Method for suppressing non-specific nucleic acid amplification

Incorporating a chaotropic agent in the RT-RamDA reaction solution suppresses nonspecific amplification, ensuring reproducible and stable RT-RamDA reactions by preventing primer misannealing and dissociating aberrant amplification products.

JP7824596B2Active Publication Date: 2026-03-05TOYOBO CO LTD +1
View PDF 3 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2019-09-27
Publication Date
2026-03-05

AI Technical Summary

Technical Problem

Nonspecific nucleic acid amplification occurs during RT-RamDA reactions, leading to smearing on the high-molecular-weight side when detected by electrophoresis, which affects the reproducibility and accuracy of the method.

Method used

Performing the RT-RamDA reaction in the presence of template RNA and a chaotropic agent in the RT-RamDA reaction solution, with a final concentration of the chaotropic agent ranging from greater than 0 mM to 50 mM, preferably 20 mM or less, to suppress nonspecific amplification.

Benefits of technology

Effectively suppresses nonspecific nucleic acid amplification, enabling highly reproducible and stable RT-RamDA reactions without impairing quantitative performance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007824596000003
    Figure 0007824596000003
  • Figure 0007824596000001
    Figure 0007824596000001
  • Figure 0007824596000002
    Figure 0007824596000002
Patent Text Reader

Abstract

To provide a method for suppressing non-specific nucleic acid amplification in an RT-RamDA reaction.SOLUTION: The present invention provides a method for suppressing non-specific nucleic acid amplification that may occur in an RT-RamDA reaction solution by coexisting a template RNA and a chaotropic agent in the RT-RamDA reaction solution. Preferably, the final concentration of the chaotropic agent in the RT-RamDA reaction solution is more than 0 mM and 50 mM or less. The chaotropic agent is preferably at least one selected from the group consisting of guanidinium ion, urea ion, iodide ion, lithium ion, and salts thereof.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a method for suppressing non-specific nucleic acid amplification in an RT-RamDA reaction. [Background technology]

[0002] The RT-RamDA method is an amplification reverse transcription method in which cDNA is amplified using RNA as a template by incubating a mixture containing template RNA, primers, DNA strand-specific RNA:DNA hybrid strand degrading enzyme, RNase H minus reverse transcriptase, and a substrate (Patent Document 1). It has been reported that the RT-RamDA method can increase cDNA by 10 to 100 times compared to conventional reverse transcription reactions. Therefore, it is possible to detect low-expression genes from minute amounts of RNA, which was previously difficult, and to expand the number of detectable genes, making it a promising nucleic acid amplification technique. [Prior art documents] [Patent documents]

[0003] [Patent Document 1] International Publication No. 2016 / 052619 Brochure Summary of the Invention [Problem to be solved by the invention]

[0004] The present inventors have discovered that nonspecific nucleic acid amplification sometimes occurs during RT-RamDA reactions, resulting in smearing on the high-molecular-weight side when detected by electrophoresis. This finding suggests the need for a method to suppress such unintended nonspecific nucleic acid amplification. While not wishing to be bound by theory, one possible cause of this nonspecific amplification is inappropriate annealing of primers or the formation of aggregates of abnormal amplification products. Therefore, one object of the present invention is to provide a means for suppressing the above-described nonspecific nucleic acid amplification that occurs during the RT-RamDA method. [Means for solving the problem]

[0005] As a result of intensive research to achieve the above-mentioned objective, the inventors discovered that in the RT-RamDA method, nonspecific nucleic acid amplification reactions can be suppressed by performing the RT-RamDA reaction in the presence of template RNA and a chaotropic agent in the RT-RamDA reaction solution, and thus completed the present invention.

[0006] That is, the present invention includes the following aspects. [Item 1] A method for suppressing nonspecific nucleic acid amplification in an RT-RamDA reaction, characterized by allowing a template RNA and a chaotropic agent to coexist in an RT-RamDA reaction solution. [Item 2] The method described in Item 1, in which a template RNA-containing biological sample to be subjected to an RT-RamDA reaction is treated with a cell lysis agent containing a chaotropic agent to prepare a template RNA-containing biological sample solution containing a chaotropic agent, and the template RNA-containing biological sample solution containing the chaotropic agent is mixed with the RT-RamDA reaction solution to allow the template RNA and the chaotropic agent to coexist in the RT-RamDA reaction solution. [Item 3] The method according to Item 1 or 2, wherein the final concentration of the chaotropic agent in the RT-RamDA reaction solution is greater than 0 mM and not greater than 50 mM. [Item 4] The method according to any one of Items 1 to 3, wherein the final concentration of the chaotropic agent in the RT-RamDA reaction solution is greater than 0 mM and equal to or less than 20 mM. [Item 5] The method according to any one of Items 1 to 4, wherein the chaotropic agent is at least one chaotropic agent selected from the group consisting of guanidinium ions, urea ions, iodide ions, lithium ions, and salts thereof. [Item 6] The method according to any one of Items 1 to 5, wherein the chaotropic agent is a guanidinium salt. [Item 7] The method according to any one of Items 1 to 6, wherein the chaotropic agent is guanidine thiocyanate. [Item 8] The method according to any one of Items 1 to 7, wherein the RT-RamDA reaction solution further contains an inorganic salt. [Item 9] The method according to Item 8, wherein the inorganic salt is at least one selected from the group consisting of potassium salts, manganese salts, and magnesium salts. [Item 10] A method for stabilizing an RT-RamDA reaction, characterized by allowing a template RNA and a chaotropic agent to coexist in an RT-RamDA reaction solution. [Item 11] A kit for use in the method according to any one of Items 1 to 10, comprising an RT-RamDA reaction solution containing a chaotropic agent. [Item 12] A kit for use in the method according to any one of Items 1 to 10, comprising a cell lysis solution containing a chaotropic agent. [Effects of the Invention]

