 or 2 monomers comprising a BNA scaffold modification. In another embodiment, the oligonucleotide comprises 1 or 2 monomers comprising a BNA scaffold modification and having Formula II. In another embodiment, the oligonucleotide comprises 2 monomers comprising a BNA scaffold modification. In another embodiment, the oligonucleotide comprises a BNA scaffold modification and includes two monomers having Formula II. In another embodiment, the oligonucleotide comprises one monomer having a BNA scaffold modification. In another embodiment, the oligonucleotide comprises one monomer having a BNA scaffold modification and includes one monomer having Formula II.

[0215] In another embodiment, an oligonucleotide in accordance with the invention comprises the sequence GGAAGAUGGCAU (SEQ ID NO: 6072). In another embodiment, an oligonucleotide in accordance with the invention comprises a sequence selected from the group consisting of SEQ ID NOs: 453, 455, 456, 453, 455, 456, 459, 461, 462, 465, 467, 468, 471, 473, 474, 483, 486, 525, 531, 538, 539, 540, 543, 545, 546, and 4528-4572. In another embodiment, an oligonucleotide in accordance with the invention comprises a sequence selected from the group consisting of SEQ ID NOs: 453, 455, 459, 4528, 4531, 4532, 4533, 4535, 4542, 4548, and 4568. In another embodiment, an oligonucleotide in accordance with the invention comprises a sequence selected from the group consisting of SEQ ID NOs: 453, 455, and 456. In another embodiment, an oligonucleotide in accordance with the invention comprises a sequence selected from the group consisting of SEQ ID NOs: 455 and 459. In another embodiment, an oligonucleotide in accordance with the invention comprises a sequence selected from the group consisting of SEQ ID NOs: 4528, 4531, 4532, 4533, 4535, 4542, 4548 and 4568. In another embodiment, an oligonucleotide in accordance with the invention comprises a sequence selected from the group consisting of SEQ ID NOs: 459, 4528, 4531, 4532, 4533 and 4542.

[0216] In another embodiment, an oligonucleotide in accordance with the invention comprises the sequence GGAAGAUGGCAU (SEQ ID NO: 6072) and is intended to skip exon 51 of dystrophin pre-mRNA. In another embodiment, an oligonucleotide in accordance with the invention comprises a sequence selected from the group consisting of SEQ ID NOs: 452-613 or 4528-4572 and is intended to skip exon 51 of dystrophin pre-mRNA. In another embodiment, an oligonucleotide in accordance with the invention comprises a sequence selected from the group consisting of SEQ ID NOs: 453, 455, and 456 and is intended to skip exon 51 of dystrophin pre-mRNA. In another embodiment, an oligonucleotide in accordance with the invention comprises a sequence selected from the group consisting of SEQ ID NOs: 455 and 459 and is intended to skip exon 51 of dystrophin pre-mRNA.

[0217] In another embodiment, an oligonucleotide in accordance with the invention comprises the sequence GGUAAGUUCNGUCCAAGC (SEQ ID NO: 6073), where N is T or U. In another embodiment, an oligonucleotide in accordance with the invention comprises the sequence GGUAAGUUCNGUCCAAGC (SEQ ID NO: 6073), where N is T or U, and is for skipping exon 51 of dystrophin pre-mRNA. In another embodiment, an oligonucleotide in accordance with the invention comprises a sequence selected from the group consisting of SEQ ID NOs: 4565 to 4571. In another embodiment, an oligonucleotide in accordance with the invention comprises a sequence selected from the group consisting of SEQ ID NOs: 4565 to 4571, and is for skipping exon 51 of dystrophin pre-mRNA.

[0218] In another embodiment, an oligonucleotide according to the invention comprises a sequence selected from the group consisting of SEQ ID NOs: 4561 to 4564 and SEQ ID NO: 4572. In another embodiment, an oligonucleotide according to the invention comprises a sequence selected from the group consisting of SEQ ID NOs: 4561 to 4564 and SEQ ID NO: 4572, and is for skipping exon 51 of dystrophin pre-mRNA.

[0219] In another embodiment, an oligonucleotide in accordance with the invention comprises the sequence CCCAAUUUUUCCUG (SEQ ID NO: 6074). In another embodiment, an oligonucleotide in accordance with the invention comprises the sequence CCCAAUGCCAUCCUG (SEQ ID NO: 6075). In another embodiment, an oligonucleotide in accordance with the invention comprises a sequence selected from the group consisting of SEQ ID NOs: 3185, 3573, 3855, 4198, and 4401. In another embodiment, an oligonucleotide in accordance with the invention comprises a sequence selected from the group consisting of SEQ ID NOs: 3185, 3573, 3855, and 4401. In another embodiment, an oligonucleotide in accordance with the invention comprises the sequence CCCAAUUUUUCCUG (SEQ ID NO: 6074) and is for skipping exon 45 of dystrophin pre-mRNA. In another embodiment, an oligonucleotide in accordance with the invention comprises the sequence CCCAAUGCCAUCCUG (SEQ ID NO: 6075) and is for skipping exon 45 of dystrophin pre-mRNA. In another embodiment, an oligonucleotide according to the invention comprises a sequence selected from the group consisting of SEQ ID NOs: 3185, 3573, 3855, 4198 and 4401 and is for skipping exon 45 of dystrophin pre-mRNA. In another embodiment, an oligonucleotide according to the invention comprises a sequence selected from the group consisting of SEQ ID NOs: 3185, 3573, 3855 and 4401 and is for skipping exon 45 of dystrophin pre-mRNA.

[0220] In a preferred embodiment, the oligonucleotide according to the invention comprises the sequence CUUCUGUUAGCC (SEQ ID NO: 6076). Such oligonucleotides preferably have a length of 16 to 24 nucleotides, more preferably 20 nucleotides. In this regard, a preferred embodiment is an antisense oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 29.

[0221] In a preferred embodiment, the oligonucleotide according to the invention comprises the sequence UAUUUAGCA (SEQ ID NO: 6077). Such oligonucleotides preferably have a length of 16 to 24 nucleotides, more preferably 23 nucleotides. In this regard, a preferred embodiment is an antisense oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 161.

[0222] In a preferred embodiment, the oligonucleotide according to the invention comprises the sequence GGAAUUUGU (SEQ ID NO: 6078). Such oligonucleotides preferably have a length of 16 to 24 nucleotides, more preferably 23 nucleotides. In this regard, a preferred embodiment is an antisense oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 119.

[0223] In a preferred embodiment, the oligonucleotide according to the invention comprises the sequence CUCAACAGA (SEQ ID NO: 6079). Such oligonucleotides preferably have a length of 16 to 24 nucleotides, more preferably 23 nucleotides. In this regard, a preferred embodiment is an antisense oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 233.

[0224] When the oligonucleotide according to the present invention is intended to skip exon 44 of dystrophin pre-mRNA, it preferably comprises a sequence represented by SEQ ID NOs: 6076-6079.

[0225] In a preferred embodiment, the oligonucleotide according to the invention comprises the sequence GCCCAAU (SEQ ID NO: 6080). Such oligonucleotides preferably have a length of 16 to 26 nucleotides, more preferably 25 nucleotides. In this regard, a preferred embodiment is an antisense oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 3185.

[0226] In a preferred embodiment, the oligonucleotide according to the invention comprises the sequence CCAAUUUU (SEQ ID NO: 6081). Such oligonucleotides preferably have a length of 16 to 26 nucleotides, more preferably 24 nucleotides. In this regard, a preferred embodiment is an antisense oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 3573.

[0227] In a preferred embodiment, the oligonucleotide according to the invention comprises the sequence GCCCAAU (SEQ ID NO: 6082). Such oligonucleotides preferably have a length of 16 to 26 nucleotides, more preferably 25 nucleotides. In this regard, a preferred embodiment is an antisense oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 3855.

[0228] In a preferred embodiment, the oligonucleotide according to the invention comprises the sequence UCUGACAACA (SEQ ID NO: 6083). Such oligonucleotides preferably have a length of 16 to 24 nucleotides, more preferably 22 nucleotides. In this regard, a preferred embodiment is an antisense oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 4198.

[0229] In a preferred embodiment, the oligonucleotide according to the invention comprises the sequence CAAUGCCAUCC (SEQ ID NO: 6084). Such oligonucleotides preferably have a length of 16 to 24 nucleotides, more preferably 21 nucleotides. In this regard, a preferred embodiment is an antisense oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 4401.

[0230] When the oligonucleotide according to the present invention is intended to skip exon 45 of dystrophin pre-mRNA, it preferably comprises a sequence represented by SEQ ID NO: 6074, 6075, or 6080-6084.

[0231] In a preferred embodiment, the oligonucleotide according to the invention comprises the sequence AAGAUGGCAU (SEQ ID NO: 6085). Such oligonucleotides preferably have a length of 16 to 24 nucleotides, more preferably 22 nucleotides. In this regard, a preferred embodiment is an antisense oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 459.

[0232] In a preferred embodiment, the oligonucleotide according to the invention comprises the sequence UAAGUUCUGUCCAA (SEQ ID NO: 6086). Such oligonucleotides preferably have a length of 16 to 24 nucleotides, more preferably 18 nucleotides. In this regard, a preferred embodiment is an antisense oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 4565.

