Novel sialosides and their therapeutic uses

Synthetic sialosides with specific glycan structures produced via fermentation efficiently bind to influenza viruses, addressing production challenges and providing a scalable therapeutic solution for influenza prevention and treatment.

JP7825628B2Active Publication Date: 2026-03-06CENT NAT DE LA RECH SCI (C N R S) +3
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2023546012
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2021-01-29
Filing Date
2022-01-28
Publication Date
2026-03-06
Estimated Expiration
2042-01-28

AI Technical Summary

Technical Problem

Existing methods for producing long-chain sialosides that efficiently bind to pathogenic viruses, particularly human influenza viruses, are limited by the complexity of their molecular structure and the difficulty in achieving large-scale production through chemical or enzymatic synthesis.

Method used

Development of synthetic sialosides with the formula Neu5Ac-α2-6-R1(R2)[GlcNAcβ1-4]n-GlcNAc, where R1 is a glycan structure containing at least one galactose and R2 is fucose linked by an α1-3 or α1-4 bond, produced through fermentation processes using metabolically engineered microorganisms to prevent the formation of by-products.

Benefits of technology

The synthetic sialosides exhibit high affinity for influenza virus hemagglutinins, effectively inhibiting viral attachment to host cells and can be produced in large quantities, offering a promising therapeutic approach for preventing or treating influenza infections.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007825628000007
    Figure 0007825628000007
  • Figure 0007825628000008
    Figure 0007825628000008
  • Figure 0007825628000009
    Figure 0007825628000009
Patent Text Reader

Abstract

The present invention relates to synthetic sialosides having formula (I): Neu5Ac-α2-6-R1(R2)[GlcNAcβ1-4] n -GlcNAc formula wherein GlcNAc is N-acetylglucosamine, GlcNAcβ1-4 is an N-acetylglucosamine unit linked via a β1-4 bond, n is 1 or more, R1 is a glycan structure containing at least one galactose (Gal), and R2 is selected from the group consisting of H, fucose linked via an α1-3 bond (Fucα1-3) or an α1-4 bond (Fucα1-4).
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to synthetic sialic acid-containing carbohydrates, also known as sialosides. These novel compounds can be produced by fermentation. These sialosides can also bind to the surface proteins of several viruses, particularly the hemagglutinin of influenza viruses. Consequently, these sialosides inhibit viral attachment to host cells and are therefore useful compounds for preventing or treating viral infections. [Background technology]

[0002] Viruses have evolved to invade cells from all three domains of life: bacteria, archaea, and eukaryotes. Of the more than 3,600 known viruses, several hundred are able to infect human cells, and the majority of these are associated with disease. Virus entry into animal cells is initiated by attachment to a receptor, followed by key conformational changes in viral proteins, penetration through or fusion with the cell membrane. Some viruses, such as influenza virus, can cross the endosomal membrane very rapidly and the efficiency of entry can be greater than 50% (ie, 50% of the attached viruses enter the cell). A way to prevent or at least reduce viral infection of cells by pathogenic viruses is to inhibit and / or block the interaction of the virus with host cell receptors, therefore, research into these virus / host cell interactions is of utmost importance. Among the viruses of the Orthomyxoviridae family, influenza virus is one of the most studied. The infectious cycle of influenza virus is initiated by the interaction of the viral hemagglutinin protein (HA) with sialic acid-containing glycans (sialosides) incorporated into glycoproteins and glycolipids present on the surface of host cells.

[0003] It has been proposed that saturation of the binding sites of the viral hemagglutinin HA with synthetic sialic acid-containing ligands inhibits influenza virus attachment to host cells ( Matrosovich and Klenk, 2003 ). This promising approach is currently being pursued, particularly by searching for the most suitable synthetic ligands, ie, those that exhibit better affinity for the hemagglutinin of each influenza virus. Examination of this interaction between influenza virus hemagglutinin and sialosides has shown that influenza viruses have specificity for their host cells due to selective binding to certain sialosides. Indeed, human and animal influenza viruses display hemagglutinins with different binding preferences for various sialosides expressed on the surface of host cells.

[0004] Avian influenza virus strains express hemagglutinins that have a binding preference for sialic acid linked to the rest of the glycan chain by an α2-3 linkage. In contrast, hemagglutinins from human influenza virus strains show enhanced binding to α2-6-linked sialic acid. This correlates with the abundance of α2-6-linked sialic acid in the upper respiratory tract of humans and the presence of α2-3-linked sialic acid in the intestinal mucosa of birds, where replication of human and avian strains of influenza virus occurs, respectively. Overall, sialic acid linkage specificity influences host range: avian and equine strains of influenza virus recognize sialic acid in α2,3 linkages with galactose, whereas human strains prefer sialic acid in α2,6 linkages. However, the determinants of influenza tropism are more complex than just preferential binding to α2-6 and α2-3 sialic acids.

[0005] Human respiratory epithelial cells have been shown to express sialylated N-glycans with extended poly-N-acetyllactosamine (poly-LacNAc) chains, suggesting that human hyaluronan preferentially binds to extended α2-6 sialosides. This was confirmed by a glycan microarray study on synthetic sialosides, which showed that human influenza virus HA from subtypes H1, H2, and H3 bound best to linear sialosides with di- and tri-LacNAc extensions ( Nycholat et al., 2012 ). Interestingly, the receptor specificity of HA from H3 influenza virus subtypes appears to have evolved recently; the “oldest” H3 viruses prefer short branched sialosides, whereas the “most recent” H3 viruses bind exclusively to linear sialosides with a tri-LacNAc extension (Yang et al., 2015). It is now well established that not all sialosides bind to HA with equal efficiency and that different virus strains exhibit different receptor specificities according to their host tropism.

[0006] Production of synthetic sialosides The greatest technical challenge in the development of these promising therapeutic molecules is the acquisition / production of these specific sialoside ligands. The preparation of structurally diverse sialosides can be achieved through chemical synthesis, enzymatic synthesis, or modification of naturally occurring sialosides. Extraction and purification from natural sources is not contemplated, as only very small amounts can be obtained by this method. Long-chain sialylated polylactosamines appear to be the best candidates for effectively preventing or treating influenza infections by decoy strategies. However, chemical or enzymatic production of long-chain sialosides is not possible on a large scale. Therefore, the best alternative for the production of these sialosides is a microbiological approach, i.e., production by fermentation of specific engineered microorganisms. A method for producing 3' sialyllactose and 6' sialyllactose by fermentation is disclosed in WO 2007 / 101862.

[0007] Furthermore, fermentation processes are already being used for the industrial large-scale production of human milk oligosaccharides for the infant formula market (Bych et al. 2019). This technology is based on the expression of specific recombinant glycosyltransferase genes in Escherichia coli strains that have been metabolically engineered to overexpress the sugar nucleotides used in the glycosylation reaction. Although the production of polylactosamine structures in metabolically engineered bacteria has been reported, the microbial production of long-chain sialylated polylactosamines appears difficult to achieve for the following reasons: - the complexity of its molecular structure, and - The number of by-products expected, the production of which would dramatically reduce production yield. It is a primary object of the present invention to disclose novel structures of long-chain sialosides that efficiently bind to pathogenic viruses, particularly human influenza viruses, and that can be produced in large quantities by fermentation processes. Summary of the Invention

[0008] The present invention relates to synthetic sialosides having the following formula (I): Neu5Ac-α2-6-R1(R2)[GlcNAcβ1-4] n -GlcNAc formula (I) (In the formula, - GlcNAc is N-acetylglucosamine; - GlcNAcβ1-4 is an N-acetylglucosamine unit linked by a β1-4 bond; - n is greater than or equal to 1; - R1 is a glycan structure containing at least one galactose (Gal); and R2 is selected from the group consisting of H, fucose linked with an α1-3 bond (Fucα1-3) or an α1-4 bond (Fucα1-4). The present invention also relates to multivalent sialosides, including supports bearing a plurality of synthetic sialosides as described above.

[0009] Another object of the present invention is a pharmaceutical composition comprising, in a pharmaceutically acceptable medium, at least one polyvalent sialoside as defined above. Another object of the present invention is a medical device comprising at least one polyvalent sialoside as defined above. The present invention also relates to a polyvalent sialoside of the present invention or a pharmaceutical composition of the present invention for use as a medicament. Furthermore, the present invention relates to a polyvalent sialoside of the invention or a pharmaceutical composition of the invention for use in the prevention and / or treatment of infection by a virus having an affinity for sialic acid, said virus being in particular an influenza virus, preferably a human, equine, swine or avian influenza virus. [Brief explanation of the drawings]

[0010] [Figure 1] This diagram shows the engineered metabolic pathway for COV6S biosynthesis for the SCH6 strain.