[0007] The present invention makes it possible to effectively suppress nonspecific nucleic acid amplification reactions in the RT-RamDA reaction, thereby enabling highly reproducible and stable RT-RamDA reactions to be performed without impairing the quantitative performance of the RT-RamDA method. [Brief explanation of the drawings]

[0008] [Figure 1] FIG. 1 shows the amplification curves of quantitative PCR under conditions 1 to 4 in Example 1. DETAILED DESCRIPTION OF THE INVENTION

[0009] The following is a detailed description of the embodiments of the present invention, but the present invention is not limited thereto. All non-patent documents and patent documents described in this specification are incorporated herein by reference. In addition, the term "to" in this specification means "at least, at most." For example, "X to Y" in the specification means "at least X, at most Y." In addition, "and / or" in this specification means either one or both.

[0010] In one embodiment, the method of the present invention for suppressing nonspecific nucleic acid amplification in the RT-RamDA reaction is characterized in that the RT-RamDA reaction is carried out in the presence of a template RNA and a chaotropic agent in the RT-RamDA reaction solution. By amplifying cDNA from template RNA in the presence of a chaotropic agent in the RT-RamDA reaction solution, nonspecific nucleic acid amplification that may occur in the RT-RamDA reaction can be effectively suppressed or reduced. Furthermore, the method of the present invention can also be considered a method for stabilizing the RT-RamDA reaction, since it suppresses nonspecific nucleic acid amplification and enables the RT-RamDA reaction to be carried out stably and reproducibly.

[0011] RT-RamDA method (amplified reverse transcription method in which reverse transcription of template RNA amplifies cDNA using RNA as a template) The RT-RamDA method is a nucleic acid amplification method that includes a step of incubating a mixture containing a template RNA, a primer, a DNA strand-specific RNA:DNA hybrid strand degrading enzyme, an RNase H minus reverse transcriptase, and a substrate. Therefore, the RT-RamDA reaction solution of the present invention contains at least the above-mentioned components (i.e., template RNA, primer, DNA strand-specific RNA:DNA hybrid strand degrading enzyme, RNase H minus reverse transcriptase, and substrate). In the RT-RamDA method, a complementary DNA (cDNA) to the template RNA is synthesized using the RNA-dependent DNA polymerase activity of the RNase H minus reverse transcriptase. The cDNA strand of the RNA-cDNA hybrid strand is randomly cleaved by the DNA strand-specific RNA:DNA hybrid strand degrading enzyme. The cleavage site serves as a starting point for the strand displacement activity of the RNase H minus reverse transcriptase to remove the 3'-end cDNA strand from the RNA, and a new cDNA strand is synthesized at the site removed by the RNase H minus reverse transcriptase. Details of the RT-RamDA method are described in, for example, U.S. Patent Application Publication No. 2017 / 0275685 (the entirety of which is incorporated herein by reference).

[0012] In one embodiment, the present invention is characterized by suppressing nonspecific nucleic acid amplification that can occur during the RT-RamDA method. As used herein, "nonspecific nucleic acid amplification" is not particularly limited and refers to the generation of amplification products other than normal specific amplification products during the RT-RamDA method. Examples of nonspecific amplification product formation include the formation of linear multimers (concatemers) of amplification products, aggregates of linear multimers (concatemers) of amplification products, linear multimers (concatemers) between primers, aggregates of linear multimers (concatemers) between primers, mismatch annealing of primers, and / or primer dimer formation. The present invention does not necessarily suppress the formation of all of the nonspecific amplification products listed above; for example, it may suppress the formation of at least one of the nonspecific amplification products listed above. In this specification, the criteria for determining whether nonspecific nucleic acid amplification is suppressed include, for example, whether the linear relationship between the initial template amount and the Ct value improves and / or the PCR efficiency improves (e.g., PCR efficiency approaches 100%) when a chaotropic agent is co-present in the RT-RamDA reaction solution compared to when a chaotropic agent is not used.

