Methods for treating cancer using engineered T cells
Co-cultured lentiviral vector-transduced antigen-presenting cells and T cells with patient-specific tumor antigens and CARs enhance CAR therapy by promoting rapid and persistent anti-tumor T cell expansion, overcoming existing challenges in CAR-based cancer treatment.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2023-09-22
- Publication Date
- 2026-03-04
AI Technical Summary
Current challenges in CAR-based cancer therapy include limited in vivo expansion of CAR+ T cells, rapid loss of cells after infusion, and the excessively long time between diagnosis and treatment, along with the lack of specific tumor targets.
Compositions comprising co-cultured lentiviral vector-transduced autologous antigen-presenting cells and T cells, expressing patient-specific tumor antigens and chimeric antigen receptors, to generate an active anti-tumor T cell population for direct infusion, promoting in vivo expansion and persistence.
The approach leads to tumor stabilization, reduction, and/or elimination by generating a patient-specific anti-tumor T cell population capable of rapid expansion and persistence, addressing the limitations of existing CAR therapies.
Smart Images

Figure 0007824256000004 
Figure 0007824256000005 
Figure 0007824256000001
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No. 62 / 175,003, filed June 12, 2015, the entire contents of which are incorporated herein by reference.
[0002] Field of Disclosure The present application relates to the field of cancer, in particular to compositions comprising autologous antigen-presenting cells transduced with lentiviral vectors expressing patient-specific mutant cancer transcripts co-cultured with autologous chimeric antigen receptor (CAR)-transduced T cells, and methods of use in patient-specific combination immunotherapy. [Background technology]
[0003] Background of the Invention Cancer is one of the major threats to human health. In the United States alone, cancer affects nearly 1.3 million new patients each year, making it the second leading cause of death after cardiovascular disease, accounting for approximately one-quarter of all deaths. Solid tumors are responsible for most of these deaths. While significant advances have been made in the medical treatment of certain cancers, the 5-year overall survival rate for all cancers has improved by only about 10% over the past 20 years. Cancers, or malignant tumors, rapidly metastasize and grow uncontrolled, making treatment extremely difficult. One of the challenges in modern cancer treatment is the time that elapses between a patient's biopsy and cancer diagnosis and effective treatment. During this time, a patient's tumor may grow unhindered, resulting in the disease progressing further before treatment can be applied. This negatively impacts cancer prognosis and outcomes.
[0004] Chimeric antigen receptors (CARs) are hybrid molecules containing three essential units: (1) an extracellular antigen-binding motif, (2) a linking / transmembrane motif, and (3) an intracellular T cell signaling motif (Long AH, Haso WM, Orentas RJ. Lessons learned from a highly active CD2-specific chimeric antigen receptor. Oncoimmunology. 2013; 2(4):e23621 (Non-Patent Document 1)). The antigen-binding motif of CARs is generally based on a single-chain variable fragment (scFv), the smallest binding domain of an immunoglobulin (Ig) molecule. Alternative antigen-binding motifs have also been engineered, for example, receptor ligands (i.e., IL-13 has been engineered to bind to tumor-expressed IL-13 receptors), intact immune receptors, library-derived peptides, and innate immune system effector molecules (e.g., NKG2D). Alternative cellular targets for CAR expression (e.g., NK or gamma-delta T cells) are also under development (Brown CE et al. Clin Cancer Res. 2012;18(8):2199-209 (Non-Patent Document 2); Lehner M et al. PLoS One. 2012;7(2):e31210 (Non-Patent Document 3). Considerable effort is still required to define the most active T cell population for transduction with CAR vectors, to determine optimal culture and expansion techniques, and to define the molecular details of the CAR protein structure itself.
[0005] The linking motif of the CAR can be a relatively stable structural domain, such as the constant domain of IgG, or can be designed to be an extended, flexible linker. Structural motifs, such as those derived from the constant domain of IgG, can be used to extend the scFv binding domain away from the T cell plasma membrane surface. This allows the binding domain to bind to tumor cells. This may be important for some tumor targets that are particularly close to the cell surface membrane (e.g., for disialoganglioside GD2; Orentas et al., unpublished observations). To date, the signaling motif used in CARs has always included the CD3-ζ chain, because this core motif is an important signal for T cell activation. The first reported second-generation CARs featured the CD28 signaling domain and CD28 transmembrane sequence. This motif was also used in third-generation CARs containing the CD137 (4-1BB) signaling motif (Zhao Y et al., J Immunol. 2009;183(9):5563-74 (Non-Patent Document 4)). With the advancement of new technologies, T cell activation by beads linked to anti-CD3 and anti-CD28 antibodies and the presence of the canonical "signal 2" derived from CD28 no longer need to be encoded by the CAR itself. Using bead activation, third-generation vectors were found to be no superior to second-generation vectors in in vitro assays and offered no clear benefit over second-generation vectors in mouse models of leukemia (Haso W, Lee DW, Shah NN, Stetler-Stevenson M, Yuan CM, Pastan IH, Dimitrov DS, Morgan RA, FitzGerald DJ, Barrett DM, Wayne AS, Mackall CL, Orentas RJ. Anti-CD22-chimeric antigen receptors targeting B cell precursor acute lymphoblastic leukemia. Blood. 2013;121(7):1165-74 (Non-Patent Document 5); Kochenderfer JN et al. Blood. 2012;119(12):2709-20 (Non-Patent Document 6)).This is supported by the clinical success of second-generation CD28 / CD3-ζ (Lee DW et al., American Society of Hematology Annual Meeting, New Orleans, LA; December 7-10, 2013 (Non-Patent Document 7)) and CD19-specific CARs with CD137 / CD3-ζ signaling formats (Porter DL et al., N Engl J Med. 2011; 365(8):725-33 (Non-Patent Document 8)). In addition to CD137, other tumor necrosis factor receptor superfamily members, such as OX40, can also provide important sustained signals in CAR-transduced T cells (Yvon E et al., 2013). Clin Cancer Res. 2009; 15(18): 5852-60 (Non-Patent Document 9). The culture conditions under which the CAR T cell population is cultured are equally important.
[0006] A current challenge in broader and more effective application of CAR therapy to cancer relates to the lack of compelling targets. While creating binding agents to cell surface antigens is now readily achievable, discovering cell surface antigens specific to tumors while sparing normal tissues remains a formidable challenge. One potential way to confer higher target cell specificity to CAR-expressing T cells is to use a combinatorial CAR approach. In one system, the CD3-ζ and CD28 signaling units are split between two different CAR constructs expressed in the same cell; in another system, two CARs are expressed in the same T cell, but one has lower affinity, thus requiring the alternative CAR to be first bound for full activity of the second CAR (Lanitis E et al. Cancer Immunol Res. 2013; vol. 1(1): pp. 43-53 (Non-Patent Document 10); Kloss CC et al. Nat Biotechnol. 2013; vol. 31(1): pp. 71-5 (Non-Patent Document 11)). A second challenge for generating a single scFv-based CAR as an immunotherapeutic agent is tumor cell heterogeneity. At least one group has developed a CAR strategy for glioblastoma in which an effector cell population simultaneously targets multiple antigens (HER2, IL-13Ra, EphA2) in the hope of avoiding the growth of target antigen-negative populations (Hegde M et al. Mol Ther. 2013;21(11):2087-101 (Non-Patent Document 12)).
[0007] T cell-based immunotherapy is an emerging field in synthetic biology; multiple promoters and gene products are envisioned to direct these highly potent cells to the tumor microenvironment, where they can escape negative regulatory signals and mediate effective tumor killing. Elimination of unwanted T cells via drug-induced dimerization of an inducible caspase-9 construct with AP1903 demonstrates one way in which a powerful switch can be pharmacologically initiated to control T cell populations (Di Stasi A et al., N Engl J Med. 2011;365(18):1673-83 (Non-Patent Document 13)). Creation of an effector T cell population immune to the negative regulatory effects of transforming growth factor-β by expression of a decoy receptor further demonstrates the extent to which effector T cells can be engineered for optimal antitumor activity (Foster AE et al., J Immunother. 2008;31(5):500-5 (Non-Patent Document 14)).
[0008] Thus, although CARs appear to be able to induce T cell activation in a manner similar to endogenous T cell receptors, the major obstacles to the clinical application of this CAR-based technology to date are the limited in vivo expansion of CAR+ T cells, the rapid loss of cells after infusion, disappointing clinical activity, and the excessively long time between diagnosis and timely treatment of cancer using such CAR+ T cells. [Prior art documents] [Non-patent literature]
[0009] [Non-Patent Document 1] Long AH,Haso WM,Orentas RJ.Lessons learned from a highly-active CD2-specific chimeric antigen receptor.Oncoimmunology.2013;Volume 2 (Issue 4):page e23621 [Non-patent document 2] Brown CEらClin Cancer Res. 2012; Volume 18 (No. 8): Pages 2199~209 [Non-licensed document 3] Lehner MらPLoS One.2012;Volume 7(No.2):e31210 pages
Non-licensed Document 4
Non-licensed Document 5
Non-licensed Document 6
Non-licensed Document 7
Non-licensed literature 9
Non-licensed literature 10
Non-licensed Document 11
[0010] Thus, there is an urgent and long-felt need in the art to discover compositions and methods for the treatment of cancer using CAR-based therapies that can exhibit patient-specific, intended therapeutic properties without the drawbacks mentioned above.
[0011] The present invention addresses these needs by providing compositions comprising co-cultured lentiviral vector-transduced autologous antigen-presenting cells / T cells and methods of their use in patient-specific combination therapies that can be used to treat cancer and other diseases and / or conditions.
[0012] In particular, the invention disclosed and described herein provides a composition comprising autologous antigen presenting cells transduced with a lentiviral vector expressing a patient-specific tumor-encoded mutant cancer antigen, which cells are co-cultured with autologous T cells transduced with a lentiviral vector-expressed chimeric antigen receptor (CAR), either with or without one or more lentiviral-expressed tumor biopsy- and peripheral blood-derived tumor antigen T cell receptors transduced into a therapeutic T cell population, to generate an active patient-specific anti-tumor T cell population that can be infused directly back into the patient to promote in vivo expansion, persistence of patient-specific anti-tumor T cells resulting in tumor stabilization, reduction and / or elimination, and / or cancer regression and / or elimination. [Means for solving the problem]
[0013] Summary of the Invention Provided herein are novel adoptive immunotherapy compositions comprising co-cultured lentiviral vector-transduced autologous antigen-presenting cells and T cells, and methods of their use in patient-specific combination immunotherapy that can be used to treat cancer and other diseases and conditions.
[0014] Thus, in one aspect, the present specification provides the lentiviral vector expressing patient-specific mutant cancer antigen, the lentiviral vector expressing native T cell receptor (TCR), the lentiviral vector expressing tumor-specific reactive T cell TCR transcript and the lentiviral vector expressing chimeric antigen receptor (CAR), and the host cell (for example, T cell) expressing mutant cancer antigen, native T cell receptor, T cell TCR transcript and receptor, and the nucleic acid molecule encoding mutant cancer antigen, native T cell receptor, T cell TCR transcript and receptor.For example, also provided is the method of using the lentiviral vector expressing patient-specific mutant cancer antigen, the lentiviral vector expressing native T cell receptor (TCR), the lentiviral vector expressing tumor-specific reactive T cell TCR transcript and the lentiviral vector expressing chimeric antigen receptor (CAR), host cell and nucleic acid molecule for treating cancer in a subject.
[0015] In one aspect, an adoptive immunotherapy composition comprises an autologous T cell population transduced with one or more lentiviral vectors encoding single or multiple chimeric antigen receptors (CARs), wherein the T cells are transduced with one or more lentiviral vectors expressing patient-derived tumor antigens. The present invention provides an adoptive immunotherapy composition in which a tumor-specific T cell population is co-cultured with transduced autologous antigen-presenting cells to generate an active patient-specific autologous anti-tumor T cell population capable of patient-specifically promoting in vivo expansion, persistence of patient-specific anti-tumor T cells resulting in tumor stabilization, reduction, and / or elimination, and / or cancer regression and / or elimination.
[0016] In one embodiment, the autologous antigen presenting cells are derived from autologous dendritic cells or B cells or a mixture or peripheral blood derived lymphocytes.
[0017] In one embodiment, an adoptive immunotherapy composition is provided in which autologous patient-specific T cells containing native T cell receptors (TCRs) are transduced with a lentiviral vector to express a chimeric antigen receptor (CAR), either during or after co-culture with autologous antigen-presenting cells transduced with one or more lentiviral vectors expressing patient-derived tumor antigens, to generate an active patient-specific autologous anti-tumor T cell population capable of patient-specifically promoting in vivo expansion, persistence of patient-specific anti-tumor T cells that result in tumor stabilization, reduction, and / or elimination, and / or cancer regression and / or elimination.
[0018] In one embodiment, an adoptive immunotherapy composition is provided in which patient-derived tumor antigens are identified via patient biopsy and nucleotide sequencing to identify mutant RNA transcripts within the mutanome.
[0019] In one embodiment, an adoptive immunotherapy composition is provided in which the autologous anti-tumor T cell population(s) comprises autologous antigen-presenting cells (APCs) comprising patient-specific dendritic cells or B cells or a mixture or peripheral blood-derived lymphocytes.
[0020] In another embodiment, an adoptive immunotherapy composition is provided, in which the autologous anti-tumor T cell population(s) comprises autologous antigen-presenting cells (APCs) comprising activated patient-specific autologous B cells immortalized with Epstein-Barr virus (EBV), wherein the immortalization step comprises culturing the autologous B cells with an EBV-containing cell culture supernatant. In one embodiment, commercial services for the production of such activated patient-specific autologous B cells immortalized with EBV include, for example, but not limited to, Applied Biologic Material, ABM, Inc. (https: / / www.abmgood.com / EBV-Cell-Immortalization.html). In one embodiment, the EBV-immortalized B cell line includes cell lines commonly used in the art, including, but not limited to, the EBV-immortalized B cell line B95-8 (ATCC CRL-1612), or alternatively, EBV-containing supernatant (ATCC-BR14-92).
[0021] In another aspect, an adoptive immunotherapy composition is provided comprising an autologous T cell population transduced with one or more lentiviral vectors encoding single or multiple chimeric antigen receptors, wherein the T cell population is further transduced with one or more lentiviral vectors encoding tumor-specific T cell receptors (TCRs) to generate an active patient-specific autologous anti-tumor T cell population capable of promoting in vivo expansion, persistence of patient-specific anti-tumor T cells in a patient-specific manner that results in tumor stabilization, reduction, and / or elimination, and / or cancer regression and / or elimination.
[0022] In one embodiment, an adoptive immunotherapy composition is provided in which a tumor-specific T cell receptor (TCR) is initially identified by co-culturing antigen-presenting cells (APCs) transduced with one or more lentiviral vectors expressing patient-derived tumor antigens with HLA-matched or patient-specific T cells.
[0023] In one embodiment, the autologous antigen presenting cells are autologous dendritic cells or B cells or a mixture. or derived from peripheral blood-derived lymphocytes.
[0024] In one embodiment, an adoptive immunotherapy composition is provided in which the tumor-specific T cell receptor (TCR) is HLA-matched or patient-specific.
[0025] In one embodiment, an adoptive immunotherapy composition is provided in which autologous patient-specific T cells containing a patient-specific tumor-specific T cell receptor (TCR) are transduced with a lentiviral vector to express a chimeric antigen receptor (CAR), either during or after co-culture with autologous antigen-presenting cells transduced with one or more lentiviral vectors expressing patient-derived tumor antigens, to generate an active patient-specific autologous anti-tumor T cell population capable of recognizing the tumor-specific T cell receptor (TCR) and promoting in vivo expansion, persistence of patient-specific anti-tumor T cells in a patient-specific manner, resulting in tumor stabilization, reduction, and / or elimination, and / or cancer regression and / or elimination.
[0026] In one embodiment, an adoptive immunotherapy composition is provided in which patient-derived tumor antigens are identified via patient biopsy and nucleotide sequencing to identify mutant RNA transcripts within the mutagenesis. In one embodiment, the nucleotide sequencing is performed using next-generation sequencing.
[0027] In one embodiment, an adoptive immunotherapy composition is provided in which the autologous anti-tumor T cell population(s) comprises autologous antigen-presenting cells (APCs) comprising patient-specific dendritic cells or B cells or a mixture or peripheral blood-derived lymphocytes.
[0028] In certain embodiments, adoptive immunotherapy compositions are provided in which an active patient-specific autologous anti-tumor T cell population is generated within 1 day, 3 days, 5 days, 7 days, 10 days, 14 days, 21 days, or 1 month of a tumor biopsy and can be infused directly back into a patient afflicted with cancer, wherein the active patient-specific autologous anti-tumor T cell population is capable of patient-specifically promoting in vivo expansion, persistence of patient-specific anti-tumor T cells resulting in tumor stabilization, reduction, and / or elimination, and / or cancer remission and / or elimination.
[0029] In certain embodiments of both of the above aspects, adoptive immunotherapy compositions are provided in which the CAR comprises at least one extracellular antigen-binding domain, at least one linker domain, at least one transmembrane domain, and at least one intracellular signaling domain.
[0030] In certain embodiments of both of the above aspects, adoptive immunotherapy compositions are provided in which at least one extracellular antigen-binding domain of the CAR comprises at least one single-chain variable fragment of an antibody that binds to an antigen.
[0031] In certain embodiments of both of the above aspects, adoptive immunotherapy compositions are provided in which at least one extracellular antigen-binding domain of the CAR comprises at least one heavy chain variable region of an antibody that binds to the antigen.
[0032] In certain embodiments of both of the above aspects, adoptive immunotherapy compositions are provided in which at least one extracellular antigen-binding domain of the CAR, at least one intracellular signaling domain of the CAR, or both, is connected to the transmembrane domain by a linker or spacer domain.
[0033] In certain embodiments of both of the above aspects, adoptive immunotherapy compositions are provided in which the extracellular antigen-binding domain of the CAR is preceded by a leader peptide.
[0034] In certain embodiments of both of the above aspects, adoptive immunotherapy compositions are provided in which the extracellular antigen-binding domain of the CAR targets an antigen comprising CD19, CD20, CD22, ROR1, TSLPR, mesothelin, CD33, CD38, CD123 (IL3RA), CD138, BCMA (CD269), GPC2, GPC3, FGFR4, c-Met, PSMA, glycolipid F77, EGFRvIII, GD-2, NY-ESO-1 TCR, MAGE A3 TCR, or any combination thereof.
[0035] In certain embodiments of both of the above aspects, the extracellular antigen-binding domain of the CAR is an anti-CD19 scFV antigen-binding domain, an anti-CD20 scFV antigen-binding domain, an anti-CD22 scFV antigen-binding domain, an anti-ROR1 scFV antigen-binding domain, an anti-TSLPR scFV antigen-binding domain, an anti-mesothelin scFV antigen-binding domain, an anti-CD33 scFV antigen-binding domain, an anti-CD38 scFV antigen-binding domain, an anti-CD123 (IL3RA) scFV antigen-binding domain, an anti-CD138 scFV antigen-binding domain, an anti-BCMA (CD269) scFV antigen-binding domain, an anti-GPC2 Adoptive immunotherapy compositions are provided comprising an scFV antigen-binding domain, an anti-GPC3 scFV antigen-binding domain, an anti-FGFR4 scFV antigen-binding domain, an anti-c-Met scFV antigen-binding domain, an anti-PMSA scFV antigen-binding domain, an anti-glycolipid F77 scFV antigen-binding domain, an anti-EGFRvIII scFV antigen-binding domain, an anti-GD-2 scFV antigen-binding domain, an anti-NY-ESo-1 TCR scFV antigen-binding domain, an anti-MAGE A3 TCR scFV antigen-binding domain, or an amino acid sequence thereof having 85%, 90%, 95%, 96%, 97%, 98% or 99% identity, or any combination thereof.
[0036] In certain embodiments of both of the above aspects, adoptive immunotherapy compositions are provided in which the linker or spacer domain of the CAR is derived from the extracellular domain of CD8 and is linked to a transmembrane domain.
[0037] In certain embodiments of both of the above aspects, adoptive immunotherapy compositions are provided wherein the CAR further comprises a transmembrane domain comprising a transmembrane domain of a protein selected from the group consisting of the alpha, beta, or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, CD271, TNFRSF19, or any combination thereof.
[0038] In certain embodiments of both of the above aspects, an adoptive immunotherapy composition is provided, wherein the at least one intracellular signaling domain further comprises a CD3 zeta intracellular domain.
[0039] In certain embodiments of both of the above aspects, adoptive immunotherapy compositions are provided in which at least one intracellular signaling domain is positioned C-terminal to the CD3 zeta intracellular domain.
[0040] In certain embodiments of both of the above aspects, adoptive immunotherapy compositions are provided, wherein at least one intracellular signaling domain comprises a costimulatory domain, a primary signaling domain, or any combination thereof.
[0041] In certain embodiments of both of the above aspects, at least one costimulatory domain is selected from the group consisting of OX40, CD70, CD27, CD28, CD5, ICAM-1, LFA-1 (CD11a / CD18), ICOS (CD278), DAP10, DAP12, and 4-1BB ( Adoptive immunotherapy compositions are provided that comprise a functional signaling domain of a nucleotide sequence encoding ...
[0042] In one aspect, provided herein is an isolated nucleic acid molecule encoding a patient-specific mutant cancer antigen, an isolated nucleic acid molecule encoding a native T cell receptor (TCR), an isolated nucleic acid molecule encoding a tumor-specific reactive T cell TCR transcript, or an isolated nucleic acid molecule encoding a chimeric antigen receptor (CAR).
[0043] In one embodiment of the CARs used in the activated patient-specific autologous anti-tumor T cell population(s), the CARs are modified to express or contain a detectable marker for use in diagnosis, monitoring and / or prediction of treatment outcome such as progression-free survival in cancer patients, or to monitor the progress of such treatment.
[0044] In one embodiment of a CAR used in the activated patient-specific autologous anti-tumor T cell population(s), the nucleic acid molecule encoding the disclosed CAR can be contained in a vector, such as a viral vector, which is a DNA vector, an RNA vector, a plasmid vector, a cosmid vector, a herpes virus vector, a measles virus vector, a lentivirus vector, an adenovirus vector, or a retrovirus vector, a baboon endogenous virus (BaEV), or a combination thereof.
[0045] In certain embodiments of CARs used in the activated patient-specific autologous anti-tumor T cell population(s), lentiviral vectors are pseudotyped with different viral glycoproteins (GPs), including, for example, but not limited to, GPs derived from amphotropic murine leukemia virus (MLV-A), GP164, gibbon ape leukemia virus (GALV), RD114, feline endogenous virus retrovirus, and GPs derived from vesicular stomatitis virus (VSV), measles virus, fowl plague virus (FPV), Ebola virus (EboV), lymphocytic choriomeningitis virus (LCMV) non-retroviruses, and chimeric variants thereof, including, for example, but not limited to, chimeric GPs encoding the extracellular and transmembrane domains of GALV or RD114 GP fused to the cytoplasmic tail (termed TR) of MLV-A GP.
[0046] In certain embodiments of CARs used in the activated patient-specific autologous anti-tumor T cell population(s), the vector further comprises a promoter that is an inducible promoter, a tissue-specific promoter, a constitutive promoter, a suicide promoter, or any combination thereof.
[0047] In yet another embodiment of the CAR used in the activated patient-specific autologous anti-tumor T cell population(s), the vector expressing the CAR can be further modified to include one or more operable elements to control the expression of the CAR T cells or to eliminate the CAR-T cells by a suicide switch. The suicide switch can include, for example, an apoptosis-inducing signaling cascade or a drug that induces cell death. In a preferred embodiment, the vector expressing the CAR can be further modified to express an enzyme such as thymidine kinase (TK) or cytosine deaminase (CD).
[0048] In another aspect of the CAR used in the active patient-specific autologous anti-tumor T cell population(s), a host cell is also provided that comprises a nucleic acid molecule encoding the CAR. In some embodiments, the host cell is a T cell, for example, a primary T cell obtained from a subject. In one embodiment, the host cell is a CD8+ T cell.
