Recombinant acid-resistant yeast with suppressed glycerol production and method for producing lactic acid using the same

A recombinant acid-resistant yeast strain with suppressed glycerol production and enhanced lactic acid yield addresses the high costs and impurity issues in existing yeast-based lactic acid production processes, achieving cost-effective and efficient lactic acid production.

JP7829285B2Active Publication Date: 2026-03-13SK INNOVATION CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2021-04-15
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

Existing lactic acid production processes using yeast are hindered by high production costs due to the need for neutralizing agents to maintain pH, generation of neutralizing salts, and the challenge of suppressing glycerol production, which affects the yield and purity of lactic acid.

Method used

A recombinant acid-resistant yeast strain is developed by deleting genes related to glycerol production (GPD1, GPD2, GPP1, GPP2) and introducing a lactate dehydrogenase gene, reducing glycerol production while maintaining lactic acid production.

Benefits of technology

The recombinant yeast strain significantly decreases glycerol production, enhances lactic acid yield, and simplifies the fermentation process, thereby reducing production costs and improving the purity of lactic acid.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007829285000004
    Figure 0007829285000004
  • Figure 0007829285000005
    Figure 0007829285000005
  • Figure 0007829285000001
    Figure 0007829285000001
Patent Text Reader

Abstract

To provide a recombinant acid-resistant yeast with lactic acid-producing ability and suppressed glycerol production and a method of producing lactic acid using the same.SOLUTION: There is provided a recombinant strain having lactic acid-producing ability, in which a gene encoding an enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate is deleted or attenuated from an acid-resistant yeast YBC strain (KCTC13508BP) and in which a gene encoding lactate dehydrogenase is introduced into the acid-resistant yeast YBC strain. Also provided is a method of preparing lactic acid using the recombinant strain.SELECTED DRAWING: Figure 2
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a recombinant acid-tolerant yeast having the ability to produce lactic acid and suppressing glycerol production, and a method for producing lactic acid using the same. More specifically, the present invention relates to a recombinant acid-tolerant yeast into which a gene involved in lactic acid production is introduced and a gene involved in glycerol production is deleted or attenuated, and a method for producing lactic acid using the same.

Background Art

[0002] PLA (Polylactic Acid) is a biodegradable polymer produced by converting lactic acid into lactide and subjecting the latter to ring-opening polymerization. The raw material lactic acid is produced by lactic acid fermentation. PLA can be widely used for disposable food containers, and has sufficient strength to be used as various industrial plastics, including those for the automotive and textile industries, either alone or in the form of compositions or copolymers. More recently, it has also become a typical polymer used in 3D printing, and is particularly environmentally friendly in that it generates little harmful gas and odor when used in 3D printers.

[0003] Traditional lactic acid production processes use lactic acid bacteria. To prevent cell death or growth arrest due to acid caused by the accumulation of lactic acid produced by lactic acid bacteria, fermentation is carried out while adjusting the pH to 6 - 8, a neutral pH, using various forms of neutralizing agents such as Ca salts / Mg salts or ammonia. When fermentation is complete, the microorganisms are separated. However, since separation with water and conversion to lactide are difficult in the salt form, sulfuric acid is added to convert lactate to lactic acid while removing the Ca salt in the form of CaSO4. Such a process generates CaSO4, a by-product in an amount greater than that of lactic acid, leading to a decrease in process economy.

[0004] The typical process for PLA involves producing lactic acid through fermentation, followed by a purification process to convert the produced lactic acid into lactide. This lactide conversion requires a step to convert lactic acid into a hydrogenated form. Since the pH for normal neutral fermentation is 6-7, a large amount of sulfuric acid is used to convert the pH to acidic. This process generates a large amount of neutralizing salt, and the cost of removing this salt, along with the low value of the neutralizing salt itself, reduces the economic viability of the process.

[0005] On the other hand, lactic acid has L-type and D-type optical isomers. Even lactic acid bacteria that mainly produce L-type often produce about 5-10% D-type as well, and strains that mainly produce D-type exist in forms that produce both D-type and L-type, as well as forms that produce both D-type and ethanol, demonstrating the great diversity of microbial groups (Non-Patent Literature 1).

[0006] On the other hand, Lactobacillus, which naturally produces lactic acid ( Lactobacillus In the case of lactic acid, producing lactic acid at a commercial level requires the use of large amounts of expensive nutrients in the culture medium. Such excess nutrients significantly inhibit the subsequent polymerization process or, if lactide is used as an intermediate, the lactide conversion process. Obtaining high yields and high purity polymers or their precursors incurs purification costs such as adsorption, distillation, and ion exchange, which also contribute to high production costs. As a method to solve these problems, research using yeast has been proposed. Yeast is known to grow / ferment smoothly even with inexpensive nutrients and is also known to have high tolerance to acidity.

[0007] When producing lactic acid using yeast that thrives in acidic conditions (hereinafter referred to as acid-tolerant yeast), it is not necessary to maintain the culture medium's pH at 6-7 using a neutralizing agent during fermentation. This simplifies the fermentation process and eliminates the need for a subsequent purification step to remove the neutralizing agent. Furthermore, because yeast produces many of the components necessary for metabolism, it can be cultured in culture media with relatively lower nutrient levels compared to bacteria, especially Lactobacillus. This eliminates many subsequent purification steps, significantly reducing production costs.