[0013] Chaotropic agents One feature of the present invention is the inclusion of a chaotropic agent in the RT-RamDA reaction solution. Chaotropic agents are components that inhibit the stabilization of intermolecular interactions mediated by non-covalent forces such as hydrogen bonds, van der Waals forces, and hydrophobic effects. Therefore, chaotropic agents can disrupt the three-dimensional structure of macromolecules such as proteins, DNA, and RNA, denaturing them. Therefore, the use of excessive amounts of chaotropic agents may affect the RT-RamDA reaction. However, without being bound by theory, the inventors' findings suggest that the inclusion of a chaotropic agent in the RT-RamDA reaction solution under given conditions may, for example, prevent primer misannealing and / or appropriately dissociate aggregates of aberrant amplification products, thereby suppressing unintended nonspecific nucleic acid amplification and stabilizing the RT-RamDA reaction.

[0014] The chaotropic agent that can be used in the present invention is not particularly limited as long as it exhibits the effects of the present invention, and can include, for example, at least one selected from the group consisting of guanidinium ion, urea ion, iodide ion, lithium ion, and salts thereof (e.g., hydrochloride, thiocyanate, perchlorate, etc.). From the viewpoints of having a relatively small inhibitory effect on the RT-RamDA reaction and being able to highly suppress nonspecific nucleic acid amplification in the RT-RamDA reaction, it is preferable to use a guanidinium ion and / or a salt thereof as the chaotropic agent, more preferably a guanidinium salt, and even more preferably guanidine thiocyanate and / or guanidine hydrochloride, with guanidine thiocyanate being particularly preferred.

[0015] The amount of chaotropic agent added to the RT-RamDA reaction solution is not particularly limited as long as the effects of the present invention are achieved. However, as mentioned above, the presence of an excessive amount of chaotropic agent in the RT-RamDA reaction solution may inhibit the RT-RamDA reaction. Therefore, the concentration of the chaotropic agent used in the present invention is, for example, preferably 50 mM or less, more preferably 40 mM or less, even more preferably 30 mM or less, and particularly preferably 20 mM or less, as the final concentration in the RT-RamDA reaction solution. The lower limit of the final concentration of the chaotropic agent in the RT-RamDA reaction solution is not particularly limited as long as the effects of the present invention are achieved. For example, it can be more than 0 mM, preferably 1 mM or more, more preferably 3 mM or more, even more preferably 5 mM or more, even more preferably 7 mM or more, and particularly preferably 10 mM or more.

[0016] Template RNA The template RNA used in the RT-RamDA reaction can be any RNA, including RNA extracted from tissues or cells, or RNA extracted from tissues or cells and further purified (e.g., purified RNA treated by any purification method known in the art, such as ethanol precipitation or column purification). Conveniently, a biological sample (e.g., cells or tissue) to be analyzed by the RT-RamDA method can be lysed with a cell lysing agent (also referred to herein as a "template RNA-containing biological sample") and used directly in the RT-RamDA reaction without further extraction or purification steps. The amount of template RNA contained in the RT-RamDA reaction solution is not particularly limited as long as the effects of the present invention are achieved. However, from the viewpoints of more reliably and accurately performing the RT-RamDA reaction and easily obtaining stable, highly reproducible results, the amount is preferably 0.1 pg / μl to 10 ng / μl, more preferably 0.1 pg / μl to 1 ng / μl. In the present invention, when a "template RNA-containing biological sample" is used as the template RNA, the biological sample may be used in an amount such that the amount of template RNA contained in the biological sample falls within the above concentration range.

[0017] The type of cell or tissue from which template RNA to be amplified is extracted is not particularly limited, and any type of cell or tissue may be used. For example, the number of cells can be appropriately adjusted using a cell sorter. For example, RNA extracted from a small number of cells (e.g., 1 to 100, preferably 1 to 10, more preferably 1 or 2, more preferably 1) can also be used. Methods for extracting RNA from cells usually include a step of lysing the cells using a cell lysis agent containing a cell lysis component. The cell lysing agent may contain, for example, a surfactant as a cell lysis component. Examples of surfactants include, but are not limited to, anionic surfactants (e.g., sodium dodecyl sulfate, sodium cholate, sodium deoxycholate), cationic surfactants (e.g., cetyltrimethylammonium bromide), nonionic surfactants (e.g., octylphenol ethoxylate, polyoxyethylene lauryl ether, polyoxyethylene stearyl ether, polyoxyethylene sorbitan monolaurate), and zwitterionic surfactants (e.g., 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid). Furthermore, the cell lysing agent may optionally contain, as a cell lysis component, a protease (e.g., protease K), an RNase inhibitor, or a combination of two or more thereof. In more specific embodiments, the cell lysis agent used in the present invention may contain a chaotropic agent (e.g., urea, lithium perchlorate, guanidinium salts such as guanidine hydrochloride, etc.), or in other specific embodiments, the cell lysis agent may not contain a chaotropic agent. The cell lysis agent is usually used in the form of an aqueous solution in which the cell lysis components described above are dissolved in an aqueous solvent such as water (preferably nuclease-free water).