[0049] In yet another embodiment, an activated patient-specific autologous anti-tumor T cell population (multiple) of human cancer patients is administered. A pharmaceutical composition is provided comprising an antitumor-effective amount of a population (which may include any number of cancers) of a cancer that is refractory to one or more chemotherapeutic agents, including hematopoietic cancer, myelodysplastic syndrome, pancreatic cancer, head and neck cancer, skin tumor, acute lymphoblastic leukemia (ALL), minimal residual disease (MRD) in acute myeloid leukemia (AML), lung cancer, breast cancer, ovarian cancer, prostate cancer, colon cancer, melanoma or other hematological cancers and solid tumors, or any combination thereof.
[0050] In yet another embodiment, a pharmaceutical composition is provided comprising an anti-tumor effective amount of a population of active patient-specific autologous anti-tumor T cell population(s) from a human with cancer, wherein the cancer comprises a hematological cancer, such as leukemia (e.g., chronic lymphocytic leukemia (CLL), acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), or chronic myelogenous leukemia (CML)), lymphoma (e.g., mantle cell lymphoma, non-Hodgkin's lymphoma, or Hodgkin's lymphoma), or multiple myeloma, or any combination thereof.
[0051] In yet another embodiment, a pharmaceutical composition comprising an anti-tumor effective amount of a population of activated patient-specific autologous anti-tumor T cell population(s) from a human having cancer, wherein the cancer is selected from the group consisting of oral and pharyngeal cancer (tongue, mouth, pharynx, head and neck), digestive system cancer (esophagus, stomach, small intestine, colon, rectum, anus, liver, intrahepatic bile duct, gallbladder, pancreas), respiratory system cancer (larynx, lung and bronchus), bone and joint cancer, soft tissue cancer, skin cancer (melanoma, basal cell carcinoma and squamous cell carcinoma), pediatric tumors (hepatic tumors), and / or rheumatoid arthritis (rheumatoid arthritis). Pharmaceutical compositions are provided for treating adult cancers, including cancers of the breast, reproductive system (cervix, uterus, ovary, vulva, vagina, prostate, testicles, penis, endometrium), urinary system (bladder, kidney and renal pelvis, ureter), eye and orbit, endocrine system (thyroid), and brain and other nervous systems, or any combination thereof.
[0052] In another aspect, a method for generating active patient-specific autologous anti-tumor CAR-containing T cells is provided, comprising transducing T cells with a vector or nucleic acid molecule encoding i) one or more patient-specific mutated cancer antigens; ii) one or more patient-specific and tumor-specific TCRs; and iii) one or more chimeric antigen receptors (CARs) that specifically bind to the antigens, or any combination thereof, thereby generating active patient-specific autologous anti-tumor CAR-containing T cells.
[0053] In yet another aspect, provided is a method for generating a population of RNA engineered T cells, comprising introducing into cells of a subject in vitro transcribed or synthetic RNA of nucleic acid molecules encoding i) one or more patient-specific mutated cancer antigens; ii) one or more patient-specific and tumor-specific TCRs; and iii) one or more chimeric antigen receptors (CARs), or any combination thereof, thereby generating an active patient-specific autologous anti-tumor T cell population capable of patient-specifically promoting in vivo expansion, persistence of patient-specific anti-tumor T cells that result in tumor stabilization, reduction, and / or elimination, and / or cancer regression and / or elimination.
[0054] In another aspect, provided is a pharmaceutical composition comprising an autologous T cell population transduced with one or more lentiviral vectors encoding single or multiple chimeric antigen receptors (CARs), wherein the T cells are co-cultured with autologous antigen-presenting cells transduced with one or more lentiviral vectors expressing patient-derived tumor antigens, thereby generating an active patient-specific autologous anti-tumor T cell population capable of patient-specifically promoting in vivo expansion, persistence of patient-specific anti-tumor T cells that result in tumor stabilization, reduction, and / or elimination, and / or cancer regression and / or elimination.
[0055] In another embodiment, one or more chimeric antigen receptors (CARs) encoding single or multiple chimeric antigen receptors (CARs) are provided. Provided is a pharmaceutical composition comprising an autologous T cell population transduced with a number of lentiviral vectors, wherein the T cell population is further transduced with one or more lentiviral vectors encoding tumor-specific T cell receptors (TCRs) to generate an active patient-specific autologous anti-tumor T cell population capable of recognizing the tumor-specific T cell receptor (TCR) and promoting in vivo expansion, persistence of patient-specific anti-tumor T cells in a patient-specific manner that results in tumor stabilization, reduction and / or elimination, and / or cancer regression and / or elimination.
[0056] In one embodiment, a pharmaceutical composition is provided wherein the T cells are T cells from a human with hematological cancer.
[0057] In another embodiment, a pharmaceutical composition is provided wherein the hematological cancer is leukemia or lymphoma.
[0058] In another embodiment, a pharmaceutical composition is provided wherein the leukemia is chronic lymphocytic leukemia (CLL), acute lymphocytic leukemia (ALL), or chronic myelogenous leukemia (CML).
[0059] In another embodiment, a pharmaceutical composition is provided wherein the lymphoma is mantle cell lymphoma, non-Hodgkin's lymphoma, or Hodgkin's lymphoma.
[0060] In another embodiment, a pharmaceutical composition is provided wherein the hematological cancer is multiple myeloma. In another embodiment, pharmaceutical compositions are provided wherein the human cancer comprises adult cancers including oral and pharyngeal cancers (tongue, mouth, pharynx, head and neck), digestive system cancers (esophagus, stomach, small intestine, colon, rectum, anus, liver, intrahepatic bile duct, gallbladder, pancreas), respiratory system cancers (larynx, lung and bronchi), bone and joint cancers, soft tissue cancers, skin cancers (melanoma, basal cell carcinoma and squamous cell carcinoma), childhood tumors (neuroblastoma, rhabdomyosarcoma, osteosarcoma, Ewing's sarcoma), tumors of the central nervous system (brain tumor, astrocytoma, glioblastoma, glioma), and cancers of the breast, reproductive system (cervix, uterus, ovary, vulva, vagina, prostate, testicles, penis, endometrium), urinary system (bladder, kidney and renal pelvis, ureter), eye and orbit, endocrine system (thyroid), and brain and other nervous system, or any combination thereof.
[0061] In another aspect, a method is provided for treating a mammal having a disease, disorder, or condition associated with elevated expression of a tumor antigen, the method comprising administering to the subject a pharmaceutical composition comprising an anti-tumor effective amount of autologous T cells transduced with one or more lentiviral vectors encoding single or multiple chimeric antigen receptors (CARs), wherein the T cells are co-cultured with autologous antigen-presenting cells transduced with one or more lentiviral vectors expressing patient-derived tumor antigens, thereby generating an active patient-specific autologous anti-tumor T cell population capable of patient-specifically promoting in vivo expansion, persistence of patient-specific anti-tumor T cells that result in tumor stabilization, reduction, and / or elimination, and / or cancer regression and / or elimination.
[0062] In another aspect, a method for treating a mammal having a disease, disorder, or condition associated with elevated expression of a tumor antigen, the method comprising administering to a subject a pharmaceutical composition comprising an anti-tumor effective amount of autologous T cells transduced with one or more lentiviral vectors encoding single or multiple chimeric antigen receptors (CARs), wherein the T cell population is further transduced with one or more lentiviral vectors encoding tumor-specific T cell receptors (TCRs) to generate an active patient-specific autologous anti-tumor T cell population capable of recognizing the tumor-specific T cell receptor (TCR), which can be infused directly back into the patient to patient-specifically promote in vivo expansion, persistence of patient-specific anti-tumor T cells resulting in tumor stabilization, reduction, and / or elimination, and / or cancer regression and / or elimination. , a method is provided.
[0063] In certain embodiments, methods are provided herein, wherein the T cells are preselected by expressing specific activation- or memory-associated surface markers.
[0064] In certain embodiments, methods are provided herein wherein the T cells and dendritic cells are derived from a hematopoietic stem cell donor and the procedure is performed in the context of a hematopoietic stem cell transplant.
[0065] In yet another aspect, a method is provided for generating a persistent population of genetically engineered, active, patient-specific, autologous anti-tumor T cell population(s) in a human diagnosed with cancer. In one embodiment, the method comprises administering one or more active, patient-specific, autologous anti-tumor T cell population(s) described herein to a human patient in need thereof, wherein the persistent population of active, patient-specific, autologous anti-tumor T cell population(s), or a population of T cell progeny, persists in the human for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 2 years, or 3 years after administration.
[0066] In one embodiment, the T cells of the human progeny comprise memory T cells. In another embodiment, the T cells are autologous T cells.
[0067] In all of the aspects and embodiments of the methods described herein, any of the above-mentioned cancers, diseases, disorders or conditions associated with elevated expression of tumor antigens may be treated or prevented or ameliorated using one or more of the compositions comprising the activated patient-specific autologous anti-tumor T cell population(s) disclosed herein.
[0068] In yet another aspect, there is provided a kit for making a composition comprising the above-described active patient-specific autologous anti-tumor T cell population(s), or for preventing, treating, or ameliorating any cancer, disease, disorder, or condition associated with elevated expression of a tumor antigen in the above-described subject, the kit comprising a container containing any one of the above-disclosed nucleic acid molecules, vectors, host cells, or compositions, or any combination thereof, and instructions for using the kit.
[0069] It is understood that the above-described activated patient-specific autologous anti-tumor T cell population(s), lentiviral vectors expressing patient-specific mutant cancer antigens, lentiviral vectors expressing native T cell receptors (TCRs), lentiviral vectors expressing tumor-specific reactive T cell TCR transcripts, and lentiviral vectors expressing chimeric antigen receptors (CARs), as well as host cells (e.g., T cells) expressing mutant cancer antigens, native T cell receptors, T cell TCR transcripts, and receptors, as well as nucleic acid molecules, host cells, and methods encoding mutant cancer antigens, native T cell receptors, T cell TCR transcripts, and receptors, are useful beyond the specific aspects and embodiments described in detail herein. The foregoing features and advantages of the present disclosure will become more apparent from the following detailed description, which proceeds with reference to the accompanying drawings.
[0070] The following detailed description of preferred embodiments of the present invention will be better understood when read in conjunction with the accompanying drawings. For the purpose of illustrating the invention, there is shown in the drawings embodiments that are preferred in the present invention. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings. [Brief explanation of the drawings]
[0071] [Figure 1] FIG. 1 shows a first exemplary method for treating cancer, in which T cells for immunotherapy (infusion back into the patient) are transduced with CAR-expressing LVs and stimulated by their native TCR to recognize patient-specific mutant proteins identified by next-generation sequencing. [Figure 2] FIG. 2 shows a second exemplary method for treating cancer, in which T cells for immunotherapy (infusion back into the patient) are transduced with CAR-expressing LVs and TCR sequences from either a tumor biopsy or blood, and stimulated with DCs expressing transcripts identified by next-generation sequencing of the tumor. DETAILED DESCRIPTION OF THE INVENTION
[0072] Detailed Description definition As used herein, the singular forms "a," "an," and "the" refer to both the singular and the plural unless the context clearly indicates otherwise. For example, the term "an antigen" includes single or multiple antigens and can be considered equivalent to the phrase "at least one antigen." As used herein, the term "comprises" means "includes." Thus, "comprising an antigen" means "including one antigen" without excluding other elements. The phrase "and / or" means "and" or "or." It should be further understood that any and all base or amino acid sizes and all molecular weight or molecular mass values given for nucleic acids or polypeptides are approximate and provided for convenience unless otherwise specified. While many methods and materials similar or equivalent to those described herein can be used, particularly suitable methods and materials are described below. In case of conflict, the present specification, including explanations of terms, controls. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. In order to facilitate review of the various embodiments, the following explanations of terms are provided.
[0073] The term "about," when referring to a measurable value, e.g., amount, temporal duration, etc., is meant to encompass variations of ±20%, ±10%, or more preferably ±5%, or ±1%, or even more preferably ±0.1% from the specified value, where such variations are appropriate for practicing the disclosed methods.
[0074] Unless otherwise specified, technical terms herein are used according to conventional usage. Definitions of common terms in molecular biology are found in Benjamin Lewin, Genes VII, 1999, published by Oxford University Press; Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, 1994, published by Blackwell Science Ltd.; and Robert J. A. Meyers (ed.), Molecular Biology and Biotechnology: A Comprehensive Desk Reference, 1995; and other similar references.
[0075] The present invention relates to compositions and methods for treating cancer, including but not limited to hematological malignancies and solid tumors. The present invention relates to patient-specific and tumor-specific strategies of adoptive cell transfer of T cells transduced to express chimeric antigen receptors (CARs).
[0076] More particularly, the present invention relates to lentiviral vectors expressing patient-specific mutant cancer antigens, lentiviral vectors expressing native T cell receptors (TCRs), lentiviral vectors expressing tumor-specific reactive T cell TCR transcripts and lentiviral vectors expressing chimeric antigen receptors (CARs), as well as host cells (e.g., T cells) expressing mutant cancer antigens, native T cell receptors, T cell TCR transcripts and receptors, and mutant The present invention relates to nucleic acid molecules encoding cancer antigens, native T cell receptors, T cell TCR transcripts, and receptors. Also provided are methods for using the disclosed lentiviral vectors expressing patient-specific mutant cancer antigens, lentiviral vectors expressing native T cell receptors (TCRs), lentiviral vectors expressing tumor-specific reactive T cell TCR transcripts, and lentiviral vectors expressing chimeric antigen receptors (CARs), host cells, and nucleic acid molecules, for example, to treat cancer in subjects.
[0077] The present inventors have now surprisingly and unexpectedly discovered that active anti-tumor populations of T cells are more effective when expression of a tumor-specific TCR (either by selection of a native T cell population or by molecular cloning and transfer of the tumor-specific TCR using a lentiviral vector) is accompanied by expression of a chimeric antigen receptor (CAR). The CAR surprisingly and unexpectedly allows for the persistence of a T cell population bearing a tumor-specific TCR(s) by stimulating this T cell population upon encountering an autoantigen (e.g., CD19) whose loss can be tolerated by the patient and which still functions to provide a stimulatory signal to the therapeutic cell population not present in the tumor tissue itself. Such active patient-specific anti-tumor T cell populations described herein can be directly infused back into patients to promote in vivo expansion and persistence of patient-specific anti-tumor T cells, resulting in tumor stabilization, reduction, and / or elimination, and / or cancer remission and / or elimination, in a patient-specific manner.
[0078] Therefore, in its broadest aspect, the novelty of this adoptive immunotherapy lies in the use of lentiviral vectors to transduce tumor-specific mutant genes into APCs and then identify the patient's TCR by co-culturing them with patient T cells. This involves sequencing and identifying the mutant antigen in the patient, and then expressing the mutant protein in APCs via LVs, co-culturing T cells, and identifying the patient's TCR. Mutagenesis-specific TCRs and T cells can then be isolated and characterized. Furthermore, CARs are then added to enhance the immune response (IR). A distinguishing feature is that CARs are not primary immunotherapeutic agents, but act to enhance highly specific TCR responses. This enhances IR in two distinct ways: first, by providing additional signals to T cells to proliferate and survive in the body; and second, by targeting immunosuppressive cellular antigens.
[0079] In another aspect, the novelty of this adoptive immunotherapy lies in the use of lentiviral vectors to transduce tumor-encoded mutant genes into APCs using LVs, which are then co-cultured with patient cells to identify patient-derived tumor-specific TCRs. This involves sequencing and identifying patient-derived mutant antigens, and then expressing the mutant proteins in APCs using LVs and co-culturing patient T cells to identify mutant TCRs. In another aspect, CARs are used to enhance the immune response mediated by therapeutic T cell populations against tumors. The immune response is enhanced in at least three ways. First, by providing T cells with additional signals to proliferate and survive in the body, CARs enable the persistence of therapeutic T cell populations with tumor-specific TCR(s) by stimulating the T cell population when it encounters an autoantigen (e.g., CD19), whose loss can be tolerated by the patient and still function to provide a stimulatory signal to the therapeutic cell population that is not present in the tumor tissue itself. In a second embodiment, CARs can target cell types other than tumors that mediate immunosuppressive effects. For example, if CD19-expressing B cells are present in tumor lesions and mediate anti-tumor effects, a second advantage of CAR-expressing tumor-specific T cell populations is that immunosuppressive cell populations are also eliminated. In a third embodiment, CARs target immunosuppressive populations that are distal to the tumor, i.e., present in another compartment in the body. For example, CARs can target myeloid-derived suppressor cells (MDSCs), which can be present either in the tumor lesion itself or in the regional lymph nodes or bone marrow. Use.
[0080] Below is a detailed description of the CARs that may be used in the active patient-specific autologous anti-tumor T cell population(s) disclosed herein, including a description of their extracellular, transmembrane, and intracellular domains, along with further description of CARs, antibodies and antigen-binding fragments thereof, conjugates, nucleotides, expression, vectors, and host cells, methods of treatment, compositions, and kits using the disclosed CARs.
[0081] A. Chimeric Antigen Receptor (CAR) The CARs disclosed herein comprise at least one extracellular domain capable of binding to an antigen, at least one transmembrane domain, and at least one intracellular domain.
[0082] Chimeric antigen receptors (CARs) are artificially constructed hybrid proteins or polypeptides containing an antibody antigen-binding domain (e.g., a single-chain variable fragment (scFv)) linked to a T cell signaling domain via a transmembrane domain. Characteristics of CARs include their ability to redirect T cell specificity and reactivity toward selected targets in a non-MHC-restricted manner, leveraging the antigen-binding properties of monoclonal antibodies. Non-MHC-restricted antigen recognition confers on CAR-expressing T cells the ability to recognize antigens independently of antigen processing, thus bypassing a major mechanism of tumor escape. Furthermore, when expressed in T cells, CARs advantageously do not dimerize with the alpha and beta chains of endogenous T cell receptors (TCRs).
[0083] As disclosed herein, the intracellular T cell signaling domain of a CAR can include, for example, a T cell receptor signaling domain, a T cell costimulatory signaling domain, or both. A T cell receptor signaling domain refers to a portion of a CAR that includes the intracellular domain of a T cell receptor, such as, but not limited to, the intracellular portion of the CD3 zeta protein. A costimulatory signaling domain refers to a portion of a CAR that includes the intracellular domain of a costimulatory molecule, which is a cell surface molecule other than an antigen receptor or its ligand, that is required for an efficient response of lymphocytes to antigens.
[0084] 1. Extracellular domain In one embodiment, the CAR used in the active patient-specific autologous anti-tumor T cell population(s) disclosed herein comprises a target-specific binding element, otherwise referred to as an antigen-binding domain or moiety. The choice of domain depends on the type and number of ligands that define the surface of the target cell. For example, the antigen-binding domain can be selected to recognize a ligand that acts as a cell surface marker on the target cell associated with a specific disease state. Thus, examples of cell surface markers that can act as ligands for the antigen-binding domain in the CAR include those associated with viral, bacterial, and parasitic infections, autoimmune diseases, and cancer cells.
[0085] In one embodiment, CARs can be engineered to target tumor antigens of interest by engineering a desired antigen-binding domain that specifically binds to the antigen on tumor cells. Tumor antigens are proteins produced by tumor cells that elicit immune responses, particularly T cell-mediated immune responses. The choice of antigen-binding domain depends on the specific type of cancer to be treated. Tumor antigens are well known in the art and include, for example, glioma-associated antigens, carcinoembryonic antigen (CEA), beta-human chorionic gonadotropin, alpha-fetoprotein (AFP), lectin-reactive AFP, thyroglobulin, RAGE-1, MN-CA IX, human telomerase reverse transcriptase, RU1, RU2 (AS), intestinal carboxylesterase, mutated hsp70-2, M-CSF, prostase, prostate-specific antigen, and the like. Examples of tumor antigens that may be used include prostate cancer antigen (PSA), PAP, NY-ESO-1, LAGE-1a, p53, prostein, PSMA, Her2 / neu, survivin, and telomerase, prostate cancer tumor antigen-1 (PCTA-1), MAGE, ELF2M, neutrophil elastase, ephrin B2, CD22, insulin growth factor (IGF)-I, IGF-II, IGF-I receptor, and mesothelin. The tumor antigens disclosed herein are included by way of example only. This list is not intended to be exhaustive, and further examples will be readily apparent to those skilled in the art.
[0086] In one embodiment, the tumor antigen comprises one or more antigenic cancer epitopes associated with malignant tumors. Malignant tumors express several proteins that can serve as target antigens for immune attack. These molecules include, but are not limited to, tissue-specific antigens, such as MART-1, tyrosinase, and GP100 in melanoma, and prostatic acid phosphatase (PAP) and prostate-specific antigen (PSA) in prostate cancer. Other target molecules belong to the group of transformation-related molecules, such as the oncogene HER-2 / Neu / ErbB-2. Yet another group of target antigens is oncofetal antigens, such as carcinoembryonic antigen (CEA). In B-cell lymphomas, tumor-specific idiotypic immunoglobulins constitute truly tumor-specific immunoglobulin antigens unique to each individual tumor. B-cell differentiation antigens, such as CD19, CD20, CD22, and CD37, are other candidate target antigens in B-cell lymphomas. Some of these antigens (CEA, HER-2, CD19, CD20, CD22, idiotype) have been used as targets for passive immunotherapy with monoclonal antibodies with limited success.
[0087] The type of tumor antigen can also be a tumor-specific antigen (TSA) or a tumor-associated antigen (TAA). TSAs are unique to tumor cells and are not present on other cells in the body. TAAs are not unique to tumor cells, but instead are also expressed on normal cells under conditions that cannot induce a state of immunological tolerance to the antigen. The expression of an antigen on a tumor can occur under conditions that allow the immune system to respond to the antigen. A TAA can be an antigen that is expressed on normal cells during fetal development, when the immune system is immature and unable to respond, or it can be an antigen that is normally present at very low levels on normal cells but is expressed at significantly higher levels on tumor cells.
[0088] Non-limiting examples of TSAs or TAAs include differentiation antigens such as MART-1 / MelanA (MART-I), gp100 (Pmel 17), tyrosinase, TRP-1, TRP-2, and tumor-specific multilineage antigens such as MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, p15; overexpressed embryonic antigens such as CEA; overexpressed oncogenes and mutated tumor suppressor genes such as p53, Ras, HER-2 / neu; unique tumor antigens resulting from chromosomal translocations such as BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, MYL-RAR; and viral antigens such as Epstein-Barr virus antigen EBVA and human papillomavirus (HPV) antigens E6 and E7. Other large protein-based antigens include TSP-180, MAGE-4, MAGE-5, MAGE-6, RAGE, NY-ESO, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, TAG-72, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, beta-catenin, CDK4, Mum-1, p 15, p 16, 43-9F, 5T4, 791Tgp72, alpha-fetoprotein, beta-HCG, BCA225, BTAA, CA 125, CA 15-3 / CA 27.29 / BCAA, CA 195, CA These include 242, CA-50, CAM43, CD68 / P1, CO-029, FGF-5, G250, Ga733 / EpCAM, HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB / 70K, NY-CO-1, RCAS1, SDCCAG16, TA-90 / Mac-2 binding protein / cyclophilin C-related protein, TAAL6, TAG72, TLP, and TPS.
[0089] In preferred embodiments, the antigen binding domain portion of the CAR targets an antigen including, but not limited to, CD19, CD20, CD22, ROR1, mesothelin, CD33, c-Met, PSMA, glycolipid F77, EGFRvIII, GD-2, MY-ESO-1 TCR, MAGE A3 TCR, and the like.
[0090] Depending on the desired antigen to be targeted, the CAR can be engineered to contain an appropriate antigen-binding domain specific for the desired antigen target. For example, if CD19 is the desired antigen to be targeted, an antibody to CD19 can be used as the antigen-binding domain incorporated into the CAR.
[0091] In one exemplary embodiment, the antigen-binding domain portion of the CAR targets CD19. Preferably, the antigen-binding domain in the CAR is an anti-CD19 scFV, wherein the nucleic acid sequence of the anti-CD19 scFV comprises the sequence set forth in SEQ ID NO: 27. In one embodiment, the anti-CD19 scFV comprises a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 28. In another embodiment, the anti-CD19 scFV portion of the CAR comprises the amino acid sequence set forth in SEQ ID NO: 28.