[0008] However, there are prerequisites for lactic acid production technology using yeast, namely that in order to be applied to commercialization, the yield, productivity, and lactic acid concentration, which are indicators of strain fermentation performance, must be maintained at a high level similar to that of lactic acid bacteria.

[0009] Attempts have been made to develop acid-resistant lactic acid technology using yeast. However, in reality, high-performance fermentation is often only achieved by utilizing neutralization reactions during fermentation to maintain the pH at 3.7 or higher, which is above the pKa value of lactic acid. Therefore, it is difficult to call this technology acid-resistant in practice, and it is also difficult to obtain the effect of reducing production costs in the process (Non-Patent Literature 2).

[0010] Therefore, acid-tolerant yeast, which can reduce processing costs, requires that fermentation be completed in a fermentation solution with a pH below the pKa value, either without using neutralizing agents or using only minimal amounts. Commercial application is only meaningful if the three key indicators of fermentation are brought to a level similar to that of lactic acid bacteria.

[0011] Ordinary yeasts primarily produce ethanol when fermenting glucose, with glycerol as the main byproduct, and very rarely produce lactic acid. Furthermore, the probability of selecting a lactic acid-producing strain from microorganisms with high acid resistance is very low. Therefore, the inventors attempted to select yeast strains with excellent acid resistance and, using genetic engineering methods, produce strains that possess lactic acid production ability while suppressing the production of ethanol and glycerol.

[0012] Therefore, the present inventors made diligent efforts to produce an acid-resistant bacterial strain that possesses lactic acid production ability while suppressing glycerol production ability. As a result, they created a recombinant bacterial strain by removing the gene involved in glycerol production from acid-resistant yeast and further introducing the gene encoding lactate dehydrogenase. When lactic acid is produced using this recombinant bacterial strain, it was confirmed that the production of glycerol, which acts as an impurity in lactic acid production using recombinant yeast, is reduced, thus completing the present invention. [Prior art documents] [Non-patent literature]

[0013] [Non-Patent Document 1] Ellen I. Garvie,Microbiological Reviews,106-139,1980 [Non-Patent Document 2] Michael Sauer et al.,Biotechnology and Genetic Engineering Reviews,27:229-256,2010 [Overview of the project] [Problems that the invention aims to solve]

[0014] The object of the present invention is to provide a recombinant acid-resistant yeast strain having reduced glycerol production ability in addition to lactic acid production ability.

[0015] Another object of the present invention is to provide a method for producing lactic acid using the recombinant acid-resistant yeast.

[0016] Another object of the present invention is to provide a gene encoding an enzyme that converts dihydroxyacetone phosphate derived from the acid-resistant yeast to glycerol-3-phosphate. [Means for solving the problem]

[0017] To achieve the above objective, the present invention provides a recombinant strain of acid-resistant yeast YBC strain (KCTC13508BP) in which the gene encoding an enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate is deleted or weakened, and a gene encoding lactate dehydrogenase is introduced, thereby providing a strain with lactic acid production ability.

[0018] The present invention also provides a recombinant yeast strain with lactic acid production ability, in which the acid-resistant yeast YBC strain (KCTC13508BP) lacks the GPD1 gene, which encodes an enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate; the CYB2 gene, which encodes an enzyme that converts lactate to pirubate; the ADH gene, which encodes alcohol dehydrogenase; and the PDC gene, which encodes pirubate decarboxylase, and has been introduced with a gene encoding lactate dehydrogenase.

[0019] The present invention also provides a method for producing lactic acid, comprising the steps of (a) culturing the recombinant bacterial strain to produce lactic acid; and (b) obtaining the produced lactic acid.

[0020] The present invention also provides a gene that encodes a protein having enzymatic activity to convert dihydroxyacetone phosphate to glycerol-3-phosphate and having more than 90% homology to the protein represented by the amino acid sequence of SEQ ID NO: 3.

[0021] The present invention also provides a protein having enzymatic activity to convert dihydroxyacetone phosphate to glycerol-3-phosphate and exhibiting more than 90% homology to the protein represented by the amino acid sequence of SEQ ID NO: 3.

[0022] The present invention also provides a promoter for the g1544 gene having the nucleotide sequence represented by SEQ ID NO: 4 or SEQ ID NO: 5. [Effects of the Invention]

[0023] When producing lactic acid using the recombinant acid-tolerant yeast according to the present invention, while maintaining the lactic acid-producing ability, glycerol production decreases. Therefore, in the oligomerization reaction for lactide conversion during the lactic acid purification process, crosslinking by glycerol can be suppressed, and the conversion yield of lactic acid to lactide can be increased.

Brief Description of the Drawings

[0024]

Figure 1

Figure 2

Modes for Carrying Out the Invention

[0025] Unless otherwise specified, all technical and scientific terms used in this specification have the same meaning as commonly understood by those skilled in the technical field to which the present invention pertains. Generally, the nomenclature used in this specification is well-known and commonly used in this technical field.