[10] Chitopentaose

[11] Intermediate Hexasaccharide

[12] Sialylated Heptasaccharide COV6S It has been shown that chitooligosaccharides such as chitopentaose

[10] can be used as acceptors by β1-4 galactosyltransferase to form the hexasaccharide

[11] containing a terminal LacNAc motif at the non-reducing end. Subsequent sialylation of

[11] to form the sialylated heptasaccharide COV6S

[12] is possible with the additional expression of α2-6 sialyltransferase in metabolically engineered E. coli strains. Because GlcNAC is not a substrate for α2-6 sialyltransferase, the formation of by-products is prevented, and COV6S

[12] is the almost exclusive end product. [Figure 2]

[0023] Figure 1 shows the structures of two sialosides of the present invention that have been developed. COV6S of formula (II) is shown at the top; another example sialoside structure (formula (I) where R1 = Galβ1-4GlcNAcβ1-3Galβ1-4, R2 = H, n = 4) is shown at the bottom. [Figure 3] FIG. 1 is a schematic diagram of a hemagglutination inhibition assay (HI or HAI). [Figure 4] FIG. 1 is a schematic diagram of the microneutralization assay (MN). [Figure 5] Figure 1 shows the potential therapeutic effect of the ER15 compound is assayed for three post-infection treatments at D0 (1 hour post-infection), D1, and D2. A / California / 7 / 09 H1N1 virus is incubated on cells for 1 hour at 37°C. ER15 is used at five different concentrations (20 μM, 10 μM, 5 μM, 2.5 μM, and 1.25 μM) relative to untreated conditions (NT: no treatment, and PL: delivery of increasing amounts of polylysine). Supernatant samples are collected at D1, D2, and D3 post-infection to quantify virus production by (i) titration of the number of infectious particles per ml (TCID50 / ml) in MDCK cells and (ii) quantification of viral genomes (RT-qPCR). A and C: Measurement of generated infectious particles over time (hpi), expressed as TCID50 / ml; B and D: Measurement of viral mRNA over time (hpi) by RT-qPCR; A and B: multiplicity of infection (MOI) = 0.1; C and D: multiplicity of infection (MOI) = 0.01 [Figure 6] Figure 1 shows the potential therapeutic effect of the ER15 compound was assayed for three post-infection treatments at D0 (1 hour post-infection), D1, and D2. Experimental conditions were the same as for Figure 5, except that the A / Texas / 50 / 2012 H3N2 virus was incubated on the cells for 1 hour at 37°C. A and C: Measurement of generated infectious particles over a time course (hpi), expressed as TCID50 / ml; B and D: Measurement of viral mRNA over a time course (hpi) by RT-qPCR; A and B: Multiplicity of infection (MOI) = 0.1; C and D: Multiplicity of infection (MOI) = 0.01. [Figure 7] Figure 1 shows the potential therapeutic effect of ER15 compound against the A / California / 7 / 09 H1N1 strain assayed for a single post-infection treatment at DO (1 hour post-infection). A: Multiplicity of infection (MOI) = 0.1 B: Multiplicity of infection (MOI) = 0.01 [Figure 8]

[0023] Figure 1 shows the therapeutic properties of ER15 against the A / California / 7 / 09 H1N1 strain after a single administration simultaneously with viral infection. A: Multiplicity of infection (MOI) = 0.1 B: Multiplicity of infection (MOI) = 0.01 [Figure 9] Figure 1 shows the protective properties of ER15 against the A / California / 7 / 09 H1N1 strain after a single treatment given one day before infection. A: Multiplicity of infection (MOI) = 0.1 B: Multiplicity of infection (MOI) = 0.01 [Figure 10] Figure 1 shows the therapeutic properties of ER15 against the A / California / 7 / 09 H1N1 strain. The experimental conditions are the same as for Figure 5, except that the A / Lyon / 969 / 09 H1N1 virus was incubated on the cells for 1 hour at 37°C. A: Multiplicity of infection (MOI) = 0.1 B: Multiplicity of infection (MOI) = 0.01 [Figure 11] Figure 1 shows the evaluation of ER15 efficacy and cytotoxicity tested in an infected in vitro epithelial model. Epithelia are infected at the apical pole with the A / California / 7 / 2009 H1N1 strain at a multiplicity of infection of 0.1 in 150 μl. Lyophilized compound ER15 is mixed at a concentration of 0.1 mM with: water, phosphate buffer (2 g / L glycerol, 9 g / L NaCl, 10 mM pH=7.9), and citrate buffer (2 g / L glycerol, 9 g / L NaCl, 10 mM pH=6.0). A - Daily transepithelial electrical resistance (TEER) measurements. Negative controls are "mock NT" cells: uninfected, untreated cells. Another negative control is "PL": treatment of cells with polylysine diluted to 0.1 mM in water. B - Quantification of lactate dehydrogenase (LDH) release in mock (uninfected) cells treated with ER15, polylysine (PL), or no treatment (NT). Samples are collected daily from the basal medium. C - Quantification of virus production by titration of infectious particles produced per ml (TCID50 / ml). Samples are collected at the apical pole at D1, D2, and D3. D - The same samples are subjected to quantification of viral genomes by RT-qPCR. [Figure 12]Figure 1 shows the therapeutic properties of ER61 against the H1N1 A / California / 7 / 09 strain. Experimental conditions are the same as for Figure 5, except that the ER61 compound is used. Measurement of generated infectious particles over time (hours post infection: hpi), expressed as TCID50 / ml. A: Multiplicity of infection (MOI) = 0.1 B: Multiplicity of infection (MOI) = 0.01 [Figure 13] Figure 1 shows the therapeutic effect of ER15 and ER61 compounds against recent strains. The virus strains tested are incubated on A549 cells at an MOI of 0.1 for 1 hour at 37°C. ER15 and ER61 compounds are used at three different concentrations (20 μM, 5 μM, and 1.25 μM) versus untreated conditions (NT: no treatment). Three post-infection treatments are performed at D0 (1 hour post-infection), D1, and D2. Supernatant samples are collected at D1, D2, and D3 post-infection to quantify virus production by titration of the number of infectious particles per ml (TCID50 / ml). The virus strains tested are: A) A / Michigan / 45 / 2015 H1N1B) A / Kansas / 14 / 2017 H3N2C) B / Phuket / 3073 / 2013 [Figure 14] Figure 14 shows the therapeutic effect of ER15 compound on resistant H1N1 virus strains. The experimental conditions are the same as those in Figure 13. Three post-infection treatments are performed with ER15 at D0 (1 hour post-infection), D1, and D2 in cells infected with the following virus strains obtained by reverse genetics: A) RG H1N1 A / Lyon / 969 / 09 I38TB; C) RG H1N1 A / Lyon / 969 / 09 I38T+H275Y. DETAILED DESCRIPTION OF THE INVENTION

[0011] The present invention relates to synthetic sialosides having the following formula (I): Neu5Ac-α2-6-R1(R2)[GlcNAcβ1-4] n -GlcNAc formula (I) (In the formula, - GlcNAc is N-acetylglucosamine; - GlcNAcβ1-4 is an N-acetylglucosamine unit linked by a β1-4 bond; - n is 1 or more, in particular n is comprised between 1 and 4; - R1 is a glycan structure containing at least one galactose (Gal); and R2 is selected from the group consisting of H, fucose linked with an α1-3 bond (Fucα1-3) or an α1-4 bond (Fucα1-4).

[0012] Unless otherwise stated, the following terms and phrases when used herein are intended to have the following meanings: In the sense of the present invention, the term sialoside denotes a sialic acid conjugate consisting of a sialic acid linked to a carbohydrate by an O-glycosidic bond. Sialic acids are a family of monosaccharides that include 43 naturally occurring derivatives of 5-amino-3,5-dideoxy-D-glycero-D-galacto-non-2-ulosonic acid (neuraminic acid), a sugar composed of a nine-carbon backbone, that are ubiquitously expressed in all vertebrates. The most common sialic acid is 5-acetamido-2-keto-3,5-dideoxy-D-glycero-D-galactonononic acid, also named N-acetylneuraminic acid or sialic acid, and abbreviated Neu5Ac. Sialic acid is recognized as an important component of bacterial toxins and receptors for various viruses.