[0233] When the oligonucleotide according to the invention is intended to skip exon 51 of dystrophin pre-mRNA, it preferably comprises the sequence represented by SEQ ID NO: 6072, 6073, 6085 or 6086.

[0234] In a preferred embodiment, the oligonucleotide according to the invention comprises the sequence GUUGCCUCCGGUUC (SEQ ID NO: 6087). Such oligonucleotides preferably have a length of 16 to 24 nucleotides, more preferably 18 nucleotides. In this regard, a preferred embodiment is an antisense oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 845.

[0235] In a preferred embodiment, the oligonucleotide according to the invention comprises the sequence GGUUCUG (SEQ ID NO: 6088). Such oligonucleotides preferably have a length of 16 to 26 nucleotides, more preferably 25 nucleotides. In this regard, a preferred embodiment is an antisense oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 863.

[0236] In a preferred embodiment, the oligonucleotide according to the invention comprises the sequence GAUUCUGAAU (SEQ ID NO: 6089). Such oligonucleotides preferably have a length of 16 to 24 nucleotides, more preferably 22 nucleotides. In this regard, a preferred embodiment is an antisense oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 4987.

[0237] In a preferred embodiment, the oligonucleotide according to the invention comprises the sequence ACUUCAUC (SEQ ID NO: 6090). Such oligonucleotides preferably have a length of 16 to 26 nucleotides, more preferably 24 nucleotides. In this regard, a preferred embodiment is an antisense oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 5174.

[0238] In a preferred embodiment, the oligonucleotide according to the invention comprises the sequence UUCCAUGA (SEQ ID NO: 6091). Such oligonucleotides preferably have a length of 16 to 26 nucleotides, more preferably 24 nucleotides. In this regard, a preferred embodiment is an antisense oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 5446.

[0239] In a preferred embodiment, the oligonucleotide according to the invention comprises the sequence UGUUGCCU (SEQ ID NO: 6092). Such oligonucleotides preferably have a length of 16 to 26 nucleotides, more preferably 24 nucleotides. In this regard, a preferred embodiment is an antisense oligonucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 5765.

[0240] When the oligonucleotide according to the present invention is intended to skip exon 53 of dystrophin pre-mRNA, it preferably comprises a sequence represented by SEQ ID NOs: 6087-6092.

[0241] composition In one aspect of the present invention, there is provided a composition comprising at least one oligonucleotide according to the present invention, preferably comprising at least one excipient, and / or the oligonucleotide comprising at least one conjugated ligand, which may further serve to enhance targeting and / or delivery of the composition and / or the oligonucleotide to and / or into tissues and / or cells. A composition as described herein is herein referred to as a composition according to the present invention. A composition according to the present invention may comprise one or more oligonucleotides according to the present invention. In the context of the present invention, the excipient may be a separate molecule, but may also be a conjugated moiety. In the first case, the excipient may be a bulking agent such as starch. In the latter case, the excipient may be, for example, a targeting ligand linked to the oligonucleotide according to the present invention.

[0242] In a preferred embodiment of this aspect, such compositions may further comprise a cationic amphiphilic compound (CAC) or cationic amphiphilic drug (CAD). CACs are generally lysosomotropic agents and weak bases capable of buffering endosomes and lysosomes (Mae et al., Journal of Controlled Release, Vol. 134:221-227, 2009). Compositions further comprising a CAC preferably have improved RNA modulation parameters compared to similar compositions without the CAC. Without wishing to be bound by theory, this is believed to be because the CAC can assist the oligonucleotides of the present invention in reaching their site of activity, for example, by promoting endosomal escape. Preferred CACs for inclusion in the compositions of the present invention include toremifene and its derivatives, analogs, and metabolites, such as N-desmethyltoremifene, tamoxifen, afimoxifene, clomiphene, droloxifene, idoxifene, miproxifene, and nafoxidine. These CACs share a common 1,1-diphenylethylene moiety. When a compound differs from a compound described herein only by minor substitutions or modifications, the compound is a derivative of such compound and may also be viewed as an analog thereof. Metabolites of a compound are a particular class of derivatives. For compounds known in the art, metabolites are often also known. When metabolites of a compound are mentioned, at least all of these known metabolites are mentioned. For example, N-desmethyltoremifene is a known metabolite of toremifene.

[0243] In a preferred embodiment, the composition is for use as a medicament. The composition is therefore a pharmaceutical composition. Pharmaceutical compositions typically contain pharmaceutically acceptable carriers, diluents, and / or excipients. In a preferred embodiment, the composition of the present invention comprises a compound as defined herein, and optionally further contains pharmaceutically acceptable formulations, fillers, preservatives, solubilizers, carriers, diluents, excipients, salts, adjuvants, and / or solvents. Such pharmaceutically acceptable carriers, fillers, preservatives, solubilizers, diluents, salts, adjuvants, solvents, and / or excipients can be found, for example, in Remington: The Science and Practice of Pharmacy, 20th ed., Baltimore, MD: Lippincott Williams & Wilkins, 2000. The compound as described in the present invention may have at least one ionizable group. The ionizable group may be basic or acidic, and may be charged or neutral. The ionizable group can exist as an ion pair with a suitable counterion carrying the opposite charge(s). Examples of cationic counterions include sodium, potassium, cesium, Tris, lithium, calcium, magnesium, trialkylammonium, triethylammonium, and tetraalkylammonium. Examples of anionic counterions include chloride, bromide, iodide, lactate, mesylate, besylate, triflate, acetate, trifluoroacetate, dichloroacetate, tartrate, lactate, and citrate. Examples of counterions have been described [e.g., Kumar, 2008, incorporated herein by reference].

[0244] The pharmaceutical composition may contain additives that enhance the stability, solubility, absorption, bioavailability, activity, pharmacokinetics, pharmacodynamics, cellular uptake, and intracellular transport of the compound, particularly excipients capable of forming complexes, such as nanoparticles, microparticles, nanotubes, nanogels, hydrogels, poloxamers or pluronics, polymersomes, colloids, microbubbles, vesicles, micelles, lipoplexes, and / or liposomes. Examples of nanoparticles include polymer nanoparticles, (mixed) metal nanoparticles, carbon nanoparticles, gold nanoparticles, magnetic nanoparticles, silica nanoparticles, lipid nanoparticles, sugar nanoparticles, protein nanoparticles, and peptide nanoparticles. Examples of nanoparticle-oligonucleotide combinations include spherical nucleic acids (SNAs), as described in Barnaby et al., Cancer Treat. Res. 2015, 166, 23.

[0245] A preferred composition comprises at least one excipient that may further aid in enhancing targeting and / or delivery of said composition and / or said oligonucleotide to and / or into tissues and / or cells. A preferred tissue or cell is muscle tissue or cell.

[0246] Many of these excipients are known in the art (see, e.g., Bruno, 2011) and can be categorized as a first type of excipient. Examples of first type excipients include polymers (e.g., polyethyleneimine (PEI), polypropyleneimine (PPI), dextran derivatives, butyl cyanoacrylate (PBCA), hexyl cyanoacrylate (PHCA), lactic acid-glycolic acid copolymer (PLGA), polyamines (e.g., spermine, spermidine, putrescine, cadaverine), chitosan, poly(amidoamine) (PAMAM), poly(esteramine), polyvinyl ether, polyvinylpyrrolidone (PVP), polyethylene glycol (PEG), cyclodextrin, hyaluronic acid, colominic acid, and derivatives thereof), dendrimers (e.g., poly(amidoamine)), lipids (e.g., 1,2-dioleoyl-3-dimethylammonium propane (DODAP), and the like). ), dioleoyldimethylammonium chloride (DODAC), phosphatidylcholine derivatives [e.g., 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC)], lyso-phosphatidylcholine derivatives [e.g., 1-stearoyl-2-lyso-sn-glycero-3-phosphocholine (S-LysoPC)], sphingomyelin, 2-{3-[bis-(3-amino-propyl)-amino]-propylamino}-N-ditetracedylcarbamoylmethylacetamide (RPR209120), phosphoglycerol derivatives [e.g., 1,2-dipalmitoyl-sn-glycero-3-phosphoglycerol, sodium salt (DPPG-Na)], phosphatic acid acid) derivatives [1,2-distearoyl-sn-glycero-3-phosphatic acid, sodium salt (DSPA), phosphatidylethanolamine derivatives [e.g., dioleoyl-LR-phosphatidylethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhyPE)], N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium (DOTAP), N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium (DOTMA), 1,3-dioleoyloxy-2-(6-carboxy-spermyl)-propylamide (DOSPER), (1,2-dimyristyolxypropyl)-3-dimethylhydroxyethylammonium (DMRIE), (N-cholesteryloxycarbonyl-3, 7-diazanonane-1,9-diamine (CDAN), dimethyldioctadecylammonium bromide (DDAB), 1-palmitoyl-2-oleoyl-sn-glycerol-3-phosphocholine (POPC), (bL-arginyl-2,3-L-diaminopropionic acid-N-palmityl-N-oleyl-amide trihydrochloride (AtuFECT01), N,N-dimethyl-3-aminopropane derivatives [e.g., 1,2-distearoyloxy-N,N-dimethyl -3-aminopropane (DSDMA), 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane (DoDMA), 1,2-dilinoleyloxy-N,N-3-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl[1,3]-dioxolane (DLin-K-DMA), phosphatidylserine derivative [1,2-dioleyl-sn-glycero-3-phospho-L-serine, sodium salt (DOPS)], protein (e.g., albumin, gelatin, atellocollagen) and linear or cyclic peptides (e.g., protamine, PepFects, NickFects, polyarginine, polylysine, CADY, MPG, cell-penetrating peptides (CPPs), targeting peptides, cell-translocation peptides, endosomal escape peptides). Examples of such peptides have been described, for example, muscle-targeting peptides (e.g., Jirka et al., Nucl. Acid Ther. 2014, Vol. 24, p. 25), CPPs (e.g., Pip series, including those in WO 2013 / 030569), and oligoarginine series, e.g., U.S. Pat. No. 9,161,948 (Sarepta), WO 2016 / 187425 (Sarepta), and, for example, M12 peptide in Gao et al., Mol. Ther. 2014, Vol. 22, p. 1333) or blood-brain barrier (BBB)-crossing peptides such as (branched) ApoE derivatives (Shabanpoor et al., Nucl. Acids Ther. 2017, Vol. 27, p. 130). When used as separate compounds, carbohydrates and carbohydrate clusters, such as those described below, are also suitable for use as excipients of the first type.