[0026] Acid-tolerant yeast rapidly consumes sugar even at acidic pH levels, exhibiting a high growth rate, and under fermentation conditions, it converts consumed sugar into products. In our prior research, we selected the acid-tolerant yeast strain YBC (KCTC13508BP) from a large yeast library as a yeast possessing these characteristics. The acid-tolerant yeast strain YBC (KCTC13508BP) exhibits high growth and sugar consumption rate even under lactic acid concentrations of 40 g / L to 80 g / L. By modifying the metabolic pathway to increase lactic acid production and decrease ethanol production in the aforementioned acid-resistant yeast strain YBC, recombinant strains were created by deleting the genes encoding alcohol dehydrogenase and pyruvate decarboxylase from the YBC strain, and by deleting the gene encoding cytochrome b2 enzyme, which converts lactate to pyruvate, from the strain into which the lactate dehydrogenase gene had been introduced. In order to suppress glycerol production in the created recombinant strain, a recombinant strain was created in which the gene encoding glycerol 3-phosphate dehydrogenase enzyme, which converts dihydroxyacetone phosphate to glycerol 3-phosphate, was deleted. It was confirmed that this recombinant strain has high lactic acid production capacity, as well as suppressed ethanol and glycerol production capacity.

[0027] Furthermore, while the excess carbon from the reduced glycerol may be dispersed into other byproducts, there is also the potential to further increase the lactic acid production yield if it can be converted to lactic acid (e.g., through enhancement of lactate dehydrogenase).

[0028] Therefore, in one aspect, the present invention relates to a recombinant strain of acid-resistant yeast YBC strain (KCTC13508BP) in which the gene encoding an enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate is deleted or weakened, and a gene encoding lactate dehydrogenase is introduced, thereby having lactic acid production ability.

[0029] In general, glycerol is a major byproduct of yeast. Its role within cells is to regulate the redox balance by adjusting the NAD / NADH balance inside the cell, which is generated during the production of ethanol and lactate. It also plays a role in suppressing intracellular water loss due to osmotic pressure that occurs when the extracellular water activity decreases. Furthermore, it acts as a precursor to glycerol-3 phosphate, which is a precursor to triglycerides, the main energy storage (Roeland Costenoble et al., Yeast 16:1483-1495, 2000; Elke Nevoigt and Ulf Stahl, FEMS Microbiology Reviews 21:231, 1997).

[0030] In yeast, methods for suppressing glycerol production include removing or weakening genes directly related to glycerol production, and modifying genes related to regulatory mechanisms such as osmotic pressure. Regarding regulatory mechanisms such as osmotic pressure, there is the HOG (High-osmolarity glycerol) signaling pathway (Joseph P Dexter et al., BMC Systems Biology, 9:17, 2015), and methods to suppress glycerol production by removing or modifying key related factors such as SSK1 (Cytoplasmic phosphorelay intermediate osmosensor and regulator) have also been studied (Hubmann et al., Biotechnology for Biofuels, 6:87, 2013, Hubmann et al., Metabolic Engineering, 17:68, 2013).

[0031] However, research into regulating such signaling pathways through mutation requires a great deal of study, and in special strains like the acid-resistant yeast YBC strain (KCTC13508BP), verification of each step is necessary. Therefore, a more general method was used: removing the genes GPD (NAD-dependent glycerol-3-phosphate dehydrogenase) and GPP (DL-glycerol-3-phosphate phosphatase), which are directly related to glycerol production. GPD1 is primarily responsible for regulating the osmotic resistance of yeast, and GPD2 is an isoform of GPD1. S.cerevisiae It is expressed to regulate cellular activity under anaerobic conditions. Furthermore, the GPP gene, which converts glycerol-3-phosphate to glycerol, S.cerevisiae Although two isomers are well known, GPP1 is expressed under anaerobic conditions, while GPP2 is expressed under osmotic pressure. When removing each isomer of GPD and GPP, the effect on glycerol production differs depending on the culture conditions and the relevant bacterial strain (Roeland Costenoble et al., Yeast 16:1483, 2000; Jacobus albertyn et al., Molecular and Cellular Biology, 4135, 1994). Therefore, it was determined that the best method is to confirm the effect of each isomer through experiments.

[0032] In the present invention, the gene encoding the enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate is characterized by being the GPD1 or GPD2 gene, preferably the GPD1(g1544) gene, and the gene may be represented by the base sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

[0033] In one embodiment of the present invention, recombinant strain YBC2 was created by removing the g4423 gene, which is the main ADH gene, from the YBC strain, introducing the LDH gene of Sequence ID No. 12 derived from Lactobacillus plantarum at the g4423 position, removing the g3002 gene (hereinafter referred to as the g3002-1 gene), which is the CYB2 gene, and introducing the LDH gene at the position of the g3002-1 gene. Recombinant strain YBC4 was created by further removing the g2947 gene while introducing the LDH gene in recombinant strain YBC2. Recombinant strain YBC5 was created by removing the g1544 gene, which is the GPD1 gene. These recombinant strains were cultured, and it was confirmed that lactic acid production ability was improved, ethanol production ability was decreased, and glycerol production was decreased.

