A method for producing circular RNA using a dumbbell structure
A dumbbell-shaped circular RNA precursor structure allows efficient circularization by T4 RNA ligase 2 without a DNA splint, enhancing production efficiency and suitability for gene therapy applications.
Patent Information
- Application Number
- JP2024534515
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2022-12-28
- Filing Date
- 2023-11-24
- Publication Date
- 2026-02-24
- Estimated Expiration
- 2043-11-24
AI Technical Summary
Existing methods for producing circular RNA using T4 RNA ligase 2 require a DNA splint, which complicates the process and reduces production efficiency, especially for large circular RNAs intended for protein expression.
A dumbbell-shaped circular RNA precursor structure that self-hybridizes at its ends, allowing for efficient circularization by T4 RNA ligase 2 without the need for a DNA splint, and a method involving in vitro transcription, DNase I treatment, and specific ligation conditions to enhance production efficiency.
The method achieves higher circular RNA production efficiency and eliminates the need for additional RNA removal steps, enabling the use of circular RNAs as effective gene therapy agents for protein expression.
Smart Images

Figure 0007818859000004 
Figure 0007818859000005 
Figure 0007818859000006
Abstract
Description
[Technical Field]
[0001] The present invention relates to a dumbbell-shaped circular RNA precursor that can be used to produce circular RNA using T4 RNA ligase 2 without a DNA splint, and a method for producing circular RNA using the same. [Background technology]
[0002] Since the coronavirus disease-19 (COVID-19), an infectious disease caused by SARS-CoV-2 that was first identified in Wuhan, China in 2019, spread worldwide, the development of vaccine therapeutics using messenger RNA (mRNA) has become more active. mRNA has the limitation of being easily degraded in the body and having a relatively short half-life. To overcome this limitation, research has been conducted to improve safety by attaching a poly(A) tail to mRNA.
[0003] On the other hand, circular RNA (circRNA) is a covalently linked single-stranded transcript that exists very stably in vivo due to its structural characteristic of lacking 5' and 3' ends. Therefore, much research has been conducted to utilize circRNA to overcome the low safety margin of mRNA. In the same vein, US Pat. No. 10,953,033 discloses circRNA for the purpose of in vivo gene expression based on the structural characteristics of circRNA.
[0004] In eukaryotes, circRNAs are generated from mRNAs via back-splicing, and in vitro circRNA production is known to be achieved using T4 RNA ligase 1 (Rnl1), T4 RNA ligase 2 (Rnl2), or group 1 intron ribozymes. CircRNAs intended for protein expression are relatively large in size, leading to low production efficiency and difficulties in isolating and purifying them.
[0005] T4 RNA ligase 2 (Rnl2) is an enzyme that ligates the 3'- and 5'-ends of double-stranded RNA or double-stranded RNA / DNA hybrids. DNA splints that can complementarily bind to both ends of single-stranded RNA are commonly used to produce circRNA.
[0006] The present inventors have conducted extensive research into methods for improving the production efficiency of circRNA for protein expression and reducing separation and purification problems, and have completed the present invention. Summary of the Invention [Problem to be solved by the invention]
[0007] The technical problem to be achieved by the present invention is to provide a circRNA precursor that can be circularized without a DNA splint in circRNA production using T4 RNA ligase 2, and a method for efficiently producing circRNA using the same.
[0008] However, the technical problems that the present invention aims to achieve are not limited to those mentioned above, and other problems not mentioned will be clearly understood by those skilled in the art from the following description. [Means for solving the problem]
[0009] To solve the above problems, the present invention provides circular RNA precursors that are circularized by Rnl2 without a DNA splint.
[0010] The circular RNA precursor of the present invention has the following structure:
[0011] 5'-3'DumbBell Sense sequence(3'DB SS)-GOI(gene of interest)-3'DumbBell Antisense sequence(3'DB AS)-3'.
[0012] Furthermore, the circular RNA precursor of the present invention can have the following structure:
[0013] 5'-5'DumbBell Antisense sequence(5'DB AS)-5'DumbBell Sense sequence(5'DB SS)-3'DumbBell Sense sequence(3'DB SS)-GOI-3'DumbBell Antisense sequence(3'DB AS)-3'.
[0014] In one embodiment of the present invention, the 3' DB AS region has a sequence that is reverse complementary to the 3' DB SS region, and the 3' DB AS region and the 3' DB SS region form a base pair. The region in which the 3' DB AS region and the 3' DB SS region form a base pair is named 3' Dumbbell (3' DB).
[0015] In another embodiment of the present invention, the 3' DBSS region may have a length of 10 to 29 nt.
[0016] In another embodiment of the present invention, the 5' DB AS region has a reverse complementary sequence to the 5' DB SS region, and the 5' DB AS region and the 5' DB SS region form a base pair, and the region in which the 5' DB AS region and the 5' DB SS region form a base pair is named 5' Dumbbell (5' DB).
[0017] In another embodiment of the present invention, the 5' DBSS region may have a length of 3 to 15 nt.
[0018] In another embodiment of the present invention, the total length of the 3'DB and 5'DB may be 30 bp or less.
[0019] In another embodiment of the present invention, the length of the GOI region may be 500 to 5500 nt.
[0020] In another embodiment of the present invention, the GOI region may further comprise an IRES for protein expression.
[0021] The present invention also provides an expression vector capable of expressing the circular RNA precursor.
[0022] In one embodiment of the present invention, the expression vector may comprise a gene encoding the circular RNA precursor and a promoter linked to enable in vitro transcription (IVT), a process of synthesizing RNA in vitro using RNA polymerase, NTPs, and various cofactors, using DNA as a template.