[0247] Another preferred composition may include at least one excipient categorized as a second type of excipient. The second type of excipient may include or contain a conjugate group as described herein to enhance targeting and / or delivery of the compositions and / or oligonucleotides of the present invention to and / or into tissues and / or cells, such as muscle tissue or cells. The conjugate group may exhibit one or more different or identical ligands. Examples of conjugate group ligands include, for example, peptides, vitamins, aptamers, carbohydrates or carbohydrate mixtures (Han et al., Nature Communications, 2016, doi:10.1038 / ncomms10981; Cao et al., Mol. Ther. Nucleic Acids, 2016, doi:10.1038 / mtna.2016.46), proteins, small molecules, antibodies, polymers, and drugs. Examples of carbohydrate conjugate group ligands include glucose, mannose, galactose, maltose, fructose, N-acetylgalactosamine (GalNAc), glucosamine, N-acetylglucosamine, glucose-6-phosphate, mannose-6-phosphate, and maltotriose. The carbohydrates can be present in large numbers, for example, as terminal groups in a dendritic or branched linker moiety that connects the carbohydrate to a component of the composition. The carbohydrate can also be included in a carbohydrate cluster moiety, such as a GalNAc cluster moiety. The carbohydrate cluster moiety can include a targeting moiety and, optionally, a conjugate linker. In some embodiments, the carbohydrate cluster moiety includes 1, 2, 3, 4, 5, 6, or more GalNAc groups."Carbohydrate cluster," as used herein, refers to a compound having one or more carbohydrate residues attached to a scaffold or linker group (see, e.g., Maier et al., "Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting," Bioconjugate Chem., 2003, (14):18-29; Rensen et al., "Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor," J. Med. Chem., 2004, (47):5798-5808). In this context, "modified carbohydrate" refers to any carbohydrate having one or more chemical modifications relative to a naturally occurring carbohydrate. "Carbohydrate derivative," as used herein, refers to any compound that can be synthesized using a carbohydrate as a starting material or intermediate. "Carbohydrate," as used herein, refers to a naturally occurring carbohydrate, a modified carbohydrate, or a carbohydrate derivative. Both types of excipients may be combined together in one single composition as described herein. Examples of trivalent N-acetylglucosamine clusters are described in WO 2017 / 062862 (Wave Life Sciences), which also describes clusters of sulfonamide small molecules.An example of a single conjugate of the small molecule sertraline has been described (Ferres-Coy et al., Mol. Psych. 2016, 21, 328), as well as conjugates of protein-binding small molecules including ibuprofen (e.g., U.S. Pat. No. 6,656,730 ISIS / Ionis Pharmaceuticals), spermine (e.g., Noir et al., J. Am. Chem. Soc. 2008, 130, 13500), anisamide (e.g., Nakagawa et al., J. Am. Chem. Soc. 2010, 132, 8848), and folic acid (e.g., Dohmen et al., Mol. Ther. Nucl. Acids 2012, 1, e7).

[0248] Oligonucleotide aptamers are known in the art (e.g., Zhao et al., Biomaterials 2015, Vol. 67, p. 42).

[0249] Antibodies and antibody fragments can also be conjugated to the oligonucleotides of the present invention. In a preferred embodiment, antibodies or fragments thereof that target specific tissues of interest, particularly muscle tissue, are conjugated to the oligonucleotides of the present invention. Examples of such antibodies and / or fragments are targeted to CD71 (transferrin receptor), as described in WO 2016 / 179257 (CytoMx) and Sugo et al., J. Control. Rel. 2016, No. 237, p. 1, or to equilibrative nucleoside transporters (ENT), such as the 3E10 antibody, as described in Weisbart et al., Mol. Cencer Ther. 2012, Vol. 11, p. 1.

[0250] Other oligonucleotide conjugates are known to those skilled in the art and are reviewed, for example, in Winkler et al., Ther. Deliv. 2013, vol. 4, p. 791; Manoharan, Antisense Nucl. Acid. Dev. 2004, vol. 12, p. 103; and Ming et al., Adv. Drug Deliv. Rev. 2015, vol. 87, p. 81.

[0251] One skilled in the art can select, combine, and / or adapt one or more of these or other alternative excipients and delivery systems to formulate and deliver compounds for use in the present invention.

[0252] Such pharmaceutical compositions of the present invention may be administered to animals, preferably mammals, at effective concentrations for a set period of time. More preferably, mammals include humans. The oligonucleotides or compositions as defined herein for use in accordance with the present invention may be suitable for direct administration to cells, tissues, and / or organs in vivo of an individual suffering from or at risk of developing a disease or condition as identified herein, and may be administered directly in vivo, ex vivo, or in vitro. Administration may be by local, systemic, and / or parenteral routes, such as intravenous, subcutaneous, intraperitoneal, intrathecal, intramuscular, intraocular, nasal, genitourinary, intradermal, transdermal, enteral, intravitreal, intracavernous, intracerebral, intrathecal, epidural, or oral routes.

[0253] Such pharmaceutical compositions of the present invention may preferably be encapsulated in the form of an emulsion, suspension, pill, tablet, capsule or softgel for oral delivery, or in the form of an aerosol or dry powder for delivery to the respiratory tract and lungs.

[0254] In one embodiment, the oligonucleotides of the present invention may be used together with other compounds already known to be used for the treatment of said diseases, such other compounds for reducing inflammation, preferably for reducing muscle tissue inflammation, and / or supplementary compounds for improving muscle fiber function, integrity and / or survival, and / or improving, increasing or restoring candidate function may be used.

[0255] Examples include, but are not limited to, steroids, preferably (glucocorticosteroids), epicatechin, ACE inhibitors (preferably perindopril) and HDAC inhibitors, angiotensin II type 1 receptor blockers (preferably losartan), angiotensin peptide (1-7), tumor necrosis factor-alpha (TNFα) inhibitors, NF-kB inhibitors, TGFβ inhibitors (preferably decorin), human recombinant biglycan, a source of mIGF-1, myostatin inhibitors, mannose-6 phosphate, antioxidants, ion channel inhibitors, dantrolene, protease inhibitors, phosphodiesterase inhibitors (preferably PDE5 inhibitors such as sildenafil or tadalafil), and / or L-arginine. Such combined use may be sequential: each component is administered separately, possibly as a separate composition. Alternatively, each compound may be used together in a single composition.

[0256] The compounds contained in the composition according to the present invention may also be provided separately, for example, to allow for sequential administration of the active ingredients of the composition according to the present invention. In such cases, the composition according to the present invention is a combination of at least one oligonucleotide according to the present invention, with or without a conjugated ligand, at least one excipient, and optionally a compound comprising a CAC as described above.

[0257] use In a further aspect, there is provided the use of a composition or oligonucleotide as described in the preceding paragraphs for use as part of a medicament or therapy or application in which said oligonucleotide exerts its activity intracellularly.

[0258] Preferably, the oligonucleotides or compositions of the invention are for use as part of a medicament or therapy to prevent, delay, cure, ameliorate and / or treat DMD or BMD or SMA.

[0259] In one embodiment of this aspect of the invention there is preferably provided an oligonucleotide according to the invention or a composition according to the invention for use as a medicament for treating, preventing and / or delaying Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD) or spinal muscular atrophy (SMA). method

[0260] In a further aspect, there is provided a method for preventing, treating, curing, ameliorating and / or delaying a condition or disease as defined in the preceding paragraphs in a cell, tissue or organ of an individual, the method comprising administering an oligonucleotide or composition of the invention to said individual or subject in need thereof.

[0261] The method of the invention may involve administering an oligonucleotide or composition as defined herein to cells, tissues, and / or organs in vivo of an individual affected by any of the diseases defined herein or at risk of developing an inflammatory disorder, and may be administered in vivo, ex vivo, or in vitro. The individual or subject in need is preferably a mammal, more preferably a human. Alternatively, the subject is not human. Administration may be by local, systemic, and / or parenteral routes, such as intravenous, subcutaneous, nasal, intraocular, intraperitoneal, intrathecal, intramuscular, intracavity, genitourinary, intradermal, transdermal, enteral, intravitreal, intracerebral, intrathecal, epidural, or oral routes.