[0018] In certain embodiments, the RT-RamDA method of the present invention can use a template RNA-containing biological sample obtained by lysing a biological sample (e.g., cells, tissues, etc.) using a cell lysis agent containing a chaotropic agent. Such a template RNA-containing biological sample obtained by treatment with a cell lysis agent containing a chaotropic agent will directly become a biological sample solution containing a chaotropic agent unless further extraction and purification steps are performed. Therefore, when mixed with an RT-RamDA reaction solution, the chaotropic agent will be carried over into the RT-RamDA reaction solution. When such a biological sample solution containing a chaotropic agent is used as the template RNA-containing biological sample, there is an advantage in that it is not necessary to separately add a chaotropic agent to the RT-RamDA reaction solution.

[0019] When a biological sample solution obtained by lysing a biological sample with a cell lysis agent containing a chaotropic agent is used as a template RNA-containing biological sample, it is preferable to use a cell lysis agent in which the total final concentration of the chaotropic agent in the RT-RamDA reaction solution is preferably 50 mM or less, more preferably 40 mM or less, even more preferably 30 mM or less, and particularly preferably 20 mM or less, regardless of whether a chaotropic agent is added separately. Similarly, it is preferable to use a cell lysis agent in which the lower limit of the total final concentration of the chaotropic agent in the RT-RamDA reaction solution is adjusted to, for example, more than 0 mM, preferably 1 mM or more, more preferably 3 mM or more, even more preferably 5 mM or more, even more preferably 7 mM or more, and especially 10 mM or more.

[0020] DNA strand-specific RNA:DNA hybrid strand degrading enzyme The DNA strand-specific RNA:DNA hybrid strand-cleaving enzyme is preferably an enzyme that has the activity of cleaving the DNA strand in an RNA-DNA hybrid strand. Examples of such enzymes that can be used include double-strand-specific DNase and non-specific DNase. The amount of DNA strand-specific RNA:DNA hybrid strand-cleaving enzyme contained in the RT-RamDA reaction solution is not particularly limited as long as the effects of the present invention are achieved. However, from the viewpoints of enabling the RT-RamDA reaction to be carried out more reliably and accurately and facilitating the stable and highly reproducible results, the amount is preferably 0.01 U / μl to 0.1 U / μl.

[0021] The double-strand-specific degrading enzyme (also called double-strand-specific nuclease; DSN) can be derived from a prokaryote or a eukaryote, but preferably, a double-strand-specific DNA degrading enzyme derived from crustaceans or a modified form thereof can be used. Specific examples include the following: Solenocera melantho (shrimp shrimp) DNase Penaeus japonicus (prawn) DNase Paralithodes camtschaticus (king crab) DSN Pandalus borealis (sea shrimp) dsDNase Chionoecetes opilio (snow crab) DSN Other DSN homologs The double-strand-specific DNase is preferably an enzyme that has DNA degradation activity even at temperatures below 60° C. Among the above, shrimp-derived double-strand-specific DNase or a modified form thereof is preferred. Commercially available double-strand-specific DNases can be used, including dsDNase (ArcticZymes), H1-dsDNase (ArcticZymes), dsDNase (Thermo Scientific), Shrimp DNase, Recombinant (Affymetrix), Atlantis dsDNase (Zymo Research), and Thermolabile Nuclease (Roche).

[0022] Examples of nonspecific DNases include enzymes that have the activity of cleaving the DNA strand of an RNA-DNA hybrid chain, but have substantially no activity of cleaving the RNA strand of an RNA-DNA hybrid chain or single-stranded RNA, and preferably have a lower activity of cleaving single-stranded DNA compared to the activity of cleaving the DNA strand of an RNA-DNA hybrid chain. Nonspecific DNases are preferably enzymes that have DNA degradation activity even at temperatures below 60°C. Commercially available nonspecific DNases can be used, such as DNase I (manufactured by Thermo Fisher). The non-specific DNase to be used may be an enzyme derived from a prokaryote or a eukaryote, but preferably, a mammalian non-specific DNase or a variant thereof, more preferably, a bovine non-specific DNase or a variant thereof, can be used.

[0023] The above-mentioned variant refers to an enzyme obtained by modifying a naturally occurring amino acid sequence. Specifically, it refers to an enzyme consisting of an amino acid sequence that has 80% or more (preferably 90% or more, more preferably 95% or more) sequence identity with a naturally occurring amino acid sequence, as well as an enzyme consisting of an amino acid sequence in which one or several (for example, 1 to 10, preferably 1 to 5, more preferably 1 to 3) amino acids have been deleted, substituted, and / or added in the naturally occurring amino acid sequence.

[0024] Single-stranded DNA binding protein The RT-RamDA reaction solution may further contain a single-stranded DNA-binding protein. Single-stranded DNA-binding proteins are typically used together with a DNA-strand-specific RNA:DNA hybrid strand-degrading enzyme. In particular, when a non-specific DNA degrading enzyme is used as the DNA-strand-specific RNA:DNA hybrid strand-degrading enzyme, it is preferable to contain a single-stranded DNA-binding protein. Examples of single-stranded DNA-binding proteins include T4 gene 32 protein, RecA, SSB (single-stranded DNA binding protein), and combinations of two or more of these. When the RT-RamDA reaction solution contains a single-stranded DNA-binding protein, the amount of the single-stranded DNA-binding protein added is not particularly limited as long as the effects of the present invention are achieved. However, from the viewpoints of more reliably carrying out the RT-RamDA reaction and easily obtaining stable, highly reproducible results, the amount is preferably 10 ng / μl to 100 ng / μl.