[0092] In one embodiment of the present invention, a CAR is provided that is capable of binding to a non-TSA or non-TAA, including, for example, but not limited to, an antigen derived from Retroviridae (e.g., human immunodeficiency viruses, e.g., HIV-1 and HIV-LP), Picornaviridae (e.g., poliovirus, hepatitis A virus, enterovirus, human coxsackievirus, rhinovirus, and echovirus), rubella virus, coronavirus, vesicular stomatitis virus, rabies virus, Ebola virus, parainfluenza virus, mumps virus, measles virus, respiratory syncytial virus, influenza virus, hepatitis B virus, parvovirus, Adenoviridae, Herpesviridae (e.g., herpes simplex virus types 1 and 2 (HSV), varicella-zoster virus, cytomegalovirus (CMV), and herpes viruses), Poxviridae (e.g., smallpox virus, vaccinia virus, and poxvirus), or hepatitis C virus, or any combination thereof.
[0093] In another aspect of the present invention, a CAR capable of binding to an antigen derived from a bacterial strain of Staphylococci, Streptococcus, Escherichia coli, Pseudomonas, or Salmonella is provided. In particular, a CAR capable of binding to an antigen derived from an infectious bacterium, such as Helicobacter pyloris, Legionella pneumophilia, a bacterial strain of Mycobacteria sp. (e.g., M. tuberculosis, M. avium, M. intracellulare, M. kansaii, or M. gordonea), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitides, Listeria monocytogenes, Streptococcus pyogenes, Group A Streptococcus, Group B Streptococcus (Streptococcus agalactiae), Streptococcus pneumoniae, or Clostridium tetani, or a combination thereof, is provided.
[0094] 2. Transmembrane domain In the CARs used in the active patient-specific autologous anti-tumor T cell population(s) disclosed herein, the CAR comprises one or more transmembrane domains fused to the extracellular domain of the CAR.
[0095] In one embodiment, an isolated nucleic acid molecule is provided, wherein the encoded linker domain is derived from the extracellular domain of CD8 and is linked to the transmembrane domain.
[0096] In one embodiment, an isolated nucleic acid molecule is provided in which the encoded linker domain is derived from the extracellular domain of the transmembrane domain and is linked to the transmembrane domain.
[0097] In some cases, the transmembrane domain may be selected or by amino acid substitution to avoid binding of such domain to transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex.
[0098] The transmembrane domain can be derived from either natural or synthetic sources. If the source is natural, the domain can be derived from any membrane-bound or transmembrane protein. The transmembrane region particularly used in the present invention can be derived from (i.e., at least include) the alpha, beta, or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, CD271, or TNFRSF19. Alternatively, the transmembrane domain can be synthetic, in which case it predominantly contains hydrophobic residues such as leucine and valine. Preferably, a triplet of phenylalanine, tryptophan, and valine is found at each end of the synthetic transmembrane domain. Optionally, a short oligopeptide or polypeptide linker, preferably between 2 and 10 amino acids in length, can form the link between the transmembrane domain and the cytoplasmic signaling domain of the CAR. Glycine-serine duplexes provide particularly suitable linkers.
[0099] In one embodiment, the transmembrane domain in the CAR of the present invention is a CD8 transmembrane domain. In one embodiment, the CD8 transmembrane domain comprises the nucleic acid sequence of SEQ ID NO: 11. In one embodiment, the CD8 transmembrane domain comprises a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 12. In another embodiment, the CD8 transmembrane domain comprises the amino acid sequence of SEQ ID NO: 12.
[0100] In some instances, the transmembrane domain of the CAR comprises a CD8 alpha hinge domain. In one embodiment, the CD8 hinge domain comprises the nucleic acid sequence of SEQ ID NO: 13. In one embodiment, the CD8 hinge domain comprises a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 14. In another embodiment, the CD8 hinge domain comprises the amino acid sequence of SEQ ID NO: 14.
[0101] Without intending to be limited to any particular mechanism of action, possible reasons for the enhanced therapeutic function associated with exemplary CARs used in the active patient-specific autologous anti-tumor T cell population(s) disclosed herein of the present invention are believed to include, for example, but not by way of limitation, a) improved lateral movement within the plasma membrane, allowing for more efficient signaling; b) superior location within plasma membrane microdomains such as lipid rafts and a greater ability to interact with transmembrane signaling cascades associated with T cell activation; c) superior location within the plasma membrane due to preferential movement away from inhibitory or down-regulatory interactions, e.g., less proximity to or fewer interactions with phosphatases such as CD45; and d) superior assembly into the T cell receptor signaling complex (i.e., immune synapse), or any combination thereof.
[0102] In one embodiment of the active patient-specific autologous anti-tumor T cell population(s) disclosed herein, non-limiting exemplary transmembrane domains used in the CARs disclosed herein include TNFRSF16, and the TNFRSF19 transmembrane domain is described in Applicant's co-pending provisional patent application Ser. No. 62 / 239,509, entitled CHIMERIC ANTIGEN The TNFRSF transmembrane domains and / or linker or spacer domains may be used to derive TNFRSF transmembrane domains and / or linker or spacer domains, including other TNFRSF members within the tumor necrosis factor receptor superfamily, particularly those listed in Table I therein, as disclosed in US Patent Application Publication No. 20150023332, filed October 9, 2015, and assigned to Miltenyi Biotech Technology, Inc., Application No. LEN_015PRO.
[0103] 3. Spacer domain In the CARs used in the active patient-specific autologous anti-tumor T cell population(s) disclosed herein, a spacer domain can be placed between the extracellular domain and the TNFRSF transmembrane domain, or between the intracellular domain and the TNFRSF transmembrane domain. A spacer domain refers to any oligopeptide or polypeptide that functions to link the TNFRSF transmembrane domain with the extracellular domain and / or the TNFRSF transmembrane domain with the intracellular domain. A spacer domain contains up to 300 amino acids, preferably 10 to 100 amino acids, and most preferably 25 to 50 amino acids.
[0104] In some embodiments, the linker may include a spacer element, which, if present, increases the size of the linker, thereby increasing the distance between the effector molecule or detectable marker and the antibody or antigen-binding fragment. Exemplary spacers are known to those of skill in the art, including those described in U.S. Patent Nos. 7,964,566, 7,498,298, 6,884,869, 6,323,315, 6,239,104, 6,034,065, 5,780,588, 5,665,860, 5,663,149, 5,635,483, 5,599,902, 5,554,725, 5,530,097, 5,521 Nos. 5,284, 5,504,191, 5,410,024, 5,138,036, 5,076,973, 4,986,988, 4,978,744, 4,879,278, 4,816,444 and 4,486,414, as well as those listed in U.S. Patent Application Publication Nos. 20110212088 and 20110070248, each of which is incorporated herein by reference in its entirety.
[0105] The spacer domain preferably has a sequence that promotes the binding of CAR to the antigen and enhances signal transduction into the cell. Examples of amino acids that are predicted to promote binding include cysteine, charged amino acids, and serine and threonine in potential glycosylation sites, and these amino acids can be used as amino acids that constitute the spacer domain.
[0106] The spacer domain may be the entire or a portion of the hinge region of CD8 alpha (NCBI RefSeq: NP_001759.3), amino acids 118-178 (SEQ ID NO: 15), CD8 beta (GenBank: AAA35664.1), amino acids 315-396 of CD4 (NCBI RefSeq: NP_000607.1), or amino acids 137-152 of CD28 (NCBI RefSeq: NP_006130.1). Alternatively, the spacer domain may be a portion of the constant region of an antibody heavy or light chain (e.g., the CH1 region or CL region, e.g., a peptide having the amino acid sequence set forth in SEQ ID NO: 16). Furthermore, the spacer domain may be an artificially synthesized sequence.
[0107] Furthermore, in the CAR, a signal peptide sequence can be linked to the N-terminus. Signal peptide sequences are present at the N-terminus of many secretory and membrane proteins and are 15 to 30 amino acids in length. Many of the protein molecules referred to above as intracellular domains have signal peptide sequences, and these signal peptides can be used as signal peptides for CAR. In one embodiment, the signal peptide comprises the amino acid sequence set forth in SEQ ID NO:6.
[0108] 4. Intracellular domain The cytoplasmic domain or other intracellular signaling domain of a CAR is responsible for activating at least one of the normal effector functions of the immune cell in which the CAR is placed. The term "effector function" refers to a specialized function of a cell. For example, the effector function of a T cell can be cytolytic activity or helper activity, including cytokine secretion. Thus, the term "intracellular signaling domain" refers to the portion of a protein that transmits an effector function signal and instructs the cell to perform a specialized function. While the entire intracellular signaling domain can usually be used, it is often not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signaling domain is used, such a truncated portion can be used in place of the intact chain, as long as it transmits the effector function signal. Thus, the term intracellular signaling domain is meant to include any truncated portion of the intracellular signaling domain sufficient to transmit the effector function signal.
[0109] Preferred examples of intracellular signaling domains for use in CARs include the cytoplasmic sequences of the T cell receptor (TCR) and co-receptors that act in concert to initiate signal transduction following antigen receptor engagement, as well as any derivatives or variants of these sequences, and any synthetic sequences with the same functional capability.
[0110] It is known that signals generated through the TCR alone are insufficient for full activation of T cells, and that secondary or costimulatory signals are also required. Thus, T cell activation can be said to be mediated by two distinct classes of cytoplasmic signaling sequences: those that initiate antigen-dependent primary activation via the TCR (primary cytoplasmic signaling sequences) and those that act antigen-dependently to provide secondary or costimulatory signals (secondary cytoplasmic signaling sequences).
[0111] Primary cytoplasmic signaling sequences regulate the primary activation of the TCR complex in either a stimulatory or inhibitory manner. Primary cytoplasmic signaling sequences that act in a stimulatory manner may contain signaling motifs known as immunoreceptor tyrosine-based activation motifs, or ITAMs.
[0112] Examples of ITAMs containing primary cytoplasmic signaling sequences of particular use in the CARs disclosed herein include those derived from TCR zeta (CD3 zeta), FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d. Specific, non-limiting examples of ITAMs include amino acids 51-164 of CD3 zeta (NCBI RefSeq: NP_932170.1), amino acids 45-86 of Fc epsilon RI gamma (NCBI RefSeq: NP_004097.1), amino acids 201-244 of Fc epsilon RI beta (NCBI RefSeq: NP_000130.1), amino acids 139-182 of CD3 gamma (NCBI RefSeq: NP_000064.1), amino acids 128-171 of CD3 delta (NCBI RefSeq: NP_000723.1), amino acids 153-207 of CD3 epsilon (NCBI RefSeq: NP_000724.1), and CD5 (NCBI RefSeq: NP_000724.1). RefSeq:NP_055022.2) and amino acids 402–495 of 0022 (NCBI RefSeq:NP_001762). 2), amino acids 707 to 847 of CD79a (NCBI RefSeq: NP_001774.1), amino acids 166 to 226 of CD79b (NCBI RefSeq: NP_000617.1), and amino acids 182 to 229 of CD66d (NCBI Included herein are peptides having a sequence of amino acid numbers 177 to 252 of NCBI RefSeq:NP_001806.2), as well as variants thereof having the same functions as these peptides. The amino acid numbers based on the amino acid sequence information in NCBI RefSeq ID or GenBank described herein are numbered based on the full length of the precursor of each protein (including signal peptide sequences, etc.). In one embodiment, the cytoplasmic signaling molecule in the CAR comprises a cytoplasmic signaling sequence derived from CD3 zeta.
[0113] In a preferred embodiment, the intracellular domain of the CAR can be designed to include a CD3-zeta signaling domain, either alone or in combination with any other desired cytoplasmic domain(s) useful in the context of the CAR. For example, the intracellular domain of the CAR can include a CD3 zeta chain portion and a costimulatory signaling region. The costimulatory signaling region refers to a portion of the CAR that includes the intracellular domain of a costimulatory molecule. Costimulatory molecules are cell surface molecules other than antigen receptors or their ligands that are required for efficient lymphocyte response to antigens. Examples of such costimulatory molecules include CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83. Specific, non-limiting examples of such costimulatory molecules include amino acids 236-351 of CD2 (NCBI RefSeq: NP_001758.2), amino acids 421-458 of CD4 (NCBI RefSeq: NP_000607.1), amino acids 402-495 of CD5 (NCBI RefSeq: NP_055022.2), amino acids 207-235 of CD8 alpha (NCBI RefSeq: NP_001759.3), amino acids 196-210 of CD83 (GenBank: AAA35664.1), amino acids 181-220 of CD28 (NCBI RefSeq: NP_006130.1), and CD137 (4-1BB, NCBI The present disclosure primarily exemplifies 4-1BB as a costimulatory signaling element, but other costimulatory elements are within the scope of the present disclosure.
[0114] The cytoplasmic signaling sequences within the cytoplasmic signaling portion of the CAR can be linked to each other randomly or in a specific order. Optionally, a short oligopeptide or polypeptide linker, preferably between 2 and 10 amino acids in length, can form the linkage. Glycine-serine duplexes provide particularly suitable linkers.
[0115] In one embodiment, the intracellular domain is designed to comprise the signaling domain of CD3-zeta and the signaling domain of CD28. In another embodiment, the intracellular domain is designed to comprise the signaling domain of CD3-zeta and the signaling domain of 4-1BB. In yet another embodiment, the intracellular domain is designed to comprise the signaling domain of CD3-zeta and the signaling domains of CD28 and 4-1BB.
[0116] In one embodiment, the intracellular domain in the CAR is designed to comprise the signaling domain of 4-1BB and the signaling domain of CD3-zeta, wherein the signaling domain of 4-1BB comprises the nucleic acid sequence set forth in SEQ ID NO: 17, and the signaling domain of CD3-zeta comprises the nucleic acid sequence set forth in SEQ ID NO: 18. The signaling domain comprises the nucleic acid sequence set forth in SEQ ID NO:19.
[0117] In one embodiment, the intracellular domain in the CAR is designed to comprise the signaling domain of 4-1BB and the signaling domain of CD3-zeta, wherein the signaling domain of 4-1BB comprises a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 18, and the signaling domain of CD3-zeta comprises a nucleic acid sequence encoding the amino acid sequence of SEQ ID NO: 20.
[0118] In one embodiment, the intracellular domain in the CAR is designed to comprise the signaling domain of 4-1BB and the signaling domain of CD3-zeta, wherein the signaling domain of 4-1BB comprises the amino acid sequence set forth in SEQ ID NO: 18 and the signaling domain of CD3-zeta comprises the amino acid sequence set forth in SEQ ID NO: 20.
[0119] 5. Further description of CAR The functional portion of a CAR used in the active patient-specific autologous anti-tumor T cell population(s) disclosed herein is also expressly included within the scope of the present invention. The term "functional portion," when used in reference to a CAR, refers to any one or more parts or fragments of a CAR disclosed herein, which part or fragment retains the biological activity of the CAR (parent CAR) of which it is a part. A functional portion includes, for example, a part of a CAR that retains the ability to recognize target cells or detect, treat, or prevent disease to a similar degree, the same degree, or a higher degree than the parent CAR. With respect to a parent CAR, the functional portion may, for example, constitute about 10%, 25%, 30%, 50%, 68%, 80%, 90%, 95% or more of the parent CAR.
[0120] The functional portion can contain additional amino acids at the amino or carboxy terminus of the portion, or at both termini, which additional amino acids are not found in the amino acid sequence of the parent CAR. Desirably, the additional amino acids do not interfere with the biological function of the functional portion, such as, for example, recognizing target cells, detecting cancer, treating or preventing cancer, etc. More desirably, the additional amino acids enhance the biological activity of the functional portion compared to the biological activity of the parent CAR.
[0121] The functional variants of the CAR disclosed herein are included within the scope of this disclosure.The term "functional variant" as used herein refers to a CAR, polypeptide or protein that has substantial or significant sequence identity or similarity with the parent CAR, and this functional variant retains the biological activity of the CAR it is a variant of.Functional variants include, for example, variants of the CAR (parent CAR) described herein that retain the ability to recognize target cells to a similar degree, the same degree, or a higher degree than the parent CAR.With respect to the parent CAR, functional variants can be, for example, at least about 30%, 50%, 75%, 80%, 90%, 98% or more identical in amino acid sequence to the parent CAR.
[0122] A functional variant can, for example, comprise the amino acid sequence of a parent CAR with at least one conservative amino acid substitution. Alternatively, or in addition, a functional variant can comprise the amino acid sequence of a parent CAR with at least one non-conservative amino acid substitution. In this case, it is preferred that the non-conservative amino acid substitution does not interfere with or inhibit the biological activity of the functional variant. The non-conservative amino acid substitution can enhance the biological activity of the functional variant, so that the biological activity of the functional variant is increased compared to the parent CAR.
[0123] The amino acid substitutions in CAR are preferably conservative amino acid substitutions. Conservative amino acid substitutions are known in the art and include those that have certain physical and / or chemical properties. Amino acid substitutions include those in which one amino acid having the same or similar chemical or physical properties is replaced with another amino acid having the same or similar chemical or physical properties. For example, a conservative amino acid substitution can be an acidic / negatively charged polar amino acid substituting another acidic / negatively charged polar amino acid (e.g., Asp or Glu), an amino acid having a nonpolar side chain substituting another amino acid having a nonpolar side chain (e.g., Ala, Gly, Val, He, Leu, Met, Phe, Pro, Trp, Cys, Val, etc.), a basic / positively charged polar amino acid substituting another basic / positively charged polar amino acid (e.g., Lys, His, Arg, etc.), an uncharged amino acid with a polar side chain substituting another uncharged amino acid with a polar side chain (e.g., Asn, Gin, Ser, Thr, Tyr, etc.), an amino acid with a beta-branched side chain substituting another amino acid with a beta-branched side chain (e.g., He, Thr, and Val), an amino acid with an aromatic side chain substituting another amino acid with an aromatic side chain (e.g., His, Phe, Trp, and Tyr), etc.
[0124] A CAR can consist essentially of the specified amino acid sequence(s) described herein, such that other components, e.g., other amino acids, do not significantly alter the biological activity of the functional variant.
[0125] CARs (including functional portions and functional variants) can be of any length, i.e., comprise any number of amino acids, provided that the CAR (or functional portion or functional variant thereof) retains its biological activity, e.g., the ability to specifically bind to an antigen, the ability to detect diseased cells in a mammal, or the ability to treat or prevent a disease in a mammal, etc. For example, a CAR can be about 50 to about 5,000 amino acids in length, e.g., 50, 70, 75, 100, 125, 150, 175, 200, 300, 400, 500, 600, 700, 800, 900, 1,000 or more amino acids in length.
[0126] CARs (including functional portions and functional variants of the invention) can contain synthetic amino acids in place of one or more naturally occurring amino acids. Such synthetic amino acids are known in the art and include, for example, aminocyclohexanecarboxylic acid, norleucine, -amino n-decanoic acid, homoserine, S-acetylaminomethyl-cysteine, trans-3-hydroxyproline and trans-4-hydroxyproline, 4-aminophenylalanine, 4-nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, β-phenylserine, β-hydroxyphenylalanine, phenylglycine, α-naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxylic acid, 1,2,3,4-tetrahydrobenzoic ... Examples of suitable hydroxybenzoates include 2-amino-2-methyl-2-propanol, ...
[0127] CARs (including functional portions and functional variants) can be glycosylated, amidated, carboxylated, phosphorylated, esterified, N-acylated, cyclized, e.g., via disulfide bridges, or converted into acid addition salts and / or optionally dimerized or polymerized, or conjugated.
[0128] CARs (including functional portions and functional variants thereof) can be obtained by methods known in the art. CARs can be produced by any suitable method for producing polypeptides or proteins. Suitable methods for de novo synthesis of polypeptides and proteins are described in Chan et al., Fmoc Solid Phase Peptide Synthesis, Vol. 1, No. 1, pp. 111-114, 1997. s, Oxford University Press, Oxford, United Kingdom, 2000; Peptide and Protein Drug Analysis, Reid, R. (ed.), Marcel Dekker, Inc., 2000; Epitope Mapping, Westwood et al. (eds.), Oxford University Press, Oxford, United Kingdom, 2001; and U.S. Patent No. 5,449,752. Methods for generating chimeric antigen receptors, T cells containing such receptors, and their uses (e.g., for the treatment of cancer) are known in the art and are further described herein (e.g., Brentjens et al., 2010, Molecular Therapy, Vol. 18:4, pp. 666-668; Morgan et al., 2010, Molecular Therapy, published online February 23, 2010, pp. 1-9; Till et al., 2008, Blood, Vol. 112:2261-2271; Park et al., Trends Biotechnol., Vol. 29:550-557, 2011; Grupp et al., N Engl J Med., Vol. 368:1509-1518, 2013; Han et al., J. Hematol., 2013, pp. 1-9, each of which is incorporated herein by reference in its entirety). Oncol., 6:47, 2013; Tumaini et al., Cytotherapy, 15, 1406-1417, 2013; Haso et al. (2013) Blood, 121, 1165-1174; WO2012 / 079000, WO2013 / 126726; and U.S. Patent Application Publication No. 2012 / 0213783. For example, nucleic acid molecules encoding the disclosed chimeric antigen binding receptors can be included in an expression vector (e.g., a lentiviral vector) used to transduce host cells, such as T cells, to produce the disclosed CARs. In some embodiments, a method of using a chimeric antigen receptor includes isolating T cells from a subject, transducing the T cells with an expression vector (e.g., a lentiviral vector) encoding the chimeric antigen receptor, and administering the CAR-expressing T cells to the subject for treatment in the subject, e.g., treatment of a tumor.
[0129] B. Antibodies and Antigen-Binding Fragments One embodiment further provides a CAR, a T cell expressing a CAR, an antibody that specifically binds to one or more of the antigens disclosed herein, or an antigen-binding domain or portion thereof, for use in the active patient-specific autologous anti-tumor T cell population(s) disclosed herein. As used herein, "T cell expressing a CAR" or "CAR T cell" means a T cell that expresses a CAR, e.g., has antigen specificity determined by the antibody-derived targeting domain of the CAR.
[0130] As used herein, an "antigen-binding domain" can include antibodies and antigen-binding fragments thereof. The term "antibody" is used herein in the broadest sense and encompasses various antibody structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antigen-binding fragments thereof, so long as they exhibit the desired antigen-binding activity. Non-limiting examples of antibodies include, for example, intact immunoglobulins known in the art, as well as variants and fragments thereof that retain binding affinity to antigens.
[0131] A "monoclonal antibody" is an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic epitope. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies and should not be construed as requiring production of the antibody by any particular method. In some instances, a monoclonal antibody is an antibody produced by a single clone of B lymphocytes, or by cells transfected with nucleic acids encoding the antibody light and heavy chain variable regions of a single antibody (or antigen-binding fragment thereof), or by a single clone of B lymphocytes ... The monoclonal antibody is an antibody produced by the descendants of a subject. In some examples, the monoclonal antibody is isolated from a subject. The monoclonal antibody may have conservative amino acid substitutions that do not substantially affect antigen binding or other immunoglobulin functions. Exemplary methods for producing monoclonal antibodies are known, see, for example, Harlow & Lane, Antibodies, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Publications, New York (2013).
[0132] Typically, immunoglobulins have heavy (H) chains and light (L) chains interconnected by disulfide bonds. Immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region genes, as well as numerous immunoglobulin variable domain genes. There are two types of light chains, lambda (λ) and kappa (κ). There are five major heavy chain classes (or isotypes): IgM, IgD, IgG, IgA, and IgE, which determine the functional activity of antibody molecules.
[0133] Each heavy and light chain contains a constant region (or constant domain) and a variable region (or variable domain; see, e.g., Kindt et al., Kuby Immunology, 6th ed., W.H. Freeman and Co., p. 91 (2007)). In some embodiments, the variable regions of the heavy and light chains combine to specifically bind to an antigen. In further embodiments, only the heavy chain variable region is required. For example, naturally occurring camelid antibodies consisting only of heavy chains are functional and stable in the absence of light chains. (See, e.g., Hamers-Casterman et al., Nature, 363:446-448, 1993; Sheriff et al., Nat. Struct. Biol., 3:733-736, 1996). References to "VH" or "VH" refer to the variable region of an antibody heavy chain, including those of antigen-binding fragments such as Fv, scFv, dsFv, or Fab. References to "VL" or "VL" refer to the variable domain of an antibody light chain, including those of Fv, scFv, dsFv, or Fab.
[0134] The variable regions of the light and heavy chains contain a "framework" region interrupted by three hypervariable regions, also called "complementarity-determining regions" or "CDRs" (see, e.g., Kabat et al., Sequences of Proteins of Immunological Interest, USDapartment of Health and Human Services, 1991). The sequences of the framework regions of different light or heavy chains are relatively conserved within a species. The framework region of an antibody, which is the combined framework regions of the constituent light and heavy chains, functions to position and align the CDRs in three-dimensional space.