[0023] The present invention also provides a method for efficiently producing circular RNA using the circular RNA precursor and Rnl2, which comprises the following steps:
[0024] (1) A step of inducing in vitro transcription of the expression vector of claim 6 under conditions of GTP:GMP=1:5-10.
[0025] (2) After the transcription induction step, a step of treating with DNase I in vitro.
[0026] (3) Adding Rnl2 in vitro to induce ligation.
[0027] As one embodiment of the present invention, the method may further comprise the step of treating RppH in vitro after carrying out step (2).
[0028] In another embodiment of the present invention, the method may further include a heating step just before step (3), in which the heating step includes heating the test tube to 80°C for 3 minutes and cooling it at 6°C per minute until it cools to 26°C.
[0029] In another embodiment of the present invention, the step (3) may be carried out at 25° C. for 1 hour or more.
[0030] In another embodiment of the present invention, the method may further comprise the step of (4) treating with RNase R in vitro after step (3).
[0031] In another embodiment of the present invention, the method may further comprise the step of treating in vitro with poly(A) polymerase immediately before step (4). [Effects of the Invention]
[0032] The circular RNA precursors of the present invention can be produced using T4 RNA ligase 2 (Rnl2) without the need for a DNA splint, and can produce circular RNA with greater efficiency than using a DNA splint. Furthermore, while circular RNA production using ribozymes requires the final removal of the ribozyme, the present invention does not require an additional RNA removal step. Furthermore, the circular RNA precursors of the present invention can be produced using circular RNAs containing a protein-encoding gene in the GOI, making them useful as gene therapy agents for protein expression. [Brief explanation of the drawings]
[0033] [Figure 1] FIG. 1 is a simplified schematic diagram of the expression of dumbbell-shaped circular RNA precursors of the present invention and the process of circular RNA production and purification by Rnl2. [Figure 2]DNA sequences and structures expressing various dumbbell-shaped circular RNA precursors are shown. Figure 2A shows the wild-type DB gene, Figure 2B shows the 3'DB gene, Figure 2C shows the 5'DB gene, Figure 2D shows the 5'3'DB deletion gene, Figure 2E shows the 3'DB-M1 gene, Figure 2F shows the 3'DB-M2 gene, Figure 2G shows the 3'DB-M3 gene, Figure 2H shows the DB-M1 gene, Figure 2I shows the DB-M2 gene, and Figure 2J shows the DB-M3 gene. Figure 2K shows the 271-nt DB-M3 gene, Figure 2L shows the 997-nt DB-M3 gene, Figure 2M shows the 2300-nt DB-M3 gene, Figure 2N shows the 3004-nt DB-M3 gene, Figure 2O shows the 4000-nt DB-M3 gene, and Figure 2P shows the 5002-nt DB-M3 gene. [Figure 3] This result confirmed that the 3' dumbbell region in the dumbbell-structured circular RNA precursor is essential for ligation by Rnl2. [Figure 4] To determine the effect of 3' DB region length on the efficiency of circular RNA production, we examined the circularization efficiency of mutant circular RNA precursors (3'DB-M) designed with different lengths and GC ratios in the 3' DB region. Figure 4A shows the design of the 3'DB and mutant 3'DB precursors (3'DB-M), and Figure 4B shows the circularization efficiency of each circular RNA precursor after ligation with Rnl2. [Figure 5] Figure 5A shows the design of circular RNA mutant precursors (DB-M) with different lengths of 5' DB region to confirm the effect of 5' DB region length on circular RNA production efficiency. Figure 5B shows the results of confirming the circularization efficiency of each mutant precursor by Rnl2. [Figure 6] The results of confirming the length of the gene that can be inserted into the circular RNA are shown in Figure 6A, which shows the results of electrophoresis on a formaldehyde agarose gel, and Figure 6B, which shows the results of electrophoresis on an EX 2% agarose gel. [Figure 7] This shows the results of confirming the circularization efficiency of circular RNA precursors depending on the ratio of GTP to GMP during IVT. [Figure 8]The results show the efficiency of circularization of circular RNA precursors as a function of the heat treatment temperature, time, and cooling conditions of the heating step before Rnl2 treatment. [Figure 9] This shows the results of confirming the circularization efficiency of circular RNA precursors depending on the ligation temperature and time conditions. [Figure 10] This shows the results of confirming the circularization efficiency of circular RNA precursors with or without an RppH treatment step before ligation induction. [Figure 11] The results of IVT and circularization induction of DB-WT under various conditions were confirmed. [Figure 12] The results of IVT and circularization induction of 3'DB under various conditions were confirmed. [Figure 13] FIG. 10 is a diagram comparing the circularization efficiency of circular RNA production using a dumbbell-structured circular RNA precursor and circular RNA production using a DNA splint.
[0034] [Best Mode for Carrying Out the Invention] The present inventors have developed a dumbbell-shaped circular RNA precursor that can be circularized by T4 RNA ligase 2 without a DNA splint in order to produce circular RNA for intracellular protein expression as a gene therapy agent, and have developed and completed various mutant precursors to improve the circularization efficiency of the circular RNA precursor.
[0035] T4 RNA ligase 2 (Rnl2) can ligate the 3' and 5' ends of double-stranded RNA. We designed and constructed a self-hybridizing circular RNA precursor that can form a dumbbell structure by complementary binding to the 5' and 3' ends of the RNA. We confirmed that this RNA precursor can be circularized by Rnl2 even without a DNA splint.