[0025] Primer Primers used in the RT-RamDA reaction include primers specific to the template RNA, oligo dT primers, random primers, and combinations of two or more of these. When oligo dT primers and random primers are used in combination, the molar ratio of oligo dT primers to random primers can be, for example, 1:5 to 1:15, preferably 1:8 to 1:12. Examples of random primers include completely random primers and NSR (Not So Random) primers.

[0026] A completely random primer is a mixture of primers having various base sequences, each of which is a completely random base sequence. A completely random primer may contain a sequence that is completely identical (or completely complementary) to an rRNA sequence. Examples of completely random primers include completely random pentamers, completely random hexamers, completely random heptamers, completely random octamers, and combinations thereof. For example, a completely random hexamer may be a mixture of all possible base sequences (46 types) using the four types of nucleotides (A, T, C, and G).

[0027] NSR primers are fully random primers that have been stripped of primers with sequences completely complementary to rRNA sequences, such as 18S rRNA, 28S rRNA, 12S rRNA, 16S rRNA, and combinations thereof. Examples of NSR primers include fully random hexamers excluding hexamers with sequences completely complementary to rRNA sequences, and also fully random pentamers, heptamers, octamers, and other primer sets excluding those with sequences completely complementary to rRNA sequences. By using such NSR primers, mRNA and the like can be analyzed with higher sensitivity.

[0028] Details of NSR primers are described in, for example, 1) Amour et al., Digital transcriptome profiling using selective hexamer priming for cDNA synthesis, Nature Methods, Vol. 6, No. 9, 2009, pp. 647-649; 2) Ozsolak et al., Digital transcriptome profiling from attomole-level RNA samples, Genome Research, Vol. 20, 2010, pp. 519-525; and 3) U.S. Patent Application Publication No. 2010 / 0029511 (the entire contents of which are incorporated herein by reference). The length of the primer is, for example, 5 bases or more, preferably 6 bases or more, from the viewpoint of annealing, and, for example, 30 bases or less, preferably 25 bases or less, more preferably 20 bases or less, from the viewpoint of synthesis. The concentration of the primer in the RT-RamDA reaction solution is not particularly limited, but is, for example, 1 to 10 μM, preferably 2 to 6 μM, and more preferably 3 to 5 μM.

[0029] Deoxyribonucleotides (substrates) Deoxyribonucleotides are preferably deoxyribonucleoside triphosphates. Examples of deoxyribonucleotide triphosphates include deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), deoxyadenosine triphosphate (dATP), deoxythymidine triphosphate (dTTP), deoxyuridine triphosphate (dUTP), derivatives thereof, and combinations of two or more thereof. Among these, mixtures of dCTP, dGTP, dATP, and dTTP, mixtures of dCTP, dGTP, dATP, and dUTP, mixtures of dCTP, dGTP, dATP, dTTP, and dUTP, etc. are preferred. The amount of deoxyribonucleotides (substrates) contained in the RT-RamDA reaction solution is not particularly limited as long as it achieves the effects of the present invention, but it is preferably 0.1 to 5 mM from the viewpoint of enabling the RT-RamDA reaction to be carried out more reliably and making it easier to obtain stable, highly reproducible results.

[0030] RNase H minus reverse transcriptase The RNase H minus reverse transcriptase used in the RT-RamDA reaction refers to any protein (enzyme) that has reverse transcription activity (RNA-dependent DNA polymerase activity) but does not have RNase H activity. Examples of RNase H minus reverse transcriptases include avian myeloblastosis virus reverse transcriptase (AMV-RT), Moloney murine leukemia virus reverse transcriptase (MMLV-RT), human immunovirus reverse transcriptase (HIV-RT), EIRV-RT, RAV2-RT, C. hydrogenogormans DNA polymerase, rTth DNA polymerase, SuperScript I, SuperScript II, their mutants, and their derivatives. Among these, MMLV-RT is preferred. The amount of RNase H minus reverse transcriptase contained in the RT-RamDA reaction solution is not particularly limited as long as it achieves the effects of the present invention, but from the viewpoint of enabling the RT-RamDA reaction to be carried out more reliably and making it easier to obtain stable and highly reproducible results, it is preferably 0.2 to 2 U / μl.

[0031] The RT-RamDA reaction solution of the present invention may be provided as a reagent containing RNase H minus reverse transcriptase from the beginning, or may be prepared immediately before use and added to the RT-RamDA reaction solution before the RT-RamDA reaction. When added to the RT-RamDA reaction solution immediately after use, the RNase H minus reverse transcriptase may be used as is, lyophilized, or diluted with water (preferably nuclease-free water). For example, the RT-RamDA reaction solution may be diluted to 1 / 20 to 1 / 30 so that the final concentration of the RNase H minus reverse transcriptase in the RT-RamDA reaction solution falls within the above-mentioned range.