[0135] CDRs are primarily responsible for binding to an epitope of an antigen. The amino acid sequence boundaries of a given CDR can be determined by the methods described by Kabat et al. ("Sequences of Proteins of Immunological Interest", 5th ed. Public Health Service, National Institutes of Health, Bethesda, MD, 1991; "Kabat" numbering scheme), Al-Lazikani et al. (JMB 273, 927-948, 1997; "Chothia" numbering scheme), and Lefranc et al. ("IMGT unique numbering scheme"). The CDRs of each chain are typically referred to as CDR1, CDR2, and CDR3 (N- to C-terminus), and are also typically identified by the chain in which the particular CDR is located. Thus, the VH CDR3 is the CDR of the VH gene. The VL CDR1 is the CDR3 from the variable domain of the heavy chain of the antibody in which it is found, while the VL CDR1 is the CDR1 from the variable domain of the light chain of the antibody in which it is found. The light chain CDRs are sometimes referred to as LCDR1, LCDR2, and LCDR3. The heavy chain CDRs are sometimes referred to as LCDR1, LCDR2, and LCDR3.
[0136] "Antigen-binding fragments" are portions of full-length antibodies that retain the ability to specifically recognize their cognate antigen, as well as various combinations of such portions. Non-limiting examples of antigen-binding fragments include Fv, Fab, Fab', Fab'-SH, F(ab')2; diabodies; linear antibodies; single-chain antibody molecules (e.g., scFv); and multispecific antibodies formed from antibody fragments. Antibody fragments include antigen-binding fragments produced by modification of whole antibodies or those synthesized de novo using recombinant DNA methodologies (see, e.g., Kontermann and Dubel (eds.), Antibody Engineering, Vols. 1-2, 2nd Edition, Springer Press, 2010).
[0137] Single-chain antibodies (scFv) are genetically engineered molecules containing the VH and VL domains of one or more antibodies (or antibodies) linked by a suitable polypeptide linker as a genetically fused single-chain molecule (see, e.g., Bird et al., Science, 242:423-426, 1988; Huston et al., Proc. Natl. Acad. Sci., 85:5879-5883, 1988; Ahmad et al., Clin. Dev. Immunol., 2012, doi:10.1155 / 2012 / 980250; Marbry, IDrugs, 13:543-549, 2010). The intramolecular orientation of the VH and VL domains in scFvs is typically not critical for scFvs. Thus, scFvs with both possible configurations (VH domain-linker domain-VL domain; VL domain-linker domain-VH domain) can be used.
[0138] In dsFv, the heavy and light variable chains are mutated to introduce disulfide bonds to stabilize the association of the chains. Also included are bispecific antibodies, which are bivalent, bispecific antibodies in which the VH and VL domains are expressed on a single polypeptide chain but use a linker that is too short to allow pairing between the two domains on the same chain, thereby pairing the domains with complementary domains on another chain and creating two antigen-binding sites (see, e.g., Holliger et al., Proc. Natl. Acad. Sci., 90:6444-6448, 1993; Poljak et al., Structure, 2:1121-1123, 1994).
[0139] Antibodies also include genetically engineered forms such as chimeric antibodies (e.g., humanized murine antibodies) and heteroconjugate antibodies (e.g., bispecific antibodies). See also Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, IL); Kuby, J., Immunology, 3rd ed., W.H. Freeman & Co., New York, 1997.
[0140] Non-naturally occurring antibodies can be constructed using solid-phase peptide synthesis, can be produced recombinantly, or can be obtained by screening combinatorial libraries consisting of variable heavy and variable light chains, as described, for example, in Huse et al., Science 246:1275-1281 (1989), which is incorporated herein by reference. These and other methods of generating, for example, chimeric, humanized, CDR-grafted, single-chain, and bifunctional antibodies are well known to those of skill in the art (Winter and Harris, Immunol. Today 14:243-246 (1993); Ward et al., Nature 14:243-246 (1993)). 341:544-546 (1989); Harlow and Lane, supra, 1988; Hilyard et al., Protein Engineering: A practical approach (IRL Press 1992); Borrabeck, Antibody Engineering, 2nd Edition (Oxford University Press 1995); each of which is incorporated herein by reference.
[0141] An "antibody that binds to the same epitope" as a reference antibody refers to an antibody that blocks the binding of the reference antibody to its antigen by 50% or more in a competition assay; conversely, the reference antibody blocks the binding of the antibody to its antigen by 50% or more in a competition assay. Antibody competition assays are known, and exemplary competition assays are provided herein.
[0142] A "humanized" antibody or antigen-binding fragment comprises a human framework region and one or more CDRs derived from a non-human (e.g., mouse, rat, or synthetic) antibody or antigen-binding fragment. The non-human antibody or antigen-binding fragment providing the CDRs is referred to as the "donor," and the human antibody or antigen-binding fragment providing the framework is referred to as the "acceptor." In one embodiment, all CDRs are derived from the donor immunoglobulin in the humanized immunoglobulin. Constant regions need not be present, but if present, can be substantially identical to human immunoglobulin constant regions, e.g., at least about 85-90%, e.g., about 95% or more identical. Thus, all parts of a humanized antibody or antigen-binding fragment, except possibly the CDRs, are substantially identical to the corresponding parts of a natural human antibody sequence.
[0143] A "chimeric antibody" is an antibody that contains sequences from two different antibodies, typically from different species. In some instances, a chimeric antibody contains one or more CDRs and / or framework regions from one human antibody and CDRs and / or framework regions from another human antibody.
[0144] A "fully human antibody" or "human antibody" is an antibody that contains sequences derived from the human genome but does not contain sequences derived from another species. In some embodiments, a human antibody contains CDRs, framework regions, and (if present) an Fc region derived from the human genome. Human antibodies can be identified and isolated using technology to create sequences based on sequences derived from the human genome, for example, by phage display, or using transgenic animals (see, e.g., Barbas et al., Phage Display: A Laboratory Manuel. 1st Edition, New York: Cold Spring Harbor Laboratory Press, 2004. Print.; Lonberg, Nat. Biotech., 23:1117-1125, 2005; Lonenberg, Curr. Opin. Immunol., 20:450-459, 2008).
[0145] An antibody can have one or more binding sites. If more than one binding site is present, these binding sites may be identical to one another or different. For example, naturally occurring immunoglobulins have two identical binding sites, single-chain antibodies or Fab fragments have one binding site, while bispecific or bifunctional antibodies have two different binding sites.
[0146] Methods for testing antibodies for the ability to bind to any functional portion of a CAR are known in the art and include any antibody-antigen binding assay, such as radioimmunoassay (RIA), ELISA, Western blot, immunoprecipitation, and competitive inhibition assays. (See, for example, Janeway et al., hereinafter US Patent Application Publication No. 2002 / 0197266 A1, and US Patent No. 7,338,929).
[0147] The CAR, CAR-expressing T cell, antibody, or antigen-binding portion thereof, can also comprise a detectable label, such as a radioisotope, a fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), an enzyme (e.g., alkaline phosphatase, horseradish peroxidase), and an elemental particle (e.g., a gold particle).
[0148] C. Conjugate The CARs, CAR-expressing T cells, or monoclonal antibodies or antigen-binding fragments thereof specific for one or more of the antigens disclosed herein used in the active patient-specific autologous anti-tumor T cell population(s) disclosed herein can be conjugated to agents such as effector molecules or detectable markers using any number of means known to those skilled in the art. Both covalent and non-covalent means can be used. Conjugates include, but are not limited to, molecules in which an effector molecule or detectable marker is covalently linked to an antibody or antigen-binding fragment that specifically binds to one or more of the antigens disclosed herein. Those skilled in the art will recognize that conjugation of an effector molecule or detectable marker to an antibody or antigen-binding fragment that specifically binds to one or more of the antigens disclosed herein can be accomplished by a number of means known to those skilled in the art. 125 I, 32 P, 14 C. 3 H and 35 It will be understood that a variety of effector molecules and detectable markers may be used, including, but not limited to, S, as well as other labels, targeting moieties, ligands, and the like.
[0149] The choice of a particular effector molecule or detectable marker will depend on the particular target molecule or cell and the desired biological effect. Thus, for example, the effector molecule can be a cytotoxin used to bring about the death of a particular target cell (e.g., a tumor cell).
[0150] The procedure for attaching an effector molecule or detectable marker to an antibody or antigen-binding fragment varies depending on the chemical structure of the effector. Polypeptides typically contain various functional groups, such as carboxylic acid (COOH), free amine (-NH), or sulfhydryl (-SH) groups, which are available for reaction with appropriate functional groups on an antibody to result in attachment of an effector molecule or detectable marker. Alternatively, the antibody or antigen-binding fragment can be derivatized to expose or attach additional reactive functional groups. Derivatization can include attachment of any of several known linker molecules, such as those available from Pierce Chemical Company, Rockford, IL. The linker can be any molecule used to attach an antibody or antigen-binding fragment to an effector molecule or detectable marker. The linker can form covalent bonds to both the antibody or antigen-binding fragment and the effector molecule or detectable marker. Suitable linkers are well known to those skilled in the art and include, but are not limited to, straight-chain or branched-chain carbon linkers, heterocyclic carbon linkers, or peptide linkers. When the antibody or antigen-binding fragment and the effector molecule or detectable marker are polypeptides, the linkers can be attached to the constituent amino acids through their side groups (e.g., via a disulfide linkage to cysteine) or to the amino and carboxyl groups of the alpha carbon of the terminal amino acid.
[0151] In some embodiments, the linker may include a spacer element, which, if present, increases the size of the linker, thereby increasing the distance between the effector molecule or detectable marker and the antibody or antigen-binding fragment. Exemplary spacers are known to those of skill in the art and include those described in U.S. Pat. No. 7,964,566, U.S. Pat. No. 7,964,566, U.S. Pat. ,498,298, U.S. Patent No. 6,884,869, U.S. Patent No. 6,323,315, U.S. Patent No. 6,239,104, U.S. Patent No. 6,034,065, U.S. Patent No. 5,780,588, U.S. Patent No. 5,665,860, U.S. Patent No. 5,663,149, U.S. Patent No. 5,635,483, U.S. Patent No. 5,599,902, U.S. Patent No. 5,554,725, U.S. Patent No. 5,530,097, U.S. Patent No. 5,521,284, U.S. Patent No. 5,504,191, U.S. No. 5,410,024, U.S. Patent No. 5,138,036, U.S. Patent No. 5,076,973, U.S. Patent No. 4,986,988, U.S. Patent No. 4,978,744, U.S. Patent No. 4,879,278, U.S. Patent No. 4,816,444 and U.S. Patent No. 4,486,414, as well as those listed in U.S. Patent Application Publication No. 20110212088 and U.S. Patent Application Publication No. 20110070248, each of which is incorporated herein by reference in its entirety.
[0152] In some embodiments, the linker is cleavable under intracellular conditions, such that cleavage of the linker releases the effector molecule or detectable marker from the antibody or antigen-binding fragment in the intracellular environment. In yet other embodiments, the linker is non-cleavable, and the effector molecule or detectable marker is released, for example, by antibody degradation. In some embodiments, the linker is cleavable by a cleaving agent present in the intracellular environment (e.g., within a lysosome, endosome, or caveolae). The linker can be, for example, a peptide linker that is cleaved by an intracellular peptidase or protease enzyme, including, but not limited to, a lysosomal or endosomal protease. In some embodiments, the peptide linker is at least two amino acids long or at least three amino acids long. However, the linker can also be 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acids long, e.g., 1-2, 1-3, 2-5, 3-10, 3-15, 1-5, 1-10, or 1-15 amino acids long. Proteases can include cathepsins B and D and plasmin, all of which are known to hydrolyze dipeptide drug derivatives, resulting in the release of active drugs inside target cells (see, e.g., Dubowchik and Walker, 1999, Pharm. Therapeutics 83:67-123). For example, a peptide linker cleavable by the thiol-dependent protease cathepsin B can be used (e.g., a phenylalanine-leucine or glycine-phenylalanine-leucine-glycine linker). Other examples of such linkers are described, for example, in U.S. Pat. No. 6,214,345, which is incorporated herein by reference. In a specific embodiment, the peptide linker cleavable by intracellular proteases is a valine-citrulline linker or a phenylalanine-lysine linker (see, e.g., U.S. Pat. No. 6,214,345, which describes the synthesis of doxorubicin using a valine-citrulline linker).
[0153] In other embodiments, the cleavable linker is pH-sensitive, i.e., sensitive to hydrolysis at a certain pH value. Typically, pH-sensitive linkers are hydrolyzable under acidic conditions. For example, acid-labile linkers (e.g., hydrazones, semicarbazones, thiosemicarbazones, cis-aconitic amides, orthoesters, acetals, ketals, etc.) that are hydrolyzable in lysosomes can be used (see, for example, U.S. Patent No. 5,122,368; U.S. Patent No. 5,824,805; U.S. Patent No. 5,622,929; Dubowchik and Walker, 1999, Pharm. Therapeutics 83:67-123; Neville et al., 1989, Biol. Chem. 264:14653-14661). Such linkers are relatively stable under neutral pH conditions, such as in blood, but are unstable at pHs below 5.5 or 5.0, which is approximately the pH of the lysosome. In certain embodiments, the hydrolyzable linker is a thioether linker (e.g., a thioether attached to a therapeutic agent via an acylhydrazone bond) (see, e.g., U.S. Patent No. 5,629,297). (See No. 622,929).
[0154] In other embodiments, the linker is cleavable under reducing conditions (eg, a disulfide linker). A variety of disulfide linkers are known in the art, including, for example, those that can be formed using SATA (N-succinimidyl-S-acetylthioacetate), SPDP (N-succinimidyl-3-(2-pyridyldithio)propionate), SPDB (N-succinimidyl-3-(2-pyridyldithio)butyrate), and SMPT (N-succinimidyl-oxycarbonyl-alpha-methyl-alpha-(2-pyridyl-dithio)toluene)-, SPDB, and SMPT (see, e.g., Thorpe et al., 1987, Cancer Res. 47:5924-5931; Wawrzynczak et al., Immunoconjugates: Antibody Conjugates in Radioimagery and Therapy of Cancer (C.W. Vogel, ed., Oxford University Press, 1987); Phillips et al., Cancer Res. 68:9280-9290, 2008. See also U.S. Patent No. 4,880,935.
[0155] In yet other specific embodiments, the linker is a malonate linker (Johnson et al., 1995, Anticancer Res. 15:1387-93), a maleimidobenzoyl linker (Lau et al., 1995, Bioorg-Med-Chem. 3(10):1299-1304), or a 3'-N-amide analog (Lau et al., 1995, Bioorg-Med-Chem. 3(10):1305-12).
[0156] In still other embodiments, the linker is non-cleavable and the effector molecule or detectable marker is released by antibody degradation (see U.S. Patent Application Publication No. 2005 / 0238649, the entire contents of which are incorporated herein by reference).
[0157] In some embodiments, the linker is resistant to cleavage in an extracellular environment. For example, when the conjugate is present in an extracellular environment (e.g., in plasma), about 20% or less, about 15% or less, about 10% or less, about 5% or less, about 3% or less, or about 1% or less of the linkers in a sample of the conjugate are cleaved. Whether a linker is resistant to cleavage in an extracellular environment can be determined, for example, by incubating a conjugate containing the desired linker with plasma for a predetermined period of time (e.g., 2, 4, 8, 16, or 24 hours), and then quantifying the amount of free effector molecule or detectable marker present in the plasma. Various exemplary linkers that can be used in the conjugates are described in WO2004 / 010957, U.S. Patent Application Publication No. 2006 / 0074008, U.S. Patent Application Publication No. 2005 / 0238649, and U.S. Patent Application Publication No. 2006 / 0024317, each of which is incorporated herein by reference in its entirety.
[0158] In some embodiments, conjugates of a CAR, a T cell expressing a CAR, an antibody or antigen-binding portion thereof, and one or more small molecule toxins, such as calicheamicin, maytansinoids, dolastatins, auristatins, trichothecines, and CC1065, and derivatives of these toxins that have toxin activity, are provided.
[0159] Maytansine compounds suitable for use as maytansinoid toxin moieties are well known in the art and can be isolated from natural sources according to known methods, extracted from genetic engineering techniques (see Yu et al. (2002) PNAS 99:7968-7973), or synthetically prepared maytansinol (maytansinol) according to known methods. Maytansinol and maytansinol analogs can be used to produce maytansinoids. Maytansinoids are mitotic inhibitors that act by inhibiting tubulin polymerization. Maytansine was first isolated from the East African shrub Maytenus serrata (U.S. Pat. No. 3,896,111). Subsequently, it was discovered that certain microorganisms also produce maytansinoids, such as maytansinol and C-3 maytansinol esters (U.S. Pat. No. 4,151,042). Synthetic maytansinol and its derivatives and analogs are described, for example, in U.S. Pat. Nos. 4,137,230; 4,248,870; 4,256,746; 4,260,608; 4,265,814; 4,294,757; 4,307,016; 4,308,268; 4,308,269; 4,309,428; and 4,311,140. Nos. 3,946; 4,315,929; 4,317,821; 4,322,348; 4,331,598; 4,361,650; 4,364,866; 4,424,219; 4,450,254; 4,362,663; and 4,371,533, each of which is incorporated herein by reference. Maytansinoid-containing conjugates, methods for making same, and their therapeutic uses are disclosed, for example, in U.S. Patent Nos. 5,208,020; 5,416,064; 6,441,163 and European Patent EP 0 425 235 B1, the disclosures of which are expressly incorporated herein by reference.
[0160] Additional toxins can be used with CARs, CAR-expressing T cells, antibodies, or antigen-binding portions thereof. Exemplary toxins include Pseudomonas exotoxin (PE), ricinus toxin, abrin, diphtheria toxin and its subunits, ribotoxin, ribonuclease, saporin and calicheamicin, and botulinum toxins A-F. These toxins are well known in the art, and many are readily available from commercial sources (e.g., Sigma Chemical Company, St. Louis, MO). Contemplated toxins also include variants of these toxins (see, e.g., U.S. Patent Nos. 5,079,163 and 4,689,401).
[0161] Saporin is a toxin derived from Saponaria officinalis that disrupts protein synthesis by inactivating the 60S portion of the ribosomal complex (Stirpe et al., Bio / Technology, 10:405-412, 1992). However, this toxin lacks a mechanism for specific entry into cells and therefore requires conjugation to an antibody or antigen-binding fragment that recognizes an internalized cell surface protein in order to be efficiently taken up by cells.
[0162] Diphtheria toxin is isolated from Corynebacterium diphtheriae. Typically, diphtheria toxin for use in immunotoxins is mutated to reduce or eliminate nonspecific toxicity. A mutant known as CRM107, which has full enzymatic activity but significantly reduced nonspecific toxicity, has been known since the 1970s (Laird and Groman, J. Virol. 19:220, 1976) and has been used in human clinical trials. See U.S. Patent Nos. 5,792,458 and 5,208,021.
[0163] Castor toxin is the lectin RCA60 from Ricinus communis (castor bean). For examples of castor toxins, see U.S. Patent Nos. 5,079,163 and 4,689,401. Ricinus communis agglutinin (RCA) is a lectin derived from the plant Ricinus communis (castor bean), according to its molecular weight of approximately 65 kD and 120 kD, respectively. 60 Oh and RCA 120 The toxin exists in two forms, termed the A chain and the B chain (Nicholson and Blaustein, J. Biochim. Biophys. Acta 266:543, 1972). The A chain is responsible for inactivating protein synthesis and killing the cell. The B chain binds the toxin to cell surface galactose residues and facilitates transport of the A chain into the cytosol (Olsnes et al., Nature 249:627-631, 1974 and U.S. Pat. No. 3,060,165).
[0164] Ribonucleases have also been conjugated to targeting molecules for use as immunotoxins (see Suzuki et al., Nat. Biotech. 17:265-70, 1999). Exemplary ribotoxins, such as α-sarcin and restrictocin, are discussed, for example, in Rathore et al., Gene 190:31-5, 1997; and Goyal and Batra, Biochem. 345, Part 2:247-54, 2000. Calicheamicin, originally isolated from Micromonospora echinospora, is a member of the enediyne antitumor antibiotic family, generating double-strand breaks in DNA that lead to apoptosis (see, for example, Lee et al., J. Antibiot. 42:1070-87, 1989). This drug is the toxic moiety of an immunotoxin in clinical trials (see, eg, Gillespie et al., Ann. Oncol. 11:735-41, 2000).
[0165] Abrin includes toxic lectins from Abrus precatorius. The toxicants, abrins a, b, c, and d, have molecular weights of approximately 63 kD and 67 kD and are composed of two disulfide-linked polypeptide chains, A and B. The A chain inhibits protein synthesis; the B chain (abrin-b) binds to D-galactose residues (see Funatsu et al., Agr. Biol. Chem. 52:1095, 1988; and Olsnes, Methods Enzymol. 50:330-335, 1978).
[0166] The CARs, CAR-expressing T cells, monoclonal antibodies specific for one or more of the antigens disclosed herein, and antigen-binding fragments thereof used in the activated patient-specific autologous anti-tumor T cell population(s) can also be conjugated to a detectable marker; for example, a detectable marker detectable by ELISA, spectrophotometry, flow cytometry, microscopy, or imaging techniques (e.g., computed tomography (CT), computed axial tomography (CAT) scan, magnetic resonance imaging (MRI), nuclear magnetic resonance imaging (NMRI), magnetic resonance tomography (MTR), ultrasound, fiber optic testing, and laparoscopic testing). Specific, non-limiting examples of detectable markers include fluorophores, chemiluminescent agents, enzymatic linkages, radioactive isotopes, and heavy metals or compounds (e.g., superparamagnetic iron oxide nanocrystals for detection by MRI). For example, useful detectable markers include fluorescent compounds, including fluorescein, fluorescein isothiocyanate, rhodamine, 5-dimethylamine-1-napthalenesulfonyl chloride, phycoerythrin, lanthanide phosphors, and the like. Bioluminescent markers, such as luciferase, green fluorescent protein (GFP), and yellow fluorescent protein (YFP), are also used. CARs, CAR-expressing T cells, antibodies, or antigen-binding portions thereof, can also be conjugated to enzymes useful for detection, such as horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase, glucose oxidase, and the like. When a CAR, CAR-expressing T cells, antibodies, or antigen-binding portions thereof, is conjugated to a detectable enzyme, it can be detected by adding an additional reagent that the enzyme uses to produce a discernible reaction product. For example, when the agent horseradish peroxidase is present, the addition of hydrogen peroxide and diaminobenzidine can visually detect the presence of the enzyme. This results in a detectable colored reaction product. CARs, CAR-expressing T cells, antibodies, or antigen-binding portions thereof, can also be conjugated with biotin and detected via indirect measurement of avidin or streptavidin binding. It should be noted that avidin itself can be conjugated with an enzyme or fluorescent label.
[0167] CAR, CAR-expressing T cells, antibodies, or their antigen-binding portions can be conjugated with paramagnetic agents such as gadolinium. Paramagnetic agents such as superparamagnetic iron oxide can also be used as labels. Antibodies can also be conjugated with lanthanides (e.g., europium and dysprosium) and manganese. Antibodies or antigen-binding fragments can also be labeled with a predetermined polypeptide epitope recognized by a secondary reporter (e.g., leucine zipper pair sequence, binding site for secondary antibody, metal binding domain, epitope tag).
[0168] CAR, CAR-expressing T cells, antibodies, or antigen-binding portions thereof can also be conjugated with radiolabeled amino acids.Radiolabels can be used for both diagnostic and therapeutic purposes.For example, radiolabels can be used to detect one or more of the antigens and antigen-expressing cells disclosed herein by x-ray, emission spectroscopy, or other diagnostic techniques.In addition, radiolabels can be used therapeutically as toxins for treating tumors in subjects, for example, for treating neuroblastoma.Examples of labels for polypeptides include, but are not limited to, the following radioisotopes or radionucleotides: 3 H, 14 C. 15 N, 35 S, 90 Y, 99 Tc, 111 In, 125 I, 131 I.