[0036] The "circular RNA precursor" provided by the present invention is a RNA precursor in which both ends self-hybridize with the interior to form a secondary structure resembling a dumbbell, and is therefore referred to interchangeably as "dumbbell-structured circular RNA precursor," "self-hybridizing circular RNA precursor," and "dumbbell-shaped circular RNA precursor."
[0037] In this specification, the dsRNA (double strand RNA) region formed by complementary binding of the 5' end of the circular RNA precursor to the interior of the RNA is named the "5' DB region," and the dsRNA region formed by complementary binding of the 3' end to the interior of the RNA is named the "3' DB region."
[0038] In the present specification, when referring to the region that forms dsRNA without distinguishing between the 5' DB region and the 3' DB region, it is referred to as "DB region."
[0039] The secondary structure of RNA is variable depending on the binding strength between bases and environmental conditions. In this specification, the DB region refers to a region where three or more nucleotides bind complementary to each other, i.e., a dsRNA region of 3 bp or more.
[0040] In the present invention, the DB region preferably comprises three or more nucleotides that are continuously complementary to each other to form base pairs; however, this does not exclude the case where the DB region contains one or two nucleotides that do not form base pairs, as long as the binding strength is maintained by increasing the length of the DB region.
[0041] In this specification, the RNA sequences constituting the 5' DB region are respectively designated as "5' DB sense sequence (5' DB SS)" and "5' DB antisense sequence (5' DB AS)," and the RNA sequences constituting the 3' DB region are respectively designated as "3' DB sense sequence (3' DB SS)" and "3' DB antisense sequence (3' DB AS)."
[0042] The circular RNA precursor of the present invention may further contain random nucleotides of 1 to 19 nt in length so that a loop is formed between the 5' DB SS and the 5' DB AS.
[0043] The circular RNA precursor of the present invention contains a gene of interest (GOI) between the 3'DB SS and 3'DB AS, and the GOI may further contain an IRES for protein expression and may further contain a UTR region for improved translation efficiency.
[0044] In the present study, we investigated the effects of the 5' DB region and 3' DB region on the circularization efficiency of dumbbell-structured circular RNA precursors formed by self-hybridization. Specifically, the previously designed dumbbell-structured circular RNA precursor had a 13-bp 5' DB region and a 19-bp 3' DB region, and this circular RNA precursor is herein designated "DB-WT." Based on DB-WT, we designed a 3' dumbbell circular RNA precursor lacking the 5' DB region (hereinafter designated "3' DB"), a 5' dumbbell circular RNA precursor lacking the 3' DB region (hereinafter designated "5' DB"), and a 5' and 3' dumbbell deletion precursor that does not form a dumbbell structure (hereinafter designated "5'3' DB deletion"), and induced ligation by Rnl2. The results confirmed that the 3' DB region, but not the 5' DB region, is essential for ligation by Rnl2.
[0045] In response to this, the present inventors provide a circular RNA precursor lacking a 5' DB region and containing only a 3' DB region. In this case, the 3' end of the circular RNA precursor of the present invention also self-hybridizes with its internal region. Therefore, the terms "dumbbell-shaped circular RNA precursor" and "self-hybridizing circular RNA precursor" are used herein to include circular RNA precursors containing only a 3' DB region.
[0046] Long dsRNA is recognized intracellularly as a foreign substance, activating the STING pathway and inducing a cellular immune response. Therefore, circular RNAs that induce cellular immune responses are not suitable for use as gene therapy agents. Previous studies have shown that dsRNAs longer than 40 bp are recognized by TLR3 and induce an immune response (Schlee et al., Nature Review, https: / / www.nature.com / articles / nri.2016.78). Furthermore, dsRNAs longer than 30 bp activate the kinase PKR, inducing an immune response, whereas dsRNAs shorter than 25 bp do not activate PKR (Lemaire et al., 2009, JMB, https: / / www.ncbi.nlm.nih.gov / pmc / articles / PMC2570377 / , Manche et al., 1992, MCB, https: / / pubmed.ncbi.nlm.nih.gov / 1357546 / ). DB-WT contains a DB region of 32 bp in total, including a 13-bp 5' DB region and a 19-bp 3' DB region. Therefore, we sought to find a circular RNA precursor structure that exhibits optimal circularization efficiency while reducing the length of the DB region so as not to induce an immune response in cells.
[0047] As a specific experimental example, three types of circular RNA mutant precursors (hereafter referred to as "3'DB-M") were prepared based on the 3'DB, differing in the length and GC content of the 3'DB region. The three types of 3'DB-M were designed as shown in Table 3, and the circularization efficiency of these three types of 3'DB-M was compared with the 3'DB to confirm the circularization efficiency by Rnl2. The results showed that the shorter the 3'DB region, the lower the circularization efficiency, and that the GC content of the 3'DB region had little effect on the circularization efficiency. Therefore, the longer the 3'DB region, as long as it does not induce a cellular immune response, the higher the circularization efficiency.
[0048] Next, we created three types of circular RNA mutant precursors (hereafter referred to as "DB-M") by setting the 3' DB region length to 19 bp and decreasing the 5' DB region length in DB-WT. As a result, we confirmed that there was no significant difference in circularization efficiency when the 5' DB region length was 5 bp compared to when it was 13 bp. Therefore, we provide circular RNA precursors with a 5' DB region length of 5 bp and a 3' DB region length of 19 bp, which enable highly efficient circular RNA generation while minimizing the possibility of inducing a cellular immune response.
