Radiopharmaceutical complexes and combinations thereof targeting prostate-specific membrane antigen

Abstract

The present invention relates to a tissue targeting compound.In particular, the present invention relates to a tissue targeting compound comprising a monoclonal antibody or an antigen-binding fragment thereof that has binding affinity for prostate specific membrane antigen (PSMA).Furthermore, the present invention relates to a combination, preferably a pharmaceutical combination, that comprises a tissue targeting compound of formula (I) and an additional pharmaceutical agent.The combination is useful for therapy, preferably for the treatment of hyperproliferative diseases such as cancer. JPEG2025511999000068.jpg34170

Description

[Technical Field]

[0001] The present invention relates to a tissue-targeting compound.In particular, the present invention relates to a tissue-targeting compound comprising a monoclonal antibody or its antigen-binding fragment that has binding affinity for prostate-specific membrane antigen (PSMA).Furthermore, the present invention relates to a combination, preferably a pharmaceutical combination, comprising a tissue-targeting compound of formula (I) and an additional pharmaceutical agent.The tissue-targeting compound and / or combination is useful for diagnosis and / or therapy, preferably therapy, more preferably for the treatment of hyperproliferative diseases such as cancer.

[0002] Furthermore, the present invention relates to methods for preparing said tissue-targeting compounds and to their use in the diagnosis and / or treatment of diseases, preferably in the treatment of diseases, especially hyperproliferative diseases, especially cancer. [Background technology]

[0003] Specific cell killing can be essential for the successful treatment of various diseases in mammalian subjects. A typical example of this is the treatment of malignant diseases such as sarcoma and cancer. However, the selective removal of certain cell types can also play an important role in the treatment of other diseases, particularly hyperplastic and neoplastic diseases.

[0004] The most common methods of selective treatment are currently surgery and external beam radiation. However, targeted radionuclide therapy is a promising and developing field with the potential to deliver highly cytotoxic radiation specifically to disease-associated cell types. The most common forms of radiopharmaceuticals currently approved for human use use beta and / or gamma radionuclides. However, there has been some interest in the use of alpha radionuclides in therapy due to the potential for more potent cell killing.

[0005] The radiation range of typical alpha emitters in physiological environments is generally less than 100 μm, equivalent to the diameter of only a few cells. These radiation sources have a range that reaches neighboring cells within the tumor, but if well targeted, most of the emitted energy does not penetrate the target cell, making them highly suitable for treating tumors, including micrometastases. Thus, not every cell needs to be targeted, minimizing damage to surrounding healthy tissue (see Feinendegen et al., Radiat. Res. 148:195-201 (1997)). In contrast, beta particles have a range of more than 1 mm in water (see Wilbur, Antibody Immunocon. Radiopharm. 4:85-96 (1991)).

[0006] The energy of alpha particle radiation is high compared to the energies carried by beta particles, gamma rays, and X-rays, which are typically 5-8 MeV, i.e., 5-10 times that of beta particles and more than 20 times that of gamma rays. This deposition of a large amount of energy over a very short distance therefore gives alpha rays a very high linear energy transfer (LET), a high relative biological effectiveness (RBE), and a low oxygen enhancement ratio (OER) compared to gamma and beta rays (see Hall, "Radiobiology for the radiologist," 5th ed., Lippincott Williams & Wilkins, Philadelphia, PA, USA, 2000). This explains the exceptional cytotoxicity of alpha radionuclides and imposes stringent demands on the biological targeting of such isotopes and the level of control and research of alpha radionuclide distribution necessary to avoid unacceptable side effects.

[0007] To date, the primary focus for applications in radioimmunotherapy has been on 211At, 213Bi, and 225Ac, and these three nuclides have been investigated in clinical immunotherapy trials. However, while targeted radiotherapy has been performed for some time using macrocyclic complexes of radionuclides, typically using the macrocyclic chelator DOTA (2,2',2'',2''''-(1,4,7,10-tetraazacyclododecane-1,4,7,10-tetrayl)tetraacetic acid), currently used compounds lack stability and dissociate the radionuclide from the chelating macrocycle, resulting in reduced selectivity and activity for targeted tissues and increased toxicity for non-targeted tissues.

[0008] For example, a high chelator-to-antigen (CAR) ratio of 10 has been reported in preclinical studies using a one-step radiolabeling procedure for DOTA antibody-chelator conjugates (ACC) (William F. Maguire, Michael R. McDevitt, Peter M. Smith-Jones, David A. Scheinberg. "Efficient one-step radiolabeling of monoclonal antibodies to high specific activity with Actinium-225 for alpha-particle radioimmunotherapy of cancer," J. Nucl. Med. 2014;55(9):1492-1498). However, after 2 hours of labeling at 37°C, quantitative labeling was not achieved, requiring a subsequent purification step to remove unlabeled Actinium-225. This contrasts with the tissue-targeting compounds of the present invention, which can quantitatively chelate Actinium-225 at room temperature, resulting in complexes with significantly lower CAR ratios (<1) after 1 hour.

[0009] While the use of larger macrocycles has resulted in more stable complexation, particularly of larger-sized radionuclides, there is a need for the development of targeted compounds with improved stability, selectivity, and efficacy, particularly in the field of hyperproliferative diseases such as cancer. In some types of cancer, particularly prostate cancer, patients initially respond to therapy but eventually develop resistance (Swami U, McFarland TR, Nussenzveig R, Agarwal N. Advanced Prostate Cancer: Treatment Advances and Future Directions. Trends Cancer 2020;6(8):702-15 doi 10.1016 / j.trecan.2020.04.010). Therefore, there is a need for new agents that can selectively target specific cells and cell types in malignant diseases, which are highly effective and reduce, mitigate, and / or avoid the spread of resistance. In particular, there is a need to provide new therapeutic agents for treating cancer, especially prostate cancer, the most common cancer in men (Mattiuzzi C, Lippi G. Current Cancer Epidemiology. JEpidemiol Glob Health 2019;9(4):217-22 doi 10.2991 / jegh.k.191008.001). Prostate-specific membrane antigen (PSMA), encoded by the FOLH1 (folate hydrolase 1) gene, is highly expressed in prostate cancer cells and is a suitable target for radiotherapy.

[0010] Surprisingly, it has been found that tissue-targeting compounds of formula (I) and combinations comprising tissue-targeting compounds of formula (I) and additional pharmaceutical agents of the present invention exhibit advantageous properties in terms of their stability, activity, efficacy, and selectivity. In particular, the tissue-targeting compounds of formula (I) of the present invention exhibit high values ​​for immunoreactive fraction (IRF) at low chelator-to-antigen (CAR) ratios and high monomeric purity, thus resulting in a higher fraction of radionuclide-labeled compounds with affinity for PSMA. Furthermore, the tissue-targeting compounds of formula (I) of the present invention exhibit favorable in vivo biodistribution and low liver accumulation, which is a sign of reduced dissociation of the radionuclide from the chelating moiety and therefore increased stability. In contrast to previously reported examples in the literature, the tissue-targeting compounds of formula (I) of the present invention can be labeled with radionuclides under very mild conditions and at low temperatures (i.e., room temperature), thereby reducing antibody denaturation and the amount of non-PSMA-bound fraction in the final product. Therefore, the tissue-targeting compound of formula (I) of the present invention exhibits a better tumor-to-liver ratio, and therefore can treat disease more effectively and selectively, and can reduce the damage to non-targeted tissues while maintaining high efficacy against cancer cells in targeted tissues.When combined with one or more additional pharmaceutical agents, it can achieve greater therapeutic effectiveness than when any compound is used alone.

[0011] In the radiopharmaceutical field, there is a growing need to provide radionuclide-containing compounds and / or combinations containing radionuclide-containing compounds that are stable for a sufficient period of time to allow delivery to the administering physician and patient without undergoing radiopharmaceutical degradation, for example, due to decomplexation of the radionuclide from the chelating agent. Increasing the stability of the radiopharmaceutical in radionuclide-containing compounds and / or combinations containing radionuclide-containing compounds is particularly desirable from a logistical standpoint, as it allows for reliable delivery of radiopharmaceutical-containing pharmaceuticals across countries and / or continents. It would be desirable to have available radionuclide-containing compounds and / or combinations containing radionuclide-containing compounds that are stable for at least 48 hours, preferably 96 hours, and / or have a monomer content of at least 85% over at least 48 hours, preferably at least 90% over at least 48 hours. The present invention solves these problems by providing a tissue-targeting compound of Formula (I) and a combination containing a tissue-targeting compound of Formula (I) and an additional pharmaceutical agent.

[0012] In particular, combinations comprising a tissue-targeted compound of formula (I) and a further pharmaceutical agent of the invention include: (1) produce a superior effect in reducing tumor growth or even eliminating tumors compared to administration of either agent alone; (2) resulting in the administration of smaller doses of the targeted compound and / or chemotherapeutic agent; (3) provide chemotherapy treatments that are better tolerated by patients with fewer adverse pharmacological complications than are observed with single-agent chemotherapy and certain other combination therapies; (4) providing treatment for a wide range of different cancer types in mammals, particularly humans; (5) provide a high response rate among treated patients; (6) Providing longer survival times among treated patients compared with standard chemotherapy treatments; (7) resulting in a longer time to tumor progression, and / or (8) Providing efficacy and tolerability results that are at least as good as those of the drugs used alone, compared with known inhibitory effects of other cancer drug combinations It is useful. [Prior art documents] [Non-patent literature]

[0013] [Non-Patent Document 1] Feinendegen et al., Radiat. Res. 148:195-201 (1997) [Non-patent document 2] Wilbur, Antibody Immunocon.Radiopharm.4:85~96(1991) [Non-patent document 3] Hall, "Radiobiology for the radiologist", 5th ed., Lippincott Williams & Wilkins, Philadelphia PA, USA, 2000 [Non-patent document 4] William F. Maguire, Michael R. McDevitt, Peter M. Smith-Jones, David A. Scheinberg. “Efficient one-step radiolabeling of monoclonal antibodies to high specific activity with Actinium-225 for alpha-particle radioimmunotherapy of cancer”, J.Nucl.Med.2014;55(9):1492~1498 [Non-Patent Document 5] Swami U, McFarland TR, Nussenzveig R, Agarwal N.Advanced Prostate Cancer: Treatment Advances and Future Directions.Trends Cancer 2020;6(8):702-15 doi 10.1016 / j.trecan.2020.04.010 [Non-patent document 6] Mattiuzzi C, Lippi G.Current Cancer Epidemiology.JEpidemiol Glob Health 2019;9(4):217-22 doi 10.2991 / jegh.k.191008.001 Summary of the Invention

[0014] The present invention provides a tissue-targeting compound of formula (I) [ka] where [Ab] is a monoclonal antibody or antigen-binding fragment thereof having binding affinity for prostate-specific membrane antigen (PSMA). Regarding. [Means for solving the problem]

[0015] definition The term "comprising" as used herein includes "consisting of."

[0016] In the text, when any item is referred to as "mentioned in this specification", it means that it can be mentioned anywhere in the text.

[0017] In the context of the present invention, "tissue-targeted" is used herein to indicate that the substance (i.e., tissue-targeted compound, tissue-targeted actinium complex, and / or tissue-targeted moiety, particularly when in the form of a tissue-targeted complex described herein) acts to localize itself (particularly any conjugated actinium complex) preferentially to at least one tissue site where its presence is desired (e.g., to effect radioactive decay). Thus, the tissue-targeted compound, complex, group, or moiety acts to provide greater localization to at least one desired site within the body of a subject after administration to that subject, compared to the concentration of an equivalent complex without the targeting moiety. The targeting moiety in this case is preferably selected to specifically bind to a cell surface receptor associated with cancer cells or other receptors associated with the tumor microenvironment.

[0018] In the context of the present invention, the term "PSMA" refers to the prostate-specific membrane antigen encoded by the FOLH1 (folate hydrolase 1) gene (Gene ID: 2346).

[0019] In the context of the present invention, the terms TLX592 and J592 can be used interchangeably and refer to the same monoclonal antibody, i.e., a monoclonal antibody having binding affinity for the antigen PSMA (anti-PSMA antibody) developed by Telix Pharmaceuticals, as described, for example, in WO 2021 / 000018.

[0020] TLX592 (or J592) comprises a heavy chain sequence according to SEQ ID NO: 19 and a light chain sequence according to SEQ ID NO: 20.

[0021] Furthermore, TLX592 (or J592) comprises at least three CDR heavy chain sequences according to SEQ ID NO: 21, SEQ ID NO: 22 and SEQ ID NO: 23 and three CDR light chain sequences according to SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26: TLX592 CDR heavy chain sequence SEQ ID NO: 21: EYTIH SEQ ID NO: 22: N INPNNGGTTY NQKFED SEQ ID NO: 23: GW NFDY TLX592 CDR light chain sequence SEQ ID NO: 24: KASQDVG TAVD SEQ ID NO: 25: W ASTRHT SEQ ID NO: 26: QQ YNSYPLT

[0022] The compounds of formula (I) of the present invention comprise a chelating moiety comprising a complexed actinium atom (Ac). In the context of the present invention, the term "Ac" refers to an ion of at least one alpha-emitting actinium isotope. Preferably, the alpha-emitting actinium isotope is 225Ac. Preferably, the ion of at least one alpha-emitting actinium isotope has a triple positive charge. 225 Ac, i.e. 225 Ac 3+ Therefore, in the context of the present invention, the term "Ac" is preferably 225 Ac 3+ This means, but is not limited to:

[0023] In the compounds of formula (I) of the present invention, the actinium (Ac) atom is shown as complexed to four oxygen atoms and two nitrogen atoms of the macrocycle and two carboxylate groups. While this is the assumed complexation pattern for the actinium atom, this depiction includes all possible and conceivable cases where one or more of the bonds are absent, e.g., the actinium atom is not bonded to all heteroatoms of the macrocycle or is not bonded to a carboxylate group.

[0024] In the context of the present invention, the term IRF refers to the immunoreactive fraction, i.e., the fraction of the labeled product (i.e., the compound of formula (I) of the present invention) that can bind to the target (i.e., PSMA). The Lindmo assay (Lindmo T. et al. (1984) "Determination of the immunoreactive fraction of radiolabeled monoclonal antibodies by linear extrapolation to binding at infinite antigen excess." J. Immunol. Methods. 72, 77-89) is the most commonly used method to assess the immunoreactive fraction.

[0025] In the context of the present invention, the term CAR refers to the chelator to antigen ratio, which is a measure of the specific activity of a radiolabeled compound (eg, a compound of formula (I) of the present invention).

[0026] The terms "polypeptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. This term applies to amino acid polymers in which one or more amino acid residues are artificial chemical mimics of corresponding natural amino acids, as well as natural amino acid polymers and non-natural amino acid polymers. Unless otherwise indicated, a specific polypeptide sequence also implicitly encompasses its conservatively modified variants.

[0027] Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Similarly, nucleotides may be referred to by their commonly accepted single-letter codes.

[0028] The term "antibody" as used herein is intended to refer to immunoglobulin molecules, including, but not limited to, full-length antibodies and monovalent antibodies. A "full-length antibody" is preferably composed of two heavy (H) chains and two light (L) chains, which are four polypeptide chains typically interconnected by disulfide bonds. Each heavy chain is composed of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. The heavy chain constant region can include, for example, three domains: CH1, CH2, and CH3. Each light chain is composed of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The light chain constant region is composed of one domain (CL). The VH and VL regions can be further subdivided into hypervariable regions called complementarity-determining regions (CDRs), interspersed with more conserved regions called framework regions (FRs). Each VH and VL is typically composed of three CDRs and up to four FRs, arranged, for example, from the amino terminus to the carboxy terminus, in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. As used herein, a "monovalent antibody" preferably comprises two heavy (H) chains and one light (L) chain, which are three polypeptide chains typically interconnected by disulfide bonds. One heavy chain comprises a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. The heavy chain constant region can comprise, for example, three domains, CH1, CH2, and CH3. The other heavy chain comprises only the heavy chain constant region. The light chain comprises a light chain variable region (abbreviated herein as VL) and a light chain constant region. The light chain constant region comprises one domain (CL). The VH and VL regions can be further subdivided into hypervariable regions called complementarity-determining regions (CDRs), interspersed with more conserved regions called framework regions (FRs). Each VH and VL is typically composed of three CDRs and up to four FRs, arranged from amino terminus to carboxy terminus, for example, in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0029] As used herein, the term "complementarity-determining region" (CDR; e.g., CDR1, CDR2, and CDR3) refers to amino acid residues in an antibody variable domain whose presence is necessary for antigen binding. Each variable domain typically has three CDR regions, identified as CDR1, CDR2, and CDR3. Each complementarity-determining region is composed of amino acid residues from the "complementarity-determining region" defined by Kabat (e.g., approximately 24-34 residues (L1), 50-56 residues (L2), and 89-97 residues (L3) in the light chain variable domain and 31-35 residues (H1), 50-65 residues (H2), and 95-102 residues (H3) in the heavy chain variable domain; (Kabat et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD. (1991)) and / or residues from the "hypervariable loops" (e.g., about residues 26-32 (L1), 50-52 (L2), and 91-96 (L3) in the light chain variable domain and residues 26-32 (H1), 53-55 (H2), and 96-101 (H3) in the heavy chain variable domain (Chothia and Lesk; J Mol Biol 196:901-917 (1987)). In some examples, the complementarity determining regions may include amino acids from both the CDR regions and the hypervariable loops as defined according to Kabat.

[0030] Depending on the amino acid sequence of the constant domain of their heavy chains, intact antibodies can be assigned to different "classes". There are five main classes of intact antibodies: IgA, IgD, IgE, IgG, and IgM, several of which can be further divided into "subclasses" (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. A preferred class of immunoglobulin for use in the present invention is IgG.

[0031] The heavy chain constant domains corresponding to different classes of antibodies are called "alpha," "delta," "epsilon," "gamma," and "mu," respectively. The subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known. As used herein, "antibody" refers to conventionally known antibodies and functional fragments thereof.

[0032] As used herein, a "functional fragment" or "antigen-binding antibody fragment" of an antibody / immunoglobulin is defined as a fragment of an antibody / immunoglobulin (e.g., the variable region of an IgG) that retains the antigen-binding region. The "antigen-binding region" of an antibody is typically found in one or more hypervariable regions of the antibody, e.g., the CDR-1, CDR-2 and / or CDR-3 regions, although variable "framework" regions can also play an important role in antigen binding, e.g., by providing a scaffold for the CDRs.

[0033] "Functional fragments" or "antigen-binding antibody fragments" or "antibody fragments" of the present invention include, but are not limited to, Fab, Fab', Fab'-SH, F(ab')2, and Fv fragments; diabodies; single-domain antibodies (DAbs), linear antibodies; single-chain antibody molecules (scFv); and multispecific antibodies formed from antibody fragments, such as bi- and tri-specific antibodies (CAK Borrebaeck, ed. (1995) Antibody Engineering (Breakthroughs in Molecular Biology), Oxford University Press; R. Kontermann & S. Duebel, eds. (2001) Antibody Engineering (Springer Laboratory Manual), Springer Verlag). An antibody other than a "multispecific" or "multifunctional" antibody is understood to have each of its binding sites identical. F(ab')2 or Fab may be engineered to minimize or completely eliminate intermolecular disulfide interactions between the CH1 and CL domains.

[0034] The term "Fc region" herein is used to define the C-terminal region of an immunoglobulin heavy chain containing at least a portion of the constant region. This term includes native sequence Fc regions and variant Fc regions. In one embodiment, a human IgG heavy chain Fc region extends from Cys226 or Pro230 to the carboxyl terminus of the heavy chain. However, the C-terminal lysine (Lys447) of the Fc region may or may not be present. Unless otherwise specified herein, the numbering of amino acid residues in the Fc region or constant region is according to the EU numbering system, also referred to as the EU index, as described in Kabat et al., Sequences of Proteins of Immunological Interest, 5th ed., Public Health Service, National Institutes of Health, Bethesda, MD, 1991.

[0035] Variants of antibodies or antigen-binding antibody fragments contemplated by the present invention are molecules that retain the binding activity of the antibody or antigen-binding antibody fragment.

[0036] "Binding proteins" contemplated in the present invention are antibody mimetics such as affibodies, adnectins, anticalins®, DARPins, avimers, nanobodies, etc. (reviewed by Gebauer M. et al., Curr. Opinion in Chem. Biol. 2009;13:245-255; Nuttall SD et al., Curr. Opinion in Pharmacology 2008;8:608-617).

[0037] A "human" antibody or antigen-binding fragment thereof is defined herein as one that is not chimeric (e.g., not "humanized") and not derived (in whole or in part) from a non-human species. A human antibody or antigen-binding fragment thereof can be derived from a human or can be a synthetic human antibody. A "synthetic human antibody" is defined herein as an antibody having a sequence derived in silico, in whole or in part, from a synthetic sequence based on analysis of known human antibody sequences. In silico design of a human antibody sequence or fragment thereof can be achieved, for example, by analyzing a database of human antibody or antibody fragment sequences and devising a polypeptide sequence using the data obtained therefrom. Another example of a human antibody or antigen-binding fragment thereof is one encoded by nucleic acid isolated from a library of antibody sequences of human origin (e.g., such a library is based on antibodies taken from natural human sources). Examples of human antibodies include those described in Soderlind et al., Nature Biotech. 2000, 18:853-856.