[0262] In one embodiment, in the method of the present invention, the concentration of the oligonucleotide or composition is in the range of 0.01 nM to 1 μM. The concentration used is more preferably 0.05 to 500 nM, or 0.1 to 500 nM, or 0.02 to 500 nM, or 0.05 to 500 nM, and even more preferably 1 to 200 nM.

[0263] The dose range of the oligonucleotide or composition according to the invention is preferably designed based on ascending dose studies (in vivo use) in clinical trials where strict protocol requirements exist. Oligonucleotides as defined herein may be used at doses ranging from 0.01 to 200 mg / kg, or 0.05 to 100 mg / kg, or 0.1 to 50 mg / kg, or 0.1 to 20 mg / kg, preferably 0.5 to 10 mg / kg.

[0264] The concentration or dosage ranges of the oligonucleotides or compositions as indicated above are preferred concentrations or dosages for in vitro or ex vivo use. Those skilled in the art will understand that the concentration or dosage of the oligonucleotides used may further vary or may even need to be omitted depending on the identity of the oligonucleotides used, the target cells to be treated, the gene target and its expression level, the medium used, and the transfection and incubation conditions.

[0265] In one embodiment of this aspect of the invention there is provided a method for preventing, treating and / or delaying Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD) or spinal muscular atrophy (SMA), comprising administering to a subject an oligonucleotide according to the invention or a composition according to the invention.

[0266] Specific Embodiments of the Invention 1.i) Ia) at least one 2'-substituted monomer and optionally a phosphorothioate backbone linkage or Ib) only 2'-substituted monomers linked by phosphorothioate backbone linkages and / or by phosphodiester linkages; ii) 5-methylcytosine and / or 5-methyluracil bases and iii) at least one monomer comprising a bicyclic nucleic acid (BNA) scaffold modification; An oligonucleotide comprising: 2. The oligonucleotide according to embodiment 1, comprising 1, 2, 3 or 4 monomers comprising a bicyclic nucleic acid (BNA) scaffold modification, preferably a bridged nucleic acid scaffold modification. 3. The oligonucleotide according to embodiment 1 or 2, wherein at least one bicyclic nucleic acid (BNA) scaffold modification is comprised in a terminal monomer of said oligonucleotide, preferably in the 5'-terminal monomer of said oligonucleotide, more preferably in both terminal monomers of said oligonucleotide. 4. Each occurrence of the bicyclic nucleic acid (BNA) scaffold modification is a conformationally restricted nucleotide (CRN) monomer, a locked nucleic acid (LNA) monomer, a xylo-LNA monomer, an α-L-LNA monomer, a β-D-LNA monomer, a 2'-amino-LNA monomer, a 2'-(alkylamino)-LNA monomer, a 2'-(acylamino)-LNA monomer, a 2'-N-substituted-2'-amino-LNA monomer, a (2'-O,4'-C) constrained ethyl (cEt) LNA monomer, a (2'-O,4'-C) constrained methoxyethyl (cMOE) BNA monomer, a 2',4'-BNA NC (NH) monomer, 2',4'-BNA NC The oligonucleotide according to any one of embodiments 1 to 3, wherein the monomers are independently selected from the group consisting of (N-Me) monomers, Ethylene-Bridged Nucleic Acid (ENA) monomers, 2'-C-Bridged Bicyclic Nucleotide (CBBN) monomers, and derivatives thereof. 5. The oligonucleotide according to any one of embodiments 1 to 4, wherein said 2'-substituted monomer is a 2'-substituted RNA monomer, a 2'-F monomer, a 2'-amino monomer, a 2'-O-substituted monomer, a 2'-O-methyl monomer or a 2'-O-(2-methoxyethyl) monomer, preferably a 2'-O-methyl monomer. 6. The oligonucleotide according to any one of embodiments 1 to 5, wherein all cytosine bases are 5-methylcytosine bases and / or all uracil bases are 5-methyluracil bases. 7. The oligonucleotide according to any one of embodiments 1 to 6, wherein said oligonucleotide has a length of less than 34 nucleotides. 8. The oligonucleotide according to any one of embodiments 1 to 7, comprising or consisting of a sequence that is complementary to, or binds to, or targets or hybridizes to, at least a part of an exon and / or non-exon region, preferably complementary to, or binds to, or targets or hybridizes to at least a part of an exon recognition sequence (ERS), an exon splicing silencer (ESS), an intron splicing silencer (ISS), an SR protein binding site, or another splicing element, signal or structure. 9. The oligonucleotide according to embodiment 8, wherein at least a portion of said exonic and / or non-exonic region has a length of 10 to 33 nucleotides. 10. The oligonucleotide according to embodiment 8 or 9, wherein said exon and / or non-exon region is in the DMD gene or in the SMN gene. 11. The oligonucleotide according to any one of embodiments 1 to 10, which is represented by a nucleotide sequence comprising or consisting of SEQ ID NOs: 8 to 1580, or by a nucleotide sequence comprising or consisting of a fragment of SEQ ID NOs: 8 to 1580, preferably by a nucleotide sequence comprising or consisting of SEQ ID NOs: 453, 455, 456, 459, 461, 462, 465, 467, 468, 471, 473, 474, 483 or 486, or by a nucleotide sequence comprising or consisting of a fragment of SEQ ID NOs: 453, 455, 456, 459, 461, 462, 465, 467, 468, 471, 473, 474, 483 or 486. 12. The oligonucleotide according to any one of embodiments 1 to 11, wherein said oligonucleotide induces pre-mRNA splicing modulation, preferably wherein said pre-mRNA splicing modulation alters protein production or composition, preferably wherein said pre-mRNA splicing modulation comprises exon skipping or exon inclusion, most preferably wherein said RNA modulation comprises exon skipping. 13. The oligonucleotide according to any one of embodiments 1 to 12, wherein said oligonucleotide induces pre-mRNA splicing modulation, and said pre-mRNA splicing modulation alters the production of a protein associated with a disease or condition, and wherein said disease or condition is Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD) or spinal muscular atrophy (SMA). 14. The oligonucleotide according to any one of embodiments 1 to 13, having improved parameters compared to a corresponding oligonucleotide not comprising a bicyclic nucleic acid (BNA) scaffold modification. 15. A composition comprising an oligonucleotide as defined in any one of embodiments 1 to 14, preferably comprising at least one excipient which may further serve to enhance targeting and / or delivery of said composition and / or said oligonucleotide to and / or into tissues and / or cells. 16. An oligonucleotide according to any one of embodiments 1 to 14, or a composition according to claim 15, for use as a medicament, preferably for treating, preventing and / or delaying Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD) or spinal muscular atrophy (SMA). 17. A method for preventing, treating and / or delaying Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD) or spinal muscular atrophy (SMA), comprising administering to a subject an oligonucleotide as defined in any one of embodiments 1 to 14 or a composition as defined in claim 15. 18. An oligonucleotide having a length of 10 to 33 nucleotides, a) at least one monomer is represented by Formula I [ka] [In the formula, B is a nucleobase, X is F, -NR 1 R 2 -OR, R is alkenyl or optionally substituted alkyl, and the optional substituents, if present, are halo, OR 1 , N.R. 1 R 2 or SR 1 and R 1 is H, alkyl, cycloalkyl, aryl, heterocycloalkyl, or heteroaryl, each independently optionally further substituted with halo, hydroxy, or alkyl; R 2 is H or alkyl, [ka] indicates the point of attachment to the rest of the oligonucleotide] and b) at least one monomer comprises a BNA scaffold modification and has Formula II [ka] [In the formula, B 1 is a nucleobase, ZY is -(CH2) n O-, -C(CH2CH2)O-, -CH2WCH2-, -(CH2) n NR 3 -, -CH2S(O m )-, -CH(CH3)O-, -CH(CH2OCH3)O-, -CH2N(R 3 )O-, -CH2CH2-, -C(O)NR 3-, -CH=CHO-, -CH2SO2NR 3 - and -NHC(O)NH-; n is 1 or 2, m is 0, 1 or 2; W is O, S or NR 3 and R 3 is H, -C(O)R 4 , -C(=NH)NR 5 R 5 , benzyl, or optionally substituted alkyl, wherein the optional substituents, if present, are selected from halo and alkoxy; R 4 is alkyl, cycloalkyl or aryl, R 5 is H or alkyl, [ka] indicates the point of attachment to the rest of the oligonucleotide] and c) the monomers are linked by phosphorothioate backbone linkages and / or by phosphodiester backbone linkages; d) An oligonucleotide, wherein at least one nucleobase in the oligonucleotide is a 5-methylcytosine or 5-methyluracil base. 19. The oligonucleotide according to embodiment 18, wherein R is unsubstituted alkyl or CH3 or CH2CH3. 20.R 1 20. The oligonucleotide according to embodiment 18 or 19, wherein 21. The oligonucleotide according to any of embodiments 18 to 20, wherein X is F or -OR. 22. The oligonucleotide according to any of embodiments 18 to 21, wherein X is F or —OCH 3 . 23.ZY is -(CH2) n 23. The oligonucleotide of any of embodiments 18 to 22, wherein the divalent group is selected from the group consisting of: -O-, -CH(CH3)O-, and -CH(CH2OCH3)O-. 24. The oligonucleotide according to any of embodiments 18 to 23, wherein ZY is —CH2O—, preferably wherein Z is —CH2— and Y is —O—. 25. The oligonucleotide according to any of embodiments 18 to 24, comprising the sequence GGAAGAUGGCAU (SEQ ID NO: 6072). 26. The oligonucleotide according to any of embodiments 18 to 25, having a length of 16, 17, 18, 19, 20, 21 or 22 nucleotides. 27. The oligonucleotide according to any of embodiments 18 to 26, having a length of 19, 20 or 22 nucleotides. 28. The oligonucleotide according to any of embodiments 18 to 27, having a length of 20 or 22 nucleotides. 29. The oligonucleotide according to any of embodiments 18 to 28, having a length of 20 nucleotides. 30. The oligonucleotide according to any of embodiments 18 to 28, having a length of 22 nucleotides. 31. The oligonucleotide according to any of embodiments 18 to 27, having a length of 19 nucleotides. 30. The oligonucleotide according to any of embodiments 18 to 27, which is represented by a sequence comprising or consisting of a sequence selected from SEQ ID NOs: 453, 455, 459, 4528, 4531, 4532, 4533, 4535, 4542, 4548 and 4568. 31. The oligonucleotide according to any of embodiments 18 to 26, represented by a sequence consisting of a sequence selected from SEQ ID NOs: 453, 455, 459, 4528, 4531, 4532, 4533, 4535, 4542, 4548 and 4568. 32. The oligonucleotide according to any of embodiments 18 to 31, wherein said oligonucleotide induces pre-mRNA splicing modulation, wherein said pre-mRNA splicing modulation preferably alters protein production or composition, and preferably comprises exon skipping or exon inclusion, and most preferably wherein said RNA modulation comprises exon skipping. 33. The oligonucleotide according to any of embodiments 18 to 32, wherein said oligonucleotide induces pre-mRNA splicing modulation, and said pre-mRNA splicing modulation alters the production of a protein associated with a disease or condition, and wherein said disease or condition is Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD) or spinal muscular atrophy (SMA). 34. The oligonucleotide according to any of embodiments 18 to 33, wherein said oligonucleotide induces pre-mRNA splicing modulation, and said pre-mRNA splicing modulation alters the production of a protein associated with Duchenne muscular dystrophy (DMD). 35. The oligonucleotide according to any of embodiments 18 to 33, wherein said oligonucleotide induces pre-mRNA splicing modulation, and said pre-mRNA splicing modulation alters the production of a protein associated with Becker muscular dystrophy (BMD). 36. The oligonucleotide according to any of embodiments 18 to 33, wherein said oligonucleotide induces pre-mRNA splicing modulation, and said pre-mRNA splicing modulation alters the production of a protein associated with spinal muscular atrophy (SMA). 37. The oligonucleotide according to any of embodiments 18 to 36, having improved parameters compared to a corresponding oligonucleotide not comprising a bicyclic nucleic acid (BNA) scaffold modification.