[0049] The dumbbell-shaped circular RNA structure of the present invention can produce circular RNA containing genes up to approximately 6000 nt in length, but from the perspective of production efficiency, the length of the gene contained in the circular RNA structure is preferably 200 to 5500 nt, and more preferably 500 to 3500 nt.
[0050] The present inventors have developed a method for increasing the efficiency of circular RNA production when producing circular RNA using the dumbbell-structured circular RNA precursor of the present invention.
[0051] In a specific experiment, IVT was performed with the addition of GMP to induce ligation with T4 RNA ligase 2 without the RppH treatment step, and excellent circular RNA production yields were confirmed at a GTP:GMP ratio of 1:1 to 10. Therefore, the present inventors have provided a method for producing circular RNA without the RppH treatment step by performing IVT at this GTP:GMP ratio.
[0052] Furthermore, the present invention induces ligation to Rnl2 through secondary structure formation of circular RNA precursors. To induce the intended ligation, a heating step was added before Rnl2 treatment. In this case, the heating step was performed at 80°C for 3 minutes, followed by cooling at a rate of 6°C per minute to 26°C. This confirmed that the efficiency of circular RNA production could be improved.
[0053] Furthermore, we confirmed that a ligation temperature of 25°C is suitable, a ligation reaction time of 1 hour is sufficient, and that the circular RNA yield can be further increased by adding an RppH treatment step. However, the increase in circular RNA production yield by RppH treatment was more effective with 3'DB than with DB-WT, confirming that when the stability of the 5'DB region is increased, the secondary structure of the circular RNA precursor makes it difficult for RppH to access the 5' end. Even after circular RNA purification, the band was observed to be darker with DB-WT than with 3'DB, which is likely due to the secondary structure of the precursor that does not circularize when the stability of the 5'DB region is high, making it difficult for the enzyme to access the end.
[0054] On the other hand, the inventors have found that when the dumbbell-structured circular RNA precursor of the present invention is used, a higher circular RNA production efficiency can be achieved than with splint ligation, and it is expected that the circular RNA precursor of the present invention will be useful in producing circular RNA using Rnl2.
[0055] In the present invention, circular RNA precursors include natural ribonucleotides adenosine, guanosine, cytosine, and uracil, and may also include non-natural ribonucleotides.
[0056] The present invention provides a cassette, gene delivery system, and vector for expressing the above-mentioned dumbbell-structured circular RNA precursor. In describing the circular RNA precursor and the gene encoding it in this specification, it is obvious to those skilled in the art that thymine in the gene corresponds to uracil in the circular RNA precursor. DETAILED DESCRIPTION OF THE INVENTION
[0057] Hereinafter, the embodiments will be described in detail with reference to the accompanying drawings. However, since various modifications can be made to the implemented examples, the scope of the patent application is not limited or restricted by these examples. It should be understood that all modifications, equivalents, or alternatives to the embodiments are included in the scope of the patent.
[0058] The terms used in the examples are used merely for the purpose of explanation and should not be construed as limiting. The singular term includes the plural term unless the context clearly dictates otherwise. In this specification, the terms "comprise" or "have" and the like are intended to specify the presence of the features, numbers, steps, operations, components, parts, or combinations thereof described in the specification, and should not be understood to preclude the presence or possibility of addition of one or more other features, numbers, steps, operations, components, parts, or combinations thereof.
[0059] Unless otherwise defined, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by a person of ordinary skill in the art to which the embodiments belong. Terms defined in commonly used dictionaries, etc., should be interpreted to be consistent with the meaning they have in the context of the relevant art, and should not be interpreted as having an ideal or overly formal meaning unless expressly defined in this application.
[0060] In addition, in the description with reference to the accompanying drawings, the same components are denoted by the same reference numerals regardless of the drawing numerals, and redundant description thereof will be omitted. In describing the embodiments, if it is determined that a detailed description of related publicly known technology may unnecessarily obscure the gist of the embodiments, the detailed description thereof will be omitted. [Example]
[0061] [Experimental Method] 1. Preparation of DNA template for expression of dumbbell-shaped circular RNA precursor 1-1. Wild-type dumbbell circular RNA precursor (DB-WT) To generate pUC-Dumbbell (DB), we synthesized a T7 RNA polymerase promoter, dumbbell, IRES, and Rluc poly(A) sequence (Integrated DNA Technologies) and cloned it into the pUCIDT vector. pUC-DB was then linearized with SpeI restriction enzyme. The DB gene contains a 13-nt 5' DumbBell antisense sequence (5' DB AS) and a 5' DumbBell sense sequence (5' DB SS) at the 5' end, a 19-nt 3' DumbBell sense sequence (3' DB SS), and a 19-nt 3' DumbBell antisense sequence (3' DB AS) at the 3' end (Figure 2A).
[0062] 1-2.3' dumbbell circular RNA precursor (3'DB) pUC-DB was used as a template, and 5'-GCGCT GTTTAAAC TAATACGACTCACTATAGGAAAAAATCGAGGGTCTCCCCTAGTTG-3' (sense: SEQ ID NO: 1) and 5'- GCGCTGCGATCGC PCR was performed using the primer CCATTTTGCTGTATTCAA-3' (antisense: SEQ ID NO: 2), and the amplified product was ligated to the PmeI / AsisI fragment of pUC-DB. The underlined sequences in each of the sense and antisense primers represent the PmeI and AsiSI recognition sites, respectively. PCR was performed using the Advantage-HF2 PCR kit (Clonetech) to create pUC-3'DB.