[0038] A "humanized antibody" or humanized antigen-binding fragment thereof is defined herein as (i) an antibody derived from a non-human source (e.g., a transgenic mouse with a heterologous immune system) and which is based on human germline sequences; (ii) an antibody in which amino acids in the framework regions of a non-human antibody have been partially replaced with human amino acid sequences by genetic engineering; or (iii) a CDR graft in which the CDRs of the variable domain are derived from a non-human source, one or more frameworks of the variable domain are of human origin, and the constant domains, if present, are of human origin.

[0039] A "chimeric antibody" or antigen-binding fragment thereof is defined herein as one in which the variable domains are of non-human origin and some or all of the constant domains are of human origin.

[0040] As used herein, the term "monoclonal antibody" refers to an antibody obtained from a population of substantially homogeneous antibodies; i.e., the individual antibodies comprising the population are identical except for possible minor mutations, e.g., naturally occurring mutations. Thus, the term "monoclonal" indicates the character of the antibody as not being a mixture of individual antibodies. In contrast to polyclonal antibody preparations, which typically contain different antibodies directed against different determinants (epitopes), each monoclonal antibody of a monoclonal antibody preparation is directed against a single determinant on an antigen. In addition to their specificity, monoclonal antibody preparations are advantageous in that they are typically uncontaminated by other immunoglobulins. The term "monoclonal" should not be construed as requiring production of the antibody by any particular method. The term monoclonal antibody specifically includes chimeric, humanized, and human antibodies.

[0041] An "isolated" antibody is one that has been identified and separated from components of the cell in which it is expressed. The contaminating components of the cell are substances that would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes.

[0042] An "isolated" nucleic acid is a nucleic acid that has been identified and separated from a component of its natural environment. Isolated nucleic acid includes a nucleic acid molecule contained in cells that ordinarily contain the nucleic acid molecule, but where the nucleic acid molecule is present extrachromosomally or at a chromosomal location that is different from its natural chromosomal location.

[0043] As used herein, an antibody that "specifically binds to," "is specific for," or "specifically recognizes" an antigen of interest (e.g., as an antigen-binding antibody), e.g., a tumor-associated polypeptide antigen target or antigen-binding polypeptide target, is one that binds the antigen target with sufficient affinity so that the antibody is useful as a therapeutic agent in targeting cells or tissues that express the antigen, or binds the antigen-binding polypeptide target with sufficient affinity so that the antibody is useful as a reversal agent for neutralizing the therapeutic activity of the antigen-binding polypeptide (e.g., an antigen-binding antibody), and does not significantly cross-react with other proteins, other than orthologs and variants (e.g., mutant forms, splice variants, or proteolytically truncated forms) of said target. As used herein, the terms "specifically recognize" or "specifically binds to" or "is specific for" a particular polypeptide or epitope on a particular polypeptide target refer to, for example, an epitope of about 10 -4 Less than M, instead about 10 -5 Less than M, instead about 10 -6 Less than M, instead about 10 -7 Less than M, instead about 10 -8 Less than M, instead about 10 -9 Less than M, instead about 10 -10 Less than M, instead about 10 -11 Less than M, instead about 10 -12 Monovalent K for antigens less than or equal to M DThe antibody may be characterized by an antibody or antigen-binding fragment thereof having a specific binding activity. If an antibody can distinguish between an antigen and one or more reference antigens, the antibody "specifically binds to," "is specific for," or "specifically recognizes" such antigen. In its most general form, "specific binding," "specific binding to," "specific for," or "specifically recognizes" refers to the antibody's ability to distinguish between an antigen of interest and unrelated antigens, as determined, for example, by one of the following methods: surface plasmon resonance (SPR), Western blot, ELISA test, RIA test, ECL test, IRMA test, and peptide scanning. For example, a standard ELISA assay can be performed. Scoring can be performed by standard color development (e.g., secondary antibody with horseradish peroxidase and tetramethylbenzidine with hydrogen peroxide). Reactions in certain wells are scored, for example, by optical density at 450 nm. A typical background (=negative reaction) can be 0.1 OD; a typical positive reaction can be 1 OD. This means that the difference between positive and negative is more than 5-fold, more than 10-fold, more than 50-fold, and preferably more than 100-fold. Typically, binding specificity is determined not by a single reference antigen, but by using a series of about 3-5 unrelated antigens, such as milk powder, BSA, or transferrin.

[0044] "Binding affinity" or "affinity" refers to the strength of the sum total of non-covalent interactions between a single binding site of a molecule and its binding partner. Unless otherwise indicated, as used herein, "binding affinity" refers to the intrinsic binding affinity that reflects a 1:1 interaction between members of a binding pair (e.g., antibody and antigen). The dissociation constant "K D" is commonly used to describe the affinity between a molecule (such as an antibody) and its binding partner (such as an antigen), i.e., how tightly the ligand binds to a particular protein. Ligand-protein affinity is influenced by non-covalent intermolecular interactions between the two molecules. Affinity can be measured by common methods known in the art, including the methods described herein. In one embodiment, "K" is used in accordance with the present invention. D " Also "K D The "value" is measured by using a surface plasmon resonance assay using a suitable instrument, including but not limited to a Biacore instrument such as a Biacore T100, Biacore T200, Biacore 2000, Biacore 4000, or Biacore 3000 (GE Healthcare Biacore, Inc.), or a ProteOn XPR36 instrument (Bio-Rad Laboratories, Inc.).

[0045] "Antibody-dependent cellular cytotoxicity" or "ADCC" refers to a form of cytotoxicity in which secreted Ig bound to Fc gamma receptors (FcγR) present on certain cytotoxic cells (e.g., NK cells, neutrophils, and macrophages) enables these cytotoxic effector cells to specifically bind to antigen-bearing target cells and subsequently kill the target cells, for example, with cytotoxins. To assess the ADCC activity of an antibody of interest, an in vitro ADCC assay, such as that described in U.S. Pat. No. 5,500,362 or U.S. Pat. No. 5,821,337 or U.S. Pat. No. 6,737,056 (Presta), can be performed. Useful effector cells for such assays include PBMCs and NK cells.

[0046] "Complement-dependent cytotoxicity" or "CDC" refers to the lysis of target cells in the presence of complement. Activation of the classical complement pathway is initiated by the binding of the first component of the complement system (C1q) to antibodies (of the appropriate subclass) that are bound to their cognate antigen. To assess complement activation, a CDC assay, such as that described in Gazzano-Santoro et al., J. Immunol. Methods 202:163 (1996), can be performed. Polypeptide variants with altered Fc region amino acid sequences (polypeptides with mutant Fc regions) and increased or decreased C1q binding are described, for example, in U.S. Pat. No. 6,194,551 and WO 1999 / 51642.

[0047] "Percent (%) sequence identity" with respect to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acid or amino acid residues in a candidate sequence that are identical to the nucleic acid or amino acid residues in the reference polynucleotide or polypeptide sequence, respectively, after aligning the sequences and introducing gaps as necessary to achieve the maximum percent sequence identity. Conservative substitutions are not considered part of sequence identity. Alignment without gaps is preferred. Alignment for determining percent amino acid sequence identity can be achieved in a variety of ways within the skill of the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. Those skilled in the art can determine the appropriate parameters for aligning sequences, including any algorithms required to achieve maximum alignment across the entire length of the sequences being compared.

[0048] Substantial sequence identity / similarity can be considered as having at least 80% sequence similarity / identity for the entire sequence and / or at least 90% sequence similarity / identity for specific binding regions (e.g., CDR regions). Preferred sequence similarity or identity can be at least 92%, 95%, 97%, 98%, or 99%. Sequence similarity and / or identity can be determined using the "BestFit" program in the University of Wisconsin Genetics Computer Group version 10 software package. The program uses the Smith and Waterman local match algorithm with default values: gap creation penalty = 8, gap extension penalty = 2, average match = 2.912, average mismatch = 2.003.

[0049] The terms "polynucleotide" and "nucleic acid," used interchangeably herein, refer to a chain of nucleotides of any length, including DNA and RNA. The nucleotides may be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and / or their analogs, or any substrate that can be incorporated into a chain by DNA or RNA polymerase. Polynucleotides may contain modified nucleotides, such as methylated nucleotides and their analogs.

[0050] "Sequence homology" indicates the percentage of amino acids that are identical or represent conservative amino acid substitutions.

[0051] Furthermore, nucleic acid sequences encoding the heavy and / or light chain variable regions can be converted into nucleic acid sequences encoding, for example, full-length antibody chains, Fab fragments, or scFvs. VL- or VH-encoding DNA fragments can be operably linked to another DNA fragment encoding, for example, an antibody constant region or a flexible linker (so that the amino acid sequences encoded by the two DNA fragments are in frame). The sequences of human heavy and light chain constant regions are known in the art (see, for example, Kabat, EA et al. (1991) Sequences of Proteins of Immunological Interest, 5th ed., USDapartment of Health and Human Services, NIH Publication No. 91-3242), and DNA fragments encompassing these regions can be obtained by standard PCR amplification.

[0052] To generate a polynucleotide sequence encoding an scFv, the nucleic acids encoding the VH and VL can be operably linked to another fragment encoding a flexible linker, such that the VL and VH regions are linked by the flexible linker and the VH and VL sequences can be expressed as a contiguous single-chain protein (see, e.g., Bird et al. (1988) Science 242:423-426; Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883; McCafferty et al., Nature (1990) 348:552-554).

[0053] Standard recombinant DNA expression methods can be used to express antibodies, antigen-binding fragments, or variants thereof (see, e.g., Goeddel; Gene Expression Technology. Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990)). For example, DNA encoding the desired polypeptide can be inserted into an expression vector, which can then be transfected into a suitable host cell. Suitable host cells include prokaryotic and eukaryotic cells. Examples of prokaryotic host cells include bacteria, and examples of eukaryotic host cells include yeast, insects and insect cells, plants and plant cells, transgenic animals, or mammalian cells. In some embodiments, DNA encoding the heavy and light chains is inserted into separate vectors. In other embodiments, DNA encoding the heavy and light chains is inserted into the same vector. It will be understood that the design of the expression vector, including the selection of regulatory sequences, will be influenced by factors such as the choice of host cell, the expression level of the desired protein, and whether expression is constitutive or inducible.

[0054] Useful expression vectors for bacterial use are constructed by inserting a DNA sequence encoding a desired protein in operable reading phase with a functional promoter, along with appropriate translation initiation and termination signals. The vector will contain one or more phenotypic selectable markers and an origin of replication to ensure vector maintenance and, if desired, to provide amplification within the host. Suitable prokaryotic hosts for transformation include, but are not limited to, E. coli, Bacillus subtilis, Salmonella typhimurium, and various species of Pseudomonas, Streptomyces, and Staphylococcus.

[0055] Bacterial vectors can be, for example, based on bacteriophages, plasmids, or phagemids. These vectors can contain a selectable marker and a bacterial replication origin, typically derived from a commercially available plasmid containing elements of the well-known cloning vector pBR322 (ATCC37017). After transformation of an appropriate host strain and growth of the host strain to an appropriate cell density, the selected promoter is derepressed / induced by appropriate means (e.g., temperature shift or chemical induction), and the cells are cultured for an additional period. Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract is retained for further purification.

[0056] In bacterial systems, several expression vectors can be advantageously selected depending on the intended use of the expressed protein: when producing large quantities of such proteins, e.g., for the production of antibodies or screening peptide libraries, vectors which direct the expression of high levels of fusion protein products that are easily purified may be desirable, for example.

[0057] Antibodies or antigen-binding fragments thereof or variants thereof of the present invention include naturally occurring purified products, products of chemical synthetic procedures, and products made by recombinant techniques from prokaryotic hosts including, for example, E. coli, Bacillus subtilis, Salmonella typhimurium, and various species of Pseudomonas, Streptomyces, and Staphylococcus, preferably E. coli cells.

[0058] Preferred control sequences for mammalian host cell expression include viral elements that direct high-level protein expression in mammalian cells, such as promoters and / or enhancers derived from cytomegalovirus (CMV) (such as the CMV promoter / enhancer), promoters and / or enhancers derived from simian virus 40 (SV40) (such as the SV40 promoter / enhancer), promoters and / or enhancers derived from adenovirus (e.g., the adenovirus major late promoter (AdMLP)), and polyoma. Antibody expression can be constitutive or regulated (e.g., inducible by the addition or removal of a small molecule inducer such as tetracycline in conjunction with the Tet system). For further description of viral regulatory elements and their sequences, see, for example, U.S. Patent No. 5,168,062 to Stinski, U.S. Patent No. 4,510,245 to Bell et al., and U.S. Patent No. 4,968,615 to Schaffner et al. The recombinant expression vector may also contain an origin of replication and a selectable marker (see, for example, U.S. Pat. Nos. 4,399,216, 4,634,665, and 5,179,017). Suitable selectable markers include genes that confer resistance to drugs such as G418, puromycin, hygromycin, blasticidin, zeocin / bleomycin, or methotrexate on a host cell into which the vector has been introduced, or selectable markers that utilize an auxotrophy such as glutamine synthetase (Bebbington et al., Biotechnology (NY). 1992 February;10(2):169-75).For example, the dihydrofolate reductase (DHFR) gene confers resistance to methotrexate, the neo gene confers resistance to G418, the bsd gene from Aspergillus terreus confers resistance to blasticidin, puromycin N-acetyltransferase confers resistance to puromycin, the Sh ble gene product confers resistance to zeocin, and resistance to hygromycin is conferred by the E. coli hygromycin resistance gene (hyg or hph). Selectable markers such as DHFR or glutamine synthase are also useful in amplification techniques in conjunction with MTX and MSX.

[0059] Transfection of expression vectors into host cells can be carried out using standard techniques such as electroporation, nucleofection, calcium phosphate precipitation, lipofection, polycation-based transfection (such as polyethyleneimine (PEI)-based transfection), and DEAE-dextran transfection.

[0060] Suitable mammalian host cells for expressing the antibodies, antigen-binding fragments thereof, or variants thereof provided herein include, but are not limited to, Chinese hamster ovary (CHO) cells (CHO-K1, CHO-S, CHO-K1SV, etc.) [e.g., the dhfr-CHO cells described in Urlaub and Chasin (1980) Proc. Natl. Acad. Sci. USA 77:4216-4220 and Urlaub et al., Cell. 1983 June;33(2):405-12, used with the DHFR selection marker, as described in R.J. Kaufman and P.A. Sharp (1982) Mol. Biol. 159:601-621; and the dhfr-CHO cells described in Fan et al., Biotechnol. Bioeng. 2012 Apr;109(4):1007-15], NS0 myeloma cells, COS cells, HEK293 cells, HKB11 cells, BHK21 cells, CAP cells, EB66 cells and SP2 cells.

[0061] Expression could also be transient or semi-stable in expression systems such as HEK293, HEK293T, HEK293-EBNA, HEK293E, HEK293-6E, HEK293-Freestyle, HKB11, Expi293F, 293EBNALT75, CHO Freestyle, CHO-S, CHO-K1, CHO-K1SV, CHOEBNALT85, CHOS-XE, CHO-3E7, or CAP-T cells (e.g., Durocher et al., Nucleic Acids Res. 2002 Jan. 15;30(2):E9).

[0062] In some embodiments, the expression vector is designed so that the expressed protein is secreted into the culture medium that the host cells are grown in. The antibody, antigen-binding fragment thereof, or variant thereof can be recovered from the culture medium using standard protein purification methods.

[0063] The antibody or antigen-binding fragment thereof or variant thereof of the present invention can be recovered and purified from recombinant cell culture by well-known methods, including, but not limited to, ammonium sulfate or ethanol precipitation, acid extraction, protein A chromatography, protein G chromatography, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography, mixed-mode chromatography, and lectin chromatography. High-performance liquid chromatography ("HPLC") can also be used for purification. See, for example, Colligan, Current Protocols in Immunology, or Current Protocols in Protein Science, John Wiley & Sons, NY, NY (1997-2001), e.g., chapters 1, 4, 6, 8, 9, and 10, each of which is incorporated herein by reference in its entirety.

[0064] The antibodies, or antigen-binding fragments thereof, or variants thereof of the present invention include naturally occurring purified products, products of chemical synthetic procedures, and products produced by recombinant techniques from eukaryotic hosts, including, for example, yeast, higher plants, insects, and mammalian cells. Depending on the host used in the recombinant production procedure, the antibodies of the present invention can be glycosylated or non-glycosylated. Such methods are described in many standard laboratory manuals, such as Sambrook, supra, Sections 17.37-17.42; Ausubel, supra, Chapters 10, 12, 13, 16, 18, and 20.

[0065] In preferred embodiments, the antibody is purified (1) to greater than 95% by weight of antibody, and in more preferred embodiments, greater than 99% by weight, as determined, for example, by the Lowry method, UV-Vis spectroscopy, or SDS capillary gel electrophoresis (e.g., on a Caliper LabChip GXII, GX 90, or Biorad Bioanalyzer instrument); (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence; or (3) to homogeneity by SDS-PAGE under reducing or non-reducing conditions using Coomassie blue or, preferably, silver stain. Isolated naturally occurring antibodies include antibodies in situ within recombinant cells, since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibodies will be prepared by at least one purification step.

[0066] As used in the context of the present invention, the term "Ac225-Macropa-Pelgifatamab" refers to the following compound: [ka] (wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof attached to the rest of the molecule via the terminal amino group of a lysine residue of the monoclonal antibody or antigen-binding fragment thereof).

[0067] As used in the context of the present invention, the term "Ac225-DOTA-pergifatamab" refers to the following compound: [ka] (wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof attached to the rest of the molecule via the terminal amino group of a lysine residue of the monoclonal antibody or antigen-binding fragment thereof).

[0068] The present invention includes a combination comprising the tissue-targeting compound of formula (I) described herein and one or more additional compounds (i.e., additional pharmaceutical agents) that preferably have biological activity against cancer, particularly prostate cancer.These compounds are defined by their class, thus allowing those skilled in the art to identify such compounds that belong to said class.

[0069] In the context of the present invention, nonsteroidal antiandrogen drug refers to the antiandrogen drug with nonsteroidal chemical structure, which is typically selective and is a complete or silent antagonist of androgen receptor.Examples thereof include but are not limited to darolutamide, bicalutamide, enzalutamide, apalutamide, flutamide, nilutamide, topilutamide, proxalutamide or bebdegalutamide or any combination thereof.In the context of the present invention, nonsteroidal antiandrogen drug is preferably selected from darolutamide and enzalutamide, and more preferably, nonsteroidal antiandrogen drug is darolutamide.In certain embodiments, nonsteroidal antiandrogen drug is enzalutamide.In certain embodiments, nonsteroidal antiandrogen drug is apalutamide.In further embodiments, nonsteroidal antiandrogen drug is bicalutamide, flutamide or nilutamide. In other further embodiments, the nonsteroidal antiandrogen is ARV-766, EPI-7386, CC-94676, AC-0176, HP-518 or TAS-3681. Preferably, the nonsteroidal antiandrogen is darolutamide.

[0070] In the context of the present invention, steroidal antiandrogen drug refers to the antiandrogen drug with steroidal chemical structure, which is typically the antagonist of androgen receptor.Its examples include but are not limited to cyproterone acetate, allylestrenol, chlormadinone acetate, delmadinone acetate, gestnorone caproate, hydroxyprogesterone caproate, medroxyprogesterone acetate, megestrol acetate, osaterone acetate, oxendolone and spironolactone.In the context of the present invention, steroidal antiandrogen drug is preferably cyproterone acetate.

[0071] In the context of the present invention, androgen synthesis inhibitor refers to the enzyme inhibitor that prevents the biosynthesis of androgen.Its examples include but are not limited to ketoconazole, abiraterone, aminoglutethimide, goserelin and ceviteronel.In the context of the present invention, androgen synthesis inhibitor is preferably abiraterone or goserelin.

[0072] In the context of the present invention, antigonadotropin drug refers to the compound that suppresses the activity and / or downstream effect of one or both of gonadotropin, follicle-stimulating hormone (FSH) and luteinizing hormone (LH).Examples thereof include but are not limited to abarelix, danazol, gestrinone, paroxypropion, cetrorelix, degarelix, elagolix, ganirelix, linzagolix and relugolix.In the context of the present invention, antigonadotropin drug is preferably degarelix or relugolix.

[0073] In the context of the present invention, PARP inhibitor refers to the compound that is the pharmacological inhibitor of enzyme poly-ADP ribose polymerase (PARP).Its examples include but are not limited to olaparib, rucaparib, veliparib, niraparib, talazoparib, pamiparib, CEP 9722, E7016 and iniparib.In the context of the present invention, PARP inhibitor is preferably olaparib or rucaparib.

[0074] In the context of the present invention, ATR inhibitor refers to a compound that is a pharmacological inhibitor of the enzyme ATR serine / threonine-protein kinase, also known as ataxia telangiectasia and Rad3-related protein or FRAP-related protein 1 (FRP1).Examples thereof include but are not limited to benzosertib, BAY1895344 (elimsertib), AZD6738, M6620, AZ20 and VE 821.In the context of the present invention, ATR inhibitor is preferably benzosertib or BAY1895344.

[0075] In the context of the present invention, ATM inhibitors refer to compounds that are pharmacological inhibitors of the enzyme ATM serine / threonine kinase, examples of which include, but are not limited to, AZD1390, KU-55933, KU-60019, KU-59403, CP-466722, AZ31 / AZ32, and AZD0156.