[0032] Inorganic salts The RT-RamDA reaction solution of the present invention preferably further contains an inorganic salt. The presence of an inorganic salt in the RT-RamDA reaction solution enables the RT-RamDA reaction to proceed more efficiently. The type of inorganic salt that can be used in the present invention is not particularly limited as long as it achieves the effects of the present invention, but examples include potassium salts, manganese salts, and / or magnesium salts, with potassium salts being preferred. When an inorganic salt is present in the RT-RamDA reaction solution, the final concentration of the inorganic salt in the reaction solution is not particularly limited, but can be, for example, 20 to 100 mM.

[0033] DNA polymerase The RT-RamDA reaction solution of the present invention may or may not contain a DNA polymerase. When the RT-RamDA reaction solution of the present invention contains a DNA polymerase, any DNA polymerase can be used, including, but not limited to, the following DNA polymerases: Taq, Tbr, Tfl, Tru, Tth, Tli, Tac, Tne, Tma, Tih, Tfi, Pfu, Pwo, Kod, Bst, Sac, Sso, Poc, Pab, Mth, Pho, ES4, VENT™, DEEPVENT™, and variants thereof

[0034] RNase inhibitors The RT-RamDA reaction solution of the present invention may contain an RNase inhibitor. The RNase inhibitor is not particularly limited, and examples thereof include proteins derived from human placenta, rat lung, or pig liver.

[0035] Additives The RT-RamDA reaction solution of the present invention may further contain other additives, such as buffers, salts, and combinations of two or more of these. Examples of buffers include Tris, Tricine, Bis-Tricine, Hepes, Mops, Tes, Taps, Pipes, Caps, and combinations of two or more of these. Buffers are usually dissolved in water (preferably nuclease-free water) and used in the form of an aqueous solution. Examples of salts include chlorides (e.g., lithium chloride, sodium chloride, potassium chloride, magnesium chloride, manganese chloride), acetates (e.g., lithium acetate, sodium acetate, potassium acetate, magnesium acetate, manganese acetate), sulfates (e.g., potassium sulfate, magnesium sulfate, manganese sulfate), and combinations of two or more thereof.

[0036] ·incubation The RT-RamDA reaction involves incubating an RT-RamDA reaction solution containing the template RNA to be analyzed, primers, a DNA strand-specific RNA:DNA hybrid strand-cleaving enzyme, an RNase H minus reverse transcriptase, a substrate, and optionally a single-stranded DNA-binding protein and other optional components under specified conditions to carry out a nucleic acid amplification reaction. The incubation in the RT-RamDA reaction may be carried out under isothermal conditions or under thermal cycling conditions. The reverse transcriptase may then be inactivated, if necessary. The method for inactivating reverse transcription is not particularly limited, but may include, for example, incubation at 90-100°C for a specified time (e.g., 1-10 minutes).

[0037] (1) Isothermal conditions When incubation is performed under isothermal conditions, it can be performed at a predetermined temperature, for example, between 25°C and less than 50°C, preferably between 30 and 45°C, more preferably between 35 and 40°C, for example, 37°C, for a predetermined time (for example, 5 to 180 minutes, preferably 10 to 150 minutes). Incubation at a predetermined temperature between 25°C and less than 50°C may be carried out in two or more stages. For example, incubation may be performed at a predetermined temperature between 25°C and less than 30°C for 5 to 15 minutes, then at a predetermined temperature between 30°C and less than 35°C for 5 to 15 minutes, and then at a predetermined temperature between 35°C and less than 50°C for a predetermined time (e.g., 5 to 60 minutes). After incubation at a predetermined temperature between 25°C and less than 50°C, incubation may be performed at a predetermined temperature between 50°C and less than 100°C, for example. Incubation at a predetermined temperature between 50°C and less than 100°C may be performed in two or more stages. For example, incubation may be performed at a predetermined temperature between 50°C and less than 80°C for 5 to 15 minutes, followed by incubation at a predetermined temperature between 80°C and 90°C for 5 to 15 minutes.

[0038] (2) Thermal cycle conditions When incubation is performed under thermal cycling conditions, for example, a predetermined temperature T1 (e.g., 25°C) between 20°C and less than 30°C and a predetermined temperature T2 (e.g., 37°C) between 30 and 45°C may be combined, with one cycle consisting of a predetermined time at T1 (e.g., 1 to 3 minutes, e.g., 2 minutes) and a predetermined time at T2 (e.g., 1 to 3 minutes, e.g., 2 minutes), and this cycle may be repeated preferably 10 to 40 times, more preferably 15 to 35 times. Prior to the thermal cycling, the sample may be incubated at a predetermined temperature between 25°C and less than 30°C for a predetermined time (e.g., 5 to 15 minutes), then at a predetermined temperature between 30°C and less than 35°C for a predetermined time (e.g., 5 to 15 minutes), and then at a predetermined temperature between 35°C and less than 50°C for a predetermined time (e.g., 1 to 5 minutes). After the thermal cycle, the mixture may be incubated at a predetermined temperature between 50°C and 80°C for a predetermined time (e.g., 5 to 15 minutes), and then at a predetermined temperature between 80°C and 90°C for a predetermined time (e.g., 5 to 15 minutes).