[0267] definition In this document and in the claims, the verb "comprise" and its conjugations are used in their open-ended sense to mean that the items following the word are included, but items not specifically listed are not excluded. Furthermore, the verb "consisting of" can be replaced by "consisting essentially of," meaning that the oligonucleotide or composition as defined herein may contain additional components than those specifically identified, and that said additional component(s) do not alter the unique characteristics of the invention. Furthermore, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one element may be present, unless the context clearly requires that there is one and only one element. The indefinite article "a" or "an" therefore usually means "at least one."

[0268] Each embodiment as identified herein can be combined together unless otherwise specified. All patent and literature references cited herein are hereby incorporated by reference in their entirety.

[0269] Throughout this application, the words "bind," "target," and "hybridize" may be used interchangeably when used in connection with an antisense oligonucleotide that is complementary, preferably reverse-complementary, to a portion of a pre-mRNA as identified herein. In the context of the present invention, "hybridize" is used under physiological conditions in a cell, preferably a muscle cell, unless otherwise specified.

[0270] Where a structural formula or chemical name would be understood by one of ordinary skill in the art to have chiral centers, the chirality is not indicated, but individual reference is made to all three enantiomers, either the racemic mixture, the pure R enantiomer, and the pure S enantiomer, for each chiral center.

[0271] Whenever a parameter of a substance is discussed in connection with the present invention, it is assumed that the parameter is determined, measured, or indicated under physiological conditions unless otherwise specified. Physiological conditions are known to those of skill in the art and include aqueous solvent systems, atmospheric pressure, pH values ​​between 6 and 8, temperatures ranging from room temperature to about 37°C (about 20°C to about 40°C), and appropriate concentrations of buffer salts or other components. It is understood that charge is often associated with equilibrium. A moiety that is said to carry or possess a charge is one that is found in a state that carries or possesses such a charge more than one that does not carry or possess such a charge. As such, those of skill in the art will understand that atoms shown in this disclosure to have a charge may not carry a charge under certain conditions, and that a neutral moiety may carry a charge under certain conditions.

[0272] Generally, substitution replaces one moiety, which may be hydrogen, with another moiety. Considering the carbon backbone of an organic molecule, an RNA monomer is essentially 2'-substituted because it has a hydroxyl moiety at its 2' position. A DNA monomer would therefore not be 2'-substituted; an RNA monomer can be viewed as a 2'-substituted DNA monomer. Then, when an RNA monomer is 2'-substituted, the substitution can be either a replacement of 2'-OH or 2'-H. When an RNA monomer is 2'-O-substituted, the substitution replaces H in the 2'-OH moiety. As a non-limiting example, 2'-O-methyl RNA is a 2'-substituted monomer (-OMe replaces -H) and a 2'-substituted RNA monomer (-OMe replaces -OH) and a 2'-O-substituted RNA monomer (-Me replaces -H), while 2'-F RNA is a 2'-substituted RNA monomer (-F replaces -OH or H) but not a 2'-O-substituted RNA monomer (2'-O is either no longer present or unsubstituted). 2'-F RNA in which the F-substituted 2'-OH is 2'-F-2'-deoxy RNA, which is also 2'-F DNA.

[0273] "Alkenyl" refers to a straight or branched hydrocarbon group having 2 to 8 carbon atoms and at least one double bond. In certain embodiments, alkenyl includes ethenyl, propenyl, 1-but-3-enyl, 1-pent-3-enyl, and 1-hex-5-enyl.

[0274] "Alkoxy" means a group of the formula -OR, where R is alkyl. In certain embodiments, alkoxy includes methoxy, ethoxy, propoxy, 2-propoxy, butoxy, t-butoxy, pentyloxy, and hexyloxy.

[0275] "Alkyl" refers to a straight-chain or branched saturated hydrocarbon group containing 1 to 20 carbon atoms, and in certain embodiments, 1 to 6 carbon atoms. In certain embodiments, alkyl contains 1 to 4 carbon atoms, and in certain embodiments, 1 to 3 carbon atoms. In certain embodiments, alkyl includes methyl, ethyl, n-propyl, iso-propyl, n-butyl, s-butyl, t-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, 3-methylhexyl, 2,2-dimethylpentyl, 2,3-dimethylhexyl, n-heptyl, n-octyl, n-nonyl, and n-decyl.

[0276] "Aryl" means a monovalent 6- to 14-membered mono-, bi-, or tri-carbon ring, where a monocyclic ring is aromatic and at least one ring in a bicyclic or tricyclic ring is aromatic. In certain embodiments, aryl includes phenyl, naphthyl, indanyl, and anthracenyl.

[0277] "Cycloalkyl" means a monocyclic or bicyclic, saturated or partially unsaturated (not aromatic), hydrocarbon group of 3 to 10 carbon ring atoms. In certain embodiments, a cycloalkyl group contains 5 to 6 carbon atoms, and is defined herein as C 5~6It may also be referred to as cycloalkyl. Cycloalkyl groups include fused, bridged, and spirocycloalkyl bicyclic rings. For example, when fused, a cycloalkyl group can include two rings that share adjacent atoms (e.g., one covalent bond). When bridged, a cycloalkyl group can include two rings that share three or more atoms, with a bridge containing at least one atom separating the two bridgehead atoms. When spiro, a cycloalkyl group can include two rings that share only one single atom, a spiro atom, which may be a quaternary carbon. In certain embodiments, cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl. In certain embodiments, a cycloalkyl group can be: [ka] Includes.

[0278] "Halo" means a fluoro, chloro, bromo or iodo group. Preferably, "halo" means fluoro. "Halo" can be replaced by halogen. Preferred halogens are fluorine, chlorine, bromine or iodine. The most preferred halogen is fluorine.

[0279] "Heteroaryl" means one or more heteroaryls, such as -O-, -S(O) n "(n)" means a monocyclic, fused bicyclic, or fused tricyclic radical of 5 to 14 ring atoms containing one, two, three, or four ring heteroatoms independently selected from -(n is 0, 1, or 2), -N=(trivalent nitrogen), N(H)-, and >N-oxide, with the remaining ring atoms being carbon, where the ring containing the monocyclic radical is aromatic and at least one of the fused rings containing the bicyclic or tricyclic radical is aromatic (although the ring need not contain a heteroatom, e.g., 2,3-dihydrobenzo[b][1,4]dioxin-6-yl). Fused bicyclic radicals include bridged ring structures. Unless otherwise specified, valence may be at any atom of any ring of the heteroaryl group, valence rules permitting.