[0076] In the context of the present invention, DNA-PK inhibitor refers to the compound that is the pharmacological inhibitor of DNA-dependent protein kinase (DNA-PK).Its examples include but are not limited to AZD7648, nedisertib, VX-984, CC-115, samotricisib and BAY-8400.In the context of the present invention, DNA-PK inhibitor is preferably nedisertib or BAY-8400.

[0077] In the context of the present invention, AKT inhibitor refers to the compound that is the pharmacological inhibitor of serine / threonine kinase AKT.Its examples include but are not limited to ipatasertib, afuresertib, milansertib, capivasertib, uprosertib and MK2206.In the context of the present invention, AKT inhibitor is preferably ipatasertib.

[0078] In the context of the present invention, Pi3K inhibitor refers to the compound that can inhibit one or more phosphoinositide 3-kinase (PI3K) enzymes, which are part of PI3K / AKT / mTOR pathway.Its examples include but are not limited to copanlisib, buparlisib, duvelisib, idelalisib, paxalisib, zandelisib, inavolisib, duvelisib, alpelisib and umbralisib.In the context of the present invention, Pi3K inhibitor is preferably copanlisib.

[0079] In the context of this invention, a PSMA-targeted beta-emitter refers to a compound containing a radionuclide capable of emitting beta radiation, examples of which include, but are not limited to, (177Lu)-bipibotide tetraxetane (Pluvicto), 177Lu-PSMA-I&T, and PNT2002.

[0080] In the context of the present invention, immune checkpoint inhibitor refers to a compound that can block proteins called checkpoints, which are produced by some types of immune system cells, such as T cells, and some cancer cells.Checkpoints help prevent immune responses from becoming too strong, and can sometimes prevent T cells from killing cancer cells.Examples of checkpoint inhibitors include, but are not limited to, atezolizumab, durvalumab, avelumab, nivolumab, pembrolizumab, and ipilimumab.

[0081] In the context of this invention, an alpha emitter refers to a compound containing a radionuclide capable of undergoing radioactive decay, where the radionuclide emits an alpha particle (a helium nucleus), thereby transforming or "decaying" into a different atomic nucleus, decreasing its mass number by 4 and its atomic number by 2. Examples include, but are not limited to, 223Ra, J591-225Ac, and PSMA-617-225Ac.

[0082] In the context of the present invention, a vaccine refers to a compound suitable for cell-based cancer immunotherapy of prostate cancer, examples of which include, but are not limited to, sipuleucel-T.

[0083] In the context of the present invention, chemotherapeutic agent refers to the compound suitable for chemotherapy of prostate cancer.Its examples include but are not limited to paclitaxel, docetaxel, ixabepilone, vinorelbine, nocodazole, vincristine, colchicine and eribulin.In the context of the present invention, chemotherapeutic agent is preferably paclitaxel or docetaxel.

[0084] In the context of the present invention, external beam radiation therapy refers to radiation therapy in which an external source of ionizing radiation is directed and / or applied to a specific part of a subject's body.

[0085] In the context of the present invention, the term "combination" refers not only to dosage forms containing all components (i.e., the tissue-targeted compound of formula (I) and an additional pharmaceutical agent, also called a fixed-dose combination), and to combination packs containing the components separate from each other, but also to components administered simultaneously or sequentially, as long as they are used for the prevention or treatment of the same disease.

[0086] The amount of active ingredient administered can vary widely depending on considerations such as the particular compound and dosage unit used, the mode and time of administration, the duration of treatment, the age, sex, and general condition of the patient being treated, the nature and extent of the condition being treated, the rate of drug metabolism and excretion, potential drug combinations and drug-drug interactions.

[0087] Description of the Invention compound According to a first aspect, the present invention provides a tissue-targeting compound of formula (I): [ka] where [Ab] is a monoclonal antibody or antigen-binding fragment thereof having binding affinity for prostate-specific membrane antigen (PSMA). Regarding.

[0088] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] where [Ab] is a monoclonal antibody or antigen-binding fragment thereof that has binding affinity for prostate-specific membrane antigen (PSMA), and [Ab] is attached to the remainder of the molecule via the terminal amino group of a lysine residue of the monoclonal antibody or antigen-binding fragment thereof. Regarding.

[0089] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] (wherein [Ab] is a monoclonal antibody or antigen-binding fragment thereof having binding affinity for prostate-specific membrane antigen (PSMA), selected from pelgifatamab, J591, and TLX592.) Regarding.

[0090] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] (wherein [Ab] is an anti-PSMA monoclonal antibody or antigen-binding fragment thereof selected from pelgifatamab, J591, and TLX592) Regarding.

[0091] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] wherein [Ab] is a monoclonal antibody or antigen-binding fragment thereof having binding affinity for prostate-specific membrane antigen (PSMA), selected from pelgifatamab and J591. Regarding.

[0092] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] (wherein [Ab] is an anti-PSMA monoclonal antibody or antigen-binding fragment thereof selected from pelgifatamab and J591) Regarding.

[0093] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] (wherein [Ab] is J591, a monoclonal antibody or antigen-binding fragment thereof having binding affinity for prostate-specific membrane antigen (PSMA). Regarding.

[0094] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] (wherein [Ab] is the anti-PSMA monoclonal antibody J591 or an antigen-binding fragment thereof) Regarding.

[0095] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] (wherein [Ab] is pelgifatamab, a monoclonal antibody having binding affinity for prostate-specific membrane antigen (PSMA), or an antigen-binding fragment thereof) Regarding.

[0096] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] wherein [Ab] is pergifatamab, a monoclonal antibody or antigen-binding fragment thereof having binding affinity for prostate-specific membrane antigen (PSMA), wherein pergifatamab or an antigen-binding fragment thereof is attached to the remainder of the molecule via the terminal amino group of a lysine residue of the monoclonal antibody or antigen-binding fragment thereof. Regarding.

[0097] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] (wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof) Regarding.

[0098] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pergifatamab or an antigen-binding fragment thereof, and the pergifatamab or antigen-binding fragment thereof is attached to the rest of the molecule via the terminal amino group of a lysine residue of the monoclonal antibody or antigen-binding fragment thereof. Regarding.

[0099] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof, comprising a heavy chain nucleotide sequence having sequence similarity or identity to SEQ ID NO: 1 and a light chain nucleotide sequence having sequence similarity or identity to SEQ ID NO: 2. Regarding.

[0100] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof comprising a heavy chain sequence according to SEQ ID NO: 1 and a light chain sequence according to SEQ ID NO: 2. Regarding.

[0101] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pergifatamab or an antigen-binding fragment thereof comprising a heavy chain sequence according to SEQ ID NO: 1 and a light chain sequence according to SEQ ID NO: 2, wherein the pergifatamab or antigen-binding fragment thereof is linked to the remainder of the molecule via the terminal amino group of a lysine residue of the monoclonal antibody or antigen-binding fragment thereof. Regarding.

[0102] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof, comprising at least three CDR heavy chain sequences according to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, and three CDR light chain sequences according to SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10. Regarding.

[0103] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pergifatamab or an antigen-binding fragment thereof comprising at least three CDR heavy chain sequences according to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7 and three CDR light chain sequences according to SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10, wherein pergifatamab or an antigen-binding fragment thereof is linked to the remainder of the molecule via the terminal amino group of a lysine residue of the monoclonal antibody or antigen-binding fragment thereof. Regarding.

[0104] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] where [Ab] is the heavy chain sequence according to SEQ ID NO: 1: SEQ ID NO:1 - heavy chain and the light chain sequence according to SEQ ID NO: 2: SEQ ID NO:2 - light chain gacatccagatgacccagagccccagctccctgtccgcgtcggtcggagaccgggtcaccatcacctgccgcgcgtcgcagggcatctcgaactacctggcgtggtaccagcagaagaccggcaaggtgccgaagttccttatctacgaggcctctctacgct ccagtcgggagtcccgtcgcggttcagcgggggtggctccgggaccgacttcacgctgaccatctcgagtctccagccggaggacgtcgcgacctattactgtcagaactacaactcggcccccttcaccttcggcccgggcaccaaggtcgacatcaagc gcaccgtcgcggcgccgtccgtcttcatcttccccccgtcggacgagcagctcaagtccggcaccgcctcggtcgtgtgcctgctcaacaacttctacccccgagaggcaaaggtgcagtggaaggtcgacaacgccctgcagtccggcaactcgcaggag agcgtcacggagcaggacagcaaggacagtacctacagcctctcctccaccctgaccctgagtaaagccgactacgagaagcacaaggtgtacgcgtgcgaagtcacccaccagggcctctcgtcccccgtgaccaagtccttcaaccggggcgagtgctga anti-PSMA monoclonal antibody pelgifatamab or its antigen-binding fragment) Regarding.

[0105] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab, or an antigen-binding fragment thereof, comprising a heavy chain amino acid sequence having sequence similarity or identity to SEQ ID NO:3 and a light chain amino acid sequence having sequence similarity or identity to SEQ ID NO:4. Regarding.

[0106] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof, comprising a heavy chain amino acid sequence according to SEQ ID NO: 3 and a light chain amino acid sequence according to SEQ ID NO: 4. Regarding.

[0107] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the heavy chain amino acid sequence according to SEQ ID NO: 3: [Table 1] and the light chain amino acid sequence according to SEQ ID NO: 4: [Table 2] anti-PSMA monoclonal antibody pelgifatamab or its antigen-binding fragment) Regarding.

[0108] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab, or an antigen-binding fragment thereof, comprising a heavy chain nucleotide sequence and / or a deduced amino acid sequence having similarity or identity to the sequence shown in FIG. 1 and a light chain nucleotide sequence and / or a deduced amino acid sequence having similarity or identity to the sequence shown in FIG. 2. Regarding.

[0109] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab, or an antigen-binding fragment thereof, comprising a heavy chain nucleotide sequence and / or deduced amino acid sequence according to the sequence shown in FIG. 1 and a light chain nucleotide sequence and / or deduced amino acid sequence according to the sequence shown in FIG. 2. Regarding.

[0110] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof, comprising at least three CDR heavy chain sequences and three CDR light chain sequences according to the sequences shown in Figure 3. Regarding.

[0111] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pergifatamab or an antigen-binding fragment thereof comprising at least three CDR heavy chain sequences and three CDR light chain sequences according to the sequences shown in Figure 3, and wherein the pergifatamab or antigen-binding fragment thereof is linked to the remainder of the molecule via the terminal amino group of a lysine residue of the monoclonal antibody or antigen-binding fragment thereof. Regarding.

[0112] The tissue-targeting compounds of formula (I) of the present invention comprise a chelating moiety capable of binding to actinium. Preferably, the chelating moiety comprises an 18-membered chelating moiety. Preferably, the chelating moiety comprises the macrocyclic chelator N,N'-bis[(6-carboxy-2-pyridyl)methyl]-4,13-diaza-18-crown-6 (Macropa).

[0113] The macrocyclic chelating agent Macropa is described, for example, in Thiele et al., Angew. Chem. Int. Ed. 2017, 56(46), 14712 and references therein. Macropa chelating agents and their derivatives are also described in WO 2018 / 183906 and WO 2020 / 106886 and references therein.

[0114] The actinium-complexed chelating moiety preferably terminates with an isothiocyanate or carboxylic acid moiety to facilitate its coupling with the anti-PSMA antibody or its antigen-binding fragment. When using a macropaque chelating agent, one of the pyridine rings of the macropaque chelating agent is typically substituted so that it can be coupled to the anti-PSMA antibody or its antigen-binding fragment. This may be a simple functional group (e.g., carboxylic acid -COOH) or a more complex chemical structure, as long as it can be coupled to the anti-PSMA antibody or its antigen-binding fragment. In particular, the substituent on the pyridine ring of the macropaque chelating agent preferably terminates with an isothiocyanate or carboxylic acid moiety.

[0115] The anti-PSMA antibody or antigen-binding fragment thereof is preferably coupled to the remainder of the molecule forming the tissue-targeting compound of the present invention through a lysine residue on the antibody. Thus, the actinium-complexed chelating moiety and the anti-PSMA antibody or antigen-binding fragment thereof can be coupled via an amide or thiourea moiety. When using the preferred macrocyclic chelator Macropa, the terminal isothiocyanate or carboxylic acid moiety couples with the terminal amino group of the lysine residue in the anti-PSMA antibody or antigen-binding fragment thereof, resulting in the formation of a thiourea or amide group, respectively. Thus, the preferred actinium-complexed chelating moiety, including the Macropa chelator, is coupled to the anti-PSMA antibody or antigen-binding fragment thereof via a thiourea or amide bond derived from the terminal amino group of the lysine residue in the anti-PSMA antibody or antigen-binding fragment thereof.

[0116] The preferred antibody or antigen-binding fragment thereof in the compound of the present invention has binding affinity to PSMA (anti-PSMA antibody). Prostate-specific membrane antigen (PSMA) is an enzyme encoded by the FOLH1 (folate hydrolase 1) gene in humans. Specific binding fragments such as Fab, Fab', F(ab')2 and single-chain specific binding antibodies are typical fragments. In particular, the anti-PSMA antibody is preferably selected from pelgifatamab, J591 and TLX592 or antigen-binding fragments thereof. Preferably, the anti-PSMA antibody is selected from pelgifatamab and J591 or antigen-binding fragments thereof. More preferably, the anti-PSMA antibody is pelgifatamab or antigen-binding fragment thereof.

[0117] Pergifatamab (CAS Registry Number 2414550-93-7, WHO Recommended List 86, WHO Drug Information, Vol. 35, No. 3, INN published in 2021) is a monoclonal antibody (anti-PSMA antibody) with binding affinity to the antigen PSMA. Its preparation, isolation, and purification are described, for example, in U.S. Pat. No. 8,114,965 (pergifatamab = clone 006).

[0118] Pergifatamab has a heavy chain nucleotide sequence according to SEQ ID NO: 1: SEQ ID NO:1 - heavy chain and the light chain nucleotide sequence according to SEQ ID NO:2: SEQ ID NO:2 - light chain gacatccagatgacccagagccccagctccctgtccgcgtcggtcggagaccgggtcaccatcacctgccgcgcgtcgcagggcatctcgaactacctggcgtggtaccagcagaagaccggcaaggtgccgaagttccttatctacgaggcctctctacgct ccagtcgggagtcccgtcgcggttcagcgggggtggctccgggaccgacttcacgctgaccatctcgagtctccagccggaggacgtcgcgacctattactgtcagaactacaactcggcccccttcaccttcggcccgggcaccaaggtcgacatcaagc gcaccgtcgcggcgccgtccgtcttcatcttccccccgtcggacgagcagctcaagtccggcaccgcctcggtcgtgtgcctgctcaacaacttctacccccgagaggcaaaggtgcagtggaaggtcgacaacgccctgcagtccggcaactcgcaggag agcgtcacggagcaggacagcaaggacagtacctacagcctctcctccaccctgaccctgagtaaagccgactacgagaagcacaaggtgtacgcgtgcgaagtcacccaccagggcctctcgtcccccgtgaccaagtccttcaaccggggcgagtgctga Includes:

[0119] Additionally, pergifatamab has a heavy chain amino acid sequence according to SEQ ID NO: 3: [Table 3] and the light chain amino acid sequence according to SEQ ID NO: 4: [Table 4] Includes:

[0120] Additionally, pergifatamab comprises a heavy chain nucleotide sequence according to the sequence shown in FIG. 1 and a light chain nucleotide sequence according to the sequence shown in FIG.

[0121] Additionally, pergifatamab comprises a heavy chain amino acid sequence according to the sequence shown in FIG. 1 and a light chain amino acid sequence according to the sequence shown in FIG.

[0122] Additionally, pergifatamab comprises at least three CDR heavy chain sequences according to SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 and three CDR light chain sequences according to SEQ ID NO:8, SEQ ID NO:9 and SEQ ID NO:10: Pergifatamab CDR heavy chain sequence SEQ ID NO: 5: RYGMH SEQ ID NO: 6: VIWYDGSNKYYADSVKG SEQ ID NO: 7: GGDFLYYYYYGMDV Pergifatamab CDR light chain sequence SEQ ID NO: 8: RASQGISNYLA SEQ ID NO: 9: EASTLQS SEQ ID NO: 10: QNYNSAPFT

[0123] Additionally, pergifatamab contains at least three CDR heavy chain sequences and three CDR light chain sequences according to the sequences shown in FIG.

[0124] J591 is a monoclonal antibody (anti-PSMA antibody) with binding affinity to the antigen PSMA. Its preparation, isolation, and purification are described, for example, in WO 2002 / 098897 and EP 2277542.

[0125] Additionally, J591 comprises a heavy chain sequence according to SEQ ID NO: 11 and a light chain sequence according to SEQ ID NO: 12: SEQ ID NO:11: EVQLVQSGPE VKKPGATVKI SCKTSGYTFT EYTIHWVKQA PGKGLEWIGN INPNNGGTTY NQKFEDKATL TVDKSTDTAY MELSSLRSED TAVYYCAAGW NFDYWGQGTL LTVSSASTKG PSVFPLAPSS KSTSGGTAAL GCLVKDYFPE PVTVSWNSGA LTSGVHTFPA VLQSSGLYSL SSVVTVPSSS LGTQTYICNV NHKPSNTKVD KKVEPKSCDK THTCPPCPAP ELLGGPSVFL FPPKPKDTLM ISRTPEVTCV VVDVSHEDPE VKFNWYVDGV EVHNAKTKPR EEQYNSTYRV VSVLTVLHQD WLNGKEYKCK VSNKALPAPI EKTISKAKGQ PREPQVYTLP PSRDELTKNQ VSLTCLVKGF YPSDIAVEWE SNGQPENNYK TTPPVLDSDG SFFLYSKLTV DKSRWQQGNV FSCSVMHEAL HNHYTQKSLS LSPG SEQ ID NO: 12: DIQMTQSPSS LSTSVGDRVT LTCKASQDVG TAVDWYQQKP GPSPKLLIYW ASTRHTGIPS RFSGSGSGTD FTLTISSLQP EDFADYYCQQ YNSYPLTFGP GTKVDIKRTV AAPSVFIFPP SDEQLKSGTA SVVCLLNNFY PREAKVQWKV DNALQSGNSQ ESVTEQDSKD STYSLSSTLT LSKADYEKHK VYACEVTHQG LSSPVTKSFN RGEC

[0126] Furthermore, J591 comprises at least three CDR heavy chain sequences according to SEQ ID NO: 13, SEQ ID NO: 14 and SEQ ID NO: 15 and three CDR light chain sequences according to SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18: J591 CDR heavy chain sequence SEQ ID NO: 13: YTIH SEQ ID NO: 14: N INPNNGGTTY NQKFED SEQ ID NO: 15: GW NFDY J591 CDR light chain sequence SEQ ID NO: 16: KASQDVG TAVD SEQ ID NO: 17: W ASTRHT SEQ ID NO: 18: QQ YNSYPLT

[0127] TLX592 is a monoclonal antibody (anti-PSMA antibody) with binding affinity for the antigen PSMA developed by Telix Pharmaceuticals, as described, for example, in WO 2021 / 000018.

[0128] TLX592 comprises a heavy chain sequence according to SEQ ID NO: 19 and a light chain sequence according to SEQ ID NO: 20: SEQ ID NO: 19: EVQLVQSGAE VKKPGASVKV SCKASGYTFT EYTIHWVRQA PGKGLEWIGN INPNNGGTTY NQKFEDRVTI TVDKSTSTAY MELSSLRSED TAVYYCAAGW NFDYWGQGTT VTVSSASTKG PSVFPLAPSS KSTSGGTAAL GCLVKDYFPE PVTVSWNSGA LTSGVHTFPA VLQSSGLYSL SSVVTVPSSS LGTQTYICNV NHKPSNTKVD KRVEPKSCDK THTCPPCPAP ELLGGPSVFL FPPKPKDTLM ISRTPEVTCV VVDVSHEDPE VKFNWYVDGV EVHNAKTKPR EEQYNSTYRV VSVLTVLAQD WLNGKEYKCK VSNKALPAPI EKTISKAKGQ PREPQVYTLP PSREEMTKNQ VSLTCLVKGF YPSDIAVEWE SNGQPENNYK TTPPVLDSDG SFFLYSKLTV DKSRWQQGNV FSCSVMHEAL HNQYTQKSLS LSPGK SEQ ID NO:20: DIQMTQSPST LSASVGDRVT ITCKASQDVG TAVDWYQQKP GQAPKLLIYW ASTRHTGVPD RFSGSGGSTD FTLTISRLQP EDFAVYYCQQ YNSYPLTFGQ GTKVDIKRTV AAPSVFIFPP SDEQLKSGTA SVVCLLNNFY PREAKVQWKV DNALQSGNSQ ESVTEQDSKD STYSLSSTLT LSKADYEKHK VYACEVTHQG LSSPVTKSFN RGEC

[0129] Furthermore, TLX592 comprises at least three CDR heavy chain sequences according to SEQ ID NO: 21, SEQ ID NO: 22 and SEQ ID NO: 23 and three CDR light chain sequences according to SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26: TLX592 CDR heavy chain sequence SEQ ID NO: 21: EYTIH SEQ ID NO: 22: N INPNNGGTTY NQKFED SEQ ID NO: 23: GW NFDY TLX592 CDR light chain sequence SEQ ID NO: 24: KASQDVG TAVD SEQ ID NO: 25: W ASTRHT SEQ ID NO: 26: QQ YNSYPLT

[0130] combination In a further aspect, the present invention relates to a combination, preferably a pharmaceutical combination, comprising a tissue-targeting compound of formula (I) above and a further pharmaceutical agent, said combination being useful in therapy, preferably in the treatment of hyperproliferative diseases such as cancer.