[0169] Means for detecting such detectable markers are well known to those skilled in the art. Thus, for example, radiolabels can be detected using photographic film or scintillation counters, fluorescent markers can be detected using a photodetector to detect emitted illumination, enzymatic labels are typically detected by providing the enzyme with a substrate and detecting the reaction product produced by the action of the enzyme on the substrate, and chromogenic labels are detected by simply visualizing the colored label.
[0170] D. Nucleotides, Expression, Vectors and Host Cells Further provided by one embodiment of the present invention is a nucleic acid comprising a nucleotide sequence encoding any of the CARs, antibodies, or antigen-binding portions thereof described herein (including functional portions and functional variants thereof). The nucleic acids of the present invention may comprise a nucleotide sequence encoding any of the leader sequences, antigen-binding domains, transmembrane domains, and / or intracellular T cell signaling domains described herein.
[0171] In one embodiment, an isolated nucleic acid molecule is provided that encodes a chimeric antigen receptor (CAR), comprising, from N-terminus to C-terminus, at least one extracellular antigen-binding domain, at least one transmembrane domain, and at least one intracellular signaling domain.
[0172] In one embodiment of a CAR used in the activated patient-specific autologous anti-tumor T cell population(s), an isolated nucleic acid molecule encoding a CAR is provided, wherein the encoded extracellular antigen-binding domain comprises at least one single-chain variable fragment of an antibody that binds to an antigen.
[0173] In another embodiment of a CAR for use in the activated patient-specific autologous anti-tumor T cell population(s), an isolated nucleic acid molecule encoding a CAR is provided, wherein the encoded extracellular antigen-binding domain comprises at least one heavy chain variable region of an antibody that binds to an antigen.
[0174] In yet another embodiment of a CAR for use in an activated patient-specific autologous anti-tumor T cell population(s), an isolated nucleic acid molecule encoding a CAR is provided, wherein the encoded CAR extracellular antigen-binding domain comprises at least one lipocalin-based antigen-binding domain (anticalin) that binds to the antigen.
[0175] In one embodiment of a CAR for use in an activated patient-specific autologous anti-tumor T cell population(s), an isolated nucleic acid molecule is provided in which the encoded extracellular antigen-binding domain is connected to the transmembrane domain by a linker domain.
[0176] In another embodiment of a CAR for use in the activated patient-specific autologous anti-tumor T cell population(s), an isolated nucleic acid molecule encoding a CAR is provided, wherein the encoded extracellular antigen-binding domain is preceded by a sequence encoding a leader or signal peptide.
[0177] In yet another embodiment of a CAR for use in an activated patient-specific autologous anti-tumor T cell population(s), an isolated nucleic acid molecule encoding a CAR is provided, wherein the encoded extracellular antigen-binding domain targets an antigen including, but not limited to, CD19, CD20, CD22, ROR1, mesothelin, CD33 / IL3Ra, CD38, CD123 (IL3RA), CD138, BCMA (CD269), GPC2, GPC3, FGFR4, c-Met, PSMA, glycolipid F77, EGFRvIII, GD-2, NY-ESO-1 TCR, MAGE A3 TCR, or any combination thereof.
[0178] In certain embodiments of CARs used in the activated patient-specific autologous anti-tumor T cell population(s), the encoded extracellular antigen-binding domain is an anti-CD19 scFV antigen-binding domain, an anti-CD20 scFV antigen-binding domain, an anti-CD22 scFV antigen-binding domain, an anti-ROR1 scFV antigen-binding domain, an anti-TSLPR scFV antigen-binding domain, an anti-mesothelin scFV antigen-binding domain, an anti-CD33 / IL3Ra ... scFV antigen-binding domain, anti-CD38 scFV antigen-binding domain, anti-CD123 (IL3RA) scFV antigen-binding domain, anti-CD138 scFV antigen-binding domain, anti-BCMA (CD269) scFV antigen-binding domain, anti-GPC2 scFV antigen-binding domain, anti-GPC3 scFV antigen-binding domain, anti-FGFR4 scFV antigen-binding domain, anti-c-Met scFV antigen-binding domain, anti-PMSA scFV antigen-binding domain, anti-glycolipid F77 scFV antigen-binding domain, anti-EGFRvIII scFV antigen-binding domain, anti-GD-2 scFV antigen-binding domain, anti-NY-ESo-1 TCR scFV antigen-binding domain, anti-MAGE A3 TCR Provided is an isolated nucleic acid molecule encoding a CAR comprising an scFV antigen-binding domain, or an amino acid sequence thereof having 85%, 90%, 95%, 96%, 97%, 98% or 99% identity, or any combination thereof.
[0179] In one embodiment of a CAR used in an activated patient-specific autologous anti-tumor T cell population(s), the CAR provided herein further comprises a linker domain.
[0180] In one embodiment of a CAR used in the activated patient-specific autologous anti-tumor T cell population(s), an isolated nucleic acid molecule encoding a CAR is provided, in which an extracellular antigen-binding domain, an intracellular signaling domain, or both, is connected to a transmembrane domain by a linker domain.
[0181] In one embodiment of a CAR used in an activated patient-specific autologous anti-tumor T cell population(s), an isolated nucleic acid molecule encoding a CAR is provided, wherein the encoded linker domain is derived from the extracellular domain of CD8 and is linked to a transmembrane domain.
[0182] In yet another embodiment of a CAR for use in the active patient-specific autologous anti-tumor T cell population(s), an isolated nucleic acid molecule encoding a CAR is provided, wherein the nucleic acid sequence encoding the transmembrane domain comprises a nucleotide sequence having 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.
[0183] In one embodiment of a CAR used in the active patient-specific autologous anti-tumor T cell population(s), an isolated nucleic acid molecule encoding a CAR is provided, wherein the encoded transmembrane domain comprises an amino acid sequence containing at least one but no more than 10 alterations, or a sequence having 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.
[0184] In another embodiment of a CAR for use in the activated patient-specific autologous anti-tumor T cell population(s), an isolated nucleic acid molecule encoding a CAR is provided, wherein the encoded CAR further comprises a transmembrane domain comprising a transmembrane domain of a protein selected from the group consisting of the alpha, beta, or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, and CD154, or a combination thereof.
[0185] In yet another embodiment of a CAR for use in the activated patient-specific autologous anti-tumor T cell population(s), an isolated nucleic acid molecule encoding a CAR is provided, wherein the encoded intracellular signaling domain further comprises a CD3 zeta intracellular domain.
[0186] In one embodiment of a CAR disclosed herein, an isolated nucleic acid molecule encoding a CAR is provided, wherein the encoded intracellular signaling domain is positioned C-terminal to the CD3 zeta intracellular domain.
[0187] In another embodiment of a CAR for use in an activated patient-specific autologous anti-tumor T cell population(s), an isolated nucleic acid molecule encoding a CAR is provided, wherein the encoded at least one intracellular signaling domain comprises a costimulatory domain, a primary signaling domain, or a combination thereof.
[0188] In a further embodiment of a CAR for use in the activated patient-specific autologous anti-tumor T cell population(s), an isolated nucleic acid molecule encoding a CAR is provided, wherein the encoded at least one costimulatory domain comprises a functional signaling domain of OX40, CD70, CD27, CD28, CD5, ICAM-1, LFA-1 (CD11a / CD18), ICOS (CD278), DAP10, DAP12, and 4-1BB (CD137), or a combination thereof.
[0189] In one embodiment of a CAR used in the active patient-specific autologous anti-tumor T cell population(s), an isolated nucleic acid molecule encoding the CAR is provided that further contains a leader or signal peptide sequence.
[0190] In some embodiments, nucleotide sequence can be codon modified.Without being bound by any particular theory, it is believed that codon optimization of nucleotide sequence can increase the translation efficiency of mRNA transcript.The codon optimization of nucleotide sequence can include replacing native codon with another codon that encodes the same amino acid but can be translated by tRNA that is more readily available in cells, thus increasing translation efficiency.The optimization of nucleotide sequence can also reduce the secondary mRNA structure that interferes with translation, thus increasing translation efficiency.
[0191] In embodiments of the invention, a nucleic acid can comprise a codon-modified nucleotide sequence encoding the antigen-binding domain of a CAR of the invention. In another embodiment of the invention, a nucleic acid can comprise a codon-modified nucleotide sequence encoding any of the CARs described herein (including functional portions and functional variants thereof).
[0192] "Nucleic acid," as used herein, includes "polynucleotides," "oligonucleotides," and "nucleic acid molecules," and generally refers to a polymer of DNA or RNA that can be single- or double-stranded, synthetic or obtained from natural sources (e.g., isolated and / or purified), and can contain natural, non-natural, or modified nucleotides, and can contain natural, non-natural, or modified internucleotide linkages, e.g., phosphoramidate or phosphorothioate linkages, in place of the phosphodiesters found between nucleotides in unmodified oligonucleotides. In some embodiments, a nucleic acid does not contain any insertions, deletions, inversions, and / or substitutions. However, in some cases, as discussed herein, it may be appropriate for a nucleic acid to contain one or more insertions, deletions, inversions, and / or substitutions.
[0193] Recombinant nucleic acids can have sequences that do not occur in nature or that are created by the artificial combination of two otherwise separate segments of sequence. This artificial combination is often achieved by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acid, for example, by genetic engineering techniques such as those described in Sambrook et al., supra. Nucleic acids can be constructed based on chemical synthesis and / or enzymatic ligation reactions using procedures known in the art. See, for example, Sambrook et al., supra and Ausubel et al., supra. For example, nucleic acids can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides (e.g., phosphorothioate derivatives and acridine-substituted nucleotides) designed to increase the biological stability of the molecule or to increase the physical stability of the duplex formed upon hybridization.Examples of modified nucleotides that can be used to generate nucleic acids include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-substituted adenines, 7-methylguanine, and the like. Examples of nucleic acids include, but are not limited to, uracil-5-oxyacetic acid (v), ubutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, 3-(3-amino-3-N-2-carboxypropyl)uracil, and 2,6-diaminopurine. Alternatively, one or more of the nucleic acids of the present invention can be purchased from a company such as Integrated DNA Technologies (Coralville, IA, USA).
[0194] The nucleic acid can comprise any isolated or purified nucleotide sequence encoding a CAR or any functional portion or variant thereof. The string may contain nucleotide sequences that are degenerate to any of the sequences, or a combination of degenerate sequences.
[0195] One embodiment also provides an isolated or purified nucleic acid comprising a nucleotide sequence that is complementary to or that hybridizes under stringent conditions to the nucleotide sequence of any of the nucleic acids described herein.
[0196] Nucleotide sequences that hybridize under stringent conditions may also hybridize under high stringency conditions. "High stringency conditions" means that a nucleotide sequence specifically hybridizes to a target sequence (any nucleotide sequence of a nucleic acid described herein) in an amount detectably stronger than nonspecific hybridization. High stringency conditions include conditions that distinguish polynucleotides with exact complementary sequences, or polynucleotides containing only a few scattered mismatches, from random sequences that happen to have several small regions (e.g., 3-10 bases) that match the nucleotide sequence. Such small regions of complementarity are more easily melted than full-length complements of 14-17 or more bases, and high stringency hybridization makes them readily distinguishable. Relatively high stringency conditions include low salt and / or high temperature conditions, such as those provided by about 0.02-0.1 M NaCl or equivalent at temperatures of about 50-70°C. Such highly stringent conditions tolerate little, if any, mismatch between the nucleotide sequence and the template or target strand and are particularly suitable for detecting expression of any of the CARs of the present invention. It is generally understood that conditions can be made more stringent by the addition of increasing amounts of formamide.
[0197] Also provided are nucleic acids comprising a nucleotide sequence that is at least about 70% or more, e.g., about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98% or about 99% identical to any of the nucleic acids described herein.
[0198] In one embodiment, the nucleic acid may be incorporated into a recombinant expression vector. In this regard, one embodiment provides a recombinant expression vector comprising any of the nucleic acids. For purposes of this specification, the term "recombinant expression vector" refers to a genetically engineered oligonucleotide or polynucleotide construct that allows a host cell to express an mRNA, protein, polypeptide, or peptide when the construct comprises a nucleotide sequence encoding the mRNA, protein, polypeptide, or peptide, and when the vector is contacted with a cell under conditions sufficient for the mRNA, protein, polypeptide, or peptide to be expressed in the cell. The vector as a whole does not exist in nature.
[0199] However, portions of the vector may be naturally occurring. Recombinant expression vectors may be single-stranded or double-stranded, synthetic or derived from partially natural sources, and may contain any type of nucleotide, including, but not limited to, DNA and RNA, which may contain natural, non-natural, or modified nucleotides. Recombinant expression vectors may contain naturally occurring or non-naturally occurring internucleotide linkages, or both types of linkages. Preferably, the non-naturally occurring or modified nucleotides or internucleotide linkages do not interfere with the transcription or replication of the vector.
[0200] In one embodiment, the recombinant expression vector may be any suitable recombinant expression vector and may be used to transform or transfect any suitable host cell. Suitable vectors include vectors for propagation and propagation or expression, such as plasmids and viruses. The vector may be selected from the group consisting of the pUC series (Fermentas Life Sciences, Glen Burnie, MD), the pBluescript series (Stratagene, LaJolla, CA), the pET series (Novagen, Madison, WI), the pGEX series (Pharmacia Biotech, Uppsala, Sweden), and the pEX series (Clontech, Palo Alto, CA).
[0201] Bacteriophage vectors, such as λυTΙO, λυTΙ 1, λZapII (Stratagene), EMBL4, and λΝΜΙ 149, can also be used. Examples of plant expression vectors include pBI01, pBI101.2, pBHO1.3, pBI121, and pBIN19 (Clontech). Examples of animal expression vectors include pEUK-Cl, pMAM, and pMAMneo (Clontech). The recombinant expression vector can be a viral vector, such as a retroviral or lentiviral vector. Lentiviral vectors are vectors derived from at least a portion of the lentiviral genome, including, in particular, self-inactivating lentiviral vectors such as those provided in Milone et al., Mol. Ther. 17(8):1453-1464 (2009). Other examples of lentiviral vectors that may be used in the clinic include, for example, but not limited to, Oxford BioMedica plc's LENTIVECTOR® gene delivery technology, Lentigen's LENTIMAX™ vector system, etc. Non-clinical forms of lentiviral vectors are also available and known to those skilled in the art.
[0202] Several transfection techniques are generally known in the art (see, e.g., Graham et al., Virology, 52:456-467 (1973); Sambrook et al., supra; Davis et al., Basic Methods in Molecular Biology, Elsevier (1986); and Chu et al., Gene, 13:97 (1981).
[0203] Transfection methods include calcium phosphate coprecipitation (see, e.g., Graham et al., supra), direct microinjection into cultured cells (see, e.g., Capecchi, Cell, 22:479-488 (1980)), electroporation (see, e.g., Shigekawa et al., BioTechniques, 6:742-751 (1988)), liposome-mediated gene transfer (see, e.g., Mannino et al., BioTechniques, 6:682-690 (1988)), lipid-mediated transduction (see, e.g., Feigner et al., Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987)), and high velocity micropropellants. Microprojectile delivery (see, eg, Klein et al., Nature, 327:70-73 (1987)) is also included.
[0204] In one embodiment, recombinant expression vectors can be prepared using standard recombinant DNA techniques, for example, as described in Sambrook et al., supra, and Ausubel et al., supra. Circular or linear expression vector constructs can be prepared to contain a replication system functional in prokaryotic or eukaryotic host cells. Replication systems can be derived from, for example, ColEl, 2μ plasmid, λ, SV40, bovine papilloma virus, etc.
[0205] Recombinant expression vectors, taking into account whether the vector is DNA- or RNA-based, can optionally include regulatory sequences, e.g., transcriptional and translational initiation and termination codons, specific to the type of host cell (e.g., bacterial, fungal, plant, or animal) into which the vector will be introduced. Recombinant expression vectors can include restriction sites to facilitate cloning.
[0206] The recombinant expression vector may contain one or more marker genes to allow for the selection of transformed or transfected host cells. Marker genes include biocide resistance, resistance to, e.g., antibiotics, heavy metals, etc., complementation in auxotrophic hosts to provide prototrophy, etc. Suitable marker genes for the expression vectors of the present invention include, for example, the neomycin / G418 resistance gene, the hygromycin resistance gene, the histidinol resistance gene, the tetracycline resistance gene, and the ampicillin resistance gene.
[0207] The recombinant expression vector may comprise a native or non-native promoter operably linked to the nucleotide sequence encoding the CAR (including its functional portion and functional variant), or to a nucleotide sequence complementary to or hybridizing with the nucleotide sequence encoding the CAR. The selection of a promoter, for example, strong, weak, inducible, tissue-specific, and developmentally specific, is within the skill of those skilled in the art. Similarly, combining a nucleotide sequence with a promoter is also within the skill of those skilled in the art. The promoter may be a non-viral promoter or a viral promoter, such as a cytomegalovirus (CMV) promoter, an SV40 promoter, an RSV promoter, or a promoter found in the long terminal repeat of murine stem cell virus.
[0208] Recombinant expression vectors can be designed for transient expression, stable expression, or both, and can be made for constitutive or inducible expression.
[0209] Furthermore, recombinant expression vectors can be made to contain suicide genes. As used herein, the term "suicide gene" refers to a gene that causes cells that express the suicide gene to die. A suicide gene can be a gene that confers sensitivity to a drug or other agent on the cell in which it is expressed, or a gene that causes a cell to die when contacted with or exposed to a drug. Suicide genes are known in the art (see, for example, Suicide Gene Therapy: Methods and Reviews, Springer, Caroline J. (Cancer Research UK Centre for Cancer Therapeutics at the Institute of Cancer Research, Sutton, Surrey, UK), Humana Press, 2004), and include, for example, herpes simplex virus (HSV) thymidine kinase (TK) gene, cytosine deaminase, purine nucleoside phosphorylase, and nitroreductase.
[0210] One embodiment further provides a host cell containing any of the recombinant expression vectors described herein. As used herein, the term "host cell" refers to any type of cell that can contain a recombinant expression vector of the present invention. The host cell can be a eukaryotic cell, such as a plant, animal, fungus, or algae, or a prokaryotic cell, such as a bacterium or protist. The host cell can be a cultured cell or a primary cell, i.e., directly isolated from an organism such as a human. The host cell can be an adherent cell or a suspension cell, i.e., a cell that grows in suspension. Suitable host cells are known in the art and include, for example, DH5a E. coli cells, Chinese hamster ovary cells, monkey VERO cells, COS cells, HEK293 cells, etc. For the purpose of amplifying or replicating a recombinant expression vector, the host cell can be a prokaryotic cell, such as a DH5a cell. For the purpose of producing a recombinant CAR, the host cell can be a mammalian cell. The host cell can be a human cell. Although host cells can be of any cell type, can originate from any type of tissue, and can be at any stage of development, host cells are preferably peripheral blood lymphocytes (PBLs). Alternatively, the host cell may be a peripheral blood mononuclear cell (PBMC). The host cell may be a T cell.
[0211] For purposes herein, T cells can be any T cells, e.g., cultured T cells, e.g., primary T cells, or T cells from cultured T cell lines, e.g., Jurkat, SupTl, etc., or T cells obtained from a mammal. When obtained from a mammal, T cells can be obtained from a number of sources, including, but not limited to, blood, bone marrow, lymph nodes, thymus, or other tissues or fluids. T cells can also be enriched or purified. T cells can be human T cells. T cells can be T cells isolated from a human. T cells can be any type of T cell and at any developmental stage, including, but not limited to, CD4+ / CD8+ double-positive T cells, CD4+ helper T cells, e.g., Thi and Th2 cells, CD8+ T cells (e.g., cytotoxic T cells), tumor-infiltrating cells, memory T cells, naive T cells, etc. T cells can be CD8+ T cells or CD4+ T cells.
[0212] In one embodiment, the CARs described herein can be used in suitable non-T cells, such as cells with immune effector function, such as NK cells and T-like cells generated from pluripotent stem cells.
[0213] Also provided by one embodiment is a population of cells comprising at least one host cell described herein. The population of cells can be a heterogeneous population comprising host cells comprising any of the described recombinant expression vectors in addition to at least one other cell, e.g., a host cell (e.g., a T cell), that does not comprise any recombinant expression vector, or a cell other than a T cell, e.g., a B cell, macrophage, neutrophil, erythrocyte, hepatocyte, endothelial cell, epithelial cell, muscle cell, brain cell, etc. Alternatively, the population of cells can be a substantially homogeneous population, wherein the population primarily comprises host cells comprising (e.g., consisting essentially of) the recombinant expression vector. The population can also be a clonal population of cells, wherein all cells in the population are clones of a single host cell comprising the recombinant expression vector, such that all cells in the population comprise that recombinant expression vector. In one embodiment of the present invention, the population of cells is a clonal population comprising host cells comprising the recombinant expression vector described herein.
[0214] CARs (including functional portions and variants thereof), nucleic acids, recombinant expression vectors, host cells (including populations thereof), and antibodies (including antigen-binding portions thereof) can be isolated and / or purified. For example, a purified (or isolated) host cell preparation is one in which the host cells are more pure than the cells in their natural environment in the body. Such host cells can be produced, for example, by standard purification techniques. In some embodiments, a host cell preparation is purified such that the host cells represent at least about 50%, e.g., at least about 70%, of the total cell content of the preparation. For example, the purity can be at least about 50%, greater than about 60%, about 70%, or about 80%, or can be about 100%.
[0215] E. Treatment Method It is contemplated that the CARs used in the activated patient-specific autologous anti-tumor T cell population(s) can be used in methods of treating or preventing disease in a mammal. In this regard, one embodiment provides a method of treating or preventing cancer in a mammal, comprising administering to the mammal a CAR, a nucleic acid, a recombinant expression vector, a host cell, a population of cells, an antibody and / or an antigen-binding portion thereof, and / or a pharmaceutical composition in an amount effective to treat or prevent cancer in the mammal.
[0216] One embodiment further comprises lymphodepleting the mammal prior to administering a CAR disclosed herein. Examples of lymphodepletion include non-myeloablative lymphodepleting chemotherapy, myeloablative lymphodepleting chemotherapy, systemic lymphodepleting chemotherapy, and the like. These may include, but are not limited to, irradiation.
[0217] For the purpose of the method of administering host cells or a group of cells, the cells can be allogeneic or autologous to the mammal.Preferably, the cells are autologous to the mammal.As used herein, allogeneic refers to any material derived from a different animal of the same species as the individual into which the material is introduced.Two or more individuals are said to be allogeneic to each other if the genes are not identical at one or more loci.In some embodiments, allogeneic materials from individuals of the same species can be genetically sufficiently different to interact antigenically.As used herein, "autologous" refers to any material derived from the same individual that is subsequently reintroduced into the individual.
[0218] The mammal referred to herein may be any mammal. As used herein, the term "mammal" refers to any mammal, including, but not limited to, rodent mammals, e.g., mice and hamsters, and logomorph mammals, e.g., rabbits. The mammal may be from the carnivora order, including felines (cats) and canines (dogs). The mammal may be from the artiodactyla order, including bovines (cows) and swines (pigs), or from the perissodactyla order, including equines (horses). The mammal may be from the primate order, ceboids or simoids (monkeys), or anthropoids (humans and apes). Preferably, the mammal is a human.
[0219] For these methods, the cancer may be acute lymphocytic cancer, acute myeloid leukemia, alveolar rhabdomyosarcoma, bladder cancer (e.g., bladder carcinoma), bone cancer, brain cancer (e.g., medulloblastoma), breast cancer, cancer of the anus, anal canal, or anorectum, eye cancer, cancer of the intrahepatic bile duct, cancer of the joints, cancer of the neck, gallbladder, or pleura, cancer of the nose, nasal cavity, or middle ear, cancer of the oral cavity, cancer of the vulva, chronic lymphocytic leukemia, chronic myeloid carcinoma The cancer may be any cancer, including any of the following: colon cancer, esophageal cancer, cervical cancer, fibrosarcoma, gastrointestinal carcinoid tumor, head and neck cancer (e.g., head and neck squamous cell carcinoma), Hodgkin's lymphoma, hypopharyngeal cancer, kidney cancer, laryngeal cancer, leukemia, liquid tumors, liver cancer, lung cancer (e.g., non-small cell lung cancer and lung adenocarcinoma), lymphoma, mesothelioma, mast cell tumor, melanoma, multiple myeloma, nasopharyngeal cancer, non-Hodgkin's lymphoma, B-chronic lymphocytic leukemia (CLL), hairy cell leukemia, acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), and Burkitt's lymphoma, ovarian cancer, pancreatic cancer, peritoneal, omental, and mesenteric cancer, pharyngeal cancer, prostate cancer, rectal cancer, renal cancer, skin cancer, small intestine cancer, soft tissue cancer, solid tumor, synovial sarcoma, gastric cancer, testicular cancer, thyroid cancer, and ureteral cancer.