[0013] The term "synthetic" emphasizes the artificial nature of the sialosides of the present invention. Indeed, these sialosides are not found in nature, and their structures have been designed by the inventors. Advantageously, these synthetic sialosides are designed to exhibit optimal affinity with viral surface proteins that have an affinity for sialic acid, particularly hemagglutinins of influenza virus strains. Each sialoside of the present invention may have different affinities for various hemagglutinins, and in particular, each sialoside of the present invention may have preferential binding to one particular hemagglutinin. Other terms and abbreviations will be familiar to those skilled in the art, in particular: - N-acetylglucosamine (GlcNAc) is an amide derivative of glucose. It is the secondary amide of glucosamine and acetic acid. This molecule is widely expressed among living organisms because it is part of the biopolymer that makes up the cell wall. Its CAS number is 7512-17-6. - β1-4 bond refers to a beta-type covalent glycosidic bond that connects one carbohydrate group to another.

[0014] α- and β-glycosidic bonds are distinguished by the relative stereochemistry of the anomeric position in the sugar and the stereocenter furthest from C1. An α-glycosidic bond is formed when both carbons have the same stereochemistry, while a β-glycosidic bond occurs when the two carbons have different stereochemistry. - A "glycan structure" is a carbohydrate structure consisting of glycosidically linked monosaccharides forming a "chain." Galactose (Gal) is an aldohexose, an epimer of glucose. Its CAS number is 59-23-4. - H represents a hydrogen atom. Fucose (Fuc) is a hexose deoxysugar, also known as 6-deoxy-L-galactose. Its CAS number is 2438-80-4. It can be linked by an α1-3 linkage (Fucα1-3) or an α1-4 linkage (Fucα1-4). Formula (I) corresponds to novel long-chain sialoside structures designed by the present inventors, which contain at least one N-acetylglucosamine unit linked by a β1-4 bond (i.e., n is 1 or greater). In some embodiments, n is equal to 2, 3, 4, 5, 6, 7, 8, or more. In preferred embodiments, n is between 1 and 4. In formula (I), the moiety R1 is defined as a glycan structure containing at least one galactose (Gal). R1 ​​is composed of a chain of one or more monosaccharides linked in a row, which defines the "backbone" of R1. To this backbone, monosaccharides or secondary chains containing at least two monosaccharides can be grafted.

[0015] R1 may be chemically modified, in particular by the addition of one or more methyl groups ("methylation") or one or more sulfate (SO3) groups (sulfation) on one or more monosaccharides that make up the glycan structure, in particular on the monosaccharides of its backbone. In certain embodiments of the present invention, R1 is a glycan structure having a main chain containing up to five monosaccharides. In this embodiment, R1 is composed of one, two, three, four, or five linked monosaccharides that form one main glycan chain. This main glycan chain can be further grafted with secondary glycan chains that branch on one or more monosaccharides of the main chain. Preferentially, R1 is composed of a backbone containing one, two, or three linked monosaccharides forming one primary glycan chain, which may be further grafted with secondary glycan chains branched on one or more monosaccharides of the backbone. In certain embodiments, R1 is composed of a backbone comprising three linked monosaccharides.

[0016] In another particular embodiment, R1 is a non-grafted backbone comprising three monosaccharides. In another particular embodiment, R1 is a grafted backbone comprising three monosaccharides. In another particular embodiment, R1 is composed of a single monosaccharide that is galactose. In another particular embodiment, R1 is a glycan structure in which at least one galactose is linked at one of the ends of the main chain. In the first configuration, R1 contains one galactose at one of the termini of its major glycan chains, and in the second configuration, R1 contains two galactoses, one linked at each of the termini of the major glycan chains. In certain embodiments of the invention, R1 is selected from the group: - Galβ1-4, - Galβ1-3, - Galβ1-4GlcNAcβ1-3Galβ1-4, and - Galβ1-4(Fucα1-3)GlcNAcβ1-3Galβ1-4 is selected from among: In another particular embodiment of the invention, R2 is H. According to this embodiment, structures having formula (III) as presented below are objects of the invention. Neu5Ac-α2-6-R1-[GlcNAcβ1-4]n-GlcNAc (Formula III) (In the formula: - n is 1 or more, in particular n is comprised between 1 and 4; and - R1 is a glycan structure containing at least one galactose (Gal)

[0017] A non-exhaustive list of sialoside structures according to the present invention is presented below. - Neu5Acα2-6Galβ1-4[GlcNAcβ1-4] n -GlcNAc - Neu5Acα2-6Galβ1-4(Fuca1-3)[GlcNAcβ1-4] n -GlcNAc - Neu5Acα2-6Galβ1-3[GlcNAcβ1-4] n -GlcNAc - Neu5Acα2-6Galβ1-3(Fucα1-4)[GlcNAcβ1-4] n -GlcNAc - Neu5Ac-α2-6Galβ1-4GlcNAcβ1-3Galβ1-4[GlcNAcβ1-4] n -GlcNAc - Neu5Ac-α2-6Galβ1-4(Fucα1-3)GlcNAcβ1-3Galβ1-4[GlcNAcβ1-4] n -GlcNAc - Neu5Ac-α2-6Galβ1-4GlcNAcβ1-3Galβ1-4(Fucα1-3)[GlcNAcβ1-4] n -GlcNAc - Neu5Ac-α2-6Galβ1-4(Fucα1-3)GlcNAcβ1-3Galβ1-4(Fucα1-3)[GlcNAcβ1-4] n -GlcNAc

[0018] According to a particular embodiment of the present invention, R1 is galactose linked via a β1-4 bond (Galβ1-4). In this embodiment, the synthetic sialoside has the following formula (II): Neu5Acα2-6Galβ1-4GlcNAcβ1-4GlcNAcβ1-4GlcNAcβ1-4GlcNAcβ1-4GlcNAc This particular sialoside of formula (II) is also referred to in this application, particularly in the Examples section, as "COV6S." Its developed structure is depicted at the top of Figure 2.

[0019] As shown in the Examples, other sialoside structures have been synthesized and tested. These structures, corresponding to general formulas (I) and (III), are presented in Table 1 below. [Table 1] These sialosides COIII6S, COIV6S, 1-COV6S, and COV6S represent synthetic sialosides according to the present invention, which contain chitooligosaccharide terminal chains. These novel sialosides can be used to construct multivalent sialoside compounds that can efficiently bind to influenza viruses and can be used as drugs to combat influenza infection. Each sialoside may exhibit distinct specificity for hemagglutinin. Indeed, depending on their structure, sialosides may exhibit specificity for binding with the hemagglutinin of various virus strains.

[0020] Polyvalent Sialosides The present invention also relates to polyvalent sialosides, including supports bearing a plurality of synthetic sialosides. In the sense of the present invention, a "polyvalent sialoside" refers to a molecular structure comprising multiple sialosides, said structure exhibiting increased binding affinity with its receptor (e.g., hemagglutinin) compared to the binding affinity of a single sialoside. Initial viral attachment to host cells is controlled by multivalent interactions in which multiple HA trimers interact with multiple sialoside ligands expressed on cell surface glycoproteins and glycolipids. The binding of soluble monomeric sialosides is too weak to competitively disrupt these strong polyvalent interactions. Based on the theory of the "multivalent effect," rational drug design based on the inhibition of virus / host cell binding must include the synthesis of multivalent sialoside compounds.

[0021] In the case of influenza virus inhibition, it has been shown that "multivalent sialoside" ligands have a stronger affinity for hemagglutinin and are therefore more suitable to act as antagonists by blocking the HA binding site and thus inhibiting their interaction with glycoproteins present on the surface of host cells. This process of saturation of the hemagglutinin binding site is based on multivalent binding, which can achieve stability and prevent virus dissociation. Many different strategies have been developed to generate various types of multivalent sialoside structures. Various synthetic multivalent sialoside inhibitors of influenza virus attachment have already been developed. They are based on supports such as liposomes (Kingery-Wood et al., 1992), dendrimers (Reuter et al., 1999), synthetic polymers (Gambaryan et al., 2005), chitosan (Umemura et al., 2010), polysaccharides (Li et al., 2011), and gold nanoparticles (Papp et al., 2010).