[0280] In certain embodiments, heteroaryl includes, but is not limited to, triazolyl, tetrazolyl, pyrrolyl, imidazolyl, thienyl, furanyl, pyrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiadiazolyl, indolyl, indazolyl, phthalimidyl, benzimidazolyl, benzoxazolyl, benzofuranyl, benzothienyl, benzopyranyl, benzothiazolyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, quinolinyl, isoquinolinyl, and tetrahydroisoquinolinyl.

[0281] "Heterocycloalkyl" means that one or more ring atoms are -O-, -S(O) n "Heterocycloalkyl" refers to a saturated or partially unsaturated (but not aromatic) monovalent monocyclic group of 3 to 9 ring atoms or a saturated or partially unsaturated (but not aromatic) monovalent bicyclic group of 5 to 12 ring atoms, where - (n is 0, 1, or 2), -N = a heteroatom independently selected from (trivalent nitrogen) or NH-, and the remaining ring atoms are carbon. Heterocycloalkyl groups include fused, bridged, and spiro heterocycloalkyl bicyclic rings. For example, when fused, a heterocycloalkyl group can contain two rings that share adjacent atoms (e.g., one covalent bond). When bridged, a heterocycloalkyl group can contain two rings that share three or more atoms, with a bridge containing at least one atom separating the two bridgehead atoms. When spiro, a heterocycloalkyl group can contain two rings that share only one single atom, a spiro atom, which can be a quaternary carbon. In certain embodiments, a heterocycloalkyl group can be -O-, -S(O) n - (n is 0, 1 or 2), -N = (trivalent nitrogen) or NH-; and

[0282] In certain embodiments, heterocycloalkyl groups contain 5 or 6 ring atoms. In certain embodiments, heterocycloalkyl groups include, but are not limited to, azetidinyl, pyrrolidinyl, piperidinyl, morpholinyl, piperazinyl, pyranyl, tetrahydropyranyl, tetrahydrothiopyranyl, dioxinyl, thiomorpholinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, oxazolinyl, oxazolidinyl, isoxazolidinyl, thiazolinyl, thiazolidinyl, and tetrahydrofuryl.

[0283] In the context of the present invention, a decrease or increase in the parameter to be evaluated means a change of at least 5% in the value corresponding to that parameter. More preferably, a decrease or increase in value means a change of at least 10%, and even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 90% or 100%. In this latter case, it may be the case that there is no longer a detectable value associated with the parameter.

[0284] The use of a substance as a medicament as described herein may also be interpreted as the use of said substance in the manufacture of a medicament. Similarly, whenever a substance is used for therapy or as a medicament, it may also be used for the manufacture of a medicament for therapy.

[0285] The word "about" or "approximately," when used in connection with a numerical value (e.g., about 10), preferably means that the value may be 0.1% more or less than the given value (of 10).

[0286] Preferably the compound or composition of the invention is for use in the method or use of the invention.

[0287] As will be understood by those of skill in the art, throughout this application the terms "BNA," "BNA scaffold," "BNA nucleotide," "BNA nucleoside," "BNA modification," or "BNA scaffold modification" may be interchanged with conformationally constrained scaffold modification, locked scaffold modification, locked nucleotide, locked nucleoside, locked monomer, or Tm-enhancing scaffold modification or high-affinity modification, etc., where appropriate.

[0288] The following examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention in any way. [Example]

[0289] Example 1 (In Vitro) Materials and Methods AON Antisense oligonucleotides (AONs) (Table 1, Figures 1-3) had phosphorothioate backbones with 2'-O-methyl monomers and either LNA (SEQ ID NOS: 452, 453, 455, and 456), 2'-amino-LNA (SEQ ID NOS: 456A), or CRN (SEQ ID NOS: 453C and 455C) scaffold modifications. AONs with SEQ ID NOS: 452 featured cytosine, while the other SEQ ID NOS: 453C and 455C featured 5-methylcytosine. 2'-amino-LNA refers to a scaffold modification sometimes designated 2'-amino-2'-deoxyLNA. AONs were synthesized on a 10 μmol scale using a OP-10 synthesizer (GE / AKTA Oligopilot) by standard phosphoramidite protocols. The AONs were cleaved and deprotected in a two-step sequence (diethylamine followed by concentrated NH4OH treatment), purified by HPLC, dissolved in water, and excess NaCl was added to exchange the ions. After evaporation, the AONs were redissolved in water, desalted by FPLC, and lyophilized. Mass spectrometry confirmed the identity of all AONs, and purity (determined by UPLC) was found to be acceptable (>80%) for all AONs. [Table 1]

[0290] Gymnotic uptake and cDNA synthesis Immortalized myoblasts derived from a DMD patient with a deletion of exons 48-50 (Δ48-50) were cultured to confluency in 6-well plates. To induce myotube formation, growth medium was replaced with low-serum differentiation medium supplemented with 800 nM or 4 μM AONs for 5 days (in triplicate) according to non-GLP standard operating procedures. Total RNA was then isolated, and 1000 ng of RNA was used as input for cDNA synthesis using random hexamer primers.

[0291] Digital droplet (dd) PCR analysis A specific Taqman minor groove binder (MGB) assay for detecting dystrophin transcripts with and without exon 51 was designed (Table 2) and purchased from Applied Biosystems. Digital droplet PCR analysis was performed with 1 μl (for non-skipped transcripts) or 4 μl (for skipped transcripts) of cDNA in a 20 μl reaction volume using an annealing / extension temperature of 60°C according to the manufacturer's instructions (BioRad). Data were presented as exon skipping percentage [N0 skipped / (N0 skipped + N0 non-skipped) * 100]. [Table 2]

[0292] Simple Western Capillary Immunoassay Total protein was extracted in protein loading buffer (6% 1.25 M Tris-HCl pH 6.8, 20% glycerol, 15% SDS, 0.0016% bromophenol blue, 5% β-mercaptoethanol (all Sigma) with protease inhibitors (Roche)). Protein concentrations were measured using a Compat-Able Protein Assay Preparation Reagent Set (Thermo Scientific) and a Pierce BCA Protein Assay Kit (Thermo Scientific). For healthy human control cell samples, 50, 5, or 0.5 μg / mL was applied, and for DMD patient cell samples, 100, 50, or 10 μg / mL was applied. Dystrophin protein levels were quantified using a Simple Western Capillary Immunoassay (Protein Simple) and a WES66-440 kDa Rabbit Master Kit (Protein Simple catalog number PSMK20) according to the manufacturer's protocol. A WES plate was loaded with biotinylated ladder, samples, primary rabbit polyclonal anti-dystrophin antibody (Abcam, catalog no. ab15277, diluted 1:50 in the provided antibody diluent), streptavidin-HRP for ladder detection, secondary anti-rabbit antibody, luminol-peroxide mix, and wash buffer (all provided in the WES Master Kit). The plate was centrifuged at 2500 rpm at room temperature for 5 minutes and loaded into the WES instrument along with the corresponding capillary cartridge. After the assay was run, data was analyzed using Compass software. result

[0293] The implementation of at least one 5' and / or 3' BNA scaffold-modified nucleotide in an AON improves exon 51 skipping levels when compared to an AON of the same sequence without the BNA scaffold-modified nucleotide (based on SEQ ID NO: 452). Figure 1A shows this effect of low (800 nM) and high (4 μM) concentrations of three AONs (SEQ ID NOs: 453, 455, and 456) in DMD patient muscle cells in vitro. The BNA scaffold modification in this case is LNA. Compared to AONs without the BNA scaffold modification based on SEQ ID NO: 452, AONs with LNA nucleotides induced 4- to 8-fold higher exon 51 skipping levels. This was associated with even greater improvements in dystrophin levels (up to 20-fold with SEQ ID NO: 456) (Figure 1B). Similar effects were obtained using 5' and / or 3' CRN scaffold modified (SEQ ID NOs: 453C and 455C) or 2'-amino-LNA scaffold modified (SEQ ID NO: 456A) nucleotides when compared to AONs without BNA scaffold modifications based on SEQ ID NO: 452 at 800 nM and / or 4 μM (Figure 2A, B).

[0294] Example 2 (In Vivo) Materials and Methods AON Antisense oligonucleotides (AONs) (Table 1, Figure 3) had BNA scaffold modifications resulting in an all-phosphorothioate backbone with 2'-O-methyl substitutions in all non-BNA monomers, 5-methylcytosine, and LNA monomers (SEQ ID NOs: 453, 455, and 456). A control AON with SEQ ID NO: 452 had a phosphorothioate backbone with 2'-O-methyl monomers, cytosine, and no BNA scaffold modifications. AONs were synthesized on a 1 mmol scale using an OP-10 synthesizer (GE / AKTA Oligopilot) by standard phosphoramidite protocols. AONs were cleaved and deprotected (diethylamine followed by concentrated NH4OH treatment) in a two-step sequence, purified by anion exchange chromatography, desalted by ultrafiltration / diafiltration, and lyophilized. The identity of all AONs was confirmed by mass spectrometry, and purity (determined by UPLC) was found to be acceptable for all AONs (>85%).