[0220] The terms "treat" and "prevent," and words derived therefrom, as used herein, do not necessarily mean 100% or complete treatment or prevention. Rather, there are various degrees of treatment or prevention that one of skill in the art would recognize as having a potential beneficial or therapeutic effect. In this regard, the method may provide any amount or level of treatment or prevention of cancer in a mammal.
[0221] Furthermore, the treatment or prevention provided by this method can include treatment or prevention of one or more conditions or symptoms of the disease, such as cancer, being treated or prevented. Also, for purposes herein, "prevention" can include delaying the onset of the disease, or its symptoms or conditions.
[0222] Another embodiment is a method of detecting the presence of cancer in a mammal, comprising: (a) detecting a sample comprising one or more cells from the mammal by addition of a CAR, a nucleic acid, a recombinant expression vector, a host cell, , a population of cells, an antibody and / or antigen-binding portion thereof, or a pharmaceutical composition, thereby forming a complex; and (b) detecting the complex, wherein detection of the complex indicates the presence of cancer in the mammal.
[0223] The sample can be obtained by any suitable method, for example, biopsy or autopsy. A biopsy is the removal of tissue and / or cells from an individual. Such removal can be the collection of tissue and / or cells from an individual in order to perform experiments on the removed tissue and / or cells. This experiment can include experiments to determine whether the individual has a certain condition or disease state and / or whether they are suffering from a certain condition or disease state. The condition or disease can be, for example, cancer.
[0224] For embodiments of methods for detecting the presence of a proliferation disorder, e.g., cancer, in a mammal, the sample containing mammalian cells can be a sample containing whole cells, a lysate thereof, or a fraction of a whole cell lysate, e.g., a nuclear or cytoplasmic fraction, a whole protein fraction, or a nucleic acid fraction. When the sample contains whole cells, these cells can be any cells of a mammal, e.g., cells of any organ or tissue, including blood cells or endothelial cells.
[0225] The contacting step can occur in vitro or in vivo with respect to a mammal. Preferably, the contacting step is in vitro.
[0226] Also, detection of complexes can be carried out by many methods known in the art.For example, the CAR disclosed herein, polypeptide, protein, nucleic acid, recombinant expression vector, host cell, cell population, or antibody or its antigen-binding portion can be labeled with detectable label, such as the radioisotope disclosed above, fluorophore (e.g., fluorescein isothiocyanate (FITC), phycoerythrin (PE)), enzyme (e.g., alkaline phosphatase, horseradish peroxidase) and element particle (e.g., gold particle), etc.
[0227] Methods for testing CAR for its ability to recognize target cells and antigen specificity are known in the art.For example, Clay et al., J.Immunol., vol. 163: 507-513 (1999) teaches a method for measuring the release of cytokines (e.g., interferon-γ, granulocyte / monocyte colony stimulating factor (GM-CSF), tumor necrosis factor α (TNF-α) or interleukin 2 (IL-2)).In addition, CAR function can be evaluated by measuring cytotoxicity, as described in Zhao et al., J.Immunol., vol. 174: 4415-4423 (2005).
[0228] Another embodiment provides the use of the CARs, nucleic acids, recombinant expression vectors, host cells, populations of cells, antibodies or antigen-binding portions thereof, and / or pharmaceutical compositions of the invention to treat or prevent a proliferative disorder, such as cancer, in a mammal. The cancer can be any of the cancers described herein.
[0229] Any administration method, including local and systemic administration, can be used for the disclosed therapeutic agents. For example, topical, oral, intravascular (e.g., intravenous), intramuscular, intraperitoneal, intranasal, intradermal, intrathecal, and subcutaneous administration can be used. The specific administration mode and dosing regimen will be selected by the attending clinician, taking into account the characteristics of the case (e.g., the subject, the disease, the disease state involved, and whether the treatment is preventive). When more than one agent or composition is being administered, one or more administration routes can be used; for example, a chemotherapeutic agent can be administered orally, and an antibody or antigen-binding fragment or conjugate or composition can be administered intravenously. Administration methods include injection, in which the CAR, CAR T cell, conjugate, antibody, antigen-binding fragment, or composition is provided in a non-toxic, pharmaceutically acceptable carrier, such as water, saline, Ringer's solution, dextrose solution, 5% human serum albumin, solid oil, ethyl oleate, or liposomes. In some embodiments, local administration of the disclosed compounds can be used, for example, by applying the antibody or antigen-binding fragment to an area of tissue from which a tumor has been removed or to an area suspected of being prone to tumor development. In some embodiments, sustained intratumoral (or near-tumoral) release of a pharmaceutical preparation comprising a therapeutically effective amount of the antibody or antigen-binding fragment can be beneficial. In other examples, the conjugate is applied topically to the cornea as eye drops or intravitreally to the eye.
[0230] The disclosed therapeutic agents can be formulated in unit dosage forms suitable for individual administration of precise dosage amounts. Furthermore, the disclosed therapeutic agents can be administered in a single dose or in a multiple-dose schedule. A multiple-dose schedule is one in which the main course of treatment may involve more than one discrete dose, e.g., 1 to 10 doses, followed by other doses given at subsequent time intervals as needed to maintain or enhance the effect of the composition. Treatment may involve a daily dose or multiple daily doses of the compound(s) over a period of several days to several months or even years. Thus, the dosing regime will also be determined, at least in part, based on the specific needs of the subject being treated and will be dependent on the judgment of the administering practitioner.
[0231] Typical dosages of antibodies or conjugates can range from about 0.01 to about 30 mg / kg, for example, from about 0.1 to about 10 mg / kg.
[0232] In particular examples, the subject is administered a therapeutic composition comprising one or more of the conjugate, antibody, composition, CAR, CAR T cell, or additional agent in a multiple daily dosing schedule, e.g., at least 2 consecutive days, 10 consecutive days, etc., for a period of, e.g., weeks, months, or years. In one example, the subject is administered the conjugate, antibody, composition, or additional agent for a period of at least 30 days, e.g., at least 2 months, at least 4 months, at least 6 months, at least 12 months, at least 24 months, or at least 36 months.
[0233] In some embodiments, the disclosed methods include providing a subject with surgery, radiation therapy, and / or chemotherapy in combination with the disclosed antibodies, antigen-binding fragments, conjugates, CARs, or CAR-expressing T cells (e.g., sequentially, substantially simultaneously, or simultaneously). Such agents and treatment methods and therapeutic dosages are known to those skilled in the art and can be determined by skilled clinicians. Preparation and dosing schedules for additional agents can be used according to manufacturer's instructions or can be as empirically determined by those skilled in the art. Preparation and dosing schedules for such chemotherapy are also described in Chemotherapy Service, (1992) edited by M.C. Perry, Williams & Wilkins, Baltimore, Md.
[0234] In some embodiments, combination therapy may include administering to a subject a therapeutically effective amount of an additional cancer inhibitor.Non-limiting examples of additional therapeutic agents that can be used in combination therapy include microtubule binding agents, DNA intercalators or crosslinkers, DNA synthesis inhibitors, DNA and RNA transcription inhibitors, antibodies, enzymes, enzyme inhibitors, gene regulators, and angiogenesis inhibitors.These agents (administered in therapeutically effective amounts) and treatments can be used alone or in combination.For example, any suitable anti-cancer or anti-angiogenic agent can be administered in combination with the CAR, CAR-T cells, antibodies, antigen-binding fragments, or conjugates disclosed herein.Methods and therapeutic dosages of such agents are known to those skilled in the art and can be determined by skilled clinicians.
[0235] Additional chemotherapeutic agents include alkylating agents such as nitrogen mustards (e.g., chlorambucil, chlormethine, cyclophosphamide, ifosfamide, and melphalan), nitrosoureas (e.g., carmustine, fotemustine, lomustine, and streptozocin), platinum compounds (e.g., carboplatin, cisplatin, oxaliplatin, and BBR3464), busulfan, dacarbazine, mechlorethamine, procarbazine, temozolomide, thiotepa, and uramustine; antimetabolites such as folates (e.g., methotrexate, pemetrexed, and raltitrexed), purines (e.g., cladribine, clofarabine, fludarabine, mercaptopurine, and thioguanine), pyrimidines (e.g., capecitabine), cytarabine, fluorouracil, and gemcitabine; plant alkaloids, such as For example, podophyllum (e.g., etoposide and teniposide), taxanes (e.g., docetaxel and paclitaxel), vincas (e.g., vinblastine, vincristine, vindesine, and vinorelbine); cytotoxic / antitumor antibiotics, such as members of the anthracycline family (e.g., daunorubicin, doxorubicin, epirubicin, idarubicin, mitoxantrone, and valrubicin), bleomycin, rifampicin, hydroxyurea, and mitomycin; topoisomerase inhibitors, such as topotecan and irinotecan; monoclonal antibodies, such as alemtuzumab, bevacizumab, cetuximab, gemtuzumab, rituximab, panitumumab, pertuzumab, and trastuzumab; tumor-affinity photosensitizers, such as aminolevulinic acid, methyl aminolevulinate, porfimer sodium, and verteporfin;and other drugs, such as alitretinoin, altretamine, amsacrine, anagrelide, arsenic trioxide, asparaginase, axitinib, bexarotene, bevacizumab, bortezomib, celecoxib, denileukin diftitox, erlotinib, estramustine, gefitinib, hydroxycarbamide, imatinib, lapatinib, pazopanib, pentostatin, masoprocol, mitotane, pegaspargase, tamoxifen, sorafenib, sunitinib, vemurafenib, vandetanib, and tretinoin. The selection and therapeutic dosage of such drugs are known to those skilled in the art and can be determined by a skilled clinician.
[0236] In certain embodiments of the invention, cells activated and expanded using the methods described herein or other methods known in the art in which T cells are expanded to therapeutic levels are administered to a patient in conjunction with (e.g., before, simultaneously with, or after) any number of appropriate treatment modalities, including, but not limited to, drug treatment, e.g., antiviral therapy, cidofovir and interleukin-2, cytarabine (also known as ARA-C) or natalizumab treatment for MS patients, or efalizumab treatment for psoriasis patients, or other treatments for PML patients. In further embodiments, the T cells of the present invention may be used in combination with chemotherapy, radiation, immunosuppressants such as cyclosporine, azathioprine, methotrexate, mycophenolate, and FK506, antibodies, or other immunoablative agents such as CAM PATH, anti-CD3 antibodies or other antibody therapies, cytoxins, fludarabine, cyclosporine, FK506, rapamycin, mycophenolic acid, steroids, FR901228, cytokines, and irradiation. These drugs inhibit calcineurin, a calcium-dependent phosphatase (cyclosporine and FK506), or inhibit p70S6 kinase, which is important for growth factor-induced signaling (rapamycin) (Liu et al., Cell 66:807-815, 1991; Henderson et al., Immun 73:316-321, 1991; Bierer et al., Curr. Opin. Immun 5:763-773, 1993). In a further embodiment, the cell compositions of the invention are administered in conjunction with (e.g., in combination with) bone marrow transplantation, T cell ablative therapy using either chemotherapeutic agents, such as fludarabine, external beam radiation therapy (XRT), cyclophosphamide, or antibodies, such as OKT3 or CAMPATH. The cell composition of the present invention is administered to a patient (either before, simultaneously with, or after) a B-cell depleting therapy, such as a drug that reacts with CD20, e.g., Rituxan. For example, in one embodiment, a subject may undergo standard treatment with high-dose chemotherapy followed by peripheral blood stem cell transplantation. In certain embodiments, after transplantation, the subject receives an infusion of the expanded immune cells of the present invention. In a further embodiment, the expanded cells are administered before or after surgery.
[0237] The dosage of the above treatment administered to a patient will vary depending on the exact nature of the condition being treated and the recipient of the treatment. Adjustments to dosages for human administration can be made according to accepted practices in the art. For example, the dose of CAMPATH generally ranges from 1 to about 100 mg for an adult patient, usually administered daily for a period of between 1 and 30 days. The preferred daily dose is 1 to 10 mg per day, although larger doses of up to 40 mg per day may be used in some cases.
[0238] Combination therapy can provide synergistic effects and can be proven to be synergistic, that is, the effect achieved when active ingredients are used together is greater than the sum of the effects that can be obtained from using these compounds separately.Synergistic effects can be achieved when active ingredients are (1) co-formulated and administered or delivered simultaneously as a combined unit dosage formulation; (2) delivered alternately or in parallel as separate formulations; or (3) by some other regimen.When delivered alternately, synergistic effects can be achieved when these compounds are administered or delivered sequentially, for example, by different injections in separate syringes.Generally, during alternation, each active ingredient in an effective dosage is administered continuously, that is, sequentially, whereas in combination therapy, two or more active ingredients in an effective dosage are administered together.
[0239] In one embodiment, an effective amount of an antibody or antigen-binding fragment or a conjugate thereof that specifically binds to one or more of the antigens disclosed herein is administered to a subject with a tumor after anti-cancer treatment. After a sufficient amount of time has passed for the administered antibody or antigen-binding fragment or conjugate to form an immune complex with the antigen expressed on each cancer cell, the immune complex is detected. The presence (or absence) of the immune complex indicates the effectiveness of the treatment. For example, an increase in immune complexes compared to a control taken before treatment indicates that the treatment is ineffective, and a decrease in immune complexes compared to a control taken before treatment indicates that the treatment is effective.
[0240] F. Biopharmaceutical Compositions Provided herein are biopharmaceutical or biologic compositions (hereinafter "compositions") for use in gene therapy, immunotherapy, adoptive immunotherapy, and / or cell therapy, comprising one or more of the disclosed CARs, or T cells expressing a CAR, an antibody, an antigen-binding fragment, a conjugate, a CAR, or T cells expressing a CAR that specifically binds to one or more antigens disclosed herein, in a carrier (e.g., a pharmaceutically acceptable carrier). These compositions can be prepared in unit dosage form for administration to a subject. The amount and timing of administration to achieve a desired outcome are at the discretion of the treating clinician. These compositions can be formulated for systemic (e.g., intravenous) or local (e.g., intratumoral) administration. In one example, the disclosed CARs, or T cells expressing a CAR, an antibody, an antigen-binding fragment, a conjugate, is formulated for parenteral administration, such as intravenous administration. The CAR disclosed herein, or a composition comprising a T cell, conjugate, antibody, or antigen-binding fragment expressing a CAR, is used for, for example, treatment and detection of tumors, such as, but not limited to, neuroblastoma. In some cases, these compositions are useful for the treatment or detection of cancer. The CAR disclosed herein, or a composition comprising a T cell, conjugate, antibody, or antigen-binding fragment expressing a CAR, is also used, for example, to detect pathological angiogenesis.
[0241] Compositions for administration can include a solution of CAR, or CAR-expressing T cells, conjugates, antibodies, or antigen-binding fragments dissolved in a pharmaceutically acceptable carrier, such as an aqueous carrier. A variety of aqueous carriers, such as buffered saline, can be used. These solutions are sterile and generally free of undesirable substances. The compositions can be sterilized by conventional, well-known sterilization techniques. The compositions can contain pharmaceutically acceptable auxiliary substances necessary to approximate physiological conditions, such as pH adjusting and buffering agents, toxicity adjusting agents, adjuvant drugs, etc., such as sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, etc. The concentration of CAR, or CAR-expressing T cells, antibodies, or antigen-binding fragments, or conjugates in these formulations can vary widely and is selected primarily based on fluid volume, viscosity, body weight, etc., according to the particular mode of administration selected and the needs of the subject. Actual methods for preparing such dosage forms for use in gene therapy, immunotherapy, and / or cell therapy are known or will become apparent to those skilled in the art.
[0242] A typical composition for intravenous administration contains about 0.01 to about 30 mg / kg of antibody or antigen-binding fragment or conjugate (or a corresponding dose of CAR, or T cells expressing a CAR, or a conjugate comprising the antibody or antigen-binding fragment) per subject per day. Actual methods for preparing administrable compositions will be known or apparent to those of skill in the art and are described in more detail in publications such as Remington's Pharmaceutical Science, 19th Edition, Mack Publishing Company, Easton, PA (1995).
[0243] CARs, or CAR-expressing T cells, antibodies, antigen-binding fragments, or conjugates, can be provided in lyophilized form and rehydrated with sterile water before administration, but they can also be provided in sterile solutions of known concentrations. The CAR, or CAR-expressing T cells, antibodies, or antigen-binding fragments, or conjugates, solution is then added to an infusion bag containing 0.9% sodium chloride, USP, and in some cases administered at a dosage of 0.5 to 15 mg / kg body weight. Considerable experience is available in the field for administering antibody or antigen-binding fragment and conjugate drugs; for example, antibody drugs have been commercially available in the United States since the approval of Rituxan® in 1997. CARs, or CAR-expressing T cells, antibodies, antigen-binding fragments, and their conjugates, can be administered by slow infusion rather than intravenous injection or intravenous bolus. In one example, a higher loading dose is administered with subsequent maintenance doses administered at lower levels. For example, an initial loading dose of 4 mg / kg of the antibody or antigen-binding fragment (or a corresponding dose of a conjugate comprising the antibody or antigen-binding fragment) can be infused over a period of approximately 90 minutes, followed by weekly maintenance doses of 2 mg / kg for 4-8 weeks infused over a period of 30 minutes if the previous dose was well tolerated.
[0244] Controlled-release parenteral formulations can be made as implants, oily injections, or as granular systems. For a broad review of protein delivery systems, see Banga, AJ, Therapeutic Peptides and Proteins: Formulation, Processing, and Delivery Systems, Technomic Publishing Company, Inc., Lancaster, PA (1995). Particulate systems include microspheres, microparticles, microcapsules, nanocapsules, nanospheres, and nanoparticles. Microcapsules contain a therapeutic protein, such as a cytotoxin or drug, as a central core. In microspheres, the therapeutic agent is dispersed throughout the particle. Particles smaller than about 1 μm, microspheres, and microcapsules, are commonly referred to as nanoparticles, nanospheres, and nanocapsules, respectively. Capillaries are designed to separate particles with a diameter of approximately 5 μm, so that only nanoparticles can be administered intravenously. Microparticles have a diameter of approximately 100 μm and are typically administered subcutaneously or intramuscularly.See, for example, Kreuter, J., Colloidal Drug Delivery Systems, edited by J. Kreuter, Marcel Dekker, Inc., New York, NY, pp. 219-342 (1994); and Tice and Tabibi, Treatise on Controlled Drug Delivery, edited by A. Kydonieus, Marcel Dekker, Inc., New York, NY, pp. 315-339 (1992).
[0245] The polymers can be used for ion-controlled release of the CARs disclosed herein, or T cells, antibodies or antigen-binding fragments, or conjugate compositions expressing the CARs. Various degradable and non-degradable polymer matrices used for controlled drug delivery are known in the art (Langer, Accounts Chem. Res. 26:537-542, 1993). For example, the block copolymer polaxamer 407 exists as a viscous but still mobile liquid at low temperatures, but forms a semi-fluid gel at body temperature. It has been shown to be an effective vehicle for the formulation and sustained delivery of recombinant interleukin-2 and urease (Johnston et al., Pharm. Res. 9:425-434, 1992; and Pec et al., J. Parent. Sci. Tech. 44(2):58-65, 1990). Alternatively, hydroxyapatite has been used as a microcarrier for the controlled release of proteins (Ijntema et al., Int. J. Pharm. 112:215-224, 1994). In yet another embodiment, liposomes are used for the controlled release and drug targeting of lipid-encapsulated drugs (Betageri et al., Liposome Drug Delivery Systems, Technomic Publishing Co., Inc., Lancaster, PA (1993)). Numerous additional systems for controlled delivery of therapeutic proteins are known (see U.S. Patent Nos. 5,055,303; 5,188,837; 4,235,871; 4,501,728; 4,837,028; 4,957,735; 5,019,369; 5,055,303; 5,514,670; 5,413,797; 5,268,164; 5,004,697; 4,902,505; 5,506,206; 5,271,961; 5,254,342 and 5,534,496).
[0246] G.Kit In one embodiment, also provided is a kit that uses the CAR disclosed herein.For example, a kit for treating tumor in a subject or a kit for producing CAR T cells that express one or more of the CARs disclosed herein.The kit typically includes the disclosed antibody, antigen-binding fragment, conjugate, nucleic acid molecule, CAR or CAR-expressing T cells disclosed herein.More than one of the disclosed antibody, antigen-binding fragment, conjugate, nucleic acid molecule, CAR or CAR-expressing T cells can be included in the kit.
[0247] The kit may include a container and a label or package insert on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, and the like. The container may be formed from a variety of materials, such as glass or plastic. The container typically holds a composition comprising one or more of the disclosed antibodies, antigen-binding fragments, conjugates, nucleic acid molecules, CARs, or CAR-expressing T cells. In some embodiments, the container may have a sterile access port (e.g., the container may be an intravenous solution bag or vial with a stopper pierceable by a hypodermic needle). The label or package insert may indicate that the composition can be used to treat a particular condition. Indicates that it will be.
[0248] The label or package insert typically further includes instructions for using the disclosed antibody, antigen-binding fragment, conjugate, nucleic acid molecule, CAR, or CAR-expressing T cell, for example, in a method for treating or preventing tumors or in a method for generating CAR T cells. The package insert typically includes instructions customarily included in the commercial packaging of a therapeutic product, including information about indications, usage, dosage, administration, contraindications, and / or warnings regarding the use of the therapeutic product. The instructional material can be written in electronic form (e.g., a computer diskette or compact disc) or visual (e.g., a video file). The kit can also include additional components to facilitate the specific application for which the kit is designed. Thus, for example, the kit can further include a means for detecting the label (e.g., an enzyme substrate for an enzymatic label, a filter set for detecting a fluorescent label, an appropriate secondary label such as a secondary antibody, etc.). The kit can further include buffers and other reagents routinely used for the implementation of a particular method. Such kits and their appropriate contents are well known to those skilled in the art. [Example]
[0249] The present invention is further illustrated by the following examples, which should not be construed as imposing limitations on the scope of the present invention in any way. On the contrary, it is readily understood that recourse must be had to various other embodiments, modifications, and equivalents thereof, which may occur to those skilled in the art after reading the description herein without departing from the spirit of the present invention and / or the scope of the appended claims.
[0250] The present invention is further illustrated by the following examples, which should not be construed as imposing limitations on the scope of the present invention in any way. On the contrary, it is readily understood that recourse must be had to various other embodiments, modifications, and equivalents thereof, which may occur to those skilled in the art after reading the description herein without departing from the spirit of the present invention and / or the scope of the appended claims.
[0251] Example 1 Next-generation sequencing of tumor mutanomes This procedure involves next-generation sequencing of a patient's tumor material and identifying mutant proteins present in the tumor (collectively referred to as the mutagenesis). These sequences are used as a basis for creating vectors that express the mutant tumor proteins. When available, non-tumor-associated patient material (such as peripheral blood) is used as a normal comparison, as well as publicly available human genome databases. Next-generation sequencing methods are well-established in molecular biology and can be found, for example, in Vogelstein B, Papadopoulos N, Velculescu VE et al., 2013, Cancer Genome Landscapes, Science 339:1546-1558.
[0252] The National Institutes of Health (NIH) provides the Cancer Genome Atlas online (cancergenome.nih.gov), which contains a comprehensive map of significant genomic alterations in 33 types of cancer. Data are sent to NIH through specific TCGA (The Cancer Genome Atlas) Genome Sequencing Centers (GSCs). Data in two formats, whole exome and whole genome, are available for all sequenced TCGA cancer cases. Non-tumor DNA serves as a control for each submission. Three centers funded by the National Human Genome Research Institute (NHGRI) are: The Broad Institute Sequencing Platform, Broad Institute, Cambridge, Massachusetts; Human Genome Atlas, Cambridge, Massachusetts; and Genome Sequencing Center,Baylor College of Medicine, Houston, Texas, and the Genome The Institute at Washington University, Washington University School of Medicine, St. Louis, Mo., provided the whole genome sequence.