[0022] As used herein, the phrases "support with a plurality of sialosides," "support possessing a plurality of sialosides," "a plurality of sialosides grafted onto a support," "support bearing sialosides," and "a plurality of sialosides loaded onto a support" are equivalent and used interchangeably; they all refer to any support known by one of skill in the art and to a polyvalent sialoside according to the present invention, comprising multiple chains of sialosides covalently or non-covalently bound thereto. The plurality of sialosides are usually all identical; however, multivalent sialosides containing at least two, three, or four different sialosides bound to a single support can also be made. In certain embodiments of the invention, the support comprises a liposome, a polymer, a dendrimer, or a nanoparticle. Liposomes can be used to encapsulate drugs, proteins, genes, and fluorescent dye molecules for applications in imaging and controlled drug release. Liposomes carrying sialosides can be prepared from sialoside phospholipids and amphiphilic precursors. Liposomes of different sizes can be fabricated.

[0023] The use of polymers to create polymeric networks of sialosides is one of the earliest known examples of polyvalent sialosides. The main approaches developed to obtain sialoside-containing polymers are: Assembly of monomeric sialosides by using acrylate free radical polymerization methods; and · Coupling of sialoside ligands onto commercially available and well-defined polymer scaffolds. Dendrimers are important multivalent scaffolds used to decorate ligands of interest in well-defined, uniform, and symmetrical shapes. Compared to polymers, dendrimers offer more controllable monodispersity and persistent shape. Furthermore, the 3D geometry of sialoside-bearing dendrimers closely mimics the decoration of sialoside groups across cell surfaces. The nanoparticles are well-organized, robust dendrimers that exhibit large surface areas and possess unique optical, electrochemical, and magnetic properties that facilitate sensing and imaging of specific interactions. Several types of sialoside-containing nanoparticles have been reported in the literature, the most prevalent of which are gold, silver, silica, iron, cadmium, selenium, and virus-like nanoparticles. In a particular embodiment of the invention, the support is a polymer, preferentially a natural polymer, in particular comprising polylysine (ε-poly-L-lysine).

[0024] ε-Poly-L-lysine (ε-PL) is a homopolymer linked by peptide bonds between the carboxyl and epsilon-amino groups of adjacent lysine molecules. It is naturally occurring, water-soluble, biodegradable, edible, and nontoxic to humans and the environment. ε-PL consists of 25–35 L-lysine residues. It is industrially produced by aerobic fermentation using Streptomyces albulus. It has antimicrobial activity and is approved as a food preservative in Japan and the United States. Polyvalent sialosides are structurally characterized by their constituents (support and sialoside) and also by their degree of grafting. The grafting rate, also called the coupling yield, is defined as the percentage of reactive groups on the support that are substituted with sialosides. Those skilled in the art know how to adjust the grafting rate of sialosides onto their supports. In particular, the grafting rate is controlled by the reaction conditions, particularly the proportional amounts of support and sialoside, as shown in Example 6. The grafting rate typically varies from 10% to 100%. In a particular embodiment of the present invention, the polyvalent sialoside exhibits a grafting rate comprised between 20% and 100%. Preferentially, the grafting rate is comprised between 30% and 100%, between 40% and 100%, between 50% and 100%, between 60% and 100%, between 70% and 100%, between 80% and 100%, or between 90% and 100%.

[0025] Pharmaceutical Compositions The present invention also relates to pharmaceutical compositions comprising at least one multivalent sialoside as described above in a pharmaceutically acceptable vehicle. The present invention also relates to veterinary compositions comprising, in a pharmaceutically acceptable vehicle, at least one multivalent sialoside as described above, advantageously designed for the inhibition of viruses having animal host cells. The pharmaceutical or veterinary composition comprises an effective amount of at least one multivalent sialoside according to the present invention. For purposes of this invention, an "effective amount" refers to an amount of a multivalent sialoside sufficient to inhibit viral growth and / or replication and / or the development of viral infection in an infected organism, which inhibition can be quantified, for example, by measuring viral replication. For example, in vitro, so-called "effective" amounts are comprised between 1 μM and 1 mM, as shown in Examples 9-11.

[0026] Pharmaceutical or veterinary compositions according to the invention may contain one, two, three, four, five, or more multivalent sialosides. Advantageously, each multivalent sialoside in the composition exhibits a different specificity for a particular viral strain. According to the present invention, the term "pharmaceutically acceptable vehicle" refers to one or more pharmaceutically acceptable vehicles or excipients, the administration of which to an individual or animal is not accompanied by significant adverse effects and which are well known to those skilled in the art. Pharmaceutical or veterinary compositions according to the invention are suitable for oral, sublingual, inhalation, subcutaneous, intramuscular, intravenous, transdermal, ocular, or rectal administration. According to a preferred embodiment of the invention, the pharmaceutical composition is characterized in that it is in a galenical form adapted for administration by inhalation. Inhalation refers to absorption through the respiratory tract. It is a method of absorption of therapeutic compounds, especially certain substances in the form of gases, microdroplets, or powders in suspension. The administration of pharmaceutical compositions by inhalation, ie, through the nasal and / or oral passages, is well known to those skilled in the art.

[0027] There are two forms of administration by inhalation: - administration by insufflation, if the composition is in the form of a dispersion; and - Administration by nebulization, when the composition is in the form of an aerosol (suspension) or a liquid, e.g., an aqueous solution, under pressure. The use of a nebulizer or atomizer is then recommended for administering the pharmaceutical or veterinary composition. The galenical forms contemplated here are therefore selected from powders, aqueous suspensions of drops, or solutions under pressure. Administration by nasal drops is preferred. medical devices The present invention also relates to medical devices comprising at least one multivalent sialoside as described above. In one embodiment, the medical device comprises a substrate coated with at least one polyvalent sialoside of the present invention.

[0028] In certain embodiments, the support is coated with multiple (at least two) multivalent sialosides, each multivalent sialoside having a specific affinity for hemagglutinin expressed on the surface of a different viral strain. For example, a support is coated with three multivalent sialosides, one specific for the H1N1 influenza virus strain, a second specific for the H2N2 influenza virus strain, and a third specific for the H3N2 influenza virus strain. The support may be, for example, a respiratory protective mask or a filter that can be inserted into a mask. Protective masks are increasingly needed by the general public after the emergence of major pandemics. The support may also be a glove or any other personal protective device. The support is coated with multivalent sialosides, for example, polymers grafted with multivalent sialosides according to the present invention, each sialoside being capable of exhibiting distinct specificity for different hemagglutinins. Advantageously, the medical device can be used to capture and retain at least one virus, particularly a human influenza virus, or multiple strains of a human influenza virus, that has an affinity for sialic acid. In another embodiment of the present invention, the medical device is a nasal spray comprising, as an infusion solution, a solution comprising at least one multivalent sialoside according to the present invention.

[0029] Drugs and Therapeutic Uses The present invention also relates to a multivalent sialoside as described, or a pharmaceutical composition containing at least one multivalent sialoside, for use as a medicament. The present invention also relates to multivalent sialosides as described, or pharmaceutical compositions containing at least one multivalent sialoside, for use in the prevention and / or treatment of infection by viruses having an affinity for sialic acid. The present invention also relates to multivalent sialosides as described, or pharmaceutical compositions containing at least one multivalent sialoside, for use in preventing viral transmission from one host organism to another. The phrase "viruses with affinity for sialic acid" refers to any virus that has a pathogenic effect, i.e., causes disease in a living organism, expresses receptors for sialic acid, and is therefore capable of binding to sialic acid conjugates.

[0030] Such viruses are presented in a non-exhaustive manner in the review by Matrosovich M et al., 2015. In particular, such viruses with affinity for sialic acid are selected from the families Orthomyxoviridae (including influenza viruses), Coronaviridae, Paramyxoviridae, Caliciviridae, Picornaviridae, Reoviridae, Polyomaviridae, Adenoviridae, and Parvoviridae. In particular embodiments of the invention, the virus is an influenza virus, in particular a human, equine, swine, or avian influenza virus. Influenza viruses are the cause of influenza disease. They are classified into three types: A, B, and C. Influenza viruses are also defined by the types of proteins on their surface. There are various influenza A virus subtypes according to the nature of the hemagglutinin (HA) and neuraminidase (NA) glycoproteins expressed on their surface; 16 types of HA and 9 types of NA have been identified in circulating influenza A viruses.