[0034] In the present invention, the recombinant bacterial strain is characterized by further deletion of the gene encoding alcohol dehydrogenase (ADH gene), wherein the gene encoding alcohol dehydrogenase is the g4423 gene, and the g4423 gene may be represented by Sequence ID No. 6 or Sequence ID No. 7.

[0035] In the present invention, the recombinant bacterial strain may be characterized in that an LDH gene is further introduced in place of the ADH gene.

[0036] In the present invention, the recombinant bacterial strain is characterized by further deletion of the gene encoding pyrubate decarboxylase (PDC gene), wherein the gene encoding pyrubate decarboxylase is the g3002 gene, and the g3002 gene may be represented by Sequence ID No. 8 or Sequence ID No. 9.

[0037] In the present invention, the recombinant bacterial strain may be characterized in that the LDH gene is further introduced in place of the PDC gene.

[0038] In the present invention, the recombinant bacterial strain is characterized by further deletion of the cytochrome b2 gene (CYB2 gene) that converts lactate to pirubate, the gene encoding the cytochrome b2 gene is the g2947 gene, and the g2947 gene may be represented by Sequence ID No. 10 or Sequence ID No. 11.

[0039] In the present invention, the recombinant bacterial strain may be characterized in that the LDH gene is further introduced in place of the CYB2 gene.

[0040] In the present invention, the recombinant strain may further have the LDH gene introduced in place of the GPD1 gene.

[0041] In the present invention, deletion or weakening of the g1544 gene may result in a reduction or blockage of glycerol production ability compared to the parent strain YBC (KCTC13508BP) and compared to mutant strains YBC1 / YBC2 / YBC3 / YBC4 derived from the parent strain.

[0042] In the present invention, the gene encoding the lactate dehydrogenase introduced is L.helveticus Derived LDH gene, R.oryzae Derived LDH gene or L.plantarum Preferably, it is the derived LDH gene, more preferably L.plantarum It is the LDH gene of origin.

[0043] In other aspects, the present invention relates to a recombinant strain of acid-resistant yeast YBC strain (KCTC13508BP) in which the GPD1 gene, which encodes an enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate, the CYB2 gene, which encodes an enzyme that converts lactate to pirubate, the ADH gene, which encodes alcohol dehydrogenase, and the PDC gene, which encodes pirubate decarboxylase, are deleted, and a gene encoding lactate dehydrogenase is introduced, thereby possessing lactic acid production ability.

[0044] In the present invention, the gene encoding lactate dehydrogenase may be characterized by being introduced into one or more gene sites of the deleted CYB2 gene, ADH gene, PDC gene, and GPD1 gene, and being regulated by the promoter of the deleted gene.

[0045] In one embodiment of the present invention, it was confirmed that the YBC5 strain (Δg4423::ldh / Δg3002-1::ldh / Δg2947::ldh / Δg1544) showed a significant decrease in glycerol production capacity compared to the YBC4 strain (Δg4423::ldh / Δg3002-1::ldh / Δg2947::ldh). However, although glycerol was not completely removed, this is actually a significant advantage in terms of the strain's environmental adaptability. That is, a strain that has completely lost its glycerol production capacity loses its ability to adapt to stressful environments such as external osmotic pressure, which is the original role of glycerol, and becomes very weak. Such a strain cannot withstand the stressful environments of normal commercial scale pressure, salt concentration, and product inhibition, and normal fermentation cannot be carried out. Therefore, the strain of this invention achieved the desired reduction of glycerol while exhibiting excellent performance without any adverse effects.

[0046] Therefore, in other respects, the present invention relates to a method for producing lactic acid, comprising the steps of (a) culturing the recombinant bacterial strain to produce lactic acid; and (b) obtaining the produced lactic acid.

[0047] According to the present invention, it is possible to secure an excellent acid-resistant bacterial strain that significantly increases lactate production, significantly decreases ethanol production, and also significantly reduces glycerol by-products.

[0048] In another aspect, the present invention relates to a gene encoding a protein that has enzymatic activity to convert hydroxyacetone phosphate to glycerol-3-phosphate and has 90% or more homology to the protein represented by the amino acid sequence of SEQ ID NO: 3.

[0049] In the present invention, the gene may be characterized by having enzymatic activity to convert hydroxyacetone phosphate to glycerol-3-phosphate and encoding a protein that has 90% or more, preferably 95% or more, more preferably 98% or more, and even more preferably 99% or more homology to the protein represented by the amino acid sequence of SEQ ID NO: 3.

[0050] In the present invention, the gene may be characterized by being represented by the base sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

[0051] In another aspect, the present invention relates to a protein having enzymatic activity that converts dihydroxyacetone phosphate to an enzyme that converts glycerol-3-phosphate, and having 90% or more homology to the protein represented by the amino acid sequence of SEQ ID NO: 3.