[0063] pUC-3'DB was linearized by digestion with SpeI. The 3'DB gene contains a 19-nt long 3'DB SS and a 2-nt long 5'DB SS and a 5'DB AS at the 5' end, as well as a 19-nt long 3'DB SS and a 19-nt long 3'DB AS at the 3' end (Figure 2B).
[0064] 1-3.5' dumbbell circular RNA precursor (5'DB) pUC-DB was digested with SalI to obtain a 5' dumbbell DNA fragment. The 5' DB gene contains only the 13-nt long 5' DB SS and 5' DB AS at the 5' end (Fig. 2C).
[0065] 1-4.5' and 3' dumbbell deletion precursor (5'3'DB deletion) The 5'- and 3'-dumbbell-deleted DNA fragments were obtained by cleaving pUC-3'DB with SalI. The 5'- and 3'-DB-deleted genes do not contain the dumbbell-forming sequences at either end (Fig. 2D).
[0066] 1-5. 3' dumbbell circular RNA mutant precursor (3'DB-M) To generate 3'DB mutants, the lengths of the 5' loop and 3'DB region were shortened, and the GC ratio in the 3'DB region was changed to 47%, 50%, and 70%. The 5' loop refers to the region where no base pairing occurs between the 5'DB SS and 5'DB AS.
[0067] 3'DB mutant 1 (3'DB-M1) was constructed by cloning 5-CTTTGTT TAAACTAATACGACTCACTATAGGAAAAATCCCTAGTTGTTGTGTGGACAAAACACAGCGGCCGCTTAAAACAGC-3' (sense: SEQ ID NO: 3) and 5'-TGG ACTAGT This was obtained as a PCR amplification product using the primer TGTTGTGTGG GTCGACTTTTGTTTTTTGTTTTTTTTTTGTTT-3' (antisense: SEQ ID NO: 4) (Figure 2E). The underlined sequence in the primer is the site recognized by SpeI.
[0068] 3'DB mutant 2 (3'DB-M2) was constructed by cloning 5'-CTTTGTTTAAACTAATACGACTCACTA TAGGAAAAATCCCTAGTTGTGGACAAAACACAGCGGCCGCTTAAAACAGC-3' (sense: SEQ ID NO: 5) and 5'-TGG ACTAGTThe PCR product was obtained using the primer TGTGGGTCGACTTTTGTTTTTTGTTTTTTTTTTGTT-3' (antisense: SEQ ID NO: 6) (Figure 2F). The underlined sequence in the primer is the site recognized by SpeI.
[0069] 3'DB mutant 3 (3'DB-M3) was constructed by cloning 5'-CTTTGTTTAAACTAATACGACTCAC TATAGGAAAAATCCCTAGTCGCGGACAAAACACAGCGGCCGCTTAAAACAGC-3' (sense: SEQ ID NO: 7) and 5'-TGG ACTAGT This was obtained as a PCR amplification product using the primer CGCGGGTCGACTTTTGTTTTTTGTTTTTTTTTTGTTT-3' (antisense: SEQ ID NO: 8) (Figure 2G). The underlined sequence in the primer is the site recognized by SpeI.
[0070] 1-6. Dumbbell circular RNA mutant precursor (DB-M) The DB mutant was generated by reducing the 13-bp-long 5' DB region in the DB gene from 11 bp to 2 bp.
[0071] DB variant 1 (DB-M1) was obtained from PCR amplification products using pUC-3'DB as a template and the primers 5'-TAATACGACTCACTATAGGGAGACCCTC AAAAATCGAGGGTCTCCCCTAGTTGTTG-3' (sense: SEQ ID NO: 9) and 5'-CTAGTTGTTGTGTGG AATTGTCGACTTTTGT-3' (antisense: SEQ ID NO: 10) (Figure 2H). DB variant 1 has an 11-bp 5' DB region.
[0072] DB variant 2 (DB-M2) was obtained from PCR amplification products using pUC-3'DB as a template and the primers 5'-TAATACGACTCACTATAGGGAGACCAA AAATCGAGGGTCTCCCCTAGTTGTTG-3' (sense: SEQ ID NO: 11) and 5'-CTAGTTGTTGTGTGG AATTGTCGACTTTTGT-3' (antisense: SEQ ID NO: 12) (Figure 2I). DB variant 2 has an 8-bp 5' DB region.
[0073] DB variant 3 (DB-M3) was obtained from PCR amplification products using pUC-3'DB as a template and the following primers: 5'-TAATACGACTCACTATAGGGAGAAAAA TCGAGGGCCTCCCCTAGTTGTTG-3' (sense: SEQ ID NO: 13) and 5'-CTAGTTGTTGTGTGG AATTGTCGACTTTTGT-3' (antisense: SEQ ID NO: 14) (Figure 2J). DB variant 3 has a 5-bp 5' DB region.
[0074] 1-7. Circular RNA precursors with different GOI lengths Circular RNA precursors were prepared by inserting different genes into the GOI. The DNA fragments encoding each circular RNA precursor were amplified by PCR using the primers listed in Table 1 below, and the amplified DNA products are shown in Figures 2K–P. The total length of the 5' and 3' DB regions in each circular RNA precursor was adjusted to 24 bp.
[0075] [Table 1]
[0076] 2. In vitro transcription (IVT) and purification Circular RNA precursors were synthesized from linearized DNA plasmids or PCR-amplified products by in vitro transcription using T7 RNA polymerase (200 U, Roche) in the presence of rATP, rCTP, rUTP, and rGTP (5 mM each, Roche), rGMP (25 mM, Sigma), RNase inhibitor (0.2 U, Thermo Scientific), MgCl2 (25 mM, Sigma), and DTT (10 mM, Thermo Scientific) at 37°C for 3 hours. After transcription, the DNA template was removed by treatment with DNase I (4.5 U, Thermo Scientific) at 37°C for 20 minutes. After DNase I treatment, RNA was purified using a Monarch RNA cleanup kit (New England Biolabs).