[0253] If you have a separate agreement with The Broad Institute, The WES Express (Deep) service provides tumor-normal pair or somatic mutation analysis with over 50-fold coverage and 85% coverage of target bases (information accessed June 10, 2016, www.genomics.broadinstitute.org / products / while-exome-sequencing ). Additionally, tumor samples can be sequenced at the Broad's CLIA-certified, CAP-accredited laboratory. Commercially available whole-genome and whole-exome sequencing services are currently offered by Illumina, which also offers the Tumor Immunogenicity discovery platform (ngs-immuno-oncology-application-spotlight-1170-2016-005-1.pdf). www.illumina.com / areas-of-interest / cancer / research.htlml ) are provided by other suppliers. Other suppliers are also available. We provide this information to demonstrate that whole-genome and whole-exome sequencing services are widely available in the marketplace and, based on history, the cost and speed of providing these sequences will continue to decrease. Genomic analysis of human tumor samples is a readily available service or can be performed in laboratories using commercially available equipment and systems.
[0254] <Example 2> Next-generation sequencing of TCR This procedure refers to the use of sequencing techniques to define the full complement of T cell receptors in biological samples. The analyzed material includes a patient's tumor, in which case we describe the TCRs present in the tumor. In peripheral blood, we describe the common TCRs present, some of which are tumor-specific. Next-generation sequencing allows us to quantify the frequency of specific TCRs. The application of next-generation sequencing to identify specific pairs of TCR alpha and beta chains is a well-established technique in molecular biology (Dash P, Wang G, Thomas P, 2015, Single-cell analysis of T-cell receptor AB repertoire, in Immunosenecense: Methods and Protocols, Shaw AC (Ed.), Methods in Molecular Biology, Volume 1343, Springer Science+Business Media, New York.).
[0255] Numerous methods using current molecular biology techniques, including the continued development of automated DNA sequencing, have been developed to determine the DNA sequences encoding the TCR alpha chain (TCRA) and TCR beta chain (TCRB). Furthermore, several techniques have been developed to assign which TCRA pairs with which TCRB in the same T lymphocyte, or T cell population, derived from a clonal precursor. For example, in 2012, Sun et al. demonstrated the ability to sequence TCR alpha and beta chains from phenotypically sorted CD8+ T cells at the single-cell level. Sun X, Saito M, Sato Y, et al., 2012, Unbiased analysis of TCRA / B chains at the single-cell level in human CD8+ T-cell subsets, PLoS ONE 7:e40386.
[0256] In 2014, Han et al., Miltenyi Biotec cytokine capture system Sequencing of TCRA and TCRB from T cells isolated by STEM (immunomagnetic particles) and, in some cases, selected for their ability to secrete specific cytokine subsets has been demonstrated. Han A, Gianville J, Hansmann L, Davis MM, 2014, Linking T-cell receptor sequence to functional phenotype at the single-cell level, Nature Biotechnology 32:684-692.
[0257] Similarly, the heavy and light chain coding sequences comprising the antibody repertoire encoded by B cells have been analyzed using single-cell sequencing. DeKosky B, Kojima T, Rodin A, et al., 2015, In-depth determination and analysis of the human paired heavy- and light-chain antibody repertoire, Nature Medicine 21:86-91.
[0258] Example 3 Generation of lentiviral vectors expressing tumor mutagenesis To express the mutanome in antigen-presenting cells, including patient-derived antigen-presenting cells, a non-limiting example being dendritic cells, lentiviral vectors (LVs) were used to encode the 10 most prominent mutant proteins present in the mutanome (10 is an approximation; the number of LVs can vary from 1 to 100). LVs can encode mutanomes containing relevant epitopes, or each mutant gene can be individually cloned into multiple LVs. Other genes or non-coding RNAs can also be transduced into DCs to improve the efficiency of generating highly functional DCs and / or T cells. Non-limiting examples of such genes or non-coding RNAs include IL-2, IL-4, IL-12, IL-17, IL-15, IL-21, IL-7, IL-4, GM-CSF, miR21, miR221, and miR142-T. Using tissue-specific promoters and / or tissue-specific miRNAs, as known in the art, these proteins were further transduced into DCs to facilitate DC differentiation and then arrest differentiation after it had occurred.
[0259] LVs were rapidly generated by transducing a producer cell line with a set of plasmids encoding the component genes necessary to generate the gene vector. In accordance with current regulatory requirements, these plasmids are transfected into the producer cell line as a set. One of the transfected plasmids encodes the LV's genetic payload, which is the desired gene to deliver to the target cell line. Thus, after defining the tumor mutagenesis and selecting mutant genes for expression in antigen-presenting cells, these genes are transferred into a plasmid encoding one or more mutant proteins. LVs can accommodate up to 10,000 base pairs. Therefore, up to 10 genes or individual genes can be encoded by an LV. If the allowable packaged gene(s) size is exceeded, two or more LV populations can be generated to encode the entire set of desired mutanomes. The mutant genes encoding the mutagenesis and the appropriate sequences contained therein can be rapidly cloned into the LV backbone plasmid (the plasmid encoding the gene of interest) by PCR amplification or direct synthesis. After LVs encoding the desired mutagenesis genes are generated, they are then used to transduce antigen-presenting cells.
[0260] Example 4 Generation of lentiviral vectors expressing TCR LVs are used to encode full-length TCRA and TCRB chains to provide for expression of TCR sequences identified by sequencing of patient material. These vectors are then used to transduce patient T cells, thereby generating large numbers of specific T cells (native T cells). and transduced TCR).
[0261] The ability to molecularly clone, sequence, and transfer human TCRs into primary human T cells using retroviral gene vectors is well established in the art. The transduced T cells gain the ability to target cells using the vector-transferred TCR. If the transduced T cells are clonal, it can be demonstrated that both the native and transferred TCRs are functional. (Retroviral transduction of a T cell receptor specific for an Epstein-Barr virus-encoded peptide, Clinical Immunology, 98:220-228; see also Jurgens et al., 2006, Transduction of primary lymphocytes with Epstein-Barr virus (EBV) latent membrane protein-specific T cell receptor induces lysis of virus-infected cells: a novel strategy for the treatment of Hodgkin's disease and nasopharyngeal carcinoma, J Clinical Immunology, 26:22-32.)
[0262] For example, LVs encoding one or more TCRs, whose TCRA and TCRB sequences are derived from T cells isolated from an ovarian cancer patient, are generated and used to transduce autologous patient lymphocytes that have been isolated, activated, and cultured in vitro. Examples of culture media used include RPMI-1640 or TexMACS, supplemented with or without human serum or human serum albumin and supplemental cytokines such as IL-2, IL-7, IL-15, IL-21, or a combination thereof. Activation is facilitated by the use of a nanomatrix with anti-CD3 and anti-CD28 binding, such as the Mitenyi TransACT system. Culture is achieved according to standard techniques in the art (i.e., in tissue culture flasks) or automated culture platforms such as the CliniMACS Prodigy (Miltenyi Biotec). The presence of the new TCRs on the surface of the patient-derived transduced T cell population can be demonstrated by antibody staining for the specific TCRB introduced or by PCR for these sequences.
[0263] This population of activated T cells now bearing the patient-derived clonal TCR(s) is then used to recognize a cancer antigen expressed by the patient. For example, if the TCR was first cloned from T cells from a patient activated by dendritic cells expressing antigen X, the transduced T cell population is now activated by co-culture with histocompatible APCs (such as dendritic cells or B cells) that have been transduced or transfected to express antigen X. Transfer of this T cell population into the patient demonstrates anti-tumor activity.
[0264] In another example, the LV encodes an inhibitor of the native TCR, such as an antisense or shRNA, that specifically targets the endogenous TCR rather than the TCR encoded in the vector, where the encoded TCR is modified to withstand the effects of the antisense or shRNA, thus generating tumor-specific T cells that target the antigen(s) rather than the endogenous TCR. These engineered T cells may have improved safety and efficacy over T cells that also express the endogenous TCR.
[0265] In this example, LVs expressing both a TCR and a CAR are generated to achieve an anti-tumor effect. The TCR and CAR can be expressed on the same vector or on different vectors. A preferred embodiment is the generation of multiple vectors to express the desired CAR, TCR, and any other gene or non-coding nucleic acid (collectively referred to as payload) that can improve the therapeutic or prophylactic effect of a pharmaceutical product.
[0266] <Example 5> Generation of lentiviral vectors expressing CAR Transduction of patient T cells with chimeric antigen receptors (CARs) is a key component. The CAR must be expressed on the surface of T cells at levels sufficient to ensure proper activation of the transduced T cells upon encounter with the CAR target cells. For example, CD19 CAR-bearing T cells are stimulated by normal B cells expressing CD19 or by leukemia cells expressing CD19. The CAR is not specific to the identified mutant tumor protein, but instead targets normal B cells or other proliferative cell types that may be present in the tumor microenvironment, such as myeloid-derived suppressor cells (MDSCs), tumor-associated macrophages (TAMs), tumor-associated fibroblasts or fibrocytes, or other cell types present in the tumor stroma.
[0267] For B cells, the safety profiles of CD19- and CD20-specific CARs are well established. Dual CARs targeting both CD19 and CD20 can also be used. It is reactivity to these foreign or self-antigens (e.g., when the antigen is shared with dendritic cells) that drives the proliferation of tumor-specific T cells upon infusion into the body and possibly during in vitro culture. A non-exhaustive list of antigens is as follows: CD19, CD20, CD22, CD33, CD38, CD14, CD11b, TIE-2, VEGFR1, and VEGFR2. DCs can be further engineered for enhancement by expressing genes such as GM-CSF, IL-4, TRP2, and / or IFN-alpha, as non-exhaustive examples, or as previously described. If desired, DCs can also be used for infusion into patients. In this way, DCs can serve to prime or boost the activity of transduced T cell populations in the body that now express their cognate TCRs.
[0268] One non-limiting example is the inclusion of other elements within the vector that can fine-tune the expression of the payload to improve or optimize the desired effect. These include, but are not limited to, gene switches, suicide genes, rheostat elements, etc. For example, expression of the CAR may be desired only for a certain period of time after therapy, and it may be preferable to turn off CAR expression but maintain TCR expression in the body for an extended period of time, thus allowing the engineered T cells to continue to seek out tumor cells in the body.
[0269] Example 6 Culture of DCs and transduction with lentiviral vectors expressing the mutagenesis library (DCmutn) To present mutant proteins to patient T cells, autologous antigen-presenting cells, such as dendritic cells (DCs), are transduced to express mutant proteins encoded by the mutagenesis, with the specific proteins expressed defined by those most highly expressed in the tumor. This in vitro procedure allows for accurate analysis and evaluation of immunotherapeutic T cell populations prior to infusion.
[0270] One non-limiting example involves isolating mononuclear cells from a patient's peripheral blood under non-GMP conditions, transducing them with a large number of LVs expressing a mutant antigen, and then differentiating them into dendritic cells using soluble IL-4 and GM-CSF. After the cells have differentiated, the patient's T cells are subcultured with the dendritic cells to expand tumor-specific T cells. The tumor-specific T cells are then isolated by several methods, and their specific TCRs are sequenced and determined. These TCRs are then synthesized and cloned into LVs for use in vectors manufactured under GMP conditions as pharmaceuticals.
[0271] Another non-limiting example utilizes the same mononuclear cell isolation and LV-mediated generation of antigen-specific dendritic cells, but under GMP conditions. Patient T cells are transduced with the LV anti-CD19 CAR before the specific T cells, and possibly also antigen-expressing DCs, are infused back into the patient as a therapeutic drug.
[0272] Example 7 Transduction of CAR (T-CAR) into PBMCs To facilitate T cell proliferation and further evade tumor-suppressing signals throughout the body, patient T cells are transduced with CARs, such as CARs targeting CD19, CD20, or other proliferation-competent autoantigens. CARS contain both "signal 1," provided, for example, by the CR3 zeta chain (signal 1 refers to the signal normally elicited by the TCR upon encounter with a cognate peptide-MHC complex and includes phosphorylation of the TCR-zeta chain), and "signal 2," provided by CD137, CD28, or other T cell signal transduction molecules known to play a role in T cell activation and induction of T cell proliferation and survival (signal 2 refers to the signal required to biologically enable T cells that have received signal 1 to further stimulate and persist either in vitro or in vivo and may include activation of the Jak-STAT pathway, PI3 kinase, PKC subtypes, TRAF pathway, or NF-kappaB pathway). Signals 1 and 2 may be encoded by the same CAR construct or distributed among different LV-encoded gene products and may be responsible for T cell activation upon encounter with specific CAR ligand(s). Expression of a CAR construct as a means to ensure the survival of TCR-transduced patient T cell populations is a central aspect of the adoptive immunotherapy methods described herein, in that the CAR provides a survival and survival signal for the T cells even when the tumor-specific TCR is insufficient to do so.
[0273] Example 8 Transduction of TCR(recT) into patient PBMCs LVs are generated that express the TCRA and TCRB chains identified by tumor and peripheral blood sequencing. Depending on the number of TCRA and TCRB pairs identified, LVs can encode multiple TCRs, or multiple LVs can be generated with a single TCR, or a combination of both. As detailed above in the description of DNA sequencing-based TCR identification, specific techniques for identifying TCRA and TCRB chain pairs are utilized in the design of these vectors. These T cells are reactive in vivo to tumor mutagenesis presented by LV-transduced DCs or B cells or tumor cells. Therefore, TCR sequences from ovarian cancer patients (e.g., from either peripheral blood or lymphocytes from tumor resections determined to be tumor-reactive by expression of a set of activation markers or reactivity to APCs expressing tumor-encoded proteins, i.e., part of the mutagenesis) are molecularly cloned into LV vectors, and the vectors are used to transduce patient T cells, so that the transduced T cell population now expresses tumor-reactive TCRs. The LV-transduced T cell population is tumor-reactive and can be infused back into the patient.
[0274] Example 9 Transduction of patient PBMCs with CAR and TCR (recT-CAR) In some cases, patient T cells are transduced with both at least one CAR and multiple recombinant TCR sequences (recT). These engineered multispecific T cells can react with tumor cells via the native TCR or recT, enhancing antitumor efficacy, while the CAR allows T cell persistence. In this case, a T cell population from a patient with ovarian cancer is transduced with LV vector(s) encoding both a TCR (originally derived from the patient and determined to be tumor-reactive) and a CAR. The TCR serves to activate and direct antitumor activity, while the CAR serves to allow persistence of the therapeutic T cell population throughout the body. To construct a specific example, an ovarian tumor is sequenced at the genome or exome level to identify tumor antigen X. Antigen X is then transduced via LV and delivered to autologous CARs, such as dendritic cells. The CAR is expressed in PCs. Patient lymphocytes are then incubated with DCs expressing X, and reactive cells are sequenced to identify TCRA and TCRB sequences. The TCRA and TCRB pairs derived from this sequencing are then used to construct LVs expressing X-specific TCR(s). Alternatively, tumor antigen-reactive T cells are identified directly from blood or tumor tissue by other activation markers, and the TCRA and TCRB sequences are identified and cloned into LVs. Patient T cells are then activated in ex vivo culture using TrasnAct reagent (which stimulates T cells via CD3 and CD28) in culture medium. The activated T cells are then transduced with two separate LVs: one LV reactive to X and encoding a TCR and a second LV encoding a TCR(s), or a vector co-expressing a CAR and a TCR. The transduced T cell population is then expanded in culture to demonstrate transgene expression. After verifying expression of the LV-encoding sequence, this therapeutic T cell population is infused back into the patient for anti-cancer effects. This approach can be multiplexed by expanding X to include a larger number of tumor-associated mutant proteins (mutanome products). This approach can also be multiplexed by identifying two or more TCRs associated with anti-tumor cells or by reactivity with APCs expressing several tumor antigens from the mutagenesis. The effector T cell population is then infused into patients for therapeutic effect; thus, a polyclonal T cell population expresses a single TCR specific for X along with a CAR, or a polyclonal T cell population expresses multiple TCRs reactive with several cancer antigens and also co-expresses a CAR. This important step of the present invention describes a novel patient-derived effector T cell population that is genetically engineered to express a CAR against a non-essential antigen encoded by normal tissue, such as CD19 or CD20, and a tumor-specific TCR.
[0275] Example 10 Co-culture of T cell populations and transduced DCs To expand tumor-reactive T cells (regardless of transduction with CAR, recT, or CAR and recT), T cells are co-cultured with DCs expressing a subset of the tumor mutagenesis. In one embodiment, recT-expressing cells do not require culture with DCs, as the combination of recT and CAR may be sufficient to expand tumor-reactive T cells throughout the body. The tumor reactivity of TCRA and TCRB-expressing vectors is verified by co-culture with antigen-presenting cells such as DCs, which can be routinely performed as a test. These cells are cultured with various cytokines or other factors that may improve the effectiveness of generating or identifying antigen-specific T cells. APCs or DCs can also be cultured in the presence of factors to further improve the expansion of antigen-specific T cells. Non-limiting examples include the addition of anti-PD1 inhibitors or IL-12, but many other factors exist and their improving effects during co-culture can be tested and evaluated.
[0276] Example 11 Expansion of RecT-CAR-T populations by co-administration or sequential administration of autologous cell products capable of delivering CAR- or RecT-mediated signaling to therapeutic T cell populations In a variation of this procedure, both the LV-mutanome-transduced DCs (or other APCs) and the effector T cell population can be infused or injected into the patient. This second cell population can be cultured for an additional period of time and then infused or cryopreserved, and then administered one or more times in succession. For example, mutanome-expressing DCs injected subcutaneously, into lymph nodes, or other sites throughout the body can enhance the proliferation and function of intravenously injected recT or native anti-tumor TCRs. In this scenario, expression of the CAR drives proliferation of the transduced T cell population upon encounter with the normal antigen for which the CAR is specific. Introduction of a dendritic cell population expressing the mutanome-encoded protein serves to drive anti-tumor T cell function via recT expressed by the T cell population. The CAR-driving autoantigen, e.g., CD19, may disappear to the extent that it no longer propagates the therapeutic T cell population. In this case, autologous APCs, e.g., dendritic cells, can be used. RecT-CAR-T populations can be expanded using cells or cryopreserved B cells, or inactivated Epstein-Barr virus-immortalized B cells. Additionally, immortalized B cell lines can be used to express the mutagenesis protein.
[0277] Immortalization of patient B cells using EBV has been performed in academic laboratories (e.g., at the University of North Carolina School of Medicine, https: / / unclineberger.org / research / core-facilities / tissueculture / b-cell-immortalization-services ) and commercial services (e.g., Applied Biologic Materials, ABM, Inc., https: / / www.abmgood.com / EBV-Cell-Immortalization.html This is a standard service available in both clinical and clinical settings (see ). In this setting, patient B cells are exposed to Epstein-Barr virus (EBV) in the form of culture supernatant, resulting in the growth of transformed B cell colonies. These patient-derived autologous cells are commonly used in genetic, virological, and immunological procedures.
[0278] Thus, this supplemental autologous cell product serves to expand the therapeutic T cell population by expressing the CAR target and the recT target antigen. If the supplemental APC product does not express the CAR target, it stimulates the therapeutic T cell population by expressing the mutagenesis protein alone.
[0279] Example 12 Specific T cell populations generated for immunotherapy The compositions and methods described herein result in several T cell populations suitable for adoptive immunotherapy. In all cases, when a CAR is included, the purpose is not to react to tumor antigens per se, but to drive patient T cell proliferation or target immunosuppressive cells, with or without co-expression of recT. These cell populations can be summarized as follows: A. T-CAR cultured with DCmutn. In this case, the T-CAR targets immune suppressor cells, while the DCmutn expands antigen-specific T cells.
[0280] B. recT-CAR not cultured with DCmutn. In this case, rec-T-CAR are genetically modified T cells that also express a CAR, but these cells themselves were not cultured with DCmutn. The rec-T TCR was identified by culturing DCmutn cells with a different set of T cells.
[0281] C. recT-CAR cultured with DCmutn. In this case, rec-T CAR cells were generated by transducing patient T cells with a CAR, culturing these cells with DCmutn cells, and expanding and isolating antigen-specific T cells that additionally express a CAR targeting tumor suppressor cell populations and longevity / expansion of the T cell population.
[0282] D. recT cells not cultured with DCmutn. In this case, rec-T cells are genetically modified T cells that do not express CAR, and these cells themselves were not cultured with DCs. rec-T TCR was identified by culturing DCmutn cells with different sets of T cells.
[0283] E. recT cultured with DCmutn. In this case, rec-T cells are cultured with DCmutn cells to obtain TCR antigen-specific T cells.
[0284] F. DC-mutanome populations that can be used in vitro and also act as adjuvants / vaccines in vivo. In this case, the DC-mutanome populations are used as vaccines. It is used to drive the proliferation of rec-T or rec-T CAR cells throughout the body.
[0285] Example 13 Alternative donors and T-cell types Two important variants of the adoptive immunotherapy procedure described herein can be considered with respect to alternative donors and T cell types.
[0286] The first variant is adoptive immunotherapy in the context of hematopoietic stem cell transplantation (HSCT). HSCT has been attempted in both hematologic malignancies and solid tumors. In an application of the procedure described herein, after HSCT, DCs (or other APCs) and T cell populations are derived from bone marrow (HSC) donors to generate therapeutic T cells, which are then infused after HSCT.
[0287] Thus, for example, a patient with myeloma has their malignancy sequenced and their mutagenesis defined. Mutagenesis protein antigens are expressed in APCs derived from HSC donors (via LV transduction). After co-culture with APCs expressing the mutagenesis-encoded proteins, HSC donor-derived T cells are activated and selected for direct use or TCR sequencing. The CAR construct is reactive with normal autoantigens, making it comparable to non-HSCT applications.
[0288] A second variant is the use of alternative T cell populations for adoptive immunotherapy. Cell surface activation markers such as CD137, CD69, PD-1, CD25, class II MHC, and others are frequently used (e.g., Miltenyi Biotec CliniMACS The definition and isolation of activated T cell populations (using CD137-biotin or CliniMACS CD25 reagents) is well established. Using these methods, activated T cell populations can be isolated from peripheral blood, tumors, or by exposure to dendritic cells (DC) expressing tumor-associated antigens. Similarly, the ability to isolate activated T lymphocytes producing activation-associated cytokines can be used as a means to isolate tumor antigen-reactive T cells (e.g., using the Miltenyi Biotec CliniMACS cytokine capture system (IFN-gamma)). Effector T cell populations are further sorted into specific cell populations using magnetic bead sorting, flow cytometry, solid-phase antibodies bound to plastic surfaces, solid-phase-bound ligands for desired markers expressed by the desired T cell type attached to a matrix, etc., in a manner where the T cell type is defined by the expression of cell surface proteins (markers). For example, CD4 cells reactive with mutant peptides bound to class II MHC or CD8 cells reactive with mutant peptides bound to class I MHC can be isolated using CD4 or CD8 immunomagnetic beads (e.g., using Miltenyi Biotec CliniMACS CD4 or CliniMACS CD8 reagents). These cell types are then used as single populations (e.g., CD4 alone) or in specific combinations or ratios. Similarly, markers of T cell differentiation are used to select specific populations for adoptive immunotherapy. These differentiation markers are used to positively or negatively select memory or naive T cell populations (e.g., using CliniMACS CD45RA or CliniMACS CD62L reagents). Furthermore, specific physiological aspects of T cell populations can be used to identify more primitive T cell populations that can be further expanded in vivo (e.g., using reagents that identify cell populations expressing the enzyme aldehyde dehydrogenase or the expression of specific combinations of sodium (Na+) and potassium channels (K+) on the T cell surface).Liepins A et al., 1989, Serotonin modulated Ca++ dependent K+ channels in alloimmune effector cell lytic function. Immunopharmacol Immunotoxicol 11:165-178 and Gallin EK, 1986, Ionic channels in leu. See J Leukoc Biol 39:241-254. Thus, in the foregoing examples, T cell subsets are isolated as therapeutic cell populations either prior to culturing T cells from a myeloma patient with APCs (DCmutn) or after exposure of randomized T cell populations to APCs, but prior to infusion into the patient. In one application, these markers or physiological characteristics are used to more precisely identify tumor-reactive T cells and thus serve as a basis for more efficient identification of TCRA and TCRB sequences. In another application, T cell populations for immunotherapy are preselected with specific markers prior to infusion into the patient, but after induction of recTCR and CAR expression via LV transduction. In another application, T cells expressing tumor-reactive markers are selected after isolation from the patient, and this selected subset is co-cultured with APCs (DCmutn) to more efficiently identify tumor-specific TCRA and TCRB sequences.