[0052] In the present invention, the protein may be characterized by having enzymatic activity to convert hydroxyacetone phosphate to glycerol-3-phosphate and having 90% or more, preferably 95% or more, more preferably 98% or more, homology to the protein represented by the amino acid sequence of SEQ ID NO: 3.

[0053] In another respect, the present invention relates to a promoter of the GPD1 gene having the nucleotide sequence represented by SEQ ID NO: 4 or SEQ ID NO: 5.

[0054] In the present invention, 'acid-tolerant yeast' is defined as yeast that can maintain a biomass depletion rate (such as sugar depletion rate) or a non-growth rate of at least 10% when the culture medium contains 1M or more of organic acid (especially lactic acid) at a pH below the pKa value of an organic acid, compared to when the culture medium does not contain any organic acid. More specifically, in the present invention, 'acid-tolerant yeast' is defined as yeast that can maintain a biomass depletion rate (such as sugar depletion rate) or a non-growth rate of at least 10% at a pH of 2 to 4, compared to when the pH is 5 or higher.

[0055] Recombinant yeast according to the present invention can be produced by inserting the gene into the chromosome of a host yeast by a conventional method, or by introducing a vector containing the gene into the host yeast.

[0056] The host yeast typically used is a host cell with high DNA introduction efficiency and high expression efficiency of the introduced DNA. In one embodiment of the present invention, acid-resistant yeast is used, but the invention is not limited to this; any type of yeast that sufficiently expresses the target DNA is acceptable.

[0057] The recombinant yeast can be produced by any transformation method. "Transformation" refers to the process of introducing DNA into a host organism, making the DNA replicable as a chromosomal component or through the completion of chromosome integration. It is a phenomenon in which genetic changes are artificially induced by introducing external DNA into cells, and common transformation methods include electroporation and lithium acetate-PEG.

[0058] Furthermore, in the present invention, any commonly known genetic engineering method can be used to insert a gene onto the chromosome of a host microorganism, for example, by using retroviral vectors, adenovirus vectors, adeno-associated virus vectors, herpes simplex virus vectors, poxvirus vectors, lentiviral vectors, nonviral vectors, etc. A “vector” means a DNA product containing a DNA sequence operably linked to a suitable regulatory sequence that can express DNA in a suitable host. A vector can be a plasmid, a phage particle, or simply a potential genomic insert. Once transformed into a suitable host, the vector may replicate and function independently of the host genome, or in some cases, it may be integrated into the genome itself. Currently, plasmids are the most commonly used form of vector, and linearized DNA is also a commonly used form for yeast genome integration.

[0059] A typical plasmid vector has a structure that includes (a) a replication origin that allows for efficient replication to ensure that each host cell contains the plasmid vector, (b) an antibiotic resistance gene or auxotrophic marker gene that allows for the selection of host cells transformed with the plasmid vector, and (c) restriction enzyme cleavage sites that allow for the insertion of foreign DNA sections. Even if suitable restriction enzyme cleavage sites are not present, the vector and foreign DNA can be easily ligated (Gibson assembly) using conventionally synthesized oligonucleotide adapters or linkers, and if necessary, methods for synthesizing and using the desired complete sequence are also commonly employed.

[0060] Furthermore, the aforementioned gene is "operably linked" when it is positioned in a functional relationship with other nucleic acid sequences. This can be a gene and regulatory sequence linked in a way that enables gene expression when an appropriate molecule (e.g., a transcription-activating protein) is bound to the regulatory sequence. For example, DNA for a pre-sequence or secretory leader is operably linked to DNA for a polypeptide when expressed as a pre-protein participating in polypeptide secretion; a promoter or enhancer is operably linked to a coding sequence when it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence when it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence when it is positioned to facilitate translation.

[0061] Generally, "operably linked" means that the linked DNA sequences are in contact and, in the case of secretory readers, are in contact and located within the reading frame. However, enhancers do not need to be in contact. Linking of these sequences is performed by ligation at convenient restriction enzyme sites. If such sites are not available, synthetic oligonucleotide adapters or linkers are used by conventional methods.

[0062] Of course, not all vectors function equally well in expressing the DNA sequence of the present invention, and similarly, not all hosts function identically for the same expression system. However, those skilled in the art can appropriately select and apply from a variety of other vectors, regulatory sequences, and hosts without imposing an excessive experimental burden and without departing from the scope of the present invention. For example, when selecting a vector, the host must be considered because the vector must be replicated within that host, and the number of copies of the vector, the ability to regulate the number of copies, and the expression of other proteins encoded by the vector, such as antibiotic markers, must also be considered.

[0063] In the present invention, the carbon source may be one or more selected from the group consisting of glucose, xylose, arabinose, sucrose, fructose, cellulose, galactose, glucose oligomers, and glycerol, but is not limited thereto.

[0064] In the present invention, cultivation may be carried out under conditions that prevent microorganisms, such as E. coli, from functioning further (e.g., making metabolite production impossible). For example, cultivation may be characterized by a pH of 1.0 to 6.5, preferably 1.0 to 6.0, and more preferably 2.6 to 4.0, but is not limited thereto. [Examples]

[0065] The present invention will be described in more detail below with reference to examples. It will be obvious to those with ordinary skill in the art that these examples are merely illustrative and should not be construed as limiting the scope of the present invention.