[0295] Mouse experiments This mouse experiment was conducted in accordance with the National Institutes of Health (NIH) guidelines for the care and use of laboratory animals. hDMD mice were bred and genotyped by JAX Labs (USA). Mice were randomized into groups (n=15) based on baseline body weight and gender distribution. Starting at 5-6 weeks of age, mice received weekly intravenous tail vein injections of 100 mg / kg of each AON bearing SEQ ID NO: 452, 453, 455, or 456 for a total of 12 weeks (SEQ ID NO: 452 did not contain any BNA scaffold modifications in this case). Four days after the final AON injection, animals were sacrificed, and tissue samples were collected (after transcardial perfusion with PBS to remove blood from the tissues). Muscle tissue samples were snap-frozen and stored at -80°C.

[0296] RNA isolation and cDNA synthesis Tissues were homogenized in 1 ml RNA-Bee (Bio-Connect) by grinding in a MagNA Lyser using MagNA Lyser Green Beads (Roche). Total RNA was extracted from the homogenate according to the manufacturer's instructions. 1000 ng of total RNA was used as input for cDNA synthesis. cDNA was generated in a 20 μl reaction using random hexamer primers and Transcriptor reverse transcriptase according to the manufacturer's instructions (Roche), except that incubation was at 50°C for 40 min instead of 55°C for 30 min.

[0297] Digital droplet PCR analysis A specific Taqman minor groove binder (MGB) assay for detecting dystrophin transcripts with and without exon 51 was designed (Primer Express 3.0.1 software; Applied Biosystems) (Table 2) and purchased from Applied Biosystems. Digital droplet PCR analysis was performed with 2 μl or 4 μl of cDNA in a 20 μl reaction volume using an annealing / extension temperature of 60°C according to the manufacturer's instructions (BioRad). Data are presented as exon skipping percentage [N0 skipped / (N0 skipped + N0 not skipped)]. * 100]. result

[0298] Transgenic hDMD mice expressing full-length human dystrophin enable in vivo screening of human-specific AONs in a mouse experimental background. Note that this model is not dystrophin-deficient and does not have muscle pathology. Therefore, AON uptake by muscle tissue is typically lower than that in the mdx mouse model. In this experiment, three AONs with 5' and / or 3' BNA-scaffold-modified nucleotides (SEQ ID NOs: 453, 455, and 456, using LNA scaffold modifications) were compared with the same AON without BNA scaffold-modified nucleotides (SEQ ID NO: 452) in a 12-week whole-body (IV) hDMD study. Figure 3 shows the improvement in in vivo exon 51 skipping levels for all LNA-containing AONs, up to 8-fold when using the AON with SEQ ID NO: 455 compared to the AON with SEQ ID NO: 452.

[0299] Example 3 (In Vitro) AON The antisense oligonucleotides (AONs) of the present invention (Table 3, Figure 4) contained at least one BNA scaffold modification resulting in an all-phosphorothioate backbone, 5-methylcytosine, and LNA monomers with 2'-O-methyl substitutions in all non-BNA monomers (SEQ ID NOs: 455, 459, 4528, 4531, 4532, 4533, 4535, 4542, 4548, and 4568). The control AON with SEQ ID NO: 452 contained a phosphorothioate backbone, cytosine, with 2'-O-methyl monomers and no BNA scaffold modifications. AONs were synthesized on a 5 μmol scale using an OP-10 synthesizer (GE / AKTA Oligopilot) by standard phosphoramidite protocols. The AONs were cleaved and deprotected in a two-step sequence (DEA followed by concentrated NH4OH treatment), purified by anion-exchange chromatography, desalted by size-exclusion chromatography, and lyophilized. Mass spectrometry confirmed the identity of all AONs, and purity (determined by UPLC) was found to be acceptable (>80%) for all AONs. [Table 3]

[0300] Gymnocystic uptake and cDNA synthesis Immortalized myoblasts derived from a DMD patient with a deletion of exons 48-50 (Δ48-50) were cultured to confluency in 6-well plates. To induce myotube formation, growth medium was replaced with low-serum differentiation medium supplemented with 800 nM AONs for 7 days (in triplicate) according to non-GLP standard operating procedures. Total RNA was then isolated, and 1000 ng of RNA was used as input for cDNA synthesis using random hexamer primers.

[0301] Digital droplet (dd) PCR analysis A specific Taqman minor groove binder (MGB) assay for detecting dystrophin transcripts with and without exon 51 was designed (Table 2) and purchased from Applied Biosystems. Digital droplet PCR analysis was performed with 1 μl (for transcripts without exon skipping) or 4 μl (for transcripts with exon skipping) of cDNA in a 20 μl reaction volume using an annealing / extension temperature of 60°C according to the manufacturer's instructions (BioRad). Data are presented as exon skipping percentage [N0 skipped / (N0 skipped + N0 not skipped)]. * 100].

[0302] result The implementation of at least one BNA scaffold-modified nucleotide (resulting in an LNA monomer) in an AON improves exon 51 skipping levels when compared to an AON of the same sequence without the BNA scaffold modification (based on SEQ ID NO: 452). Figure 4 shows this effect of 10 AONs (SEQ ID NOs: 455, 459, 4528, 4531, 4532, 4533, 4535, 4542, 4548, and 4568) at an 800 nM concentration in DMD patient muscle cells in vitro. Compared to the AON without the BNA scaffold modification (SEQ ID NO: 452), the AONs with the LNA nucleotide induced 10-40 fold higher exon 51 skipping levels.

[0303] Example 4 (In Vitro) Materials and Methods AON The antisense oligonucleotides (AONs) of the present invention (Table 4, Figure 5) contained an all-phosphorothioate backbone with 2'-O-methyl substitutions, 5-methylcytosines, and at least one BNA scaffold modification resulting in an LNA monomer (SEQ ID NOs: 29, 3185, and 863). Control AONs contained an all-phosphorothioate backbone with only 2'-O-methyl substituted monomers, 5-methylcytosines, but no BNA scaffold modification (SEQ ID NOs: 26, 6049, and 860; for SEQ ID NO: 6049, these modifications are identical to SEQ ID NO: 6071). AONs were synthesized on a 5 μmol scale using a standard phosphoramidite protocol on an OP-10 synthesizer (GE / AKTA Oligopilot). AONs were cleaved and deprotected in a two-step sequence (DEA followed by concentrated NH4OH treatment), purified by anion exchange chromatography, desalted by size exclusion chromatography, and lyophilized. The identity of all AONs was confirmed by mass spectrometry, and purity (determined by UPLC) was found to be acceptable for all AONs (>80%). [Table 4]

[0304] Gymnocystic uptake and cDNA synthesis Immortalized myoblasts from healthy donors were cultured to confluency in 12-well plates. To induce myotube formation, growth medium was replaced with low-serum differentiation medium supplemented with 800 nM or 4 μM AONs for 7 days (n=6) according to non-GLP standard operating procedures. Total RNA was then isolated, and 1000 ng of RNA was used as input for cDNA synthesis using random hexamer primers.

[0305] Digital droplet (dd) PCR analysis Specific Taqman minor groove binder (MGB) assays for detecting dystrophin transcripts with and without exons 44, 45, or 53 were designed (Table 5) and purchased from Applied Biosystems. Digital droplet PCR analysis was performed with 1 μl (for transcripts without exon skipping) or 4 μl (for transcripts with exon skipping) of cDNA in a 20 μl reaction volume using an annealing / extension temperature of 60°C according to the manufacturer's instructions (BioRad). Data were presented as exon skipping percentage [N0 skipped / (N0 skipped + N0 not skipped) * 100]. [Table 5]

[0306] result The implementation of BNA scaffold modifications resulting in LNA monomers at both the 5' and 3' ends of AONs targeting DMD exon 44, exon 45, or exon 53 improved exon skipping levels by 2-3 fold in healthy human control myotubes in vitro compared with AONs of the same sequence without BNA scaffold modifications. Figure 5 shows this effect for low (800 nM) and high (4 μM) concentrations of three AONs: SEQ ID NO:29 (targeting exon 44), SEQ ID NO:3185 (targeting exon 45), and SEQ ID NO:863 (targeting exon 53). Note that exon skipping levels in healthy human myotubes are usually lower than those obtained in DMD patient muscle cells (as used in Example 1). This is explained by nonsense-mediated decay of out-of-frame transcripts resulting from AON-induced exon skipping in healthy muscle cells.