[0131] A combination comprising an effective amount of a tissue-targeting compound of formula (I) above and an additional pharmaceutical agent achieves greater therapeutic efficacy than either compound used alone.

[0132] The relative ratios of each compound in the combination can also be selected based on their respective mechanisms of action and disease biology. The relative ratios of each compound can vary widely.

[0133] The release of one or more agents of the combination can also be controlled to provide the desired therapeutic activity, if present in a single dosage form, combination pack, kit, or in separate, individual dosage forms, as desired.

[0134] Generally, the combinations of the present invention comprise: (1) produce a superior effect in reducing tumor growth or even eliminating tumors compared to administration of either agent alone; (2) resulting in the administration of smaller doses of the targeted compound and / or chemotherapeutic agent; (3) provide chemotherapy treatments that are better tolerated by patients with fewer adverse pharmacological complications than are observed with single-agent chemotherapy and certain other combination therapies; (4) providing treatment for a wide range of different cancer types in mammals, particularly humans; (5) provide a high response rate among treated patients; (6) Providing longer survival times among treated patients compared with standard chemotherapy treatments; (7) resulting in a longer time to tumor progression, and / or (8) Providing efficacy and tolerability results that are at least as good as those of the drugs used alone, compared with known inhibitory effects of other cancer drug combinations It is useful.

[0135] The tissue-targeting compounds of formula (I) are compounds of the invention described herein.

[0136] The additional pharmaceutical agent is selected from a non-steroidal antiandrogen, a steroidal antiandrogen, an androgen synthesis inhibitor, an antigonadotropin, a PARP inhibitor, an ATR inhibitor, an ATM inhibitor, a DNA-PK inhibitor, an AKT inhibitor, a Pi3K inhibitor, a PSMA-targeted beta emitter, an immune checkpoint inhibitor, an alpha emitter, a vaccine, and a chemotherapeutic agent.

[0137] Preferably, the further pharmaceutical agent is selected from a non-steroidal antiandrogen, a steroidal antiandrogen, an androgen synthesis inhibitor, an antigonadotropin, a PARP inhibitor, an AKT inhibitor, a Pi3K inhibitor, a PSMA-targeted beta-emitter, an immune checkpoint inhibitor, an alpha-emitter, a vaccine, and a chemotherapeutic agent.

[0138] More preferably, the additional pharmaceutical agent is selected from a non-steroidal antiandrogen, a steroidal antiandrogen, an androgen synthesis inhibitor, an antigonadotropin, a PARP inhibitor, a PSMA-targeted beta-emitter, an alpha-emitter, a vaccine, and a chemotherapeutic agent.

[0139] More preferably, the additional pharmaceutical agent is selected from non-steroidal antiandrogens, steroidal antiandrogens, androgen synthesis inhibitors, antigonadotropins and PARP inhibitors.

[0140] Even more preferably, the additional pharmaceutical agent is selected from nonsteroidal antiandrogens, steroidal antiandrogens, androgen synthesis inhibitors, and antigonadotropins.

[0141] Even more preferably, the additional pharmaceutical agent is a nonsteroidal antiandrogen.

[0142] When the additional pharmaceutical agent is a nonsteroidal antiandrogen, it is preferably selected from darolutamide, bicalutamide, enzalutamide, apalutamide, flutamide, nilutamide, topilutamide, proxalutamide, or bebdegalutamide, or any combination thereof.More preferably, the nonsteroidal antiandrogen is selected from darolutamide and enzalutamide, and most preferably, the nonsteroidal antiandrogen is darolutamide.In certain embodiments, the nonsteroidal antiandrogen is enzalutamide.In certain embodiments, the nonsteroidal antiandrogen is apalutamide.In further embodiments, the nonsteroidal antiandrogen is bicalutamide, flutamide, or nilutamide. In other further embodiments, the nonsteroidal antiandrogen is ARV-766, EPI-7386, CC-94676, AC-0176, HP-518 or TAS-3681. Preferably, the nonsteroidal antiandrogen is darolutamide.

[0143] When the additional pharmaceutical agent is a steroidal antiandrogen, it is preferably selected from cyproterone acetate, allylestrenol, chlormadinone acetate, delmadinone acetate, gestnorone caproate, hydroxyprogesterone caproate, medroxyprogesterone acetate, megestrol acetate, osaterone acetate, oxendolone and spironolactone. More preferably, the steroidal antiandrogen is cyproterone acetate.

[0144] If the additional pharmaceutical agent is an androgen synthesis inhibitor, it is preferably selected from ketoconazole, abiraterone, aminoglutethimide, goserelin and ceviteronel. More preferably, the androgen synthesis inhibitor is abiraterone or goserelin.

[0145] If the additional pharmaceutical agent is an antigonadotropin, it is preferably selected from abarelix, danazol, gestrinone, paroxypropion, cetrorelix, degarelix, elagolix, ganirelix, linzagolix, and relugolix. More preferably, the antigonadotropin is degarelix or relugolix.

[0146] When the additional pharmaceutical agent is a PARP inhibitor, it is preferably selected from olaparib, rucaparib, veliparib, niraparib, talazoparib, pamiparib, CEP 9722, E7016 and iniparib. More preferably, the PARP inhibitor is olaparib or rucaparib.

[0147] When the further pharmaceutical agent is an ATR inhibitor, it is preferably selected from beruzosertib, BAY1895344, AZD6738, M6620, AZ20 and VE 821. More preferably, the ATR inhibitor is beruzosertib or BAY1895344 (elimsertib).

[0148] When the further pharmaceutical agent is an ATM inhibitor, it is preferably selected from AZD1390, KU-55933, KU-60019, KU-59403, CP-466722, AZ31 / AZ32 and AZD0156.

[0149] When the additional pharmaceutical agent is a DNA-PK inhibitor, it is preferably selected from ZD7648, nedisertib, VX-984, CC-115, samotricisib and BAY-8400. More preferably, the DNA-PK inhibitor is nedisertib or BAY-8400.

[0150] When the additional pharmaceutical agent is an AKT inhibitor, it is preferably selected from ipatasertib, afuresertib, milansertib, capivasertib, uprosertib and MK2206. More preferably, the AKT inhibitor is ipatasertib.

[0151] When the additional pharmaceutical agent is a Pi3K inhibitor, it is preferably selected from copanlisib, buparlisib, duvelisib, idelalisib, paxalisib, zandelisib, inavolisib, duvelisib, alpelisib and umbralisib. More preferably, the Pi3K inhibitor is copanlisib.

[0152] When the additional pharmaceutical agent is a PSMA-targeted beta-emitter, it is preferably (177Lu)-bipibotide tetraxetane (Pluvicto), 177Lu-PSMA-I&T and PNT2002.

[0153] When the further pharmaceutical agent is an immune checkpoint inhibitor, it is preferably selected from atezolizumab, durvalumab, avelumab, nivolumab, pembrolizumab and ipilimumab.

[0154] When the further pharmaceutical agent is an alpha emitter, it is preferably selected from 223Ra, J591-225Ac and PSMA-617-225Ac.

[0155] When the additional pharmaceutical agent is a vaccine, it is preferably sipuleucel-T.

[0156] When the additional pharmaceutical agent is a chemotherapeutic agent, it is preferably selected from paclitaxel, docetaxel, ixabepilone, vinorelbine, nocodazole, vincristine, colchicine and eribulin. More preferably, the chemotherapeutic agent is paclitaxel or docetaxel.

[0157] Thus, in one embodiment, the present invention provides a method for treating a cancer cell comprising: (i) a tissue-targeting compound of formula (I) [ka] where [Ab] is a monoclonal antibody or antigen-binding fragment thereof having binding affinity for prostate-specific membrane antigen (PSMA), and (ii) a pharmaceutical agent selected from nonsteroidal antiandrogens, steroidal antiandrogens, androgen synthesis inhibitors, antigonadotropins, PARP inhibitors, ATR inhibitors, ATM inhibitors, DNA-PK inhibitors, AKT inhibitors, Pi3K inhibitors, PSMA-targeted beta-emitters, immune checkpoint inhibitors, alpha-emitters, vaccines, and chemotherapeutic agents; The present invention relates to a combination comprising:

[0158] In a further embodiment, the present invention provides a method for producing a pharmaceutical composition comprising: (i) a tissue-targeting compound of formula (I) [ka] (wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof), and (ii) a pharmaceutical agent selected from nonsteroidal antiandrogens, steroidal antiandrogens, androgen synthesis inhibitors, antigonadotropins, PARP inhibitors, ATR inhibitors, ATM inhibitors, DNA-PK inhibitors, AKT inhibitors, Pi3K inhibitors, PSMA-targeted beta-emitters, immune checkpoint inhibitors, alpha-emitters, vaccines, and chemotherapeutic agents; The present invention relates to a combination comprising:

[0159] In a further embodiment, the present invention provides a method for producing a pharmaceutical composition comprising: (i) a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pergifatamab or an antigen-binding fragment thereof, wherein pergifatamab or an antigen-binding fragment thereof is attached to the remainder of the molecule via the terminal amino group of a lysine residue of the monoclonal antibody or antigen-binding fragment thereof, and (ii) a pharmaceutical agent selected from nonsteroidal antiandrogens, steroidal antiandrogens, androgen synthesis inhibitors, antigonadotropins, PARP inhibitors, ATR inhibitors, ATM inhibitors, DNA-PK inhibitors, AKT inhibitors, Pi3K inhibitors, PSMA-targeted beta-emitters, immune checkpoint inhibitors, alpha-emitters, vaccines, and chemotherapeutic agents; The present invention relates to a combination comprising:

[0160] In a further embodiment, the present invention provides a method for producing a pharmaceutical composition comprising: (i) a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof comprising a heavy chain sequence according to SEQ ID NO: 1 and a light chain sequence according to SEQ ID NO: 2, and (ii) a pharmaceutical agent selected from nonsteroidal antiandrogens, steroidal antiandrogens, androgen synthesis inhibitors, antigonadotropins, PARP inhibitors, ATR inhibitors, ATM inhibitors, DNA-PK inhibitors, AKT inhibitors, Pi3K inhibitors, PSMA-targeted beta-emitters, immune checkpoint inhibitors, alpha-emitters, vaccines, and chemotherapeutic agents; The present invention relates to a combination comprising:

[0161] In a further embodiment, the present invention provides a method for producing a pharmaceutical composition comprising: (i) a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof, comprising at least three CDR heavy chain sequences according to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, and three CDR light chain sequences according to SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10; and (ii) a pharmaceutical agent selected from nonsteroidal antiandrogens, steroidal antiandrogens, androgen synthesis inhibitors, antigonadotropins, PARP inhibitors, ATR inhibitors, ATM inhibitors, DNA-PK inhibitors, AKT inhibitors, Pi3K inhibitors, PSMA-targeted beta-emitters, immune checkpoint inhibitors, alpha-emitters, vaccines, and chemotherapeutic agents; The present invention relates to a combination comprising:

[0162] In a further embodiment, the present invention provides a method for producing a pharmaceutical composition comprising: (i) a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof, comprising a heavy chain amino acid sequence according to SEQ ID NO: 3 and a light chain amino acid sequence according to SEQ ID NO: 4, and (ii) a pharmaceutical agent selected from nonsteroidal antiandrogens, steroidal antiandrogens, androgen synthesis inhibitors, antigonadotropins, PARP inhibitors, ATR inhibitors, ATM inhibitors, DNA-PK inhibitors, AKT inhibitors, Pi3K inhibitors, PSMA-targeted beta-emitters, immune checkpoint inhibitors, alpha-emitters, vaccines, and chemotherapeutic agents; The present invention relates to a combination comprising:

[0163] In a further embodiment, the present invention provides a method for producing a pharmaceutical composition comprising: (i) a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof, comprising at least three CDR heavy chain sequences according to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, and three CDR light chain sequences according to SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10; and (ii) a drug selected from nonsteroidal antiandrogens, steroidal antiandrogens, androgen synthesis inhibitors, antigonadotropins, PARP inhibitors, PSMA-targeted beta-emitters, alpha-emitters, vaccines, and chemotherapeutic agents; The present invention relates to a combination comprising:

[0164] In a further embodiment, the present invention provides a method for producing a pharmaceutical composition comprising: (i) a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof, comprising at least three CDR heavy chain sequences according to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, and three CDR light chain sequences according to SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10; and (ii) a drug selected from nonsteroidal antiandrogens, steroidal antiandrogens, androgen synthesis inhibitors, antigonadotropins, and PARP inhibitors The present invention relates to a combination comprising:

[0165] In a further embodiment, the present invention provides a method for producing a pharmaceutical composition comprising: (i) a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof, comprising at least three CDR heavy chain sequences according to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, and three CDR light chain sequences according to SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10; and (ii) a drug selected from nonsteroidal antiandrogens, steroidal antiandrogens, androgen synthesis inhibitors, and antigonadotropins; The present invention relates to a combination comprising:

[0166] In a further embodiment, the present invention provides a method for producing a pharmaceutical composition comprising: (i) a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof, comprising at least three CDR heavy chain sequences according to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, and three CDR light chain sequences according to SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10; and (ii) nonsteroidal antiandrogen The present invention relates to a combination comprising:

[0167] In a further embodiment, the present invention provides a method for producing a pharmaceutical composition comprising: (i) a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof, comprising at least three CDR heavy chain sequences according to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, and three CDR light chain sequences according to SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10; and (ii) a nonsteroidal antiandrogen selected from the group consisting of darolutamide, bicalutamide, enzalutamide, apalutamide, flutamide, nilutamide, and topirutamide, cyproterone acetate, allylestrenol, chlormadinone acetate, delmadinone acetate, gestnorone caproate, hydroxyprogesterone caproate, medroxyprogesterone acetate, megestrol acetate, osaterone acetate, oxendolone, and spironolactone; steroidal antiandrogens selected from the group consisting of ketoconazole, abiraterone, aminoglutethimide, goserelin and seviteronel, androgen synthesis inhibitors selected from the group consisting of abarelix, danazol, gestrinone, paroxypropion, cetrorelix, degarelix, elagolix, ganirelix, linzagolix and relugolix, antigonadotropins selected from the group consisting of olaparib, rucaparib, veliparib, niraparib, talazoparib, pamiparib, CEP a PARP inhibitor selected from the group consisting of 9722, E7016, and iniparib; a PSMA-targeted beta-emitter (177Lu)-bipibotide tetraxetan (Pluvicto); an alpha-emitter selected from the group consisting of 223Ra, J591-225Ac, and PSMA-617-225Ac; the vaccine sipuleucel-T; and a chemotherapeutic agent selected from the group consisting of paclitaxel, docetaxel, ixabepilone, vinorelbine, nocodazole, vincristine, colchicine, and eribulin. The present invention relates to a combination comprising:

[0168] In a further embodiment, the present invention provides a method for producing a pharmaceutical composition comprising: (i) a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof, comprising at least three CDR heavy chain sequences according to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, and three CDR light chain sequences according to SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10; and (ii) a nonsteroidal antiandrogen selected from the group consisting of darolutamide, bicalutamide, enzalutamide, apalutamide, flutamide, nilutamide, and topirutamide, and a group consisting of cyproterone acetate, allylestrenol, chlormadinone acetate, delmadinone acetate, gestnorone caproate, hydroxyprogesterone caproate, medroxyprogesterone acetate, megestrol acetate, osaterone acetate, oxendolone, and spironolactone androgen synthesis inhibitors selected from the group consisting of ketoconazole, abiraterone, aminoglutethimide, goserelin, and seviteronel; antigonadotropins selected from the group consisting of abarelix, danazol, gestrinone, paroxypropion, cetrorelix, degarelix, elagolix, ganirelix, linzagolix, and relugolix; and PARP inhibitors selected from the group consisting of olaparib, rucaparib, veliparib, niraparib, talazoparib, pamiparib, CEP 9722, E7016, and iniparib. The present invention relates to a combination comprising:

[0169] In a further embodiment, the present invention provides a method for producing a pharmaceutical composition comprising: (i) a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof, comprising at least three CDR heavy chain sequences according to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, and three CDR light chain sequences according to SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10; and (ii) a nonsteroidal antiandrogen selected from the group consisting of darolutamide, bicalutamide, enzalutamide, apalutamide, flutamide, nilutamide, and topirutamide, cyproterone acetate, allylestrenol, chlormadinone acetate, delmadinone acetate, gestnorone caproate, hydroxyprogesterone caproate, medroxyprogesterone acetate, megestrol acetate, osaterone acetate, and oxendolone and spironolactone; androgen synthesis inhibitors selected from the group consisting of ketoconazole, abiraterone, aminoglutethimide, goserelin, and seviteronel; and antigonadotropins selected from the group consisting of abarelix, danazol, gestrinone, paroxypropion, cetrorelix, degarelix, elagolix, ganirelix, linzagolix, and relugolix. The present invention relates to a combination comprising:

[0170] In a further embodiment, the present invention provides a method for producing a pharmaceutical composition comprising: (i) a tissue-targeting compound of formula (I) [ka] wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof, comprising at least three CDR heavy chain sequences according to SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, and three CDR light chain sequences according to SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10; and (ii) a drug selected from the group consisting of the nonsteroidal antiandrogen darolutamide, the steroidal antiandrogen cyproterone acetate, the androgen synthesis inhibitor abiraterone or goserelin, and the antigonadotropin degarelix or relugolix; The present invention relates to a combination comprising:

[0171] synthesis In a further aspect, the present invention provides a tissue-targeting compound of formula (I): [ka] where [Ab] is a monoclonal antibody or antigen-binding fragment thereof that has binding affinity for PSMA. 1. A method for preparing (i) a chelating moiety of formula (II) [ka] to a monoclonal antibody or antigen-binding fragment thereof having binding affinity for PSMA; (ii) contacting the resulting product with an aqueous solution containing ions of at least one alpha-emitting actinium isotope; The present invention relates to a method comprising:

[0172] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] where [Ab] is a monoclonal antibody or antigen-binding fragment thereof that has binding affinity for PSMA. 1. A method for preparing (i) a chelating moiety of formula (II) [ka] to a monoclonal antibody or antigen-binding fragment thereof having binding affinity for PSMA via a lysine residue on the monoclonal antibody or antigen-binding fragment thereof; (ii) contacting the resulting product with an aqueous solution containing ions of at least one alpha-emitting actinium isotope; The present invention relates to a method comprising:

[0173] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] (wherein [Ab] is an anti-PSMA antibody or antigen-binding fragment thereof selected from pelgifatamab, J591, and TLX592). 1. A method for preparing (i) a chelating moiety of formula (II) [ka] to an anti-PSMA antibody or antigen-binding fragment thereof selected from pelgifatamab, J591, and TLX592 via a lysine residue on the anti-PSMA antibody or antigen-binding fragment thereof; (ii) contacting the resulting product with an aqueous solution containing ions of at least one alpha-emitting actinium isotope; The present invention relates to a method comprising:

[0174] In a further embodiment, the present invention provides a tissue-targeting compound of formula (I) [ka] (wherein [Ab] is the anti-PSMA antibody pelgifatamab or an antigen-binding fragment thereof) 1. A method for preparing (i) a chelating moiety of formula (II) [ka] to the anti-PSMA antibody pelgifatamab or an antigen-binding fragment thereof via a lysine residue on the monoclonal antibody or antigen-binding fragment thereof; (ii) contacting the resulting product with an aqueous solution containing ions of at least one alpha-emitting actinium isotope; The present invention relates to a method comprising:

[0175] In step (i), a chelating moiety of formula (II) [ka] is coupled to a monoclonal antibody or an antigen-binding fragment thereof having binding affinity for PSMA. Preferably, the anti-PSMA antibody is selected from pelgifatamab, J591, and TLX592, or an antigen-binding fragment thereof. More preferably, the anti-PSMA antibody is pelgifatamab or an antigen-binding fragment thereof.

[0176] Preferably, the chelating moiety of formula (II) is coupled to the anti-PSMA antibody, or antigen-binding fragment thereof, via a lysine residue on the monoclonal antibody, thus forming a thiourea moiety that links the chelating moiety to the anti-PSMA antibody, or antigen-binding fragment thereof.

[0177] Preferably, the coupling in step (i) is carried out at a basic pH, ie at a pH above 7. More preferably, the coupling in step (i) is carried out at a pH between 8 and 10, most preferably at pH 9.

[0178] After step (i), a tissue-targeted chelating agent of formula (III) is produced. Thus, in a further embodiment, the present invention provides a tissue-targeted chelating agent of formula (III): [ka] where [Ab] is a monoclonal antibody or antigen-binding fragment thereof that has binding affinity for PSMA. Regarding.

[0179] Preferably, the anti-PSMA antibody or antigen-binding fragment thereof is selected from pelgifatamab, J591, and TLX592, or an antigen-binding fragment thereof. More preferably, the anti-PSMA antibody is pelgifatamab or an antigen-binding fragment thereof.