[0066] Example 1: Analysis of glycerol-producing genes in the genome of acid-resistant yeast strain YBC The inventors have previously selected acid-resistant yeast strains through testing on various yeast strains, and while adding lactic acid to the culture medium in the early stages of culture and observing the growth of microorganisms and the rate of sugar consumption, they selected the YBC strain, which has the best acid resistance, and deposited it with the Korea Biotechnology Research Institute's Bioresource Center as KCTC13508BP.

[0067] From phylogenetic analysis, the YBC strain (KCTC13508BP) is S.cerevisiae We confirmed that this strain is similar to the previous one, possesses diploid genes, and exhibits crab-tree positive characteristics.

[0068] From the complete genome sequence data of the YBC strain, S.cerevisiae Furthermore, using bioinformatics information, we identified g1544 as the gene annotated with GPD1 (glycerol-3-phosphate dehydrogenase 1), which encodes an enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate, and g5617 as the gene annotated with GPD2, both present in the genome of the YBC strain. Regarding the GPP gene, which encodes an enzyme that converts glycerol-3-phosphate to glycerol, we identified two genes with very similar homology in the genome of the YBC strain, g4356 and g5443. Based on the current information, it is difficult to distinguish the roles of these two genes as GPP1 and GPP2, so we named them GPP1 v.1 and GPP1 v.2 and used them accordingly.

[0069] Table 1 shows YBC and Saccharomyces cerevisiae (Saccharomyces cerevisiae This section compares and shows the similarities between the amino acid sequences of GPD1 and GPD2.

[0070] [Table 1]

[0071] Therefore, we created deletion cassettes that can remove the GPD1 gene (g1544 gene) (sequence number 1 and sequence number 2) and its protein (sequence number 3), and deletion cassettes that can remove the GPD2 gene (g5617 gene) (sequence number 13 and sequence number 14) and its protein (sequence number 15). We also created deletion cassettes that can remove the GPP1 gene (v.1;g4356 gene) (sequence number 16 and sequence number 17), the GPP1 gene (v.2;g5443 gene) (sequence number 19 and sequence number 20) and their respective proteins (sequence number 18 and sequence number 21).

[0072] The deletion cassette used in this invention is shown in Figure 1. The selection of the relevant restriction enzyme site or antibiotic resistance gene and the method for removing the antibiotic resistance gene are well-known methods in the relevant industry and can be modified in various ways.

[0073] It is a well-known fact that when the genes that produce glycerol, GPD1 and GPD2, or GPP1 and GPP2, are removed simultaneously, the functions that enable the bacterial strain to grow and adapt to the external environment are completely blocked, and the strain becomes highly sensitive to changes in osmotic pressure, making it unsuitable for fermentation. Therefore, if the reduction of glycerol is insufficient after removing GPD1 or GPD2, a strategy was established to further reduce glycerol by removing GPP1 v1 or GPP1 v2 from the respective GPD1 / 2 removed strains.

[0074] Example 2: Measurement of GPD gene expression level To confirm the expression levels of GPD1 (g1544) and GPD2 (g5617) in the YBC strain, RT-qPCR was performed on the ALG9 gene as the housekeeping gene using the following primers. In the RT-qPCR method used in this example, RNA was extracted during the algebraic growth phase of the YBC strain, and this was used as a template to produce cDNA. Primers specific to the target genes (GPD1 and GPD2) and the housekeeping gene (used as the Ref gene) were synthesized, and qPCR was performed using these primers. The Ref gene used in the experiment was ALG9, and the size of the fragment amplified by the primers used was 1473 bp.

[0075] ALG9 forward primer: CTTTGAGTGCAAGTATCGCC (SEQ ID NO: 22) ALG9 reverse primer: TTGTGTAATTGTTCACCAAAGCC (SEQ ID NO: 23) GPD1 (g1544) forward primer: GTCGATTCTCATGTTCGTGC (SEQ ID NO: 24) GPD1 reverse primer: CTTAGCGACTTCAGTAGCGA (SEQ ID NO: 25) GPD2 (g5617) forward primer: CATGTATCGAATCAAGTTCGTG (SEQ ID NO: 26) GPD2 reverse primer: CAACTTCTGGTGCTAAATTTGC (SEQ ID NO: 27)

[0076] In the YBC strain, when examining the expression levels of the aforementioned genes, GPD1 showed an expression rate approximately 20 times higher than ALG9 after 14 hours of culture, and approximately 70 times higher after 23 hours of culture. GPD2, on the other hand, showed a very low expression rate, similar to that of ALG9.

[0077] Based on these results, we tentatively concluded that GPD1 plays the main role as the enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate in the YBC strain. However, to confirm the actual role, we created strains in which each gene was removed.

[0078] Example 3: Preparation of recombinant acid-resistant yeast strains with the GPD gene removed. Strains were created by removing the g1544, g5617, g5443, and g4356 genes, which were annotated with the GPD1, GPD2, GPP1 v1, and GPP1 v2 genes, from the genome of the YBC strain.