[0039] The method for amplifying nucleic acids according to the present invention is for amplifying a small amount of RNA (e.g., a small amount equivalent to one cell to several hundred cells). It can be used as part of an RT-PCR or RT-qPCR assay using quantitative RNA. The method for amplifying nucleic acids according to the present invention is for amplifying a small amount of RNA (e.g., a small amount equivalent to one cell to several hundred cells). It can be used in RNA sequencing using small amounts of RNA.

[0040] When PCR or qPCR is performed after the RT-RamDA reaction, the PCR or qPCR reaction solution may contain the components of the RT-RamDA reaction solution (e.g., enzymes such as DNA strand-specific RNA:DNA hybridization enzymes and RNase H minus reverse transcriptase) as they are, or may contain inactivated components. These PCR or qPCR reaction solutions may contain added components for DNA amplification (e.g., primers, deoxyribonucleotides, and DNA polymerase). Furthermore, if the RT-RamDA reaction solution contains components necessary for DNA amplification, such as DNA polymerase, the RT-RamDA reaction solution can serve as a PCR or qPCR reaction solution without modification, and the two compositions can be referred to interchangeably. Primers used for DNA amplification in PCR reaction solutions, qPCR reaction solutions, etc. are preferably primers (forward primers, reverse primers) specific to DNA (including DNA reverse transcribed from RNA). Furthermore, a composition for DNA amplification, such as a PCR reaction solution or a qPCR reaction solution, may contain an anti-DNA polymerase antibody, a reaction buffer, a metal ion (such as a magnesium ion), a fluorescent dye, a fluorescently labeled probe, or a combination of two or more of these.

[0041] When DNA amplification in a PCR reaction, qPCR reaction, or the like is carried out under thermal cycling conditions, incubation under the thermal cycling conditions may be performed for, for example, one cycle consisting of a predetermined temperature between 80°C and less than 100°C for a predetermined time (e.g., 10 to 30 seconds) and a predetermined temperature between 50°C and 70°C for a predetermined time (e.g., 30 seconds to 2 minutes), and this cycle may be repeated preferably 10 to 50 cycles, more preferably 15 to 40 cycles, but is not limited to these.

[0042] The present invention further relates to a kit capable of suppressing nonspecific nucleic acid amplification, which can be used in the above-described method of the present invention. Such a kit of the present invention can be provided as an RNA analysis kit or the like, which suppresses nonspecific nucleic acid amplification and enables stable and accurate RT-RamDA reaction. The kit of the present invention is not particularly limited, as long as it is configured to allow the coexistence of template RNA and a chaotropic agent in the RT-RamDA reaction solution. For example, the kit of the present invention can be a kit containing an RT-RamDA reaction solution containing a chaotropic agent (e.g., a premixed RT-RamDA reaction reagent containing a chaotropic agent) and / or a cell lysis solution containing a chaotropic agent (e.g., a premixed cell lysis reagent containing a chaotropic agent). That is, the chaotropic agent can be contained in either or both the RT-RamDA reaction reagent and the cell lysis reagent. Preferably, the total amount of chaotropic agent in the RT-RamDA reaction solution after mixing with the template RNA is adjusted so that the final concentration is greater than 0 mM and equal to or less than 50 mM. The kit of the present invention may further contain, if desired, other reagents, buffer solutions, etc. necessary for carrying out a nucleic acid amplification reaction. Examples of other reagents include primers and deoxyribonucleotide triphosphates. The RT-RamDA reaction solution, and optionally the cell lysis solution and other reagents, etc., may be provided in a form in which they are all contained in a single container, or in a form in which each reagent is contained in a separate container. [Example]

[0043] The present invention will be described in more detail below based on examples, but the present invention is not limited to these examples.

[0044] Example 1: Suppression of nonspecific nucleic acid amplification by guanidine thiocyanate in the RT-RamDA method (purified RNA 5 pg to 10 ng) In this example, the following test was carried out to confirm the effect of a chaotropic agent on nonspecific nucleic acid amplification in the RT-RamDA method. Guanidine thiocyanate was added to the sample solution (RT-RamDA reaction solution), and single-stranded cDNA was synthesized by the RT-RamDA reaction. Then, quantitative polymerase chain reaction (qPCR) was used to compare the amplification curves with and without guanidine thiocyanate. Specifically, this was performed using the following method. The nucleic acid fragment sample used in this example was 5 pg to 10 ng of RNA purified from NIH3T3 cells using an RNeasy Mini Kit (Qiagen). To reverse transcribe 5 pg to 10 ng of this RNA using the RT-RamDA method, the components contained in the sample solution (RT-RamDA reaction solution) used in this example and their final concentrations in the sample solution are shown in Table 1 below. [Table 1]

[0045] The RT-RamDA reaction mixture (10 μl) was prepared by adding purified RNA to the above composition and then isothermal reactions were carried out at 25°C for 10 minutes, 30°C for 10 minutes, 37°C for 30 minutes, 50°C for 5 minutes, and 95°C for 5 minutes. The DNA amounts were then compared using the following quantitative polymerase chain reaction (qPCR). Specifically, the RT-RamDA reaction was performed in the sample solution (RT-RamDA reaction solution) described above, and then diluted 5-fold with nuclease-free water (Qiagen). 2 μl of the diluted sample solution was used for qPCR. qPCR after the RT-RamDA reaction was performed using StepOne Plus (Life Technologies) under the following conditions. The qPCR reaction solution [20 μl (THUNDERBIRD™ SYBR qPCR Mix (TOYOBO)), 6 pmol forward primer, 6 pmol reverse primer, 2 μl RT-RamDA reaction solution, nuclease-free water] was treated at 95°C for 1 minute to activate the enzyme, and then 40 cycles of denaturation at 95°C for 15 seconds and extension at 60°C for 1 minute were performed.