[0180] In step (ii), the product obtained from the coupling of step (i) is contacted with an aqueous solution containing ions of at least one alpha-emitting actinium isotope. Preferably, the alpha-emitting actinium isotope is 225Ac. Preferably, the ions of the at least one alpha-emitting actinium isotope have a triple positive charge. 225 Ac, i.e. 225 Ac 3+ The present invention allows step (ii) to be carried out at room temperature, i.e., at a lower temperature than that required for the preparation of the corresponding DOTA conjugate (i.e., Ac225-DOTA-pergifatamab), which requires a higher temperature (60° C.).

[0181] use In a further embodiment, the tissue-targeting compound of formula (I) of the present invention and / or a combination comprising the tissue-targeting compound of formula (I) and an additional pharmaceutical agent of the present invention can be used to treat diseases in human or non-human animal subjects. In particular, the tissue-targeting compound of formula (I) of the present invention and / or a combination comprising the tissue-targeting compound of formula (I) and an additional pharmaceutical agent of the present invention can be used to treat hyperplastic and / or neoplastic diseases, such as cancer. Several targets are known to be associated with hyperplastic and neoplastic diseases. These include specific receptors, cell surface proteins, transmembrane proteins, and proteins / peptides found in the extracellular matrix near diseased cells. Examples of cell surface receptors and antigens that may be associated with neoplastic diseases include, but are not limited to, CD22, CD33, FGFR2 (CD332), PSMA, HER2, GPC3, and mesothelin. In a preferred embodiment, the tissue-targeting compound of Formula (I) of the present invention and / or a combination comprising the tissue-targeting compound of Formula (I) of the present invention includes a tissue-targeting moiety comprising a monoclonal antibody having specificity and / or binding affinity for PSMA. This can be reflected, for example, by a binding affinity for PSMA-expressing cells that is 50-fold or greater (preferably at least 100-fold or greater, more preferably at least 300-fold or greater) greater than for non-PSMA-expressing cells. PSMA is believed to be expressed and / or overexpressed in cells with certain disease states (as described herein); therefore, a PSMA-specific binding agent can be useful for targeting complexes to cells affected by such diseases. Similarly, the tissue-targeting moiety can bind to a cell surface marker (e.g., a PSMA receptor) present on cells in the vicinity of disease-affected cells. The PSMA cell surface marker can be more strongly expressed on diseased cells than on healthy cells, or on cells during periods of growth or replication than during a quiescent state. In one embodiment, a PSMA-specific tissue-targeting binding agent can be used in combination with another binding agent for a disease-specific cell surface marker to obtain a dual-binding complex. Tissue-targeting binding agents of PSMA are typically peptides or proteins as discussed herein.

[0182] Various aspects of the invention described herein relate to the treatment of disease, particularly for the selective targeting of diseased tissue, as well as complexes, conjugates, medicaments, formulations, kits, etc. useful in such methods. In all aspects, the diseased tissue may be present at a single site within the body (e.g., in the case of a localized solid tumor) or at multiple sites (e.g., when several joints are affected by arthritis or in the case of distributed or metastatic cancerous disease).

[0183] The targeted diseased tissue may be a soft tissue site, a calcified tissue site, or multiple sites, which may be entirely within soft tissue, entirely within calcified tissue, or may include at least one soft tissue site and / or at least one calcified tissue site. In one embodiment, at least one soft tissue site is targeted. The target site and the site of origin of the disease may be the same, or may be different (such as when specifically targeting a metastatic site). If more than one site is involved, this may include the site of origin or may be multiple secondary sites.

[0184] The term "soft tissue" is used herein to refer to tissue that does not have a "hard" mineralized matrix. In particular, soft tissue, as used herein, can be any tissue that is not skeletal. Correspondingly, "soft tissue disease," as used herein, refers to a disease that occurs in "soft tissue," as used herein. The present invention is particularly suited to the treatment of cancer, and thus "soft tissue disease" encompasses carcinomas, sarcomas, myelomas, leukemias, lymphomas, and mixed cancers that occur in any "soft" (i.e., non-calcified) tissue, as well as other non-cancerous diseases of such tissues. Cancerous "soft tissue disease" includes solid tumors that occur in soft tissue, as well as metastatic and micrometastatic tumors. Indeed, a soft tissue disease can include a primary solid tumor of soft tissue and at least one metastatic tumor of soft tissue in the same patient. Alternatively, a "soft tissue disease" can consist of only a primary tumor or only a metastasis where the primary tumor is a skeletal disease. Particularly suitable for treatment and / or targeting in any suitable embodiment of the present invention are blood neoplasms, particularly neoplastic diseases of lymphoid cells, such as lymphomas and lymphocytic leukemias, including non-Hodgkin's lymphoma, B-cell neoplasms of B-cell lymphomas. Similarly, any neoplastic disease of the bone marrow, spinal (particularly spinal) lymph nodes and / or blood cells is suitable for treatment and / or targeting in any suitable embodiment of the present invention.

[0185] Some examples of B cell disorders (e.g., neoplasms) suitable for treatment and / or targeting in appropriate embodiments of the present invention include: Chronic lymphocytic leukemia / small lymphocytic lymphoma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma (e.g., Waldenstrom's macroglobulinemia), splenic marginal zone lymphoma, plasma cell neoplasms (e.g., plasma cell myeloma, plasmacytoma, monoclonal immunoglobulin deposition disease, heavy chain disease), extranodal marginal zone B-cell lymphoma (MALT lymphoma), nodal marginal zone B-cell lymphoma (NMZL), follicular lymphoma, mantle cell lymphoma, diffuse large B-cell lymphoma, mediastinal (thymic) large B-cell lymphoma, intravascular large B-cell lymphoma, primary effusion lymphoma, and Burkitt's lymphoma / leukemia.

[0186] The tissue-targeting compounds of formula (I) of the present invention and / or combinations comprising a tissue-targeting compound of formula (I) and an additional pharmaceutical agent of the present invention preferably comprise a tissue-targeting moiety comprising a monoclonal antibody having binding affinity for prostate-specific membrane antigen (PSMA). PSMA expression in tumor cells has been observed in various types of diseases, particularly hyperproliferative diseases such as cancer (Uijen et al., Eur. J. Nucl. Med. Mol. Imaging 2021, 48, 4350, doi:10.1007 / s00259-021-05433-w). Examples of diseases and / or neoplasms suitable for treatment using preferred tissue-targeting compounds of formula (I) of the present invention and / or combinations comprising a tissue-targeting compound of formula (I) of the present invention include prostate cancer, salivary gland cancer, glioblastoma, brain cancer, thyroid cancer, hepatocellular carcinoma, and clear cell renal carcinoma.

[0187] In some embodiments, the present invention includes methods of using a tissue-targeted compound of Formula (I) and / or a combination comprising a tissue-targeted compound of Formula (I) and an additional pharmaceutical agent of the present invention to treat a disease, more preferably a hyperproliferative disease, more particularly cancer, even more particularly prostate cancer. In some embodiments, the present invention includes methods of using a tissue-targeted compound of Formula (I) and / or a combination comprising a tissue-targeted compound of Formula (I) and an additional pharmaceutical agent of the present invention to treat a disease, preferably a hyperproliferative disease, more preferably cancer, characterized by overexpression of PSMA in tumor cells.

[0188] In some embodiments, the present invention includes a method of treating a hyperproliferative disease, more particularly cancer, more particularly prostate cancer, comprising administering to a subject in need thereof an effective amount of at least one tissue-targeted compound of Formula (I) and / or a combination comprising a tissue-targeted compound of Formula (I) and an additional pharmaceutical agent of the present invention. In some embodiments, the present invention includes a method of treating a hyperproliferative disease characterized by overexpression of PSMA in tumor cells, more particularly cancer, more particularly prostate cancer, comprising administering to a subject in need thereof an effective amount of at least one tissue-targeted compound of Formula (I) and / or a combination comprising a tissue-targeted compound of Formula (I) and an additional pharmaceutical agent of the present invention.

[0189] In some embodiments, the present invention provides a tissue-targeted compound of formula (I) above and / or a combination comprising a tissue-targeted compound of formula (I) above and an additional pharmaceutical agent of the present invention, for use in the treatment and / or prevention of a disease, particularly a hyperproliferative disorder, more particularly cancer, even more particularly prostate cancer. In some embodiments, the present invention includes a tissue-targeted compound of formula (I) above and / or a combination comprising a tissue-targeted compound of formula (I) above and an additional pharmaceutical agent of the present invention, for use in the treatment and / or prevention of a hyperproliferative disease characterized by overexpression of PSMA in tumor cells.

[0190] In some embodiments, the present invention includes a combination comprising a tissue-targeted compound of Formula (I) and / or a tissue-targeted compound of Formula (I) and an additional pharmaceutical agent of the present invention for use in a method of inhibiting cell proliferation and / or inducing apoptosis in cells, comprising contacting cells with the tissue-targeted compound of Formula (I) and / or a combination comprising the tissue-targeted compound of Formula (I) and an additional pharmaceutical agent of the present invention. In some embodiments, the present invention includes a combination comprising a tissue-targeted compound of Formula (I) and / or a tissue-targeted compound of Formula (I) and an additional pharmaceutical agent of the present invention for use in a method of inhibiting cell proliferation and / or inducing apoptosis in cells, comprising contacting tumor cells with the tissue-targeted compound of Formula (I) and / or a combination comprising the tissue-targeted compound of Formula (I) and an additional pharmaceutical agent of the present invention, wherein PSMA is overexpressed in the tumor cells.

[0191] In some embodiments, the present invention comprises a tissue-targeted compound of Formula (I) and / or a combination comprising a tissue-targeted compound of Formula (I) and an additional pharmaceutical agent for use in a method of treating a hyperproliferative disease, more particularly cancer, even more particularly prostate cancer. In some embodiments, the present invention comprises a tissue-targeted compound of Formula (I) and / or a combination comprising a tissue-targeted compound of Formula (I) and an additional pharmaceutical agent for use in a method of treating a hyperproliferative disease characterized by overexpression of PSMA in tumor cells.

[0192] In some embodiments, the present invention includes the use of a tissue-targeted compound of Formula (I) and / or a combination comprising a tissue-targeted compound of Formula (I) and an additional pharmaceutical agent for the manufacture of a medicament for treating and / or preventing a hyperproliferative disease. In some embodiments, the present invention includes the use of a tissue-targeted compound of Formula (I) and / or a combination comprising a tissue-targeted compound of Formula (I) and an additional pharmaceutical agent for the manufacture of a medicament for treating and / or preventing a hyperproliferative disease characterized by overexpression of PSMA in tumor cells.

[0193] In some embodiments, the present invention includes the use of a tissue-targeted compound of Formula (I) and / or a combination comprising a tissue-targeted compound of Formula (I) and an additional pharmaceutical agent for the manufacture of a medicament for treating a hyperproliferative disease, particularly cancer, more particularly prostate cancer.

[0194] Administration In combinations comprising a tissue-targeted compound of Formula (I) and an additional pharmaceutical agent, the tissue-targeted compound of Formula (I) and the additional pharmaceutical agent may be administered sequentially in any order or simultaneously.

[0195] The tissue-targeting compound of formula (I) or the combination of the present invention, comprising the tissue-targeting compound of formula (I) and additional pharmaceutical agents, can be administered in any form by any effective route, including, for example, oral, parenteral, enteral, intravenous, intraperitoneal, topical, transdermal (for example, using any standard patch), ocular, nasal, topical, parenteral, for example, aerosol, inhalation, subcutaneous, intramuscular, buccal, sublingual, rectal, vaginal, intraarterial, and intrathecal.They can be administered alone or in combination with one or more optional components (active or inactive).Preferably, the tissue-targeting compound of formula (I) or the combination of the present invention is administered intravenously.

[0196] The tissue-targeted compound of formula (I) or the combination of the present invention comprising a tissue-targeted compound of formula (I) and an additional pharmaceutical agent can be converted into conventional pharmaceutical preparations by known methods, which may be liquid or solid preparations, such as, but not limited to, conventional and enteric-coated tablets, capsules, pills, powders, granules, elixirs, tinctures, solutions, suspensions, syrups, solid and liquid aerosols, and emulsions.

[0197] The relative ratios of each compound in the combination of the present invention comprising a tissue-targeting compound of formula (I) and an additional pharmaceutical agent can also be selected based on their respective mechanisms of action and disease biology. The relative ratios of each compound can vary widely.

[0198] The release of one or more of the agents of the combinations of the present invention comprising a tissue-targeting compound of formula (I) and an additional pharmaceutical agent, whether in a single dosage form, combination pack, kit, or in separate, stand-alone dosage forms, can also be controlled to provide the desired therapeutic activity, as needed.

[0199] The present invention includes pharmaceutical compositions comprising a pharmaceutically acceptable carrier and a pharmaceutically effective amount of a tissue-targeting compound of formula (I) or a combination of the present invention, i.e., the tissue-targeting compound of formula (I) and an additional pharmaceutical agent. A pharmaceutically acceptable carrier is any carrier that is relatively non-toxic and harmless to patients at a concentration consistent with the effective activity of the active ingredient, so that any side effects caused by the carrier do not negate the beneficial effects of the active ingredient. A pharmaceutically effective amount of a compound is an amount that produces a result or has an effect on the specific condition being treated.

[0200] For oral administration, the tissue-targeting compound of formula (I) or the combination of the present invention comprising the tissue-targeting compound of formula (I) and other pharmaceutical agents can be formulated into solid or liquid preparations, such as solid dispersions, capsules, pills, tablets, troches, lozenges, melts, powders, liquids, suspensions or emulsions, and can be prepared by the method known in the art for preparing pharmaceutical compositions.Solid unit dosage forms can be, for example, capsules, which can be the usual hard or soft gelatin type, and contain surfactants, lubricants and inert excipients, such as lactose, sucrose, calcium phosphate and corn starch.

[0201] When administered in tablet form, the tissue-targeted compound of Formula (I) or the combination of the present invention comprising a tissue-targeted compound of Formula (I) and an additional pharmaceutical agent may be tableted using conventional tablet bases (such as lactose, sucrose, and cornstarch) in combination with binders (such as acacia, cornstarch, or gelatin), disintegrants (such as potato starch, alginic acid, cornstarch, and guar gum, tragacanth gum, acacia, etc.) intended to aid in the disintegration and dissolution of the tablet after administration, lubricants (e.g., talc, stearic acid, or magnesium, calcium, or zinc stearate) intended to improve the flow of the tablet granules and prevent the tablet material from adhering to the surfaces of the tablet die and punches, dyes, colorants, and flavorings (such as peppermint, oil of wintergreen, or sakusambo flavoring) intended to improve the aesthetic quality of the tablet and make the tablet more acceptable to patients. Suitable excipients for oral liquid dosage forms include dicalcium phosphate and diluents (water and alcohols, such as ethanol, benzyl alcohol, and polyethylene alcohols), with or without the addition of pharmaceutically acceptable surfactants, suspending agents, or emulsifying agents. Various other materials may be present as coatings or to modify the physical form of the dosage unit. For example, tablets, pills, or capsules may be coated with shellac, sugar, or both.

[0202] Dispersible powders and granules are suitable for preparing aqueous suspensions. They provide the active ingredient mixed with a dispersing or wetting agent, a suspending agent, and one or more preservatives. Suitable dispersing or wetting agents and suspending agents are as already mentioned above. Additional excipients, such as the above-mentioned sweeteners, flavorings, and coloring agents, may also be present.

[0203] The tissue-targeting compound of formula (I) or the combination of the present invention comprising the tissue-targeting compound of formula (I) and an additional pharmaceutical agent can also be in the form of an oil-in-water emulsion. The oil phase can be a vegetable oil, such as liquid paraffin or a mixture of vegetable oils. Suitable emulsifiers can be (1) natural gums, such as gum arabic and gum tragacanth, (2) natural phosphatides, such as soybean and lecithin, (3) esters or partial esters obtained from fatty acids and hexitol anhydrides, such as sorbitan monooleate, and (4) condensates of the partial esters with ethylene oxide, such as polyoxyethylenesorbitan monooleate. The emulsion can also contain sweeteners and flavoring agents.

[0204] Oily suspension can be prepared by suspending active ingredient in vegetable oil, such as peanut oil, olive oil, sesame oil or coconut oil, or mineral oil, such as liquid paraffin.Oily suspension can also contain thickening agent, such as beeswax, solid paraffin or cetyl alcohol.Suspension can also contain one or more preservatives, such as p-hydroxybenzoic acid ethyl or n-propyl; one or more coloring agent; one or more flavoring agent; and one or more sweetener, such as sucrose or saccharin.

[0205] Syrups and elixirs can be formulated with sweetening agents, for example, glycerol, propylene glycol, sorbitol or sucrose, and may also contain a demulcent and preservatives, such as methyl and propylparabens, and flavoring and coloring agents.

[0206] The tissue-targeted compound of formula (I) or the combination of the present invention comprising a tissue-targeted compound of formula (I) and an additional pharmaceutical agent can also be administered parenterally, i.e., subcutaneously, intravenously, intraocularly, intrasynovially, intramuscularly, or intraperitoneally, in a sterile liquid or mixture of liquids, such as water, saline, bromine, or the like, with or without the addition of pharmaceutically acceptable surfactants (such as soap or detergent), suspending agents (such as pectin, carbomer, methylcellulose, hydroxypropylmethylcellulose, or carboxymethylcellulose), or emulsifiers and other pharmaceutical adjuvants. They may also be administered as injectable doses of the compound in physiologically acceptable diluents, including pharmaceutical carriers which may be sugar solutions and related sugar solutions, alcohols (such as ethanol, isopropanol, or hexadecyl alcohol), glycols (such as propylene glycol or polyethylene glycol), glycerol ketanol (such as 2,2-dimethyl-1,1-dioxolane-4-methanol), ethers (such as poly(ethylene glycol) 400), oils, fatty acids, fatty acid esters or fatty acid glycerides, or acetylated fatty acid glycerides.

[0207] Preferably, the tissue-targeting compound of formula (I) or the combination of the present invention comprising the tissue-targeting compound of formula (I) and an additional pharmaceutical agent is administered intravenously and / or orally, either together or separately.Preferably, in the combination of the present invention comprising the tissue-targeting compound of formula (I) and an additional pharmaceutical agent, the tissue-targeting compound of formula (I) is administered intravenously, and the additional pharmaceutical agent is administered orally.

[0208] Examples of oils that can be used in the parenteral formulations of the present invention include those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, sesame oil, cottonseed oil, corn oil, olive oil, petrolatum, and mineral oil. Suitable fatty acids include oleic acid, stearic acid, isostearic acid, and myristic acid. Suitable fatty acid esters include, for example, ethyl oleate and isopropyl myristate. Suitable soaps include fatty acid alkali metal, ammonium, and triethanolamine salts, and suitable detergents include cationic detergents such as dimethyldialkylammonium halides, alkylpyridinium halides, and alkylamine acetates; anionic detergents such as alkyl, aryl, and olefin sulfonates, alkyl sulfates, olefins, ethers, and monoglycerides, and sulfosuccinates; nonionic detergents such as fatty amine oxides, fatty acid alkanolamides, and poly(oxyethylene-oxypropylene) or ethylene oxide or propylene oxide copolymers; and amphoteric detergents such as alkyl-β-aminopropionates and 2-alkylimidazoline quaternary ammonium salts and mixtures.

[0209] Examples of surfactants used in parenteral formulations include the class of polyethylene sorbitan fatty acid esters, e.g., sorbitan monooleate, and high molecular weight adducts of ethylene oxide with hydrophobic bases formed by the condensation of propylene oxide with propylene glycol.

[0210] The tissue-targeting compound of formula (I) or the combination of the present invention, which comprises the tissue-targeting compound of formula (I) and other pharmaceutical agents, can be in the form of sterile injectable aqueous suspension.This suspension can be prepared by known method using suitable dispersing or wetting agent and suspending agent, for example, sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum arabic; natural phosphatides, for example, lecithin, alkylene oxide and fatty acid condensate, for example, polyoxyethylene stearate, ethylene oxide and long-chain aliphatic alcohol condensate, for example, heptadeca-ethyleneoxycetanol, ethylene oxide and fatty acid and hexitol-derived partial ester condensate, for example, monooleic polyoxyethylene sorbitol, or ethylene oxide and fatty acid and hexitol anhydride-derived partial ester condensate, for example, monooleic polyoxyethylene sorbitan.

[0211] Sterile injectable preparations may also be sterile injectable solutions or suspensions in non-toxic parenterally acceptable diluents or solvents. Diluents and solvents that can be used include, for example, water, Ringer's solution, isotonic saline, and isotonic glucose solution. In addition, sterile fixed oils are commonly used as solvents or suspending media. For this purpose, any non-irritating fixed oil, including synthetic mono- or diglycerides, may be used. In addition, fatty acids such as oleic acid can be used to prepare injectable preparations.

[0212] The tissue-targeting compound of formula (I) or the combination of the present invention comprising the tissue-targeting compound of formula (I) and another pharmaceutical agent can also be administered in the form of suppositories for rectal administration of the drug.These compositions can be prepared by mixing the drug with a suitable non-irritating excipient that is solid at room temperature but liquid at rectal temperature, and therefore melts in the rectum to release the drug.Such materials include, for example, cocoa butter and polyethylene glycol.

[0213] Controlled release formulations for parenteral administration include liposomal, polymeric microsphere and polymeric gel formulations that are known in the art.