[0079] The acid-resistant yeast strains used to remove the aforementioned genes were not wild-type YBC strains, but rather YBC1 strains, which were created by removing the ADH (alcohol dehydrogenase) gene from an existing YBC strain while introducing the LDH gene; YBC2 strains, which further expressed LDH while removing the g3002-1 gene (PDC gene), resulting in a strain that produces lactic acid with high efficiency while blocking ethanol production; and YBC4 strains, which removed the g2947 gene, a gene that consumes lactate, while introducing the LDH gene to eliminate lactic acid consumption.

[0080] YBC5 was created by removing the GPD1(g1544) gene from the aforementioned YBC4 strain (a diploid strain, with both allele 1 and allele 2 removed). To confirm the genotype of this strain, primers were prepared as shown in Table 1 below, and then confirmed from the genomic DNA of the strain. Simultaneously, a strain was created by removing the GPD2(g5617) gene from the YBC5 strain, and the glycerol production ability during fermentation was compared between the two strains.

[0081] The method for preparing the aforementioned strain is as follows: The aforementioned YBC1 strain was created by removing the g4423 gene, the main ADH gene of the YBC strain, and introducing the LDH gene of Lactobacillus plantarum, sequence number 12, at the g4423 position. Based on the information of g4423 and their UTRs, the ORF of each gene was removed to create a gene cassette containing the 5' and 3' UTRs, which was used as donor DNA. The 5' UTRs corresponding to each allele of g4423 are shown in sequence numbers 28 and 29, and the 3' UTRs are shown in sequence numbers 30 and 31. As mentioned above, restriction enzyme cloning, Gibson assembly, and gene synthesis methods were used to prepare the donor DNA. The LDH of sequence number 12 was synthesized and then introduced at the ORF position of g4423 to prepare donor DNA, which was then introduced into YBC to create recombinant strain YBC1.

[0082] The g3002-1 gene is located at scaffold 72 in the genome sequencing of the YBC strain and functions as a PDC gene. Recombinant strain YBC2 was created by removing the g3002-1 gene (located at scaffold 72) from the YBC1 strain and introducing the LDH gene of sequence number 12.

[0083] Cassettes for replacing the g3002 gene were prepared using the corresponding UTR as the recombination site. Similar to the method of introducing LDH at the position of the g4423 gene (ADH) in YBC1, they were prepared using the g3002-1 UTR. However, in this gene replacement, allele variation was not considered for simplicity, and a donor cassette was prepared targeting a single allele, although it is also possible to prepare them allele-specific. Furthermore, in addition to the primers used for creating the deletion strain described above, a separate primer pair that could confirm both the g3002-1 UTR and LDH was used for the primers used for gene replacement, as described below, to improve the accuracy of gene replacement confirmation.

[0084] g3002-1UTR-LDH-fwd:GCAGGATATCAGTTGTTTG(Sequence ID 32) g3002-1UTR-LDH-rev:AATACCTTGTTGAGCCATAG(Sequence ID 33)

[0085] Furthermore, the YBC4 strain was created by removing the g2947 gene, which is the CYB2 gene of the YBC2 strain, and introducing the LDH gene of Lactobacillus plantarum (SEQ ID NO: 13) at the g2947 position. The g2947 gene is located at scaffold position 41 in the genome sequencing of the YBC strain. Based on the information of g2947 and their UTRs, the ORFs of each gene were removed, and gene cassettes containing 5' and 3' UTRs were prepared and used as donor DNA. For each allele of g2947, the corresponding 5' UTR is shown in SEQ ID NOs: 34 and 35, and the 3' UTR is shown in SEQ ID NOs: 36 and 37. As mentioned above, restriction enzyme cloning, Gibson assembly, and gene synthesis methods were used to prepare the donor DNA.

[0086] However, in this gene substitution, for the sake of simplifying the process, we created a donor cassette targeting a single allele without considering allele changes, but it is also possible to create them separately for each allele.

[0087] The method for preparing the aforementioned strain is as follows: The aforementioned YBC5 strain is a strain obtained by removing the g1544 gene, which is the GPD1 gene of the YBC4 strain. The g1544 gene is located at scaffold 19 in the genome sequence analysis of the YBC strain. Based on the information of g1544 and their UTRs, the ORFs of each gene were removed, and gene cassettes containing 5' and 3' UTRs and antibiotic markers were prepared and used as donor DNA. For each allele of g1544, the corresponding 5' UTR is shown in SEQ ID NOs. 38 and 39, and the 3' UTR is shown in SEQ ID NOs. 40 and 41. As mentioned above, restriction enzyme cloning, Gibson assembly, and gene synthesis methods were used to prepare the donor DNA.

[0088] However, in the gene substitution in question, allele changes were not considered for the sake of simplicity, and a donor cassette was created targeting a single allele; however, it is also possible to create cassettes for each allele. Furthermore, antibiotic markers can also be created and applied in a form that does not utilize currently commercially available genetic engineering technology (CRISPR).