[0031] In humans, the most common influenza A viruses are from the subtypes H1N1, H2N2, and H3N2, with occasional interspecies transmission, particularly from animals to humans, of the avian viruses H5N1, H7N7, H7N9, H5N2, and H9N2. According to certain embodiments, the influenza virus is a human type A virus selected from the subtypes H1N1, H2N2, H3N2, H5N1, H7N7, H7N9, H5N2, and H9N2. In another specific embodiment of the invention, the influenza virus is a human influenza virus and is selected from among strains H1N1, H3N2, and B. In the sense of the present invention, the term "influenza virus" includes all types (A or B) and subtypes (H1N1, N3N2, etc.) of influenza virus. The term includes wild-type influenza strains and mutant influenza strains, especially strains that have genetic mutations that make them resistant to antiviral compounds. The compositions according to the invention are particularly intended for use in preventing infection with influenza viruses. Advantageously, these compositions are intended for use in preventing infection with influenza mutant strains that are resistant to conventional antiviral compounds, such as oseltamivir- and baloxavir-resistant strains, as shown in more detail in Example 13.

[0032] The term "prevention" refers to the fact that the likelihood of the occurrence of infection in a human or animal organism by at least one influenza virus is prevented or at least reduced by saturating the antigenic sites of the hemagglutinin present on the surface of the virus with the polyvalent sialoside of the present invention, thus preventing the attachment of the virus to host cells. The compositions according to the invention may also be intended for use in the treatment of influenza virus infections. The term "treatment" refers to the fact of combating at least one influenza virus infection in a human or animal organism. By administering at least one composition according to the present invention, the level of viral infection in the organism will gradually decrease and then disappear completely. The term "treatment" also refers to the fact of alleviating symptoms associated with viral infection (fever, fatigue, etc.). The present invention also relates to combination products comprising at least one multivalent sialoside and at least one other antiviral compound for simultaneous, separate, or sequential use in the prevention and / or treatment of viral infections by influenza viruses. In a preferred embodiment, the antiviral compound is selected from among the antiviral compounds classically used to prevent or treat influenza. Such antiviral compounds are commercially available and described in reference books such as Vidal. For example, oseltamivir and baloxavir marboxil are antiviral compounds that can be used in combination with the polyvalent sialosides of the present invention. The present invention also relates to a method for preventing or treating infection in a human by a virus having an affinity for sialic acid, comprising administering to the human an effective amount of at least one multivalent sialoside according to the present invention. [Example]

[0033] Although the invention herein has been described with reference to particular embodiments, it is to be understood that these embodiments are merely illustrative of the principles and applications of the present invention. It is therefore to be understood that numerous modifications can be made to the illustrative embodiments and that other arrangements can be devised without departing from the spirit and scope of the invention as defined by the appended claims.

[0034] Example 1 Production of COV6S sialoside Chitooligosaccharides are an interesting alternative to polylactosamine chains for several reasons. First, both polylactosamines and chitooligosaccharides are long chains of hexoses linked by beta-glycosidic bonds. Second, both structures contain N-acetylglucosamine as the major component. Third, chitooligosaccharides can be produced in high yields by metabolically engineered Escherichia coli expressing the chitooligosaccharide synthase nodC (Samain et al., 1997). Furthermore, it has been shown by Bettler et al (1999) that chitooligosaccharides such as chitopentaose

[10] can be used as acceptors by β1-4 galactosyltransferase to form hexasaccharides containing a terminal LacNAc motif at the non-reducing end

[11] , as shown in Figure 1. Subsequent sialylation of

[11] to form the sialylated heptasaccharide COV6S

[12] is possible by additional expression of α2-6 sialyltransferase in the metabolically engineered E. coli strain SCH1, obtained as described below.

[0035] Strain SCH1 is constructed by transforming the host strain ZLKA with four plasmids: pBSnodC, pBBR3-SS, pWKS-lgtB, and pSU6ST. a) Construction of host strain ZLKA was described by Fierfort and Samain (2008). Strain ZLKA was obtained from the Deutsche Sammlung von Mikroorganismen (reference DSM 4235) and is a derivative of the E. coli K12 strain DH1 (endA1 recA1 gyrA96 thi-1 glnV44 relA1 hsdR17) with additional silent mutations in the lacZ lacA nanA, and nanK genes. b) The pBSnodC plasmid carrying the nodC gene for chitin oligosaccharide synthase from Azorhizobium caulinaudans was constructed as described by Cottaz and Samain (2005). c) Construction of the pBBR3-SS plasmid was described by Fierfort and Samain (2008). It contains three genes, neuC, neuB, and neuA, from Campylobacter jejuni strain ATCC 4343, encoding N-acetylglucosamine-6-P epimerase, sialic acid synthase, and CMP-NeuA synthase, respectively. d) Construction of the pWKS-lgtB plasmid carrying the galactosyltransferase lgtB from Neisseria meningitidis. This plasmid was constructed as described by Cottaz and Samain (2005). e) Construction of pSU6ST plasmid carrying the α2-6 NeuAc transferase from Photobacterium sp. JT-ISH-224. This plasmid was described by Richard et al. (2017).

[0036] The strain SCH1 is grown to high cell density as previously described (Priem et al. 2002); the culture is carried out in a 3 liter reactor containing 1.5 liters of mineral medium, the temperature is maintained at 34°C, and the pH is adjusted to 6.8 with 14% NH4OH. The high cell density cultivation consisted of three phases: an exponential growth phase starting from inoculation of the fermentor and continuing until exhaustion of the carbon substrate (glycerol 17.5 g / L), a 5-h fed-batch phase at a high glycerol feed rate of 5 g / L / h, and a 20-h fed-batch phase at a glycerol feed rate of 3 g / L / h. At the end of the fermentation period, bacterial cells were harvested by centrifugation (7000 g, 30 min). The cell pellet was resuspended in distilled water, and the cells were permeabilized by autoclaving at 100° C. for 50 min. The mixture was centrifuged (7000 g, 30 min) and the supernatant containing the oligosaccharides was collected.

[0037] The pH of the extracellular fraction was lowered to 3.0 by the addition of a strong cation exchange resin (Amberlite IR120 H+ form). This resulted in protein precipitation, which was removed by centrifugation. The pH of the clear supernatant was then adjusted to 6.0 by the addition of a weak anion exchanger (Dowex 66 free base form). After decanting, the supernatant was loaded onto a Dowex 1 (HCO3 form) column (5 x 20 cm). After washing with distilled water, acidic oligosaccharides retained on the Dowex 1 resin were eluted with a continuous (NH4)2CO3 gradient from 0 to 500 mM. The eluted fractions containing COV6S are pooled and the (NH4)2CO3 is removed by lyophilization. Interestingly, the fact that GlcNAc is not a substrate for α2-6 sialyltransferase prevents the formation of by-products; consequently, COV6S (product in Figure 1

[12] ) is almost the only end-product. The structure of COV6S is confirmed by nuclear magnetic resonance (NMR) and mass spectrometry.

[0038] Example 2 Production of type 1 COV6S sialoside Type 1 COV6S sialoside (1-COV6S) has the following formula: Formula (IV) Neu5Acα2-6Galβ1-3GlcNAcβ1-4GlcNAcβ1-4GlcNAcβ1-4GlcNAcβ1-4GlcNAc This formula corresponds to general formula (I) where R1=Galβ1-3, R2=H, and n=4. It is produced by fermentation of strain SCH11 as described in Example 1 for strain SCH1. Strain SCH11 is similar to SCH1, except that the plasmid pWKS-lgtB containing the β1-3 galactosyltransferase gene has been removed and pBBR3-SS has been replaced by pBBR3-SS-β-3GalT, which contains an additional gene for β1-3 galactosyltransferase.

[0039] Plasmid pBBR3 was constructed as follows: a 1.34 kb DNA fragment containing the sequence of the β1-3 galactosyltransferase gene was amplified by PCR using genomic DNA of Helicobacter pylori ATCC43504 as a template. A SalI site was added to the left primer as follows: 5'GGTCGACGGTAAGGAGATATACATATGATTTCTGTTTATATCATTTCTTTAAAAG (SEQ ID NO: 1) A PstI site was added to the right primer as follows: 5'CTGCAGTTAAACCTCTTTAGGGGTTTTTAAAGG (SEQ ID NO: 2) The amplified fragment was first cloned into the pCR4Blunt-TOPO vector and then subcloned into the XhoI and PstI sites of the pBBR3-SS plasmid to form pBBR3-SS-β-3GalT.