[0214] The tissue-targeting compound of formula (I) or the combination of the present invention comprising the tissue-targeting compound of formula (I) and an additional pharmaceutical agent may also be in the form of a solid dispersion.The solid dispersion may be a solid solution, a glass solution, a glass suspension, an amorphous precipitate in a crystalline carrier, a eutectic or monocrystal, a compound or complex formation, and combinations thereof.

[0215] The tissue-targeting compound of formula (I) or the combination of the present invention comprising the tissue-targeting compound of formula (I) and an additional pharmaceutical agent may also contain other conventional pharmaceutically acceptable formulation ingredients, generally referred to as carriers or diluents, as necessary or desired. Conventional procedures for preparing such compositions in suitable dosage forms can be utilized.

[0216] Commonly used pharmaceutical ingredients that may be suitably used to formulate the composition for the intended route of administration include: Acidifying agents (examples include, but are not limited to, acetic acid, citric acid, fumaric acid, hydrochloric acid, and nitric acid); Alkalizing agents (examples include, but are not limited to, ammonia solution, ammonium carbonate, diethanolamine, monoethanolamine, potassium hydroxide, sodium borate, sodium carbonate, sodium hydroxide, triethanolamine, trolamine); · Adsorbents (examples include, but are not limited to, powdered cellulose and activated carbon); aerosol propellants (examples include, but are not limited to, carbon dioxide, CCl2F2, F2ClC-CClF2, and CClF3); · Air displacement agents (examples include, but are not limited to, nitrogen and argon); ·Anti-fungal preservatives (examples include, but are not limited to, benzoic acid, butylparaben, ethylparaben, methylparaben, propylparaben, sodium benzoate); · Antimicrobial preservatives (examples include, but are not limited to, benzalkonium chloride, benzethonium chloride, benzyl alcohol, cetylpyridinium chloride, chlorobutanol, phenol, phenylethyl alcohol, phenylmercuric nitrate, and thimerosal); · antioxidants (examples include, but are not limited to, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, hypophosphorous acid, monothioglycerol, propyl gallate, sodium ascorbate, sodium bisulfite, sodium formaldehyde sulfoxylate, sodium metabisulfite); · binding materials (examples include, but are not limited to, block polymers, natural and synthetic rubbers, polyacrylates, polyurethanes, silicones, polysiloxanes, and styrene-butadiene copolymers); buffering agents (examples include, but are not limited to, potassium metaphosphate, dipotassium phosphate, sodium acetate, sodium citrate anhydrous, and sodium citrate dihydrate); · Vehicles (examples include, but are not limited to, acacia syrup, aromatic syrup, aromatic elixir, cherry syrup, cocoa syrup, orange syrup, syrup, corn oil, mineral oil, peanut oil, sesame oil, bacteriostatic saline injection, and bacteriostatic water for injection); · Chelating agents (examples include, but are not limited to, edetate disodium and edetic acid); · Coloring agents (examples include, but are not limited to, FD&C Red No. 3, FD&C Red No. 20, FD&C Yellow No. 6, FD&C Blue No. 2, D&C Green No. 5, D&C Orange No. 5, D&C Red No. 8, caramel, and iron oxide red); · Clarifying agents (examples include, but are not limited to, bentonite); · emulsifiers (examples include but are not limited to acacia, cetomacrogol, cetyl alcohol, glyceryl monostearate, lecithin, sorbitan monooleate, polyoxyethylene 50 monostearate); · Encapsulating agents (examples include, but are not limited to, gelatin and cellulose acetate phthalate); Flavoring agents (examples include, but are not limited to, anise oil, cinnamon oil, cocoa, menthol, orange oil, peppermint oil, and vanillin); · humectants (examples include, but are not limited to, glycerol, propylene glycol, and sorbitol); · abrasives (examples include, but are not limited to, mineral oil and glycerin); oils (examples include, but are not limited to, peanut oil, mineral oil, olive oil, groundnut oil, sesame oil, and vegetable oil); Ointment bases (examples include, but are not limited to, lanolin, hydrophilic ointment, polyethylene glycol ointment, petrolatum, hydrophilic petrolatum, white ointment, yellow ointment, and rosewater ointment); penetration enhancers (transdermal delivery) (examples include, but are not limited to, monohydroxy or polyhydroxy alcohols, monohydric or polyhydric alcohols, saturated or unsaturated fatty alcohols, saturated or unsaturated fatty acid esters, saturated or unsaturated dicarboxylic acids, essential oils, phosphatidyl derivatives, cephalin, terpenes, amides, ethers, ketones, and ureas); · Plasticizers (examples include, but are not limited to, diethyl phthalate and glycerol); · Scavenging compounds that reduce and / or prevent radiolysis; solvents (examples include, but are not limited to, ethanol, corn oil, cottonseed oil, glycerol, isopropanol, mineral oil, oleic acid, peanut oil, purified water, water for injection, sterile water for injection, and sterile water for irrigation); stiffening agents (examples include but are not limited to cetyl alcohol, cetyl esters wax, microcrystalline wax, paraffin, stearyl alcohol, white wax and yellow wax); Suppository bases (examples include, but are not limited to, cocoa butter and polyethylene glycols (mixtures)); surfactants (examples include, but are not limited to, benzalkonium chloride, nonoxynol 10, octoxynol 9, polysorbate 80, sodium lauryl sulfate, and sorbitan monopalmitate); suspending agents (examples include but are not limited to agar, bentonite, carbomer, sodium carboxymethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, kaolin, methylcellulose, tragacanth, and veegum); · sweetening agents (examples include, but are not limited to, aspartame, glucose, glycerol, mannitol, propylene glycol, sodium saccharin, sorbitol, and sucrose); tablet anti-adherents (examples include, but are not limited to, magnesium stearate and talc); tablet binders (examples include, but are not limited to, acacia, alginic acid, sodium carboxymethylcellulose, compressible sugar, ethylcellulose, gelatin, liquid dextrose, methylcellulose, non-crosslinked polyvinylpyrrolidone, and pregelatinized starch); tablet and capsule diluents (examples include, but are not limited to, calcium hydrogen phosphate, kaolin, lactose, mannitol, microcrystalline cellulose, powdered cellulose, precipitated calcium carbonate, sodium carbonate, sodium phosphate, sorbitol, and starch); tablet coatings (examples include, but are not limited to, glucose, hydroxyethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, methyl cellulose, ethyl cellulose, cellulose acetate phthalate, and shellac); · tablet direct compression excipients (examples include, but are not limited to, calcium hydrogen phosphate); tablet disintegrants (examples include, but are not limited to, alginic acid, carboxymethylcellulose calcium, microcrystalline cellulose, polacrilin potassium, cross-linked polyvinylpyrrolidone, sodium alginate, sodium starch glycolate, and starch); tablet lubricants (examples include, but are not limited to, colloidal silica, corn starch, and talc); tablet lubricants (examples include, but are not limited to, calcium stearate, magnesium stearate, mineral oil, stearic acid, and zinc stearate); Tablet / capsule opacifiers (examples include, but are not limited to, titanium dioxide); · tablet polishing agents (examples include, but are not limited to, carnauba wax and white wax); · thickeners (examples include, but are not limited to, beeswax, cetyl alcohol, and paraffin); · Tonicity agents (examples include, but are not limited to, dextrose and sodium chloride); thickening agents (examples include, but are not limited to, alginic acid, bentonite, carbomer, sodium carboxymethylcellulose, methylcellulose, polyvinylpyrrolidone, sodium alginate, and tragacanth); and Wetting agents (examples include, but are not limited to, heptadecaethyleneoxycetanol, lecithin, sorbitol monooleate, polyoxyethylene sorbitol monooleate, and polyoxyethylene stearate).

[0217] It is believed that one skilled in the art can, using the preceding information, utilize the present invention to its fullest extent. [Brief explanation of the drawings]

[0218] [Figure 1] FIG. 1 shows the heavy chain nucleotide sequence (SEQ ID NO: 1) and the heavy chain deduced amino acid sequence (SEQ ID NO: 2) of pergifatamab (IgG1 heavy chain cDNA gene). [Figure 2] FIG. 1 shows the light chain nucleotide sequence (SEQ ID NO: 3) and the light chain deduced amino acid sequence (SEQ ID NO: 4) of pergifatamab (kappa light chain cDNA gene). [Figure 3] FIG. 1 shows the CDR heavy chain sequences (SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7) and CDR light chain sequences (SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10) of pelgifatamab. [Figure 4] FIG. 1 shows the electrospray mass spectrum of macropergifatamab ACC (antibody-chelator conjugate) (CAR 0.8). [Figure 5] FIG. 1 shows the electrospray mass spectrum of DOTA-pelgifatamab ACC (antibody-chelator conjugate) (CAR 5.7). [Figure 6] FIG. 1 shows the electrospray mass spectrum of DOTA-pelgifatamab ACC (antibody-chelator conjugate) (CAR 12.7). [Figure 7] FIG. 1 shows size exclusion chromatograms of targeted actinium conjugates (TACs) Ac225-DOTA-pelgifatamab (CAR 12.7), Ac225-DOTA-pelgifatamab (CAR 5.7) and Ac225-macropa-pelgifatamab (CAR 0.8). [Figure 8]FIG. 1 shows radiochemical purity, defined as the amount of actinium-225 bound to 225Ac-pergifatamab compared to actinium-225-labeled DOTA-J591, as determined by instant thin-layer chromatography (iTLC). [Figure 9] FIG. 1 shows binding of PSMA-targeting antibodies pelgifatamab, macropa-pelgifatamab (non-radiolabeled ACC), and non-radiolabeled isotype control ACC to PSMA-expressing LNCaP prostate cancer cells as determined by flow cytometry. [Figure 10] FIG. 1 shows the internalization of 225Ac-pelgifatamab in LNCaP prostate cancer cells. [Figure 11] FIG. 1 shows the immunoreactive fractions (IRF) of Ac225-macropa-pelgifatamab (CAR 0.8), Ac225-DOTA-pelgifatamab (CAR 5.7) and Ac225-DOTA-pelgifatamab (CAR 12.7). [Figure 12] Figure 1 shows the cytotoxicity of Ac225-macropa-pelgifatamab (CAR 0.8), Ac225-DOTA-pelgifatamab (CAR 5.7) and Ac225-DOTA-pelgifatamab (CAR 12.7) against the PSMA-expressing prostate cancer cell line C4-2. [Figure 13] Figure 1 shows the cytotoxicity of Ac225-macropa-pelgifatamab (CAR 0.8), Ac225-DOTA-pelgifatamab (CAR 5.7) and Ac225-DOTA-pelgifatamab (CAR 12.7) against the PSMA-expressing prostate cancer cell line MDA-PCa-2b. [Figure 14] Figure 1 shows the cytotoxicity of Ac225-macropa-pelgifatamab in different prostate cancer cell lines. [Figure 15]Figure 1 shows the biodistribution of Ac-225-macropa-pelgifatamab (CAR 0.8) and Ac-225-DOTA-pelgifatamab (CAR 12.7) in different tissues of the prostate cancer xenograft model MDA-PCA-2b. Animals were administered a total antibody dose of 0.75 mg / kg, iv, with a single dose of 250 kBq / kg. [Figure 16] Figure 16A shows the antitumor activity of Ac-225-macropa-pelgifatamab (CAR 0.8) and Ac-225-DOTA-pelgifatamab (CAR 12.7) in the prostate cancer xenograft model C4-2 in Balb / c nude male mice, a single iv injection of 300 kBq / kg, 0.14 mg / kg total antibody. Figure 16B shows the body weight change (percentage, %). Figure 16C shows the white blood cell count at the end of the experiment. [Figure 17] Figure 17A shows the in vivo mode of action of 225Ac-pelgifatamab in the C4-2 model. Figure 17B shows an example of γH2AX expression determined by immunohistochemistry in an untreated C4-2 tumor. Figure 17B shows the in vivo mode of action of 225Ac-pelgifatamab in the C4-2 model. Figure 17C shows an example of γH2AX expression determined by immunohistochemistry in a C4-2 tumor treated with 100 kBq / kg 225Ac-pelgifatamab for 1 day. Figure 17C shows the in vivo mode of action of 225Ac-pelgifatamab in the C4-2 model. Figure 17C shows an example of γH2AX expression determined by immunohistochemistry in a C4-2 tumor treated with 100 kBq / kg 225Ac-pelgifatamab for 4 days. Scale bar indicates 200 μm. Figure 17D shows the in vivo mode of action of 225Ac-pergifatamab in the C4-2 model. γH2AX expression in untreated C4-2 tumors (shown in panel A) and C4-2 tumors (n=3) treated with 100 kBq / kg 225Ac-pergifatamab for 1 day (shown in panel B) or 4 days (shown in panel C) was quantified by HSA software. [Figure 18]Figure 1 shows growth curves of LNCaP tumors in male SCID mice (n=10 / group) treated with vehicle or 225Ac-pelgifatamab (70, 125, or 250 kBq / kg; single dose, iv; total antibody dose 0.75 mg / kg). Statistical analysis was performed using two-way ANOVA followed by Tukey's test. ***, P<0.001 vs. vehicle (days 0-40). [Figure 19] Figure 1 shows growth curves of KUCaP-1 tumors in male scid / scid mice (n=9-10 / group) treated with isotype control (300 kBq / kg; single dose, iv; total antibody dose 0.14 mg / kg) or 225Ac-pelgifatamab (70, 150, or 300 kBq / kg; single dose, iv; total antibody dose 0.75 mg / kg). Statistical analysis was performed using two-way ANOVA followed by Tukey's test. ***, P<0.001 vs. vehicle (days 0–21); ###, P<0.001 vs. isotype control (days 0–21); §§, P<0.01; §§§, P<0.001 vs. 225Ac-pergifatamab, 300 kBq / kg (days 0–21); $$$, P<0.001 vs. 225Ac-pergifatamab, 150 kBq / kg (days 0–21). [Figure 20] FIG. 1 shows growth curves of large KUCaP-1 tumors (mean volume 470 mm3 at the start of treatment) in male scid / scid mice (n=9-10 / group) treated with vehicle or 225Ac-pelgifatamab (300 kBq / kg; single dose, iv; total antibody dose 0.75 mg / kg). [Figure 21]This figure shows the volume of the KUCaP-1 tumors described in (E) on the last day (day 21) of the isotype control group. Statistical analysis was performed using two-way ANOVA followed by Tukey's test. ***, P<0.001 vs. vehicle (days 0-21); ###, P<0.001 vs. isotype control (days 0-21); §§, P<0.01; §§§, P<0.001 vs. 225Ac-pergiftamab, 300 kBq / kg (days 0-21); $$$, P<0.001 vs. 225Ac-pergiftamab, 150 kBq / kg (days 0-21). [Figure 22] Figure 22A shows growth curves of 22Rv1 tumors treated with vehicle, darolutamide (100 mg / kg BID, po) and / or 225Ac-pergifatamab 75 kBq / kg, single dose iv, total protein dose 0.75 mg / kg. Figure 22B shows growth curves of 22Rv1 tumors treated with vehicle, darolutamide (100 mg / kg BID, po) and / or 225Ac-pergifatamab 150 kBq / kg, single dose iv, total protein dose 0.75 mg / kg. [Figure 23-1] Figure 23A shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergiftamab, its efficacy in prostate cancer cells increases. Figure 23B shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergiftamab, its efficacy in prostate cancer cells increases. Figure 23B shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergiftamab, its efficacy in prostate cancer cells increases. Figure 23C shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergiftamab, its efficacy in prostate cancer cells increases. Figure 23D shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergiftamab, its efficacy in prostate cancer cells increases. Figure 23E shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergiftamab, its efficacy in prostate cancer cells increases. Figure 23F shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergiftamab, its efficacy in prostate cancer cells increases. Figure 23G shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergiftamab, its efficacy in prostate cancer cells increases. Figure 23H ... [Figure 23-2]Figure 23C shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergifatamab, its efficacy in prostate cancer cells increases. Figure 23D shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergifatamab, its efficacy in prostate cancer cells increases. Figure 23C shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergifatamab, its efficacy in prostate cancer cells increases. Figure 23D shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergifatamab, its efficacy in prostate cancer cells increases. Figure 23D shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergifatamab, its efficacy in prostate cancer cells increases. Figure 23C shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergifatamab, its efficacy in prostate cancer cells increases. Figure 23D shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergifatamab, its efficacy in prostate cancer cells increases. [Figure 23-3] Figure 23E shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergifatamab, its efficacy in prostate cancer cells increases. Figure 23F shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergifatamab, its efficacy in prostate cancer cells increases. Figure 23E shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergifatamab, its efficacy in prostate cancer cells increases. Figure 23F ... CDKN1A RNA expression in 22Rv1 cells after 48 hours of treatment with 2 μM darolutamide, 0.15 kBq / mL 225Ac-pergifatamab, or their combinations, its efficacy in prostate cancer cells increases. [Figure 23-4]Figure 23G shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergifatamab, its efficacy in prostate cancer cells increases. Figure 23H shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergifatamab, its efficacy in prostate cancer cells increases. Figure 23G shows that darolutamide enhances PSMA expression, and when combined with 225Ac-pergifatamab, its efficacy in prostate cancer cells increases. Figure 23H ... XRCC2 RNA expression in 22Rv1 cells after 48 hours of treatment with 2 μM darolutamide, 0.15 kBq / mL 225Ac-pergifatamab, or their combinations, its efficacy in prostate cancer cells increases. Statistical analysis was performed using one-way analysis of variance (ANOVA) with Tukey's multiple comparison test and correction. *, p<0.05 compared with untreated cells; **, p<0.01 compared with untreated cells. [Figure 23-5] Figure 23I shows an isobologram of the combined effect of darolutamide and 225Ac-pergifatamab on the proliferation of VCaP cells. Figure 23J shows an isobologram of the combined effect of darolutamide and 225Ac-pergifatamab on the proliferation of 22Rv1 cells. CI, combination index. [Figure 24-1]Figure 24A shows the anti-tumor efficacy of 225Ac-pelgifatamab and darolutamide in the ST1273 prostate cancer PDX model. This figure shows PSMA expression in untreated ST1273 tumor xenografts as detected by IHC using the PSMA antibody GCP-04. Darker colors indicate PSMA staining. Scale bar: 50 μm. Figure 24B shows the anti-tumor efficacy of 225Ac-pelgifatamab and darolutamide in the ST1273 prostate cancer PDX model. This figure shows the growth of ST1273 tumors in mice treated with vehicle, 225Ac-pelgifatamab (single dose, 75 or 150 kBq / kg, iv), darolutamide (100 mg / kg, BID, po), or their combination. [Figure 24-2] Figure 24C shows the anti-tumor efficacy of 225Ac-pergifatamab and darolutamide in an ST1273 prostate cancer PDX model. Figure 24C shows the volume of individual ST1273 tumors shown in (B) at day 30. Statistical analysis was performed using one-way ANOVA followed by Tukey's test. ***, p<0.001 vs. vehicle. #, p<0.05 vs. darolutamide monotherapy. Figure 24D shows the anti-tumor efficacy of 225Ac-pergifatamab and darolutamide in an ST1273 prostate cancer PDX model. ...D shows the relative body weight change of mice shown in (B) over the course of the study. [Figure 25-1] Figure 25A shows the anti-tumor efficacy of 225Ac-pergifatamab and darolutamide in the 22Rv1 prostate cancer model. This figure shows PSMA expression in 22Rv1 tumor xenografts (untreated) as detected by IHC using the PSMA antibody GCP-04. Darker colors indicate PSMA staining. Scale bar: 50 μm. Figure 25B shows the anti-tumor efficacy of 225Ac-pergifatamab and darolutamide in the 22Rv1 prostate cancer model. This figure shows the growth of 22Rv1 tumors in mice treated with vehicle, isotype control (300 mg / kg, single dose, iv), 225Ac-pergifatamab (75, 150, or 300 kBq / kg, single dose, iv), darolutamide (100 mg / kg, BID, po), or a combination thereof. [Figure 25-2] Figure 23C shows the anti-tumor efficacy of 225Ac-pergifatamab and darolutamide in a 22Rv1 prostate cancer model. Figure 23C shows the volume of individual 22Rv1 tumors shown in (B) on day 16. Statistical analysis was performed using one-way ANOVA followed by Tukey's test. **, p<0.01 vs. vehicle; ***, p<0.001 vs. vehicle. ###, p<0.001 vs. darolutamide monotherapy. §, p<0.05 vs. respective 225Ac-pergifatamab monotherapy. Figure 25D shows the anti-tumor efficacy of 225Ac-pergifatamab and darolutamide in a 22Rv1 prostate cancer model. Figure 23C shows the volume of individual 22Rv1 tumors shown in (B) on day 16. Statistical analysis was performed using one-way ANOVA followed by Tukey's test. **, p<0.01 vs. vehicle; ***, p<0.001 vs. vehicle. ###, p<0.001 vs. darolutamide monotherapy. §, p<0.05 vs. respective 225Ac-pergifatamab monotherapy. [Figure 25-3] Figure 23E shows the anti-tumor efficacy of 225Ac-pergifatamab and darolutamide in the 22Rv1 prostate cancer model. PSMA expression in isolated 22Rv1 cancer cells obtained from 22Rv1 tumor-bearing mice (n=2) treated with vehicle or darolutamide for 18 days before sacrifice, as determined by flow cytometry. [Figure 26] FIG. 1 shows Ac-225-Macropa-J592 and Ac-225-DOTA-J592 radiolabeled free chelator iTLC showing % radiolabeled free chelator (RFC) after t=0 h and 96 h. DETAILED DESCRIPTION OF THE INVENTION

[0219] Experimental Section Chemical names were generated using BIOVIA Draw 2019 from Dassault Systemes. In some cases, commonly accepted names of commercially available reagents were used in place of BIOVIA Draw-generated names.