[0077] In some experiments, RNA purification was followed by treatment with RppH (0.5 U, New England Biolabs) for 30 min at 37°C.
[0078] 3. RNA ligation by T4 RNA ligase 2 treatment The RNA was heat-treated at 80°C for 3 minutes, cooled to 26°C by 6°C per minute, treated with T4 RNA ligase 2, and reacted at 25°C for 1 hour. The RNA was then column-purified.
[0079] 4. Splint Ligation A linear RNA with the same sequence as the 3'DB circular RNA precursor, except for a 19-nt sequence at the 3' end, was designed and ligated using a DNA splint to create a linear circular RNA precursor. Prior to ligation, 2 μM of RNA and 2 μM of DNA splint were heated at 80°C for 3 minutes and then cooled to 26°C in 6°C increments over 1 minute.
[0080] Three types of DNA splints were used, 30 nt, 60 nt, and 90 nt in length, and the specific information is shown in Table 2 below.
[0081] [Table 2]
[0082] After ligation, the DNA splint was removed by treatment with DNase I (2.4 U, Thermo Scientific) at 37°C for 20 minutes, followed by column purification of the RNA.
[0083] 5.Poly A tailing E. coli Poly(a) polymerase (0.5 U, New England Biolabs) and ATP (1 mM, New England Biolabs) were treated at 37°C for 1 h after the ligation step, and the remaining RNA was column purified.
[0084] 6.RNase R Treatment The RNA was heat-treated at 65°C for 5 min, chilled on ice for 3 min, and then treated with RNase R at 37°C for 15 min. Circular RNA was isolated via column purification and quantified using a Nanodrop 2000c (Thermo Scientific) spectrophotometer.
[0085] 7. Electrophoresis The RNA samples were mixed with formamide loading buffer (Biosesang), denatured at 65°C for 10 min, chilled on ice for 3 min, and then transferred to a 1% agarose gel and separated at 100 V for 120 min in MOPS buffer.
[0086] In some experiments, RNA was separated on 2% E-gel EX agarose gels (Invitrogen) prepared using the E-gel EX 1-2% program in an E-gel Power Snap device. A 1 kb (+) RNA ladder (Thermo Scientific) was used as a standard. Bands were visualized using an Azure 600 gel doc system (Azure Biosystems).
[0087] [Experimental Results] 1. Confirmation of circularization of various dumbbell-shaped circular RNA precursors using T4 RNA ligase 2 T4 RNA ligase 2 (Rnl2) is an enzyme that ligates the 3'- and 5'-ends of double-stranded RNA or double-stranded RNA / DNA hybrids. To produce circular RNA using Rnl2, a DNA fragment (DNA splint) that can complementarily bind to both ends of a single-stranded RNA is used.
[0088] As shown in Figure 1, the inventors designed and constructed circular RNA structures that could be circularized by Rnl2 without a DNA splint by positioning complementary binding regions at the ends of single-stranded RNA.
[0089] The first circular RNA precursor was designed to have a 13-bp 5' DB region and a 19-bp 3' DB region, and was designated wild-type circular RNA precursor and abbreviated as "DB-WT."
[0090] To confirm the influence of the presence and length of the 5'DB and 3'DB regions on circularization efficiency, we designed and constructed a 3' dumbbell circular RNA precursor lacking the 5'DB region, a 5' dumbbell circular RNA precursor lacking the 3'DB region, and a 5' and 3' dumbbell deletion precursor that does not form a dumbbell structure. These precursors are referred to as "3'DB," "5'DB," and "5'3'DB deletion."
[0091] The four RNA precursors were expressed in vitro, treated with RppH to convert the 5'-terminus to monophosphate, and then treated with T4 RNA ligase 2 (Rnl2) to induce ligation. Subsequently, poly(A) tailing and RNase R treatment were performed to remove unligated by-products. The samples were then loaded onto an agarose gel and electrophoresed to confirm the generation of circular RNAs. The results are shown in Figure 3.
[0092] As can be seen in lane 9 of the 5'3'DB deletion and 5'DB, despite the 1-hour Rnl2 treatment, all RNA was removed by RNase R treatment. In other words, the 5'3'DB deletion and 5'DB confirmed that circular RNA was not formed by Rnl2.
[0093] In the case of 3'DB, no band was observed in lane 9 0 h after Rnl2 treatment, but after 1 h of ligation induction, a clear circular RNA band was observed in lane 9, and two bands were observed in lane 7 due to circular RNA formation.
[0094] In the case of DB-WT, a band was observed in lane 9 both before (0 h) and after (1 h) ligation induction. The band observed in lane 9 before ligation induction is thought to be the result of incomplete linear RNA degradation by RNase R due to the dumbbell structure of the RNA. Furthermore, structural characteristics of DB-WT prevented RppH from acting effectively, resulting in low circularization efficiency, and no clear circular RNA band was observed in lane 7 after ligation induction.
[0095] 2.3' Confirmation of circularization efficiency by shortening the DB region length To improve the efficiency of Rnl2-mediated circularization, we designed and constructed mutant 3'DB circular RNA precursors with different lengths of the 3'DB region, 5' loop length, and GC content of the 3'DB region. The lengths of the 3'DB region, 5' loop length, and GC content of the 3'DB region of the 3'DB and its mutants are shown in Table 3 below. A simplified schematic diagram of the four circular RNA precursors is shown in Figure 4A.