[0040] Example 3 Production of COIV6S sialoside COIV6S sialoside has the following formula: Formula (V) Neu5Acα2-6Galβ1-4GlcNAcβ1-4GlcNAcβ1-4GlcNAcβ1-4GlcNAc This formula corresponds to general formula (I) where R1=Galβ1-4, R2=H, and n=3. It is produced by fermentation of strain SCH9 as described in Example 1 for strain SCH1. Strain SCH9 is similar to SCH1, except that the plasmid pBS-nodC, encoding the chitin oligosaccharide synthase from Azorhizobium caulinaudans, has been replaced by the plasmid pUC-nodC, encoding the chitin oligosaccharide synthase from Sinorhizobium meliloti and described by Samain et al. (1997).

[0041] Example 4 Preparation of COII6S and COIII6S sialosides COII6S and COIII6S sialosides have the following formula: Formula (VI) Neu5Acα2-6Galβ1-4GlcNAcβ1-4GlcNAc Formula (VII) Neu5Acα2-6Galβ1-4GlcNAcβ1-4GlcNAcβ1-4GlcNAc The formulas of both COII6S and COIII6S correspond to the general formula (I) where R1 = Galβ1-4, R2 = H, and n = 1 or 2, respectively. COII6S and COIII6S sialosides are co-produced by fermentation as described in Example 1, except that strain SCH1 is replaced by strain SCH10. After a purification step on Dowex1, the two sialosides are separated by size exclusion chromatography on a HW40 column. Strain SCH10 was similar to strain SCH1 except that plasmid pWKS-lgtB was replaced by plasmid pWKS-lgtB-ChiA, which contained the additional chiA gene from Bacillus circulans WL12. The chiA gene was previously shown to encode a chitinase that cleaves chitin pentaose into chitinbiose, with the transient accumulation of chitin triose (Cottaz and Samain, 2005). Plasmid pWKS-lgtB-ChiA is constructed as follows: a 1.3-kb DNA segment containing the chiA gene is excised from pBBR1-ChiA by KpnI NotI digestion (Cottaz and Samain 2007) and cloned into the XbaI NotI site of pWKS-lgtB in the presence of an XbaI / KpnI linker.

[0042] Example 5 Preparation of LSTc sialoside (sialoside is not included in this invention) LSTc is a natural sialoside found in human milk, which is used as the reference compound. Its structure is: Neu5Acα2-6Galβ1-4GlcNAcβ1-3Galβ1-4Glc It can be produced by fermentation as described in Example 1, except that strain SCH1 is replaced by strain LST1 and lactose (5 g / l) is added at the end of the exponential growth phase. Strain LST1 is similar to strain SCH14, except that it does not contain the pBS-nodC plasmid.

[0043] Example 6 Synthesis of polyvalent sialosides A simple approach based on reductive amination of the amine groups of a natural polymer (ε-poly-L-lysine) was used to link the reducing ends of the different sialosides obtained in Examples 1-5. The grafting rate, defined as the percentage of amine groups of ε-poly-L-lysine that are substituted with sialoside, can be controlled by the reaction conditions and can vary from 20% to 100%, as shown in Table 2 below.

[0044] A brief experimental protocol for obtaining ER15 is shown below: In a 1.5 ml microtube, 0.4 mmol of sialoside (1 equivalent per amine) is solubilized in 500 μl of deionized water. Sonication is necessary to achieve complete solubilization (Solution 1). In another 1.5 ml microtube, 50 mg of polylysine is solubilized in 100 μl of deionized water (Solution 2). The two solutions 1 and 2 are mixed, and 100 μl of borate buffer (500 mM, pH 8.5) is added. In a 1.5 ml microtube, under a fume hood, 123.6 mg NaBHCN (2 mmol, 5 equivalents per oligosaccharide) is solubilized in 50 μl deionized water, and the resulting solution 3 is added dropwise to the previous mixture. The reaction mixture is vortexed and incubated in a dry bath under a fume hood at 40° C. for 72 hours. The reaction mixture (1 ml) is transferred to a 15 ml centrifuge tube. The microtube is washed with 1 ml of deionized water, and the washings are transferred to a 15 ml tube (total volume 2 ml). After adding 4 ml of 96% ethanol (2 volumes), the tube is centrifuged at 9000 rpm for 15 minutes. The supernatant (approximately 6 ml) is removed, and the precipitate is removed with 2 ml of 1% NaCl solution. After adding 4 ml of 96% ethanol and centrifuging a second time (15 minutes, 9000 rpm, 4°C), the precipitate is collected in 5 ml of deionized water and purified on a preparative HW40 steric chromatography column (5 x 90 cm). Elution is performed with 100 mM ammonium carbonate at a flow rate of 2 ml / min. After purification, the tubes containing the product are pooled, evaporated to dryness to remove the ammonium carbonate, added with 3 ml of deionized water, and lyophilized. To obtain compounds ER59, 60, and 61, the following number of oligosaccharide equivalents were modified: 0.75 equivalents per amine, 0.5 equivalents per amine, and 0.25 equivalents per amine, respectively. The coupling rate is determined by nuclear magnetic resonance (NMR) 1H and gel permeation chromatography (GPC) in conjunction with multi-angle light scattering (MALS).

[0045] [Table 2]

[0046] Example 7 Hemagglutination Inhibition Assay (HI or HAI) The HI technique involves incubating decreasing doses of multivalent sialosides (potential inhibitors of viruses) with a fixed amount of virus. If there is recognition and binding, the virus will attach itself to the inhibitor. Erythrocytes are then added and the mixture is incubated. Free virus can recognize the sialic acid present on the surface of the erythrocytes, thus forming a network (a red veil representing the hemagglutination process), while virus attached to multivalent sialosides cannot bind to the erythrocytes and will settle to the bottom of the well, forming a pellet (representing hemagglutination inhibition). The hemagglutination titer corresponds to the reciprocal of the highest dilution at which hemagglutination inhibition is observed. If dilutions are made in a ratio of 2, a titer of <2 means that there is no hemagglutination inhibition observed from the first dilution at 1 / 2, while a titer of 4096, for example, means that there is hemagglutination inhibition up to a dilution of 1 / 4096. Figure 3 shows a summary scheme of the HI technique.

[0047] For this HI assay, the virus strains used were: A / California / 7 / 2009 H1N1, A / PortoRico / 8 / 34 H1N1, A / Texas / 50 / 12 H3N2, A / Moscow / 10 / 99 H3N2, B / Massachusetts / 2 / 2012, and B / Brisbane / 60 / 08 at a dose of 4 HAU per well. The red blood cells used were 0.5% hen red blood cells and 0.8% guinea pig red blood cells.

[0048] Table 3 below shows the results obtained with the polyvalent sialosides listed in Table 2. ER10 and ER13 are polyvalent sialosides not included in formula (I) and therefore not within the scope of the present invention. [Table 3] Significant results are in bold.

[0049] The results shown in Table 3 indicate that ER15 was the best performing compound against H1N1 viruses A / California / 7 / 09 and A / PR / 8 / 34, with potencies of 128 and 4096, respectively, while the ER10 or ER13 compounds exhibited potencies of 2 and 16 (ER10) and <2 and 2 (ER13). These experiments highlight the importance of the presence of the GlcNAc motif for their HI properties, especially for the ER15 compound. Not all compounds have the same hemagglutination inhibitory activity, or even activity against some virus types (A or B) and / or A virus subtypes.

[0050] Example 8 Microneutralization assay The microneutralization assay allows for the quantification of the inhibitory potential of antiviral compounds against infectious viruses. A schematic of the technique is shown in Figure 4. This assay is performed in a reference cell system for influenza virus: Madin-Darby canine kidney cells (MDCK), which display sialic acid on their surface linked to galactose by either alpha 2.3 or alpha 2.6 linkages. The virus strain used in this test was A / California / 7 / 2009 H1N1 at a calibrated dose of 100 TCID50 in 50 μL. The technique involves incubating decreasing doses of a test compound with a fixed amount of virus for 1 hour. If recognized, the virus will bind to the compound. This virus / compound mixture is then added to MDCK cells and incubated for 72 hours. Unbound virus will recognize sialic acid present on the cell surface and therefore be able to infect the cells (visualized cytopathic effect), while virus bound to the sialylated compound will be unable to attach itself to cells and therefore will not infect them ("neutralization" of infection).