[0289] While various details have been described in conjunction with the exemplary implementations outlined above, various alternatives, modifications, variations, improvements, and / or substantial equivalents, whether known or presently unexpected or unanticipated, may become apparent upon review of the foregoing disclosure.
[0290] Each application and patent cited herein, and each document or reference cited therein (including each issued patent in litigation, the "Application Citations"), and each PCT and foreign application or patent corresponding to and / or claiming priority to any of these applications and patents, and each document cited or referenced in each Application Citation, are hereby expressly incorporated herein by reference and may be used in the practice of the invention. More generally, documents or references are cited either in the text, in a reference list before the claims, or in the text itself, and each such document or reference (the "In-Herein Cited References"), and each document or reference cited in each In-Herein Cited Reference (including any manufacturer's specifications, instructions, etc.), is hereby expressly incorporated herein by reference.
[0291] The foregoing description of some specific embodiments provides sufficient information to enable others, by applying knowledge of the present invention, to easily modify or adapt such specific embodiments for various applications without departing from the general concept; therefore, such adaptations and modifications should, and are intended to, be understood as being within the meaning and range of equivalents of the disclosed embodiments. It is understood that the words or terms used herein are for purposes of description and not of limitation. In the drawings and description, exemplary embodiments are disclosed, and although specific terminology may be employed, unless otherwise noted, they are used in a generic and descriptive sense only, and not for purposes of limitation, and the scope of the claims is therefore not so limited. Moreover, those skilled in the art will recognize that certain steps of methods discussed herein can be sequenced in a different order or steps can be combined. It is therefore intended that the scope of the appended claims not be limited to the precise embodiments disclosed herein. Those skilled in the art will recognize and ascertain using no more than routine experimentation many equivalents to the embodiments of the invention described herein. Such equivalents are encompassed by the following claims.
[0292] Sequence Listing References This application contains a Sequence Listing that has been filed electronically with the U.S. Patent and Trademark Office in a PDF file entitled "Sequence Listing," which is incorporated herein by reference.
[0293] Sequences of the present disclosure The nucleic acid and amino acid sequences listed below are represented using standard letter abbreviations for nucleotide bases and amino acids as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood to be included by any reference to the displayed strand. In the accompanying sequence listing: SEQ ID NO:5 is the nucleotide sequence of the leader / signal peptide sequence: atgctgctgctggtgaccagcctgctgctgtgcgaactgccgcatccggcgtttctgctgattccg SEQ ID NO:6 is the amino acid sequence of the leader / signal peptide sequence: MLLLVTSLLLCELPHPAFLLIP SEQ ID NO: 11 is the nucleotide sequence of the DNA CD8 transmembrane domain: atctacatct gggcgccctt ggccgggact tgtggggtcc ttctcctgtc actggttatc accctttact gc SEQ ID NO: 12 is the amino acid sequence of the CD8 transmembrane domain: Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys SEQ ID NO: 13 is the nucleotide sequence of the DNA CD8 hinge domain: accacgacgc cagcgccgcg accaccaaca ccggcgccca ccatcgcgtc gcagcccctg tccctgcgcc cagaggcgtg ccggccagcg gcggggggcg cagtgcacac gagggggctg gacttcgcct gtgat SEQ ID NO: 14 is the amino acid sequence of the CD8 hinge domain: Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr SEQ ID NO: 15 is the amino acid sequence of amino acids 118 to 178 of the hinge region of CD8.alpha (NCBI RefSeq: NP.sub.--001759.3): Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu SEQ ID NO: 16 is the amino acid sequence of the human IgG CL sequence: Gly Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser Glu Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Phe Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro Val Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn Lys Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys Ser His Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val Glu Lys Thr Val Ala Pro Thr Glu Cys Ser SEQ ID NO: 17 is the nucleotide sequence of the DNA signaling domain of 4-1BB: aaacggggca gaaagaaact cctgtatata ttcaaacaac catttatgag accagtacaa actactcaag aggaagatgg ctgtagctgc cgatttccag aagaagaaga aggagaggtgt gaactg SEQ ID NO: 18 is the amino acid sequence of the signaling domain of 4-1BB: Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu SEQ ID NO: 19 is the nucleotide sequence of the DNA signaling domain of CD3-zeta: agagtgaagt tcagcaggag cgcagacgcc cccgcgtaca agcagggcca gaaccagctc tataacgagc tcaatctagg acgaagagag gagtacgatg ttttggacaa gagacgtggc cgggaccctg agatgggggg aaagccgaga aggaagaacc ctcaggaagg cctgtacaat gaactgcaga aagataagat ggcggaggcc tacagtgaga ttgggatgaa aggcgagcgc cggaggggca aggggcacga tggcctttac cagggtctca gtacagccac caaggacacc tacgacgccc ttcacatgca ggccctgccc cctcgc SEQ ID NO: 20 is the amino acid sequence of CD3 zeta: Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Lys Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg SEQ ID NO: 21 is the nucleotide sequence of the nucleic acid sequence (DNA) SP-CD19 binder-CD8 link-CD4tm-signal LTG1562: atgctgctgctggtgaccagcctgctgctgtgcgaactgccgcatccggcgtttctgctg attccggatattcagatgacccagaccaccagcagcctgagcgcgagcctgggcgatcgc gtgaccattagctgccgcgcgagccaggatattagcaaatatctgaactggtatcagcag aaaccggatggcaccgtgaaactgctgatttatcataccagccgcctgcatagcggcgtg ccgagccgctttagcggcagcggcagcggcaccgattatagcctgaccattagcaacctg gaacaggaagatattgcgacctatttttgccagcagggcaacaccctgccgtataccttt ggcggcggcaccaaactggaaattaccggcggcggcggcagcggcggcggcggcagcggc ggcggcggcagcgaagtgaaactgcaggaaagcggcccgggcctggtggcgccgagccag agcctgagcgtgacctgcaccgtgagcggcgtgagcctgccggattatggcgtgagctgg attcgccagccgccgcgcaaaggcctggaatggctgggcgtgatttggggcagcgaaacc acctattataacagcgcgctgaaaagccgcctgaccattattaaagataacagcaaaagc caggtgtttctgaaaatgaacagcctgcagaccgatgataccgcgatttattattgcgcg aaacattattattatggcggcagctatgcgatggattattggggccagggcaccagcgtg accgtgagcagcgcggcggcgccggcgccgcgcccgccgaccccggcgccgaccattgcg agccagccgctgagcctgcgcccggaagcgtgccgcccggcggcgggcggcgcggtgcat acccgcggcctggattttgtgcagccgatggcgctgattgtgctgggcggcgtggcgggc ctgctgctgtttattggcctgggcattttttttgcgtgcgctgccgcccgcgccgcaaa aaactgc tgtatatttttaaacagccgtttatgcgcccggtgcagaccaccccaggaagaa gatggctgcagc tgccgctttccggaagaagaagaaggcggctgcgaactgcgcgtgaaa tttagccgcagcgc ggatgcgccggcgtatcagcagggccagaaccagctgtataacgaa ctgaacctgggccgcc gcgaagaatatgatgtgctggataaacgccgcggccgcgatccg gaaatgggcggcaaacc gcgccgcaaaaacccgcaggaaggcctgtataacgaactgcag aaagataaaatggcggaa gcgtatagcgaaattggcatgaaaggcgaacgccgccgcggc aaaggccatgatggcctgtat cagggcctgagcaccgcgaccaaagatacctatgatgcg ctgcatatgcaggcgctgccgccgcgc SEQ ID NO: 22 is the amino acid sequence of SP-CD19 binder-CD8 link-CD4tm-signal LTG1562:
[0294] [Table 1]
[0295] SEQ ID NO: 27 is the nucleotide sequence of Scvf cd19: gacatccaga tgacacagac tacatcctcc ctgtctgcct ctctgggaga cagagtcaccatcagttgca gggcaagtca ggacattagt aaatatttaa attggtatca gcagaaacca gatggaactg ttaaactcct gatctaccat acatcaagat tacactcagg agtcccatca aggttcagtg gcagtgggtc tggaacagat tattctctca ccattagcaa cctggagcaa gaagatattg ccacttactt ttgccaacag ggtaatacgc ttccgtacac gttcggaggg gggaccaagc tggagatcac aggtggcggt ggctcgggcg gtggtgggtc gggtggcggc ggatctgagg tgaaactgca ggagtcagga cctggcctgg tggcgccctc acagagcctg tccgtcacat gcactgtctc aggggtctca ttacccgact atggtgtaag ctggattcgc cagcctccac gaaagggtct ggagtggctg ggagtaatat ggggtagtga aaccacatac tataattcag ctctcaaatc cagactgacc atcatcaagg acaactccaa gagccaagtt ttcttaaaaa tgaacagtct gcaaactgat gacacagcca tttactactg tgccaaacat tattactacg gtggtagcta tgctatggac tactggggcc aaggaacctc agtcaccgtc tcctca SEQ ID NO: 28 is the amino acid sequence of Scvf cd19: Asp Ile Gln Met Thr Gln Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys Arg Ala Ser Gln Asp Ile Ser Lys Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile Tyr His Thr Ser Arg Leu His Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser Leu Thr Ile Ser Asn Leu Glu Gln Glu Asp Ile Ala Thr Tyr Phe Cys Gln Gln Gly Asn Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Thr Gly Gly Gly Gly Ser 100 105 110 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val Lys Leu Gln Glu Ser Gly Pro Gly Leu Val Ala Pro Ser Gln Ser Leu Ser Val Thr Cys Thr Val Ser Gly Val Ser Leu Pro Asp Tyr Gly Val Ser Trp Ile Arg Gln Pro Pro Arg Lys Gly Leu Glu Trp Leu Gly Val Ile Trp Gly Ser Glu Thr Thr Tyr Tyr Asn Ser Ala Leu Lys Ser Arg Leu Thr Ile Ile Lys Asp Asn Ser Lys Ser Gln Val Phe Leu Lys Met Asn Ser Leu Gln Thr Asp Asp Thr Ala Ile Tyr Tyr Cys Ala Lys His Tyr Tyr Tyr Gly Gly Ser Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser SEQ ID NO: 29 is the nucleotide sequence of SP-CD19 binder-CD8 link-CD8tm-signaling LTG1494 (see Figure 3A of Applicant's co-pending provisional patent application Ser. No. 62 / 239,509): atgctgctgctggtgaccagcctgctgctgtgcgaactgccgcatccggcgtttctgctg attccggataccgatattc agatgacccagaccaccagcagcctgagcgcgagcctgggc gatcgcgtgaccattagctgccgcgcgagccaggatattagcaaatatctgaactggtat cagcagaaaccggatggcaccgtgaaactgctgatttatcataccagccgcctgcatagc ggcgtgccgagccgctttagcggcagcggcagcggcaccgattatagcctgaccattagc aacctggaacaggaagatattgcgacctatttttgccagcagggcaacaccctgccgtat acctttggcggcggcaccaaactggaaattaccggcagcaccagcggcagcggcaaaccg ggcagcggcgaaggcagcaccaaaggcgaagtgaaactgcaggaaagcggcccgggcctg gtggcgccgagccagagcctgagcgtgacctgcaccgtgagcggcgtgagcctgccggat tatggcgtgagctggattcgccagccgccgcgcaaaggcctggaatggctgggcgtgatt tggggcagcgaaaccacctattataacagcgcgctgaaaagccgcctgaccattattaaa gataacagcaaaagccaggtgtttctgaaaatgaacagcctgcagaccgatgataccgcg atttattattgcgcgaaacattattattatggcggcagctatgcgatggattattggggc cagggcaccagcgtgaccgtgagcagcgcggcggcgaccaccaccccggcgccgcgcccg ccgaccccggcgccgaccattgcgagccagccgctgagcctgcgcccggaagcgtgccgc ccggcggcgggcggcgcggtgcatacccgcggcctggattttgcgtgcgatatttatatt tgggcgccgctggcgggcacctgcggcgtgctgctgctgagcctggtgattaccctgtattgcaaacgcggccgcaaaaaactgctgtatatttttaaacagccgtttatgcgcccggtg cagaccacccaggaagaagatggctgcagctgccgctttccggaagaagaagaaggcggc tgcgaactgcgcgtgaaatttagccgcagcgcggatgcgccggcgtatcagcagggccag aaccagctgtataacgaactgaacctgggccgccgcgaagaatatgatgtgctggataaa cgccgcggccgcgatccggaaatgggcggcaaaccgcgccgcaaaaacccgcaggaaggc ctgtataacgaactgcagaaagataaaatggcggaagcgtatagcgaaattggcatgaaa ggcgaacgccgccgcggcaaaggccatgatggcctgtatcagggcctgagcaccgcgacc aaagatacctatgatgcgctgcatatgcaggcgctgccgccgcgc SEQ ID NO: 30 is the amino acid sequence of SP-CD19 binder-CD8 link-CD8tm-signaling LTG1494 (see Figure 3A of Applicant's co-pending Provisional Patent Application No. 62 / 239,509):
[0296] [Table 2]
[0297] SEQ ID NO: 31 is the nucleotide sequence of SP-CD19 binder-CD8 link-CD8tm-signal (re-engineered LTI) (LTG1538) (see Figure 3B of Applicant's co-pending provisional patent application Ser. No. 62 / 239,509): atgctgctgctggtgaccagcctgctgctgtgcgaactgccgcatccggcgtttctgctg attccggatattcagatgacccagaccaccagcagcctgagcgcgagcctgggcgatcgc gtgaccattagctgccgcgcgagccaggatattagcaaatatctgaactggtatcagcag aaaccggatggcaccgtgaaactgctgatttatcataccagccgcctgcatagcggcgtg ccgagccgctttagcggcagcggcagcggcaccgattatagcctgaccattagcaacctg gaacaggaagatattgcgacctatttttgccagcagggcaacaccctgccgtataccttt ggcggcggcaccaaactggaaattaccggcggcggcggcagcggcggcggcggcagcggc ggcggcggcagcgaagtgaaactgcaggaaagcggcccgggcctggtggcgccgagccag agcctgagcgtgacctgcaccgtgagcggcgtgagcctgccggattatggcgtgagctgg attcgccagccgccgcgcaaaggcctggaatggctgggcgtgatttggggcagcgaaacc acctattataacagcgcgctgaaaagccgcctgaccattattaaagataacagcaaaagc caggtgtttctgaaaatgaacagcctgcagaccgatgataccgcgatttattattgcgcg aaacattattattatggcggcagctatgcgatggattattggggccagggcaccagcgtg accgtgagcagcgcggcggcgaccaccaccccggcgccgcgcccgccgaccccggcgccg accattgcgagccagccgctgagcctgcgcccggaagcgtgccgcccggcggcggcggc gcggtgcatacccgcggcctggattttgcgtgcgatatttatatttgggcgccgctggcg ggcacctgcggcgtgctgctgctgagcctggtgattaccctgtattgcaaacgcggccgc aaaaaactgctgtatatttttaaacagccgtttatgcgcccggtgcagaccacccaggaa gaagatggctgcagctgccgctttccggaagaagaagaaggcggctgcgaactgcgcgtg aaatttagccgcagcgcggatgcgccggcgtatcagcagggccagaaccagctgtataac gaactgaacctgggccgccgcgaagaatatgatgtgctggataaacgccgcggccgcgat cgggaaatgggcggcaaaccgcgccgcaaaaacccgcaggaaggcctgtataacgaactg cagaaagataaaatggcggaagcgtatagcgaaattggcatgaaaggcgaacgccgccgc ggcaaaggccatgatggcctgtatcagggcctgagcaccgcgaccaaagatacctatgat gcgctgcatatgcaggcgctgccgccgcgc SEQ ID NO: 32 is the amino acid sequence of SP-CD19 binder-CD8 link-CD8tm-signal (re-engineered LTI) (LTG1538) (see Figure 3B of Applicant's co-pending provisional patent application Ser. No. 62 / 239,509):
[0298] [Table 3]
Claims
1. 1. An adoptive immunotherapy composition comprising an autologous T cell population transduced with two or more lentiviral vectors encoding single or multiple chimeric antigen receptors (CARs), wherein the T cells are co-cultured with autologous antigen-presenting cells transduced with two or more lentiviral vectors expressing patient-derived tumor antigens, thereby generating an active patient-specific autologous anti-tumor T cell population capable of patient-specifically promoting in vivo expansion, persistence of patient-specific anti-tumor T cells that result in tumor stabilization, reduction, and / or elimination, and / or cancer regression and / or elimination, wherein autologous patient-specific T cells containing native T cell receptors (TCRs) are transduced with two or more lentiviral vectors to express the CARs either during or after co-culture with autologous antigen-presenting cells transduced with two or more lentiviral vectors expressing patient-derived tumor antigens, thereby generating an active patient-specific autologous anti-tumor T cell population capable of patient-specifically promoting in vivo expansion, persistence of patient-specific anti-tumor T cells that result in tumor stabilization, reduction, and / or elimination, and / or cancer regression and / or elimination, An adoptive immunotherapy composition that generates an active patient-specific autologous anti-tumor T cell population capable of promoting in vivo expansion and persistence in a patient-specific manner.
2. The adoptive immunotherapy composition of claim 1, wherein the CAR comprises at least one extracellular antigen-binding domain, at least one linker domain, at least one transmembrane domain, and at least one intracellular signaling domain.
3. The adoptive immunotherapy composition of claim 1, wherein at least one extracellular antigen-binding domain of the CAR comprises at least one single-chain variable fragment of an antibody that binds to the antigen.
4. The adoptive immunotherapy composition of claim 1, wherein at least one extracellular antigen-binding domain of the CAR comprises at least one single-chain variable fragment of an antibody that binds to the antigen.
5. The adoptive immunotherapy composition of claim 1, wherein at least one extracellular antigen-binding domain of the CAR, at least one intracellular signaling domain of the CAR, or both, is connected to the transmembrane domain by a linker or spacer domain.
6. The adoptive immunotherapy composition of claim 5, wherein the extracellular antigen-binding domain of the CAR is preceded by a leader peptide.
7. The extracellular antigen-binding domain of the CAR targets an antigen comprising CD19, CD20, CD22, ROR1, TSLPR, mesothelin, CD33, CD38, CD123 (IL3RA), CD138, BCMA (CD269), GPC2, GPC3, FGFR4, c-Met, PSMA, glycolipid F77, EGFRvIII, GD-2, NY-ESO-1 TCR, MAGE A3 TCR, or any combination thereof, wherein the extracellular antigen-binding domain of the CAR is an anti-CD19 scFV antigen-binding domain, an anti-CD20 scFV antigen-binding domain, an anti-CD22 scFV antigen-binding domain, an anti-ROR1 scFV antigen-binding domain, an anti-TSLPR scF antigen-binding domain, anti-mesothelin scF antigen-binding domain, anti-CD33 scF antigen-binding domain, anti-CD38 scF antigen-binding domain, anti-CD123 (IL3RA) scF antigen-binding domain, anti-CD138 scF antigen-binding domain, anti-BCMA (CD269) scF antigen-binding domain, anti-GPC2 scF antigen-binding domain, anti-GPC3 scF antigen-binding domain, anti-FGFR4 scF antigen-binding domain, anti-c-Met scF antigen-binding domain, anti-PMSA scF antigen-binding domain, anti-glycolipid F77 scF antigen-binding domain, anti-EGFRvIII scF antigen-binding domain, anti-GD-2 scF antigen-binding domain, anti-NY-ESo-1 TCR 2. The adoptive immunotherapy composition of claim 1, comprising an scFv antigen-binding domain, an anti-MAGE A3 TCR scFv antigen-binding domain, or an amino acid sequence thereof having 85%, 90%, 95%, 96%, 97%, 98% or 99% identity, or any combination thereof.
8. The adoptive immunotherapy composition of claim 1, wherein the linker or spacer domain of the CAR is derived from the extracellular domain of CD8 and is linked to a transmembrane domain.
9. The adoptive immunotherapy composition of claim 1, wherein the CAR further comprises a transmembrane domain comprising a transmembrane domain of a protein selected from the group consisting of the alpha, beta or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, CD271, TNFRSF19, or any combination thereof.
10. The adoptive immunotherapy composition of claim 1, wherein at least one intracellular signaling domain further comprises a CD3 zeta intracellular domain.
11. The adoptive immunotherapy composition of claim 10, wherein at least one intracellular signaling domain is located C-terminal to the CD3 zeta intracellular domain.
12. The adoptive immunotherapy composition of claim 10, wherein at least one intracellular signaling domain comprises a costimulatory domain, a primary signaling domain, or any combination thereof.
13. The adoptive immunotherapy composition of claim 12, wherein at least one costimulatory domain comprises a functional signaling domain of OX40, CD70, CD27, CD28, CD5, ICAM-1, LFA-1 (CD11a / CD18), ICOS (CD278), DAP10, DAP12 and 4-1BB (CD137), or any combination thereof.
14. A pharmaceutical composition comprising a population of autologous T cells transduced with one or more lentiviral vectors encoding single or multiple chimeric antigen receptors (CARs), wherein the T cells are co-cultured with autologous antigen-presenting cells transduced with one or more lentiviral vectors expressing patient-derived tumor antigens, thereby generating an active patient-specific autologous anti-tumor T cell population capable of patient-specifically promoting in vivo expansion, persistence of patient-specific anti-tumor T cells that result in tumor stabilization, reduction, and / or elimination, and / or cancer regression and / or elimination, wherein autologous patient-specific T cells containing native T cell receptors (TCRs) are transduced with lentiviral vectors to express CARs either during or after co-culture with autologous antigen-presenting cells transduced with one or more lentiviral vectors expressing patient-derived tumor antigens, thereby generating an active patient-specific autologous anti-tumor T cell population capable of patient-specifically promoting in vivo expansion, persistence of patient-specific anti-tumor T cells that result in tumor stabilization, reduction, and / or elimination, and / or cancer regression and / or elimination, wherein the autologous patient-specific T cells containing native T cell receptors (TCRs) are transduced with lentiviral vectors to express CARs either during or after co-culture with autologous antigen-presenting cells transduced with one or more lentiviral vectors expressing patient-derived tumor antigens, thereby generating an active patient-specific anti-tumor T cell population capable of patient-specifically promoting in vivo expansion, persistence of patient-specific anti-tumor T cells that result in tumor stabilization, reduction, and / or elimination, and / or cancer regression and / or elimination. A pharmaceutical composition for generating an active patient-specific autologous anti-tumor T cell population capable of promoting in vivo expansion and persistence in a patient-specific manner.
15. The pharmaceutical composition described in claim 14, wherein the T cells are T cells of a human having a hematological cancer.
16. The pharmaceutical composition described in claim 15, wherein the hematological cancer is leukemia or lymphoma.
17. The pharmaceutical composition of claim 14, wherein the leukemia is chronic lymphocytic leukemia (CLL), acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML) or chronic myelogenous leukemia (CML).
18. The pharmaceutical composition described in claim 16, wherein the lymphoma is mantle cell lymphoma, non-Hodgkin's lymphoma or Hodgkin's lymphoma, or the hematological cancer is multiple myeloma.
19. The pharmaceutical composition described in claim 15, wherein the hematological cancer is multiple myeloma.
20. The pharmaceutical composition of claim 14, wherein the human cancer comprises oral and pharyngeal cancer (tongue, mouth, pharynx, head and neck), digestive system cancer (esophagus, stomach, small intestine, colon, rectum, anus, liver, intrahepatic bile duct, gallbladder, pancreas), respiratory system cancer (larynx, lung and bronchi), bone and joint cancer, soft tissue cancer, skin cancer (melanoma, basal cell carcinoma and squamous cell carcinoma), childhood tumors (neuroblastoma, rhabdomyosarcoma, osteosarcoma, Ewing's sarcoma), tumors of the central nervous system (brain tumor, astrocytoma, glioblastoma, glioma), and adult cancers including cancer of the breast, reproductive system (cervix, uterus, ovary, vulva, vagina, prostate, testicle, penis, endometrium), urinary system (bladder, kidney and renal pelvis, ureter), eye and orbit, endocrine system (thyroid), and brain and other nervous systems, or any combination thereof.
Citation Information
Patent Citations
Method for treating cancer using engineered T cells
JP2018521122A
Double transgenic t cells comprising a car and a TCR and their methods of use
WO2013126726A1
Human application of engineered chimeric antigen receptor (CAR) t-cells
WO2014186469A2