[0307] [References] Dominski and Kole, PNAS 1993,90(18):8673-8677 Friedman et al., J Biol Chem 1999,274(51):36193-36199 Uchikawa et al., J Hum Genet 2007,52(11):891-897 Williams et al., Oligonucleotides 2006,16(2):186-95 Vickers et al., J Immunol 2006, 176(6):3652-61 Karras et al., Biochemistry 2001,40(26):7853-9 Vetrini et al., Hum Mutat 2006, 27(5):420-6 Du et al., PNAS 2007, 104(14):6007-12 Rincon et al., Am J Hum Genet 2007, 81(6):1262-1270 Tyson-Capper et al., Mol Pharmacol 2006,69(3):796-804 Khoo et al., BMC Mol Biol 2007, 8;3 Renshaw et al., Mol Cancer Ther 2004,3(11):1467-84 Giles et al., Antisense Nucleic Acid DrugDev 1999, 9(2):213-20 Goto et al., J Invest Dermatol 2006,126(12):2614-20 Disterer et al., Mol Ther 2013,21(3):602-609 Uehara et al., FASEB J 2013, 27(1):76-85 Gedicke-Hornung et al., EMBO Mol Med 2013,5(7):1060-77 Lentz et al., Nat Med 2013, 19(3):345-350 Taniguchi-Ikeda et al., Nature 2011,478(7367):127-31 Owen et al., PLoS One 2012, 7(3):e33576 Zammarchi et al., PNAS 2011, 108(43):17779-84 Mercatante et al., J Biol Chem 2002,277(51):49374-82 Osorio et al., Sci Transl Med 2011,3(106):106ra107 Wein et al., Hum Mut 2010, 31(2):136-42 Gao et al., Cell Transplant 2008, 17(7):723-34 Peacey et al., NAR 2012, 40(19):9836-49 Wheeler et al., J Clin Invest 2007,117(12):3952-7 Evers et al., Nucleic Acid Ther 2014,24(1):4-12 van Ommen, van Deutekom, Aartsma-Rus, CurrOpin Mol Ther. 2008; 10(2):140-9. Yokota, Duddy, Partidge, Acta Myol. 2007;26(3):179-84. van Deutekom et al., N Engl J Med. 2007;357(26):2677-86. Goemans et al., N Engl J Med. 2011;364(16):1513-22. Cirak et al., Lancet 2011; 378: 595-605. Voit et al., Lancet Neurol 2014, 13(10):987-96 Heemskerk et al., Mol Ther 2010; 18(6):1210-7 According to Evers et al. PLoS ONE 2011, 6(9) e24308 Gao et al., Mol Ther Nucleic Acids 2015.4:e255 Goyenvalle et al., Night Med 2015, 21(3):270-5 Curr Opin Mol Ther 2009,11(2):108-15 Singh et al., Mol Cell Biol 2006,26(4):1333–46 Hua et al., Am J Hum Genet 2008, 82(4): 834-48 Hua et al., Genes Dev 2010, 24(15):1634-44 Hua et al., Nature 2011, 478(7367):123-6 Passini et al., Sci Transl Med 2011,3(72):72ra18 J Clin Invest 2014, 124(2):487–90 Chiriboga et al., Neurology 2016, 86(10):890-7 Braida C., et al, Human Molecular Genetics,2010, vol 9: 1399-1412 Aartsma-Rus et al., Hum Mol Gen 2003;12(8):907-14. Yu RZ., Anal Biochem 2002; 304: 19-25. Dorn and Kippenberger, Curr Opin Mol Ther2008; 10(1): 10-2 Krieg AM. et al., Nature 1995; 374: 546–549. Krieg , AM , Curr . Open. Immunol. 2000; 12: 35-4 Han et al., Nature Communications, 2016,doi:10.1038 / ncomms10981 Wagner , H. , Adv. Immunol. 1999; 73: 329-368. Popovic PJ. et al. J of Immunol 2006; 177:8701–8 Diebold SS, et al., Eur J Immunol. 2006; Dec;36(12):3256-67. According to Peacock H et al. J. Am. Chem. Soc. Rev. 2011,133,9200 Arai K et al.Bioorg. Med. Chem. 2011 , 21.6285 Ehmsen J. et al, J. Cell Sci. 2002, 115(Pt14):2801–2 Monaco AP, et al. , Genomics 1988; 2: 90-9 Manzur AY et al., Wiley Publishers, 2008.The Cochrane Collaboration. Hodgetts S., et al, Neuromuscular Disorders2006; 16: 591-6 Zuker M., et al, NucleicAcids Res. 2003; 31(13):3406-15. Cartegni L, et al, NatRev Genet 2002;3(4):285-98. Cartegni L, et al, Nucleic Acids Res 2003;31(13):3568-71 Remington: The Science and Practice ofPharmacy, 20th Edition. Baltimore, MD: Lippincott Williams &Wilkins, 2000 Kumar L, Pharm. Technol. 2008, 3, 128 Bruno, K., Advanced Drug Delivery Reviews2011; 63: 1210. doi: 10.1021 / ja710342q Seth et al., J. Org. Chem.2010, 75, 1569-1581 doi: 10.1093 / nass / 1.1.241 doi: 10.1021 / jo100170g Osawa et al., J. Org. Chem.,2015, 80 (21), pp 10474-10481 WO 2014 / 145356 (MiRagen Therapeutics) WO 2014 / 126229 (Mitsuoka Y et al.) Yamamoto et al. Org. Biomol. Chem. 2015, 13, 3757 Nishida et al. Chem. Commun.2010, 46, 5283 WO 2014 / 112463 (Obika S et al.) WO 2015 / 142910 (Ionis Pharmaceuticals) Hanessian et al., J. Org. Chem., 2013, 78(18), pp 9064-9075 Bolli et al., Chem Biol. 1996 Mar;3(3):197-206 DOI: 10.1021 / jo402690j Murray et al., Nucl. AcidsRes., 2012, Vol. 40, No. 13 6135–6 doi: 10.1021 / acs.joc.5b00184 Nucleic Acids Res. Rev. 2004, 32, 5791–5799 WO 2011 / 097641 (ISIS / Ionis Pharmaceuticals) WO2016 / 017422 (Osaka University) Cao et al., Mol. Ther. Nucleic Acids, 2016, doi:10.1038 / mtna.2016.46 Spitali et al., FASEB J 2013, 27(12):4909-4916 Horiba et al., J. Org. Chem. 2016, doi:10.1021 / acs.joc.6b02036 Shrestha et al., Chem. Commun. 2014, doi:10.1039 / C3CC46017G WO2017 / 062862 (WaVe Life Sciences) WO2016 / 028187 (Noogen) Jirka et al., Nucl. Acid Ther. 2014 , 24 , WO2013 / 030569 US9,161,948 (Zarepta) WO2016 / 187425 (Zarepta) Gao et al., Mol. Ther.2014, 22, Shabanpoor et al., Nucl. Acids Ther. Rev. 2017,27, WO2017 / 062862 (Wave Life Sciences) According to Ferres-Coy et al. Mol. Psych. 2016 , 21 , US 6,656,730 (ISIS / Ionis Pharmaceuticals) Noir et al., J. Am. Chem Soc. 2008, 130, 13500 Nakagawa et al., J. Am. Chem. Soc. 2010, 132,8848 Dohmen et al., Mol. Ther. Nucl. Acids 2012, 1,e7 Zhao et al. Biomaterials 2015, 67, 42 WO2016 / 179257 (CytoMx) Sugo et al., J. Control. Rel. 2016, 237, 1 Weisbart et al., Mol. Cancer Ther. 2012, 11, 1 Winkler et al., Ther. Deliv. 2013, 4, 791 Manoharan, Antisense Nucl. Acid. Dev. 2004,12, 103 Ming et al., Adv. Drug Deliv. Freeze. 2015, 87, 81

Claims

1. An oligonucleotide consisting of the sequence represented by SEQ ID NO: 455, 459, 4528, 4531, 4532, 4533, 4535, 4542, 4548 or 4568, i) all monomers that do not contain a bicyclic nucleic acid (BNA) scaffold modification contain a 2'-substitution; ii) all monomers are linked by phosphorothioate backbone linkages; iii) at least one monomer comprising a BNA scaffold modification, wherein at least one BNA scaffold modification is comprised in a terminal monomer of the oligonucleotide; and iv) all cytosine bases are replaced by 5-methylcytosine bases; the oligonucleotide is complementary to, binds to, targets, or hybridizes to at least a portion of dystrophin pre-mRNA exon 51; An oligonucleotide comprising or consisting of a sequence that is complementary to, binds to, targets, or hybridizes to at least a portion of an exon recognition sequence (ERS), an exon splicing silencer (ESS), or an SR protein binding site.

2. An oligonucleotide described in claim 1, consisting of the sequence of sequence number 4568.

3. The oligonucleotide of claim 1 or 2, wherein the oligonucleotide induces pre-mRNA splicing regulation.

4. The oligonucleotide of claim 3 , wherein the pre-mRNA splicing modulation alters protein production or composition.

5. The oligonucleotide of claim 4 , wherein the pre-mRNA splicing modulation comprises exon skipping or exon inclusion.

6. The oligonucleotide of claim 5 , wherein the pre-mRNA splicing modulation comprises exon skipping.

7. 7. The oligonucleotide of any one of claims 1 to 6, having improved binding affinity and / or kinetics, exon skipping activity, biostability, (tissue) distribution, cellular uptake and / or transport, and / or immunogenicity compared to a corresponding oligonucleotide that does not comprise a bicyclic nucleic acid (BNA) scaffold modification.

8. A composition comprising the oligonucleotide of any one of claims 1 to 7.

9. 9. The composition of claim 8, comprising at least one excipient that may further aid in enhancing targeting and / or delivery of the composition and / or the oligonucleotide to and / or into tissues and / or cells.

10. Use of an oligonucleotide according to any one of claims 1 to 7 or a composition according to claim 8 or 9 for the manufacture of a medicament for treating, preventing and / or delaying Duchenne muscular dystrophy (DMD).

Images