[0220] Table 1 below lists the abbreviations used in this paragraph and in the Examples section unless explained in the text. Other abbreviations have their customary meanings to those skilled in the art.

[0221] Table 1. Abbreviations The following table lists the abbreviations used herein. 225 Actinium-225 Ac-225 Actinium-225 ACC antibody-chelator conjugate ACN Acetonitrile BCA Bicinchoninic Acid BRFF-HPC1 serum-free medium CAR chelator-to-antibody ratio DCTA 1,2-Diaminocyclohexanetetraacetic acid DMA N,N-dimethylacetamide DMSO dimethyl sulfoxide DOTA 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid ESI electrospray ionization EtOH ethanol FBS fetal bovine serum FPLC Fast Protein Liquid Chromatography HCl Hydrochloric acid HPGe High Purity Germanium HPLC High Performance Liquid Chromatography iTLC Instant Thin Layer Chromatography IRF immunoreactive fraction mAb monoclonal antibody MEM-NEAA Minimum Essential Medium - Non-Essential Amino Acids min MS mass spectrometry NaCl Sodium chloride nm nanometer nmol nanomol pelgi pelgifatamab, prostate-specific membrane antigen IgG1 antibody Pergifatamab Prostate-specific membrane antigen IgG1 antibody PBS Phosphate-buffered saline PSMA prostate-specific membrane antigen RAC radioactivity concentration RCP radiochemical purity RPMI Roswell Park Memorial Institute 1640 Medium SEC size exclusion chromatography TAC Targeted Actinium Conjugate (Ac-225 Labeled ACC) TFA trifluoroacetic acid TOF Time of Flight UPLC Ultra High Performance Liquid Chromatography UV ultraviolet light

[0222] All reagents whose synthesis is not described in the experimental section are commercially available, or are known compounds, or can be formed from known compounds by known methods by those skilled in the art.

[0223] Various aspects of the invention described in this application are illustrated by the following examples, which are not intended to be limiting of the invention in any way.

[0224] The example test experiments described herein serve to illustrate the invention, but the invention is not limited to the examples shown.

[0225] Tissue-targeted compounds, including pergifatamab ACC characterization by size exclusion chromatography and mass spectrometry The CAR of ACC was determined by SEC-MS (Water Acquity HPLC connected to a Waters XEVO TOF; running buffer: 50 / 50 / 0.1 (v / v / v) ACN / water / TFA; flow rate: 0.06 mL / min, online desalting column: Waters Acquity BEH SEC, 1.7 μm, 2.1 × 150 mm; ESI mode) using the MS peak heights as a percentage of the major peak heights of the components mAb, mAb+1 chelator, mAb+2 chelator, mAb+3 chelator, etc., using the formula CAR = total(n * An) / total An, where n is equal to the number of chelators and An is equal to the intensity of the antibody conjugate containing n chelators. The purity and concentration of ACC were determined by SEC-UV (Agilent 1260 Infinity HPLC system, running buffer: 10% DMSO / PBS; flow rate: 0.3 mL / min, column: Waters Acquity BEH SEC, 1.7 μm, 4.6 × 300 mm, detection: UV 280 nm). This method separates higher aggregates, dimers, and fragments from ACC monomers.

[0226] Example 1: Preparation of Macropergifatamab ACC 6-[[16-[(6-carboxy-2-pyridyl)methyl]-1,4,10,13-tetraoxa-7,16-diazacyclooctadec-7-yl]methyl]-4-[2-(4-isothiocyanatophenyl)ethoxy]pyridine-2-carboxylic acid (5.8 mg, 8.2 μmol) dissolved in DMA (728 μL) was added to pergifatamab (493 mg, 3.3 μmol) in PBS (25 mL). The pH of the solution was adjusted to 9 by adding 1 M carbonate buffer, pH 9.5 (5 mL), and the solution was shaken overnight. The product was purified by FPLC (Column: HiLoad 16 / 600 Superdex 200 pg column; Running buffer: 100 mM acetate / 100 mM NaCl 1:1, pH 5; Flow rate: 1 mL / min; Detection: UV 214 / 254 nm) to give 386 mg (77% yield) of macropa-pelgifatamab ACC in 100 mM acetate / 100 mM NaCl 1:1 (2.3 mg / mL). The CAR was determined to be 0.8 by MS. The monomer purity was determined to be 99% by SEC-UV.

[0227] Example 2: Preparation of DOTA-Pergifatamab ACC CAR 5.7 p-SCN-Bn-DOTA (macrocyclic, B-205) was dissolved in PBS at 10 mg / mL. 261 μL was added to 990 μL of pelgifatamab (10 mg / mL) dissolved in PBS. The pH was adjusted to 9 using 1 M carbonate buffer. The mixture was incubated at 37°C for 2 hours on a thermomixer shaking at 550 rpm. The conjugate was purified by FPLC (column: HiLoad 16 / 600 Superdex 200 pg column; running buffer: 100 mM acetate / 100 mM NaCl 1:1, pH 5; flow rate: 1 mL / min; detection: UV 280 nm). The concentration of the combined DOTA-pelgifatamab fractions was measured by SEC-UV to be 2.6 mg / mL. The CAR was determined to be 5.7 by MS. Monomeric purity was determined to be 99% by SEC-UV.

[0228] Example 3: Preparation of DOTA-Pergifatamab ACC CAR 12.7 p-SCN-Bn-DOTA (macrocyclic, B-205) was dissolved in PBS at 10 mg / mL. 470 μL was added to 990 μL of pelgifatamab (10 mg / mL) dissolved in PBS. The pH was adjusted to 9 using 1 M carbonate buffer. The mixture was incubated overnight at 22 °C in the dark on a thermomixer shaking at 550 rpm. The conjugate was purified by FPLC (column: HiLoad 16 / 600 Superdex 200 pg column; running buffer: 100 mM acetate / 100 mM NaCl 1:1, pH 5; flow rate: 1 mL / min; detection: UV 280 nm). The concentration of the combined DOTA-pelgifatamab fractions was measured by BCA protein assay to be 2.5 mg / mL. The CAR was determined to be 12.7 by MS. Monomeric purity was determined to be 98% by SEC-UV.

[0229] Radiolabel Macropa-pelgifatamab, DOTA-pelgifatamab CAR=5.7, and DOTA-pelgifatamab CAR=12.7 were radiolabeled with Ac-225 at a specific activity of 2 MBq / mg and diluted to a radioactivity concentration of 1.5 kBq / μL with 0.1 M acetate buffer, pH 5. The mixture was incubated at room temperature for 1 hour for macropa-pelgifatamab, and at 60°C for 1 hour for the two DOTA-pelgifatamab ACCs in a heating block. The RCP of TAC was measured in triplicate for each sample by instant thin-layer chromatography using citrate buffer for elution. Unlabeled Ac-225 elutes at the solvent front while the radiolabeled compound remains stationary. Radioactivity measurements were performed using a digital gamma spectrometer (DSPEC-50, Ortec). Radioactivity was measured at least 6 hours after radiolabeling to allow the daughter nuclide to reach equilibrium with Ac-225. The RCP of the samples (defined as [(radioactivity in the application area / (total radioactivity on the strip)] × 100) was 99.9% ± 0.013; 99.2% ± 0.049, and 99.5% ± 0.110 for Ac-225-macropa-pelgifatamab, Ac-225-DOTA-pelgifatamab CAR 5.7, and Ac-225-DOTA-pelgifatamab CAR 12.7, respectively.

[0230] Both pelgifatamab-macropa and the PSMA-binding antibody J591 conjugated with DOTA were labeled with actinium-225. Labeling was performed at room temperature. J591-DOTA was also labeled at 60°C. Radiochemical purity was determined by instant thin-layer chromatography (iTLC). Labeled free actinium-225 was counted in a germanium detector using actinium-225-specific energy rays. Actinium-225 labeling of pelgifatamab was more efficient at room temperature than actinium-225 labeling of the murine monoclonal PSMA antibody J591 (225Ac-J591, Figure 8). After radiolabeling, the radiochemical purity of 225Ac-pelgifatamab was determined to be 100% as assessed by iTLC (Figure 8).

[0231] Size exclusion chromatography of TAC The purity of TAC was determined by SEC-UV. This method separates higher aggregates, dimers, and fragments from ACC monomers. Separation was performed using an Acquity UPLC Protein BEH SEC, 1.7 μm, 200 Å, 4.6 × 300 mm column operated at 30 °C. The mobile phase was 170 mM ammonium acetate and 300 mM NaCl containing 10% 2-propanol and 0.1 mM DCTA. The flow rate was 0.3 mL / min, and ACC was detected by UV at 280 nm. Analysis was performed on an Agilent 1200 Series HPLC with a 35 μL injection.

[0232] [Table 5]

[0233] Immunoreactive fraction (IRF) Immediately after radiolabeling was completed, the binding of each sample to the PSMA-coated M-270-carboxy Dynabeads® was determined. Briefly, 250 μg of beads were placed in 50 μL of buffer (PBS / 3% BSA) in a 2 mL Eppendorf tube. Samples were run in triplicate, including a sample blocked with excess naked PSMA mAb. The blocking step continued for 40 minutes while shaking the tubes on a Thermomixer (Eppendorf) at 750 rpm at room temperature. Radiolabeled compound was diluted to 5 Bq / μL in buffer and added to each bead-containing tube. Binding continued for 80 minutes while shaking at 750 rpm at room temperature. After the binding step was completed, 40 μL of buffer was added to each tube, and the beads were separated from half of the supernatant using a magnet (DynaMag-2). The radioactivity of the supernatant and beads for each sample was measured using a digital gamma spectrometer. Radioactivity was measured after at least 6 hours to allow the daughter nuclides to equilibrate with Ac-225. Total binding was defined as [(radioactivity of beads - radioactivity of supernatant) / (total radioactivity)] × 100. Nonspecific binding was determined from blocked samples using the same calculation, and the IRF was defined as [specific binding - nonspecific binding]. The IRFs were 95%, 92%, and 74% for Ac-225-macropa-pelgiftamab, Ac-225-DOTA-pelgiftamab CAR 5.7, and Ac-225-DOTA-pelgiftamab CAR 12.7, respectively (Figure 11).

[0234] Flow cytometry The in vitro binding characteristics of the fully human PSMA-targeting antibody pelgifatamab, the antibody-chelator conjugate (ACC) pelgi-macrophage, and an isotype control were evaluated in PSMA-expressing LNCaP prostate cancer cells. 50 Determination of values ​​and antibody bound per cell was performed by flow cytometry. Binding of the PSMA-targeting antibodies pelgifatamab, macropa-pelgifatamab (non-radiolabeled ACC), and non-radiolabeled isotype control ACC to PSMA-expressing LNCaP prostate cancer cells as determined by flow cytometry ( FIG. 9 ).

[0235] Internal migration 225 The internalization of Ac-pergifatamab was determined using LNCaP cells after 2 hours of incubation. The cell binding and internalization activity of actinium-225 was measured using a gamma counter (Wizard 2470, PerkinElmer) (FIG. 10).

[0236] Cytotoxicity The in vitro cytotoxicity of Ac-225-macropa-pelgifatamab, Ac-225-DOTA-pelgifatamab (CAR=5.7), and Ac-225-DOTA-pelgifatamab (CAR=12.7) was measured in PSMA-expressing prostate cancer cell lines C4-2 and MDA-PCa-2b. Cells were seeded at appropriate cell densities in cell culture media (RPMI / 10% FBS / 1% HEPES / 1% MEM NEAA / 1% Na-pyruvate / 1% L-glutamine and BRFF-HPC1 / 20% FBS, respectively). One day after seeding, Ac-225-labeled compounds at a specific activity of 2 MBq / mg were titrated in parallel with the relevant negative isotype control radiolabeled under the same conditions. Cells were exposed to the radioligand for 2 hours. Cell viability was determined after 6 days using CellTiterGlo (Promega), and luminescence was measured on an EnVision plate reader. IC values ​​were 0.09, 0.15, and 0.29 kBq / ml for Ac-225-macropa-pelgifatamab, Ac-225-DOTA-pelgifatamab CAR 5.7, and Ac-225-DOTA-pelgifatamab CAR 12.7, respectively, in C4-2 cells (Figure 9), and 0.05, 0.09, and 0.2 kBq / ml for Ac-225-macropa-pelgifatamab, Ac-225-DOTA-pelgifatamab CAR 5.7, and Ac-225-DOTA-pelgifatamab CAR 12.7, respectively, in MDA-PCa-2b cells (Figure 10). The IC50 values ​​of the Ac-225-Macropa isotype were approximately 256 kBq / ml in C4-2 cells and 3 kBq / ml in MDA-PCa-2b cells (Figures 12+13).

[0237] Cytotoxicity The in vitro cytotoxicity of Ac-225-macropa-pelgifatamab was measured in prostate cancer cell lines expressing different levels of PSMA. PC-3, DU-145, 22Rv1, C4-2, and LNCaP cells were seeded at the appropriate cell density in the following cell culture media, as suggested by the respective suppliers: DMEM / Ham's F12 + 10% FCS; DMEM + 10% FCS; RPMI + 10% FCS; DMEM / Ham's F12 + 10% FCS + insulin (human) (5 μg / ml, Sigma #19278), transferrin (human); (final: 5 μg / ml), D-biotin (final: 0.25 μg / ml, Sigma #B4639), adenine (final: 25 μg / ml, Sigma #A9795), L-3,3,5-triiodothyronine, sodium salt, Sigma #T6397 (final: 13.6 μg / ml); and RPMI + 20% FCS. One day after seeding, Ac-225-macropa-pelgifatamab at a specific activity of 2 MBq / mg was titrated in parallel with the relevant negative isotype control radiolabeled under the same conditions. Cells were treated for 5 days, after which cell viability was determined using CellTiterGlo (Promega). Strong cytotoxicity was observed in LNCaP, C4-2, and 22R1 cells, with little cytotoxicity observed in PMSA-negative PC-3 and DU-145 cells (Figure 14).

[0238] Biodistribution study of Ac-225-macropa-pelgifatamab The biodistribution of Ac-225-macropa-pelgifatamab was investigated in the PSMA-expressing prostate cancer xenograft model MDA PCa 2b. Female RJ:NMRI-Foxn1 nu / nu mice were implanted subcutaneously with testosterone pellets and administered 1 × 10 in the right flank. 6MDA PCa 2b cells were inoculated into the mice. Animals were pretreated with 200 μg / mouse nonspecific IgG2a antibody 24 hours prior to hot dosing. Animals were treated intravenously with 300 kBq / kg Ac-225-macropa-pelgifatamab at a total protein dose of 0.75 mg / kg. In another in vivo study, a xenograft MDA PCa 2b model was treated with 250 kBq / kg Ac-225-DOTA-pelgifatamab at a protein dose of 0.14 mg / kg. In both studies, animals were sacrificed at 72, 168, 336, and 504 hours after treatment, and 225Ac was determined in the blood, tumor, liver, kidney, spleen, and femur. For Ac-225-macropa-pelgifatamab-treated animals, the data show strong and persistent tumor accumulation, while accumulation in normal organs was generally low and transient with clearance over time. Compared to 225Ac-DOTA-pelgifatamab-treated animals, improved clearance from bone, low and declining radioactivity in the liver over time, and low uptake in the spleen were observed (Figure 15). These data may be explained by the improved in vivo complex stability of 225Ac with macropa compared to DOTA.

[0239] An in vivo efficacy study comparing Ac-225-macropa-pelgifatamab with Ac-225-DOTA-pelgifatamab The compounds Ac-225-macropa-pelgifatamab, Ac-225-DOTA-pelgifatamab, and isotype-macropa were labeled with 225Ac. Mice xenografted with C4-2 prostate cancer cells were treated IV with a single 300 kBq / kg dose of 0.14 mg / kg total antibody dose. As shown in Figures 16A and 16B, Ac-225-macropa-pelgifatamab exhibited greater antitumor activity than Ac-225-DOTA-pelgifatamab. Body weight loss was less than 10% in all target-treated groups. The effects on the hematopoietic system were determined by WBC counts at the end of the experiment (Figure 16C).

[0240] immunohistochemistry C4-2 tumors were treated with 120 kBq / kg 225Levels of phosphorylated histone protein H2AX (γ-H2AX) were assessed in tissue sections of paraffin-embedded C4-2 tumors (n=3) harvested 24 or 96 hours after treatment with Ac-pelgifatamab (total antibody dose 0.75 mg / kg). (17A) Untreated C4-2 tumors and (17B) 100 kBq / kg for 1 day or (17C) 4 days. 225 Example of γH2AX expression as determined by immunohistochemistry in C4-2 tumors treated with Ac-pelgifatamab. Scale bar indicates 200 μm. 17D. Untreated C4-2 tumors (shown in panel A) and 100 kBq / kg ... 225 γH2AX expression in C4-2 tumors (n=3) treated with Ac-pelgifatamab for 1 day (shown in panel B) or 4 days (shown in panel C) (Figures 17A, 17B, 17C, 17D).

[0241] in LNCaP and KUCaP-1 prostate cancer models 225 In vivo antitumor efficacy of Ac-pergifatamab. The antitumor efficacy of 225Ac-pergifatamab was evaluated in the LNCaP prostate cancer model: male SCID mice (6 weeks old, 22 g, Janvier Labs) were implanted sc with testosterone pellets (12.5 mg, 4 mm), and 1–3 days later, 5 × 10 6 LNCaP cells were inoculated sc. The tumors were 160 mm 3 Once the mice reached an average size of 1000 mg / kg, they were randomized (n=10 mice / group) and 2 days later received either vehicle or 225 Treatment consisted of a single intravenous dose of Ac-pelgifatamab (70, 125, or 250 kBq / kg, total antibody dose 0.75 mg / kg). The study was terminated 112 days after tumor cell inoculation. In the LNCaP model, treatment with 70, 125, and 250 kBq / kg (single dose) 225 Ac-pergifatamab showed very strong antitumor efficacy, and T / C 体積 The (treated / control) ratio was 0.00 at all doses tested (Figure 18).

[0242] For KUCaP-1 efficacy studies, male scid / scid mice (8 weeks old, 22 g, Janvier Labs) were implanted sc with 5 x 5 x 5 mm KUCaP-1 tumor fragments. 3 Once the average size of the 1000-kBq antibody was reached, mice were randomized (n = 9–10 mice / group) and the following day, treated with either vehicle or isotype control (300 kBq / kg, total antibody dose 0.14 mg / kg) or 225 Treatment consisted of a single intravenous injection of Ac-pelgifatamab (70, 150, or 300 kBq / kg, total antibody dose 0.75 mg / kg). Additionally, in one treatment group, tumors were grown to 470 mm 3 After reaching a size of 300kBq / kg 225 Treatment with a single dose of Ac-pelgi was completed 72 days after tumor cell inoculation. In the patient-derived KuCaP model, treatment with 75, 150, and 300 kBq / kg (single dose) 225 Ac-pergifatamab demonstrated dose-dependent efficacy, with T / C ratios of 0.55, 0.44, and 0.26, respectively. 体積 The ratio of 300 kBq / kg was obtained (Figures 19 and 21). 225 A single dose of Ac-pergifatamab induced tumor regression even in mice bearing large tumors (FIG. 20).

[0243] Tissue-targeting compounds, including TLX592 / J592 ACC characterization by size exclusion chromatography and mass spectrometry The CARs of ACCs were determined by LCMS. The CAR of Ac225-Macropa-J592 was 0.75, and the CAR of Ac225-DOTA-J592 was 6.7.

[0244] Macropa-NCS-J592 6-[[16-[(6-carboxy-2-pyridyl)methyl]-1,4,10,13-tetraoxa-7,16-diazacyclooctadec-7-yl]methyl]-4-[2-(4-isothiocyanatophenyl)ethoxy]pyridine-2-carboxylic acid was dissolved in DMA at 10 mg / mL. Anti-J592 antibody was dissolved in PBS at 10 mg / mL, and the pH was adjusted to 9 with 1 M carbonate buffer. The chelator and antibody were mixed and incubated for 1 hour at room temperature on a thermomixer shaking at 350 rpm. The product was purified by FPLC (column: Superdex® 200 Increase 10 / 300 GL; running buffer: 6 mM citrate / 10 mM histidine / 10 mM glycine / 100 mM NaCl; flow rate: 1 mL / min; detection: UV 214 / 254 nm). Concentration and monomer purity were determined by SEC-UV, and CAR was determined by SEC-MS using positive electrospray ionization and the following formula: CAR = [(A*An) / A], where A = intensity of all signals in the maximum entropy envelope, and An = signal in the maximum entropy envelope including the chelator. The CAR was determined to be 0.8.