[0051] The microneutralization titer is the reciprocal of the highest dilution at which the total absence of cytopathic effect is observed in at least 2 out of 4 wells. Dilutions are made in a ratio of 2 starting from 1:5, so a titer of <5 means there is no neutralization of infection from the first 1:5 dilution, while a titer of, for example, 160 means there is neutralization of infection up to a dilution of 1:160. [Table 4] The ER15 multivalent sialoside exhibits the highest neutralizing activity against the virus strain A / California / 7 / 2009 H1N1.

[0052] Example 9 Assay of the polyvalent sialosides of the present invention in the human cell line A549 The purpose of this assay is to evaluate the performance of ER15 as an antiviral agent in the human respiratory cell line A549 (derived from a human lung carcinoma) under different treatment conditions (therapeutic / post-infection treatment, prophylactic / pre-infection treatment), at different concentrations, and using multiple virus doses (dose effect). A549 cells are cultured in DMEM + SVF 10% + L-glutamine 2 mM + penicillin (100 U / ml) + streptomycin (100 μg / ml) in an incubator at 37° C. and 5% CO. For infection and compound evaluation, cells are seeded in 12-well plates in DMEM + L-glutamine 2 mM + penicillin (100 U / ml) + streptomycin (100 μg / ml) + bovine trypsin (T6763 Sigma) 0.5 μg / ml.

[0053] The A / California / 7 / 2009 H1N1 virus strain was used at two different multiplicities of infection (MOI): 0.1 and 0.01. This strain has a D225G hemagglutinin mutant, which gives it a higher affinity for cellular receptors. Another virus strain, A / Lyon / 969 / 09 H1N1, was used at three different MOIs: 1, 0.1, and 0.01. This strain does not exhibit the D225G mutation and has a lower affinity for the alpha 2-6 sialic acid of the cellular receptor. The lyophilized compound is mixed with 0.1 mM water, filtered at 0.22 μm and stored at −20° C. The compound used as a negative control is polylysine alone (PL). After treatment and infection of A549 cells, supernatant samples were collected at D1, D2, and D3 post-infection to quantify virus production by (i) titration of the number of infectious particles per ml (TCID50 / ml) in MDCK cells and (ii) quantification of viral genomes (RT-qPCR).

[0054] Therapeutic properties of ER15 versus polylysine alone (PL) against A-H1N1 strains The potential therapeutic effect of the ER15 compound is assayed three times post-infection treatment: at D0 (1 hour post-infection), D1, and D2. A / California / 7 / 09 H1N1 virus is incubated on the cells for 1 hour at 37°C and then removed. Culture medium containing ER15 is added - ER15 is present at five different concentrations (20 μM, 10 μM, 5 μM, 2.5 μM, and 1.25 μM) relative to the untreated condition (NT: no treatment, and PL: delivery of increasing amounts of polylysine). For virus quantification, several samples of cell supernatant are taken at three different time points. The results, shown in Figure 5, indicate that ER15 treatment administered at 1, 24, and 48 hours post-infection resulted in a 5-log to 6-log reduction in A / California / 7 / 09 H1N1 titers. When the virus inoculum was administered at an MOI of 0.1, a dose-dependent effect was observed, depending on the treatment concentration. At an MOI of 0.01, all tested ER15 concentrations (20 μM, 10 μM, 5 μM, 2.5 μM, and 1.25 μM) allowed for a maximum reduction in viral load as early as 24 hpi. The results obtained in RT-qPCR are consistent and show a significant inhibition of infection.

[0055] Therapeutic characteristics of ER15 versus polylysine alone (PL) against B-H3N2 strains The experimental conditions were the same as for (A), except that the A / Texas / 50 / 2012 H3N2 virus was incubated on the cells for 1 hour at 37°C and then removed. The results obtained, shown in Figure 6, show that: A significant reduction in infectious titer (approximately 3 logs) is observed for ER15 treatment administered at a dose of 20 μM at 1, 24, and 48 hours post-infection, and for the two MOIs tested, i.e., 0.1 and 0.01. Treatment with ER15 at concentrations between 1.25 and 10 μM doses does not significantly reduce infectious viral load for this H3N2 strain. These results are consistent with those obtained in HIA, where titers were <2. Thus, a significant effect against the H3N2 strain is observed in a dose-dependent manner. The results obtained in RT-qPCR are consistent and show a significant reduction in viral load only for treatment with 20 μM. Overall, the HIA and efficacy results in A549 cells indicate a lower affinity / performance of ER15 against the A / Texas / 50 / 2012 H3N2 strain compared to A / California / 7 / 09 H1N1.

[0056] C - Therapeutic properties of ER15 versus polylysine alone (PL) against the A / California / 7 / 09 H1N1 strain with only one administration post-infection The experimental conditions are the same as for (A), except that ER15 is administered to infected cells by addition to the medium only once at D0, 1 hour post-infection. Three different concentrations are tested: 20 μM, 5 μM, and 1.25 μM. The results obtained, shown in Figure 7, indicate that ER15 treatment administered 1 hour post-infection is sufficient to significantly reduce infectious viral load, regardless of the starting MOI (0.1 or 0.01). At least a 2-log reduction is observed at 24 hpi, and a maximum of more than a 5-log reduction is observed at 72 hpi. Thus, the effect is sustained with a single dose (1 hpi), and a dose effect is observed for an MOI of 0.1. D - Therapeutic properties of ER15 versus polylysine alone (PL) against the A / California / 7 / 09 H1N1 strain after only one administration concurrent with viral infection The experimental conditions are the same as for (A), except that ER15 is administered to the cells by addition to the culture medium only once at D0. Three different concentrations are tested: 20 μM, 5 μM, and 1.25 μM. The results obtained, shown in Figure 8, show that ER15 treatment administered at the same time point as the virus (during the infection phase) allows a significant reduction (up to 3 logs) in the infectious viral load, especially in the early stages (24 hpi and 48 hpi). At an MOI of 0.01, the effect is maintained over time (between 4 and 5 logs). In addition to a dose-dependent effect of the MOI, a dose-dependent effect of the ER15 concentration is observed.

[0057] Protective properties of ER15 versus polylysine alone (PL) against the E-A / California / 7 / 09 H1N1 strain The aim here is to evaluate the preventive effect of the ER15 compound in a single treatment given one day before infection at three different concentrations (20 μM, 5 μM, and 1.25 μM). At the time of infection, A / California / 7 / 09 H1N1 virus is added directly to the medium already containing the compound. After a 5-hour incubation, the medium containing the virus and compound is removed and replaced with fresh medium. For infectious virus quantification, samples are taken at D1, D2, and D3. The results obtained, shown in Figure 9, show that a single prophylactic treatment with ER15 administered 24 hours prior to infection significantly reduces infectious viral load over time (from a 2-3 log reduction at 24 hpi to a maximum of 5 log reduction) depending on the MOI. The effect is maintained over time (between 4-5 log reduction). A dose-dependent effect of ER15 concentration and MOI is clearly observed. Therapeutic characteristics of ER15 versus polylysine alone (PL) against the F-H1N1 A / Lyon / 969 / 09 strain The experimental conditions were the same as for (A), except that the H1N1 A / Lyon / 969 / 09 strain virus was incubated on the cells for 1 hour at 37°C and then removed. The obtained results, shown in Figure 10, show that ER15 significantly reduces the infectious viral load of the A / Lyon / 969 / 09 H1N1 strain. As expected, the results for the Lyon strain are less favorable than those for the California strain, which displays the D225G mutation.

[0058] Example 10 Evaluation of ER15 compounds in an in vitro physiological model based on reconstructed human respiratory epithelium of nasal origin Epithelia are grown on inserts placed at the air / liquid interface in 24-well plates. In this way, cells constituting the basal pole are in contact with the medium, and cells constituting the apical pole are in contact with the air. The medium is Mucilair (Epithelix), and epithelia are derived from nasal swabs from a donor pool (Epithelix). They are maintained in culture in an incubator at 37°C and 5% CO2. Infection with the A / California / 7 / 2009 H1N1 strain occurs at the apical pole in 150 μl of OptiMEM medium at a multiplicity of infection of 0.1 for 1 hour at 37°C and 5% CO2. The virus suspension is then removed and washed. After carefully removing all medium at the apical pole, treatment is performed 1 hpi in 10 μl at three different concentrations (50 μM, 20 μM, and 5 μM).