[0096] [Table 3]
[0097] The three 3'DB circular RNA mutant precursors were expressed in vitro and then treated with T4 RNA ligase 2 (Rnl2) to induce ligation. Subsequently, poly(A) tailing and RNase R treatment were performed to remove unligated by-products. The samples were then loaded onto an agarose gel and electrophoresed to confirm circular RNA generation (Figure 4B). A 5'3'DB deletion was used as a negative control, and a 3'DB deletion was used as a positive control.
[0098] As shown in Figure 4B, when the circularization efficiency of each circular RNA precursor was determined based on the lane 6 band density, the circularization efficiency was found to be highest in the following order: 3'DB, 3'DB-M1, 3'DB-M3, and 3'DB-M2. Although 3'DB-M3 produced more circular RNA than 3'DB-M2, this was not significant. These results suggest that the length of the 3'DB region is more important than the GC content of the 3'DB region for circularization efficiency.
[0099] Confirmation of circularization efficiency by shortening the length of the 3.5' DB region On the other hand, intracellular dsRNAs longer than 30 nt are at high risk of inducing cellular immune responses through PKR activation. Therefore, for use of circular RNAs as gene therapy agents, it is preferable that the double-stranded region is less than 30 nt, and the shorter the better. Therefore, we shortened the 5'DB region of DB-WT to design a DB circular RNA mutant precursor (DB-M) (Figure 5A).
[0100] DNA encoding the precursor was expressed in vitro and then treated with Rnl2 to induce ligation. Subsequently, poly(A) tailing and RNase R treatment were performed to remove unconjugated by-products. The sample was then loaded onto an agarose gel and electrophoresed to confirm circular RNA generation (Figure 5B). While the 3'DB circularization efficiency was only 50% compared to DB-WT, the three DB-Ms showed no significant difference in circularization efficiency compared to DB-WT. These results suggest that DB-M3 is the most suitable circular RNA precursor, exhibiting the highest circularization efficiency without inducing an immune response when introduced into cells.
[0101] 4. Confirmation of the maximum circular RNA length To confirm whether circular RNA precursors can be used for protein expression in cells, we designed circular RNA precursors based on DB-M3 with different gene insert sizes. These were expressed in vitro, then treated with Rnl2, poly(A) tailing, and RNase R. The formation and efficiency of circular RNAs were confirmed by electrophoresis on formaldehyde agarose gels and EX 2% gels.
[0102] The results of electrophoresis on a formaldehyde agarose gel are shown in Figure 6A, and the results of electrophoresis on an EX 2% agarose gel are shown in Figure 6B.
[0103] In the case of the 271-nt-long RNA precursor, no double band was observed in the formaldehyde agarose gel, but a clear band was confirmed even after RNase R treatment. Furthermore, an upwardly shifting band was confirmed in the EX agarose 2% agarose gel. These results indicate that the 271-nt-long circular RNA precursor forms circular RNA.
[0104] For the RNA precursors of lengths 997 nt, 2308 nt, and 3004 nt, a clear doublet band was observed in the formaldehyde agarose gel and an upwardly shifting band was observed in the EX 2% agarose gel, confirming that the circular RNA precursors were well spliced to the circular RNA.
[0105] In the case of the 4000-nt and 5002-nt long RNA precursors, no clear double band was observed on the formaldehyde agarose gel, but a band migrating above the RNA size was clearly observed on the EX 2% agarose gel.
[0106] To confirm the circularization efficiency of circular RNA precursors of each length, the circular RNA bands observed on an EX 2% agarose gel were quantified and the circularization efficiency (ligation efficiency) was calculated according to the following formula 1.
[0107] [Formula 1] Ligation efficiency (%) = Circular band quantitative value / (Circular band quantitative value + Linear band quantitative value) * 100
[0108] As a result, circular RNA precursors ranging from 271 nt to 5002 nt were circularized by Rnl2 to generate circular RNAs. The circularization efficiency was higher for smaller RNA sizes, but the circular RNA precursor of the present invention could be inserted into genes up to approximately 5000 nt in length. Specifically, the circularization efficiency was approximately 90% for 271 nt and approximately 20% for 5002 nt.
[0109] 5. Optimization of Circular RNA Production Method 5-1.GTP:GMP ratio For T4 RNA ligase 2 to join both ends of an RNA, the 5' end must be monophosphate. This is usually achieved by treating it with RppH. We induced in vitro transcription by adding GMP, then in vitro transcribed the 3'DB with different amounts and ratios of GTP and GMP to induce ligation, and then confirmed the circularization efficiency (Figure 7).
[0110] As a result, a circularization efficiency of approximately 50% was observed at a GTP:GMP ratio of 1:5, and circular RNA production increased slightly at higher GMP ratios. Considering the total rNTP usage and circularization efficiency, a GTP:GMP ratio of 1:5 was confirmed to be optimal.
[0111] 5-2. Heating conditions To induce the transcript to form the intended secondary structure after in vitro transcription, a heating step was added before ligation. We investigated whether circularization efficiency differed depending on the heating step conditions. We compared the circularization efficiency between a heating treatment at 65°C for 3 minutes followed by cooling on ice for 3 minutes and a heating treatment at 80°C for 3 minutes, cooling to 26°C at a rate of 6°C per minute. As shown in Figure 8, the heating treatment at 80°C for 3 minutes, cooling to 26°C at a rate of 6°C per minute, yielded superior circularization efficiency compared to the former condition (Figures 11 and 12).