[0046] Melting curve analysis was performed at 95°C for 15 seconds, 60°C for 15 seconds, and 95°C for 15 seconds. The messenger RNA (mRNA) of β-actin was used as the target gene.

[0047] The primers for each gene are as follows: β-actin (mRNA) Forward primer: CAGCTGAGAGGGAAATCGTG (SEQ ID NO: 1) Reverse primer: CGTTGCCAATAGTGATGACC (SEQ ID NO: 2)

[0048] The results are shown in Table 2 and FIG. [Table 2]

[0049] As shown in Table 1 and Figure 1, under Condition 1, where guanidine thiocyanate was not added, an amplification curve that could not be calculated as a Ct value was generated, indicating nonspecific nucleic acid amplification in the RT-RamDA reaction and making quantitative measurements impossible. On the other hand, under Conditions 2 to 4, where guanidine thiocyanate was added, stable amplification curves were obtained. The PCR efficiency under Conditions 2 to 4 was also closer to 100% compared to Condition 1, suggesting that nonspecific amplification products were suppressed. This demonstrates that guanidine thiocyanate suppresses nonspecific amplification in the RT-RamDA reaction. Furthermore, these results confirm that when the amount of template RNA is relatively high (e.g., when the amount of template RNA is 100 pg to 10 ng), a lower amount of guanidine thiocyanate (e.g., 15 mM or less, or 10 mM or less) results in a lower Ct value and better results.

[0050] The above-disclosed embodiments and examples are all illustrative and not restrictive. Furthermore, embodiments and examples that combine the contents disclosed in the embodiments and examples are also included within the scope of the present invention. The technical scope of the present invention is defined by the claims, and includes all changes, modifications, substitutions, etc. that are equivalent to the description of the claims and fall within the scope of the claims. [Industrial Applicability]

[0051] The present invention enables the RT-RamDA method, which enables the detection of low-expression genes from minute amounts of RNA and the expansion of the number of detected genes, to effectively suppress nonspecific nucleic acid amplification, thereby enabling more accurate and stable RNA analysis.

Claims

1. A method for suppressing non-specific nucleic acid amplification in an RT-RamDA reaction, characterized by allowing a template RNA and a chaotropic agent to coexist in an RT-RamDA reaction solution.

2. The method according to claim 1, wherein a template RNA-containing biological sample to be subjected to an RT-RamDA reaction is treated with a cell lysis agent containing a chaotropic agent to prepare a template RNA-containing biological sample solution containing a chaotropic agent, and the template RNA-containing biological sample solution containing the chaotropic agent is mixed with an RT-RamDA reaction solution, thereby allowing the template RNA and the chaotropic agent to coexist in the RT-RamDA reaction solution.

3. The method according to claim 1 or 2, wherein the final concentration of the chaotropic agent in the RT-RamDA reaction solution is greater than 0 mM and equal to or less than 50 mM.

4. The method according to any one of claims 1 to 3, wherein the final concentration of the chaotropic agent in the RT-RamDA reaction solution is more than 0 mM and not more than 20 mM.

5. 5. The method according to claim 1, wherein the chaotropic agent is at least one chaotropic agent selected from the group consisting of guanidinium ions, urea ions, iodide ions, lithium ions, and salts thereof.

6. The method according to any one of claims 1 to 5, wherein the chaotropic agent is a guanidinium salt.

7. The method according to any one of claims 1 to 6, wherein the chaotropic agent is guanidine thiocyanate.

8. The method according to any one of claims 1 to 7, wherein the RT-RamDA reaction solution further contains an inorganic salt.

9. The method according to claim 8, wherein the inorganic salt is at least one selected from the group consisting of potassium salts, manganese salts, and magnesium salts.

10. A method for stabilizing an RT-RamDA reaction, characterized by allowing a template RNA and a chaotropic agent to coexist in an RT-RamDA reaction solution.

11. A kit for use in the method according to any one of claims 1 to 10, comprising an RT-RamDA reaction solution containing a chaotropic agent.

12. A kit for use in the method of any one of claims 1 to 10, comprising a cell lysis agent containing a chaotropic agent.

Citation Information

Patent Citations

  • Improved dissolution and reverse transcription for mRNA quantification

    JP2011528914A

  • Improved virus detection method

    JP2017209036A

  • Method for nucleic acid amplification

    WO2016052619A1