[0059] Lyophilized compound ER15 is mixed at a concentration of 0.1 mM with: - water - phosphate buffer (2 g / L glycerin, 9 g / L NaCl, 10 mM pH=7.9), and - Citrate buffer (2g / L glycerin, 9g / L NaCl, 10mM pH=6.0) The negative control is polylysine (PL) diluted in water at 0.1 mM. Some cells are untreated (NT) and / or mock (uninfected). Transepithelial electrical resistance (TEER) measurements are performed daily to monitor epithelial integrity. Samples are collected at the apical pole at D1, D2, and D3 to quantify viral production by titration of the number of infectious particles per ml (TCID50 / ml - Figure 11C) and quantification of viral genomes by RT-qPCR (Figure 11D).

[0060] In parallel, the cytotoxicity of ER15 was evaluated under mock-infected conditions with the same treatment conditions. The virus inoculation volume was replaced with OptiMEM medium. Samples were taken daily in the basal medium to quantify the release of lactate dehydrogenase (LDH, released in the case of cytotoxicity). The results, shown in Figure 11B, indicate that the ER15 compound is not cytotoxic in epithelia up to at least 50 μM. Furthermore, ER15 at 50 μM significantly reduces infectious viral load in epithelia (FIGS. 11C and 11D). Phosphate and citrate buffers appear to enable greater efficacy of ER15 at 20 μM compared to the solvent water. These results are confirmed by RT-qPCR, as shown in Figure 11 D. TEER measurements are also consistent with the overall results.

[0061] Example 11 Therapeutic characteristics of ER61 versus polylysine alone (PL) against the A / California / 7 / 09 H1N1 strain The potential therapeutic effect of the ER61 compound is assayed three times post-infection treatment: at D0 (1 hour post-infection), D1, and D2. A / California / 7 / 09 H1N1 virus is incubated on A549 cells at a multiplicity of infection of 0.1 or 0.01 for 1 hour at 37°C and then removed. The experimental conditions are the same as for Example 9(A), except that the ER61 compound is used. ER61 is tested at five different concentrations (20 μM, 10 μM, 5 μM, 2.5 μM, and 1.25 μM) against untreated conditions (NT: no treatment, and PL: delivery of increasing amounts of polylysine). For virus quantification, several samples of cell supernatant are taken at three different time points. The obtained results, shown in Figure 12, indicate that ER61 treatment administered at 1, 24, and 48 hours post-infection provides a maximum 5-log reduction in A / California / 7 / 09 H1N1 titers. When the virus inoculum is at an MOI of 0.1, a dose-dependent effect is observed depending on the treatment concentration. At an MOI of 0.01, all tested ER61 concentrations (20 μM, 10 μM, 5 μM, 2.5 μM, and 1.25 μM) allow maximum viral load reduction as early as 24 hpi.

[0062] Example 12 Therapeutic properties of ER15 and ER61 compounds against recent strains The "recent" strains being tested and included in the vaccine composition are: A / Michigan / 45 / 2015 H1N1; A / Kansas / 14 / 2017 H3N2; and B / Phuket / 3073 / 2013. The potential therapeutic effects of the ER15 and ER61 compounds are assayed for three post-infection treatments (at D0 (1 hour post-infection), D1, and D2). Virus is incubated on A549 cells at a multiplicity of infection of 0.1 for 1 hour at 37°C and then removed.

[0063] The multivalent sialosides ER15 and ER61 are tested at three different concentrations (20 μM, 5 μM, and 1.25 μM) against the untreated condition (NT). For virus quantification, several samples of cell supernatant are taken at three different time points (24, 48, and 72 hours post-infection). The results obtained, shown in Figures 13A, 13B, and 13C, demonstrate the equivalence of ER15 and ER61 treatments administered at 1, 24, and 48 hours post-infection. A dose-dependent effect is observed, depending on the treatment concentration. At a concentration of 20 μM, both compounds ER15 and ER61 exhibit significant antiviral effects against the three virus strains.

[0064] Example 13 Therapeutic efficacy of ER15 compound against recombinant oseltamivir- and baloxavir-resistant H1N1 viruses Three recombinant H1N1 viruses were generated by reverse genetics using the A / Lyon / 969 / 09 H1N1 genetic backbone harboring either the H275Y mutation in neuraminidase (conferring resistance to oseltamivir), the I38T mutation in the polymerase PA subunit (conferring resistance to baloxavir), or both (H275Y + I38T). The potential therapeutic effect of the ER15 compound was assayed for three post-infection treatments (at D0 (1 hour post-infection), D1, and D2). The recombinant resistant H1N1 viruses were incubated on A549 cells at a multiplicity of infection of 0.1 for 1 hour at 37°C and then removed by washing. The experimental conditions were the same as for Example 9(A), except that the virus used was the same. ER15 is tested at five different concentrations (20 μM, 10 μM, 5 μM, 2.5 μM, and 1.25 μM) against untreated conditions (NT: no treatment, and PL: delivery of increasing amounts of polylysine). For virus quantification, several samples of cell supernatant are taken at three different time points.

[0065] The results, shown in Figure 14A, indicate that ER15 treatment administered at 1, 24, and 48 hours post-infection resulted in a maximum 2-log reduction in H1N1 I38T titers. A dose-dependent effect was observed, depending on the treatment concentration. Similar results were obtained with H1N1 H275Y and dual-resistant H1N1 (I28T+H275Y) viruses, as shown in Figures 14B and 14C, respectively. References TIFF0007825628000005.tif206165 TIFF0007825628000006.tif169168

Claims

1. A synthetic sialoside having the formula (I): Neu5Ac-α2-6-R1(R2)[GlcNAcβ1-4] n -GlcNAc Formula (I) (In the formula, GlcNAc is N-acetylglucosamine; GlcNAcβ1-4 is an N-acetylglucosamine unit linked by a β1-4 bond; n is 1 to 8; R1 is a glycan structure containing at least one galactose (Gal), wherein at least one galactose is linked at one of the ends of the main chain; and R2 is selected from the group consisting of H, α1-3 linked fucose (Fucα1-3), or α1-4 linked fucose (Fucα1-4).

2. 2. The synthetic sialoside of claim 1, wherein R1 is a glycan structure having a backbone containing at most five monosaccharides.

3. 3. The synthetic sialoside of claim 2, wherein R1 is a glycan structure having a backbone containing one, two, or three monosaccharides.

4. The synthetic sialoside of any one of claims 1 to 3, wherein R1 is selected from the group: Galβ1-4, Galβ1-3, Galβ1-4GlcNAcβ1-3Galβ1-4, and Galβ1-4(Fucα1-3)GlcNAcβ1-3Galβ1-4.

5. The synthetic sialoside of any one of claims 1 to 4, wherein R2 is H.

6. 6. The synthetic sialoside of any one of claims 1 to 5, which has the following formula (II): Formula (II): Neu5Acα2-6Galβ1-4GlcNAcβ1-4GlcNAcβ1-4GlcNAcβ1-4GlcNAcβ1-4GlcNAc

7. A polyvalent sialoside comprising a support having a plurality of synthetic sialosides according to any one of claims 1 to 6.

8. 8. The polyvalent sialoside of claim 7, wherein the support comprises a liposome, a dendrimer, a polymer, or a nanoparticle.

9. The polyvalent sialoside of claim 7 or 8, wherein the support comprises polylysine (ε-poly-L-lysine).

10. The polyvalent sialoside according to any one of claims 7 to 9, wherein the grafting rate of sialoside on the support is comprised between 20% and 100%.

11. A pharmaceutical composition comprising at least one polyvalent sialoside according to any one of claims 7 to 10 in a pharmaceutically acceptable medium.

12. 12. The pharmaceutical composition of claim 11 in a form suitable for administration by inhalation.

13. A medical device comprising at least one polyvalent sialoside according to any one of claims 7 to 10.

14. A polyvalent sialoside according to any one of claims 7 to 10 or a pharmaceutical composition according to claim 11 or 12 for use as a medicament.

15. A polyvalent sialoside according to any one of claims 7 to 10 or a pharmaceutical composition according to claim 11 or 12 for use in the prevention and / or treatment of infection by viruses having affinity for sialic acid.

16. 16. The multivalent sialoside or pharmaceutical composition for use according to claim 15, wherein the virus is an influenza virus.

17. The multivalent sialoside or pharmaceutical composition for use according to claim 16, wherein the influenza virus is a human, equine, swine, or avian influenza virus.

18. 17. The multivalent sialoside or pharmaceutical composition for use according to claim 16, wherein the influenza virus is a human influenza virus and is selected from among strains H1N1, H3N2, and B.