[0112] 5-3. Ligation reaction conditions The circularization efficiency was examined as a function of temperature and time during the ligation induction step. Specifically, the ligation temperature was set at 25°C or 37°C, and the degree of circular RNA formation was confirmed by band analysis after 1, 4, 8, or 12 hours at these temperatures (Figure 9). As a result, sufficient circular RNA bands were observed after 1 hour of ligation induction at 25°C. When the reaction was induced at 37°C, the circular RNA bands were weak. Even when ligation was induced for more than 1 hour, no significant increase in circularization efficiency was observed.
[0113] 5-4.RppH treatment To increase the efficiency of Rnl2-mediated ligation, we performed IVT under various GTP:GMP conditions and then added RppH treatment to confirm the circularization efficiency. The results showed that RppH treatment followed by Rnl2-mediated ligation was more efficient than without RppH treatment (Figure 10).
[0114] 5-5. Confirm circularization with DB-WT and 3'DB Circular RNAs were produced under the optimal circular RNA production conditions identified in sections 5-1 to 5-4 above using DB-WT and 3'DB circular RNA precursors circularized by Rnl2, and their efficiency was confirmed. An IVT experiment was performed under conditions with only GTP added and no GMP, and then RppH was added to convert the 5' end to a monophosphate. To compare the two circularization methods, the results of the experiment using DB-WT are shown in Figure 11, and the results of the experiment using 3'DB are shown in Figure 12.
[0115] As previously confirmed, DB-WT and 3'DB were joined by Rnl2 to generate circular RNAs. However, even with RppH treatment under conditions containing only GTP, DB-WT produced circular RNAs less efficiently than 3'DB. This is likely due to the inability of RppH to function properly in DB-WT due to its secondary structure. Furthermore, in DB-WT, the linear RNA band in lane 6, which is the poly(A) tailing and RNase R treatment, was not completely removed due to the secondary structure, whereas in 3'DB, no linear RNA was observed after the purification described above.
[0116] 6.Comparison of circularization efficiency with splint ligation We attempted to confirm the efficiency of circular RNA production using DB-M3 and DNA splints. The circularization conditions were set to the optimal conditions confirmed in sections 5-1 to 5-4 above. The circular RNA precursor used for splint ligation was DB-M3, with 19 nt of the 3' end deleted. DNA splints of 30, 60, or 91 nt in length were used. As shown in Figure 13, DB-M3 demonstrated superior circularization efficiency with Rnl2 compared to the three DNA splints.
[0117] As described above, although the embodiments have been described with limited drawings, those skilled in the art can apply various technical modifications and variations based on the above. For example, the described techniques may be performed in an order different from that described, and / or the components of the described systems, structures, devices, circuits, etc. may be combined or combined in a form different from that described, or may be substituted or replaced by other components or equivalents, and still achieve suitable results.
[0118] Therefore, other embodiments, examples, and equivalents to the claims also fall within the scope of the claims set forth below. [Industrial Applicability]
[0119] The present invention can be used to produce circular RNA.
Claims
1. A circular RNA precursor, The circular RNA precursor has a 5'-3' DumbBell Sense sequence (3' DB SS)-GOI (gene of interest)-3' DumbBell Antisense sequence (3' DB AS)-3' structure; the 3'DB AS region comprises a sequence reverse complementary to the 3'DB SS region; the 3'DB SS region has a length of 10 to 29 nt; the length of the region of the GOI is 500-5500 nt; Circular RNA precursors, which are circularized by Rnl2 without a DNA splint.
2. the circular RNA precursor comprises nucleotides extending in the 5' direction of the 3' DB SS region, the region consisting of extended nucleotides comprises a 5' DumbBell Antisense sequence (5' DB AS)-5' DumbBell Sense sequence (5' DB SS) structure; the 5'DB AS region comprises a reverse complementary sequence to the 5'DB SS region; The circular RNA precursor of claim 1, wherein the 5'DB SS region is 3 to 15 nt in length.
3. The circular RNA precursor of claim 2, wherein the 5'DB AS region and the 5'DB SS region are linked by 1 to 19 random nucleotides.
4. The circular RNA precursor of claim 1, wherein the GOI comprises an IRES.
5. An expression vector capable of expressing the circular RNA precursor of any one of claims 1 to 4.
6. The expression vector of claim 5 , further comprising a promoter operably linked to a gene encoding the circular RNA precursor.
7. (1) inducing in vitro transcription of the expression vector according to claim 5 under conditions of GTP:GMP=1:5-10; (2) after the transcription induction step, treating the DNA with DNase I in vitro; (3) adding Rnl2 in vitro to induce ligation; A method for producing circular RNA, comprising:
8. The method for producing circular RNA according to claim 7 , further comprising a step of treating RppH in vitro after carrying out step (2).
9. The method for producing circular RNA further comprises a heating step immediately before the step (3), The method for producing circular RNA according to claim 7, wherein the heating step comprises heating to 80°C for 3 minutes and cooling at 6°C per minute until the temperature reaches 26°C.
10. The method for producing circular RNA according to claim 7, wherein the step (3) is carried out at 25°C for 1 hour or more.
11. The method for producing circular RNA according to claim 7, further comprising the step of (4) treating with RNase R in vitro after the step (3).
12. The method for producing circular RNA according to claim 11, further comprising a step of treating with poly(A) polymerase in vitro immediately before step (4).
Citation Information
Patent Citations
CircRNA preparation method
CN111321143A