[0245] DOTA-NCS-J592 p-SCN-Bn-DOTA (macrocyclic, B-205) and anti-J592 antibody were dissolved in PBS at 10 mg / mL. The antibody pH was adjusted to 9 with 1 M carbonate buffer. p-SCN-Bn-DOTA was added to the antibody, and the mixture was incubated for 1 h at RT in a thermomixer with shaking at 350 rpm. The conjugate was purified by FPLC (column: Superdex® 200 Increase 10 / 300 GL; running buffer: 6 mM citrate / 10 mM histidine / 10 mM glycine / 100 mM NaCl; flow rate: 1 mL / min; detection: UV 280 nm). The concentration and monomer purity of the combined DOTA-antibody fractions were measured by SEC-UV. The CAR was determined by SEC-MS using positive electrospray ionization and the following formula: CAR = [(A*An) / A], where A = the intensity of all signals in the maximum entropy envelope, and An = the signals in the maximum entropy envelope including the chelator. The CAR was determined to be 6.7.

[0246] buffer exchange Buffer exchange of J592-DOTA and J592-MacroPA was performed using an Amicon Ultra-4 30K (Millipore, catalog number UFC803096, lot number R4JA84392). The ultrafiltration membrane of the Amicon® Ultra-4 device was rinsed with 3.5 mL of 0.1 M acetate buffer (reference J145-046, 21 Nov 22 AHJ). The device was spun at 7000 × g for 2 minutes. The acetate buffer was removed. The sample and 3.5 mL of 0.1 M acetate buffer were added and spun at 7000 × g for 10 minutes for buffer exchange. The sample was collected and diluted with 0.5 mL of 0.1 M acetate buffer. The new concentration was determined by SE-HPLC by comparing the UV signal from the previous pre-Amicon® sample with the known concentration.

[0247] Radiolabel Macropa-J592 CAR 0.75 and DOTA-J592 CAR 6.7 were radiolabeled with Ac-225 at a specific activity of 2 MBq / mg and diluted to a radioactivity concentration of 1.5 kBq / μL with 0.1 M acetate buffer, pH 5. The mixture was incubated at room temperature for 1 h for J592-Macropa, and at 60°C for DOTA-J592 in a heating block for 1 h. The RCP of TAC was measured in triplicate for DOTA and once for Macropa by instant thin-layer chromatography using citrate buffer for elution. While the radiolabeled compound remains stationary, unlabeled Ac-225 elutes at the solvent front. Radioactivity was measured using an HPGe detector (DSPEC-50, Ortec). Radioactivity was measured at least 6 h after radiolabeling to allow the daughter nuclide to equilibrate with Ac-225. Two time points were analyzed: 0 h and 96 h after storage at room temperature. The RCP of the samples (defined as [(radioactivity in the applied area / (total radioactivity on the strip)] × 100) was 99.9% (0 h) and 99.8% (96 h); 99.5% ± 0.06 (0 h) and 96.0% ± 0.35 (96 h) for Ac-225-Macropa-J592 and Ac225-DOTA-J592, respectively. This data indicates that Ac-225-Macropa-J592 releases less Ac than Ac225-DOTA-J592 at t = 96 h and is therefore more stable against radionuclide leakage.

[0248] Size exclusion chromatography of TAC The purity of TAC was determined by SEC. This method separates higher aggregates, dimers, and fragments from ACC monomers. Separation was performed using an Acquity UPLC Protein BEH SEC, 1.7 μm, 200 Å, 4.6 x 300 mm column operated at 30°C. The mobile phase was 200 mM ammonium acetate and 300 mM NaCl containing 10% 2-propanol and 0.1 mM DCTA. The flow rate was 0.3 mL / min, and ACC was detected by UV at 280 nm. Analysis was performed on an Agilent 1200 Series HPLC with a 40 μL injection.

[0249] [Table 6]

[0250] The results in Table 3 demonstrate the increased stability of the tissue-targeted compound of formula (I) compared to its DOTA counterpart, as indicated by the lower amount of by-products (i.e., aggregates and dimers) present after 96 h.

[0251] iTLC(RFC) Free chelator iTLC strips were preformed to measure the amount of free chelator in the conjugate solution over time. Briefly, iTLC SG plates were cut to obtain 12 cm x 1 cm strips. The application, cut, and run-point endpoints were marked at 1 cm, 4 cm, and 10 cm, respectively. 2 μL of TAC sample was applied to n=3 iTLC strips for elution with a freshly prepared 1:1 1 M ammonium acetate / 100% methanol mobile phase. The strips were developed with 3 mL of mobile phase in LSC vials. When the liquid level reached a significant endpoint, they were removed from the vials and placed on aluminum foil to dry. Samples were read after 6 hours to ensure permanent sample equilibration. The iTLC strips were measured using an Eckert & Siegler iTLC Scanner AR-2000 at 1000 volts for 1 second per strip.

[0252] Figure 26 shows the increased stability of the tissue-targeted compound of formula (I) against decomplexation compared to its DOTA counterpart, as indicated by the lower amount of free chelator present after 96 h.

[0253] Combination study of 225Ac-pergifatamab and darolutamide The effects of darolutamide and 225Ac-pelgifatamab on PSMA mRNA and protein expression in vitro were examined in VCaP and 22Rv1 prostate cancer cells. To assess PSMA protein expression, VCaP and 22Rv1 cells were treated with 0.08–5 μM darolutamide for 7 days, and PSMA expression was determined by flow cytometry using the mouse PSMA-specific monoclonal antibody (mAb) J591 (prepared in-house). To assess FOLH1 gene expression, 22Rv1 cells were treated with 2 μM darolutamide and / or 0.15 kBq / mL 225Ac-pelgifatamab for 24 or 48 hours. RNA was extracted with the RNeasy Plus Mini Kit (Qiagen), transcribed into cDNA using SuperScript IV VILO Master Mix (Invitrogen), and analyzed by qPCR.

[0254] To evaluate the combined effect of 225Ac-pergifatamab and darolutamide in vitro, VCaP and 22Rv1 cells were treated with darolutamide, 225Ac-pergifatamab, or their combination for 5 days. Cell viability was determined using CellTiter-Glo® (Promega). The combination index (CI) was calculated according to the Chou-Talalay (8) median effect model, with a CI < 0.9 defined as synergistic.

[0255] In vitro, darolutamide induced PSMA expression in androgen-dependent VCaP and androgen-independent 22Rv1 cells by more than 10-fold and more than 2-fold, respectively (FIG. 23).

[0256] Combination treatment of darolutamide and 225Ac-pergifatamab showed a 76% increase in FOLH1 gene expression in 22Rv1 cells after 48 h of treatment (Figure 23). No increase was observed with either monotherapy.

[0257] 225Ac-pergifatamab monotherapy and combined treatment with 225Ac-pergifatamab and darolutamide increased the RNA expression of CDKN1A (FIG. 23) and decreased the expression of XRCC2 (FIG. 23) in 22Rv1 cells.

[0258] The efficacy of darolutamide in combination with 225Ac-pergifatamab was synergistic in VCaP and 22Rv1 cells, with combination indexes of 0.34 and 0.38, respectively (FIG. 23).

[0259] Darolutamide enhances PSMA expression and, when combined with 225Ac-pergifatamab, increases efficacy in prostate cancer cells.

[0260] PSMA expression was determined in isolated untreated 22Rv1 and ST1273 tumors by immunohistochemistry (IHC) using the mouse PSMA-specific monoclonal antibody GCP-04 (Novus Biologicals) on formalin-fixed, paraffin-embedded (FFPE) tissue sections.

[0261] The in vivo efficacy of 225Ac-pelgifatamab in combination with darolutamide was tested in murine androgen-dependent ST1273 and androgen-independent 22Rv1 prostate cancer models.

[0262] In the ST1273 study, female NMRI nude mice (n=10 / group) were implanted with tumor fragments from ST1273 patients and, 19 days later, were treated with vehicle (PEG400, propylene glycol, glucose; v / v% 50:30:20), 225Ac-pelgifatamab (75 or 150 kBq / kg, single dose, iv), darolutamide (100 mg / kg, twice daily (BID) for 34 days, po), or their combinations.

[0263] In the 22Rv1 study, male NMRI nude mice (n=10 / group) were inoculated with 22Rv1 cells and treated 15 days later with vehicle (acetate buffer), 225Ac-pelgifatamab (75 kBq / kg, single dose, iv; total antibody dose 75 mg / kg), darolutamide (100 mg / kg, BID, po), or their combinations.

[0264] In vivo expression of PSMA protein was assessed in 22Rv1 prostate tumor-bearing male nude (nu / nu) mice treated with vehicle or darolutamide (100 mg / kg, bid, po) for 18 days. 22Rv1 tumors were extracted (n=2), and dissociated tumor cells were analyzed by flow cytometry using the J591 antibody.

[0265] Combining 225Ac-pergifatamab with darolutamide enhances therapeutic efficacy in the androgen-dependent ST1273 prostate cancer PDX model. In the PSMA-expressing (Figure 24A) androgen-dependent patient-derived ST1273 model, a single intravenous injection of 75 or 150 kBq / kg of 225Ac-pelgifatamab resulted in high antitumor efficacy with treatment / control (T / C) ratios of 0.22 and 0.05, respectively. Darolutamide monotherapy at 100 mg / kg (BID, po) demonstrated good antitumor efficacy with a T / C ratio of 0.29 (Figure 24B-C, Table 4).

[0266] Notably, combining either 75 or 150 kBq / kg of 225Ac-pergifatamab with darolutamide (100 mg / kg) resulted in additive antitumor efficacy with a T / C ratio of 0.01 for both doses (Figures 24B-C, Table 4). Furthermore, 100 days after a single injection of 225Ac-pergifatamab, 5 / 10 and 6 / 10 mice were tumor-free.

[0267] All treatments were well tolerated as evidenced by stable body weights throughout the study (Figure 24D).

[0268] [Table 7]

[0269] The antitumor efficacy of 225Ac-pergifatamab is enhanced by darolutamide in the androgen-independent 22Rv1 prostate cancer model In the PSMA-expressing (Figure 25A) androgen-independent cell line-derived 22Rv1 model, a single iv dose of 150 kBq / kg of 225Ac-pelgifatamab demonstrated antitumor efficacy with a T / C ratio of 0.59 (Figures 25B-C, Table 4). Darolutamide (100 mg / kg, po, BID) monotherapy was ineffective, as demonstrated by a T / C ratio of 0.78 on day 16.

[0270] Notably, the combination of 225Ac-pergifatamab (150 kBq / kg) and darolutamide resulted in enhanced efficacy with a T / C ratio of 0.20 (Figures 25B-C, Table 4).

[0271] All treatments were well tolerated, as evidenced by stable body weights over the course of the study (Figure 25D).

[0272] Flow cytometry analysis of isolated 22Rv1 tumors showed a 50-fold increase in PSMA expression upon darolutamide treatment compared to vehicle (Figure 25E).

[0273] In combination with darolutamide 225 The in vivo antitumor efficacy of Ac-pelgi was evaluated in the androgen-independent prostate cancer model 22Rv1. Male nude mice (n = 10–12 mice / group, nude (nu / nu)) were treated with Ac-pelgi starting from day 15 after 22Rv1 tumor cell inoculation. 225 Patients were treated with a single injection of Ac-pelgi (75 or 150 kBq / kg, iv, total protein dose 0.75 mg / kg) and / or darolutamide (100 mg / kg, BID, po). Antitumor efficacy was significantly improved in the combination group compared with both monotherapy groups (Figure 22).

Claims

1. Tissue-targeting compounds of formula (I) 【Chemistry 1】 (wherein [Ab] is a monoclonal antibody or antigen-binding fragment thereof having binding affinity for prostate-specific membrane antigen (PSMA).

2. The tissue-targeting compound of formula (I) according to claim 1, wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof, the anti-PSMA monoclonal antibody J591 or an antigen-binding fragment thereof, or the anti-PSMA monoclonal antibody TLX592 or an antigen-binding fragment thereof.

3. The tissue-targeting compound of formula (I) according to claim 1, wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof.

4. The tissue-targeting compound of formula (I) according to any one of claims 1 to 3, wherein [Ab] is the anti-PSMA antibody pelgifatamab or an antigen-binding fragment thereof, comprising at least three CDR heavy chain sequences according to SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7 and three CDR light chain sequences according to SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO:

10.

5. 3. The tissue-targeting compound of formula (I) according to claim 1 or 2, wherein [Ab] is the anti-PSMA antibody J591 or an antigen-binding fragment thereof, comprising at least three CDR heavy chain sequences according to SEQ ID NO: 13, SEQ ID NO: 14 and SEQ ID NO: 15 and three CDR light chain sequences according to SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO:

18.

6. The tissue-targeting compound of formula (I) according to claim 1 or 2, wherein [Ab] is the anti-PSMA antibody TLX592 or an antigen-binding fragment thereof, comprising at least three CDR heavy chain sequences according to SEQ ID NO: 21, SEQ ID NO: 22 and SEQ ID NO: 23 and three CDR light chain sequences according to SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO:

26.

7. Tissue-targeting compounds of formula (I) 【Chemistry 2】 where [Ab] is a monoclonal antibody or antigen-binding fragment thereof that has binding affinity for PSMA.

1. A method for preparing (i) a chelating moiety of formula (II) 【Transformation 3】 to a monoclonal antibody or antigen-binding fragment thereof having binding affinity for PSMA; (ii) contacting the resulting product with an aqueous solution containing ions of at least one alpha-emitting actinium isotope; A method comprising:

8. [Ab] is the anti-PSMA antibody pelgifatamab or an antigen-binding fragment thereof; The method comprises: (i) a chelating moiety of formula (II) 【Chemistry 4】 to the anti-PSMA antibody pelgifatamab or antigen-binding fragment thereof via a lysine residue on the monoclonal antibody or antigen-binding fragment thereof; (ii) contacting the resulting product with an aqueous solution containing ions of at least one alpha-emitting actinium isotope; 8. The method of claim 7, comprising:

9. [Ab] is the anti-PSMA antibody pelgifatamab or an antigen-binding fragment thereof; The method comprises: (i) a chelating moiety of formula (II) 【Transformation 5】 to the anti-PSMA antibody pelgifatamab or antigen-binding fragment thereof via a lysine residue on the monoclonal antibody or antigen-binding fragment thereof; (ii) contacting the resulting product with an aqueous solution containing ions of at least one alpha-emitting actinium isotope; Including, 8. The method of claim 7, wherein the anti-PSMA antibody pelgifatamab or an antigen-binding fragment thereof comprises at least three CDR heavy chain sequences according to SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 and three CDR light chain sequences according to SEQ ID NO:8, SEQ ID NO:9 and SEQ ID NO:

10.

10. A tissue-targeted chelating agent of formula (III) 【Transformation 6】 (wherein [Ab] is a monoclonal antibody or antigen-binding fragment thereof having binding affinity for PSMA).

11. The tissue-targeted chelating agent of formula (III) according to claim 10, wherein [Ab] is the anti-PSMA monoclonal antibody pergifatamab or an antigen-binding fragment thereof, the anti-PSMA monoclonal antibody J591 or an antigen-binding fragment thereof, or the anti-PSMA monoclonal antibody TLX592 or an antigen-binding fragment thereof.

12. The tissue-targeting chelating agent of formula (III) according to claim 10, wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof.

13. 13. The tissue-targeted chelating agent of formula (III) according to any one of claims 10 to 12, wherein [Ab] is the anti-PSMA antibody pelgifatamab or an antigen-binding fragment thereof, comprising at least three CDR heavy chain sequences according to SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7 and three CDR light chain sequences according to SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO:

10.

14. 12. The tissue-targeted chelating agent of formula (III) of claim 10 or 11, wherein [Ab] is the anti-PSMA antibody J591 or an antigen-binding fragment thereof, comprising at least three CDR heavy chain sequences according to SEQ ID NO: 13, SEQ ID NO: 14 and SEQ ID NO: 15 and three CDR light chain sequences according to SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO:

18.

15. The tissue-targeted chelating agent of formula (III) of claim 10 or 11, wherein [Ab] is the anti-PSMA antibody TLX592 or an antigen-binding fragment thereof, comprising at least three CDR heavy chain sequences according to SEQ ID NO: 21, SEQ ID NO: 22 and SEQ ID NO: 23 and three CDR light chain sequences according to SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO:

26.

16. 16. Use of a tissue-targeting chelating agent of formula (III) according to any one of claims 10 to 15 for the preparation of a tissue-targeting compound of formula (I) according to any one of claims 1 to 6.

17. (i) a tissue-targeting compound of formula (I) 【Transformation 7】 wherein [Ab] is a monoclonal antibody or antigen-binding fragment thereof having binding affinity for prostate-specific membrane antigen (PSMA), and (ii) A pharmaceutical agent selected from nonsteroidal antiandrogens, steroidal antiandrogens, androgen synthesis inhibitors, antigonadotropins, PARP inhibitors, ATR inhibitors, ATM inhibitors, DNA-PK inhibitors, AKT inhibitors, Pi3K inhibitors, PSMA-targeted beta-emitters, immune checkpoint inhibitors, alpha-emitters, vaccines, and chemotherapeutic agents. A combination comprising:

18. The combination of claim 17, wherein [Ab] is the anti-PSMA monoclonal antibody pelgifatamab or an antigen-binding fragment thereof, comprising at least three CDR heavy chain sequences according to SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7 and three CDR light chain sequences according to SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO:

10.

19. 19. The combination of claim 17 or 18, wherein the pharmaceutical agent is selected from nonsteroidal antiandrogens, steroidal antiandrogens, androgen synthesis inhibitors, antigonadotropins, PARP inhibitors, PSMA-targeted beta-emitters, alpha-emitters, vaccines and chemotherapeutic agents.

20. 20. The combination of any one of claims 17 to 19, wherein the pharmaceutical agent is selected from non-steroidal antiandrogens, steroidal antiandrogens, androgen synthesis inhibitors, and antigonadotropins.

21. The pharmaceutical agent comprises a nonsteroidal antiandrogen selected from the group consisting of darolutamide, bicalutamide, enzalutamide, apalutamide, flutamide, nilutamide, and topirutamide, cyproterone acetate, allylestrenol, chlormadinone acetate, delmadinone acetate, gestnorone caproate, hydroxyprogesterone caproate, medroxyprogesterone acetate, megestrol acetate, osaterone acetate, oxendolone, and spironolactone.

21. The combination of any one of claims 17 to 20, wherein the steroidal antiandrogen is selected from the group consisting of ketoconazole, abiraterone, aminoglutethimide, goserelin and seviteronel, the androgen synthesis inhibitor is selected from the group consisting of abarelix, danazol, gestrinone, paroxypropion, cetrorelix, degarelix, elagolix, ganirelix, linzagolix and relugolix, and the PARP inhibitor is selected from the group consisting of olaparib, rucaparib, veliparib, niraparib, talazoparib, pamiparib, CEP 9722, E7016 and iniparib.

22. The pharmaceutical agent is a nonsteroidal antiandrogen selected from the group consisting of darolutamide, bicalutamide, enzalutamide, apalutamide, flutamide, nilutamide and topirutamide, cyproterone acetate, allylestrenol, chlormadinone acetate, delmadinone acetate, gestnorone caproate, hydroxyprogesterone caproate, medroxyprogesterone acetate, megestrol acetate, osaterone acetate, oxendolone and spironolactone.

22. The combination of any one of claims 17 to 21, wherein the androgen synthesis inhibitor is selected from the group consisting of steroidal antiandrogens selected from the group consisting of ketoconazole, abiraterone, aminoglutethimide, goserelin and seviteronel, and an antigonadotropin selected from the group consisting of abarelix, danazol, gestrinone, paroxypropion, cetrorelix, degarelix, elagolix, ganirelix, linzagolix and relugolix.

23. 23. The combination of any one of claims 17 to 22, wherein the pharmaceutical agent is selected from the non-steroidal antiandrogen darolutamide, the steroidal antiandrogen cyproterone acetate, the androgen synthesis inhibitors abiraterone or goserelin, and the antigonadotropin degarelix or relugolix.

24. 24. The combination of any one of claims 17 to 23, wherein the pharmaceutical agent is the non-steroidal antiandrogen drug darolutamide.

25. 25. A medicament comprising a tissue-targeting compound of formula (I) according to any one of claims 1 to 6 or a combination according to any one of claims 17 to 24 for use in the treatment of a disease.

26. 26. The medicament or combination of claim 25, wherein the disease is characterized by overexpression of prostate-specific membrane antigen (PSMA).

27. 26. The medicament or combination according to claim 25, wherein the disease is cancer.

28. The medicament or combination according to claim 25, wherein the disease is a hyperproliferative disease.

29. 25. Use of a tissue-targeting compound of formula (I) according to any one of claims 1 to 6 or a combination according to any one of claims 17 to 24 for the preparation of a medicament for treating a disease.

30. 26. The medicament or combination according to claim 25, wherein the disease is prostate cancer.

31. The use described in claim 29, wherein the disease is prostate cancer.

32. A composition comprising a combination according to any one of claims 17 to 24 together with a pharmaceutically acceptable ingredient.

33. Tissue-targeting compounds and pharmaceuticals of formula (I) according to any one of claims 1 to 6; and one or more further medicinal products A kit comprising the combination of A kit, wherein the tissue-targeted compound of formula (I) or the pharmaceutical agent(s) are in the form of pharmaceutical preparations ready to be used for simultaneous, concurrent, separate or sequential administration.

Images