[0089] Furthermore, to improve the accuracy of gene replacement confirmation, separate primer pairs capable of confirming the genotypes of g1544 and g5617 (described in detail later) were used for genotype confirmation after gene substitution, as shown in Table 2 below.

[0090] [Table 2]

[0091] The genotypes of the recombinant strains prepared are as follows: YBC2:Δg4423::ldh / Δg3002-1::ldh YBC4:Δg4423::ldh / Δg3002-1::ldh / Δg2947::ldh YBC5:Δg4423::ldh / Δg3002-1::ldh / Δg2947::ldh / Δg1544 YBC5a:Δg4423::ldh / Δg3002-1::ldh / Δg2947::ldh / Δg5617

[0092] Example 4: Confirmation of inhibitory effects on lactic acid production and glycerol production in recombinant YBC strains lacking the GPD1 gene from YBC4 strain. For the recombinant strains YBC5 and YBC5a prepared in Example 3, the inoculation OD was 0.5, and the culture medium used was m-YP medium (5 g / L peptone, 4 g / L yeast extract, 5 g / L KH2PO4, 2 g / L MgSO4·7H2O, 0.15 g / L uracil) with 10% glucose added. The cultures were incubated in 500 ml flasks at 30°C and 150 rpm for 64 hours.

[0093] [Table 3]

[0094] As a result, as shown in Table 3, although the YBC5 strain showed an 80% suppression of glycerol production compared to the YBC4 strain, it still produced a small amount of glycerol. As mentioned above, glycerol plays a very important role in the environmental adaptability of microorganisms, especially their adaptability to osmotic pressure. Therefore, the glycerol reduction rate of the current YBC5 strain is very suitable because the complete suppression of glycerol production by simultaneously removing GPD1 and GPD2 or GPP1 and GPP2 makes the strain extremely sensitive to osmotic pressure, preventing normal growth and fermentation. However, in this strain, the reduction of glycerol does not directly and significantly affect the increase in lactic acid production, and some of the effect is dispersed into various other by-products. Therefore, it is necessary to apply measures that can increase the lactic acid fermentation yield in the future.

[0095] Glycerol can affect polymerization during the production of PLA, an environmentally friendly polymer. It has been reported that in the presence of glycerol, the structure of PLA changes from linear to a branched structure due to the glycerol structure (Wen Shen et al., R.Soc.open sci.5:180134, 2018). Such structural changes in PLA can affect its physical properties, including the formation of stereocomplex PLA created by van der Waals forces between optically isoplastic L-type and D-type PLA, and can also affect the production of lactic acid oligomers for conversion to lactide. In short, glycerol can act as an impurity in many subsequent processes. Of course, purification processes can reduce glycerol, but reducing glycerol using genetic engineering, as in this patent, is a fundamentally better solution for mitigating these problems in subsequent processes.

[0096] Compared to the YBC5 strain from which GPD1 was removed, the YBC5a strain from which GPD2 was removed showed a somewhat perplexing phenomenon: glycerol reduction was almost unaffected, lactic acid production decreased, and ethanol production increased. Since the overall fermentation process also showed an inhibitory effect on lactic acid fermentation, the YBC5a strain from which GPD2 was removed is unsuitable for use as a lactic acid-producing strain.

[0097] In the preparation of the YBC1-YBC4 strains used to produce the aforementioned YBC5 strain, the LDH gene was introduced when removing major genes to enhance the lactic acid production capacity of the strains. However, in the preparation of the YBC5 strain, the LDH gene was not introduced when removing the GPD1 gene. This was because six LDH genes (six in total, two at three positions) from the same Lactobacillus plantarum-derived sequence number 12 had already been introduced. It was anticipated that introducing the same type of gene would have only a slight effect on further activity increase, considering internal feedback regulation. Furthermore, as clearly shown in Example 2, although the expression rate of GPD1 / 2 under general conditions is higher than that of the Ref gene ALG9, it is lower than that of other genes such as ADH and PDC. Finally, considering the genomic instability that can occur when many of the same genes are present in the genome, this method was applied only to simple removal.

[0098] Example 5: Evaluation of fermentation performance of YBC5 strain In this example, the YBC5 strain was cultured in a bioreactor instead of a flask, and its lactic acid fermentation performance was confirmed.

[0099] YBC5 strains were cultured for 2 days in mYP medium (5g / L peptone, 4g / L yeast extract, 5g / L KH2PO4, 2g / L MgSO4·7H2O, 0.15g / L uracil) in 40ml primary seed culture and 220ml secondary seed culture. All cells were then harvested and inoculated into 2L mYP medium. The inoculation OD was 0.85. Culture was started in mYP medium with 12% glucose, and CaCO3 solution was intermittently injected to maintain the pH at pH 3. Culture was carried out at 30°C, 500rpm, and with air at 0.25vvm.

[0100] As a result, as shown in Figure 2, it was confirmed that the YBC5 strain produced lactic acid while rapidly consuming all glucose in the bioreactor. At a final pH of 3.3, it showed a lactic acid yield of 0.81 g / g, a productivity of 1.6 g / L / hr, a lactic acid concentration of 88.2 g / L, and a glycerol yield of 0.01 g / g. This confirmed that the results of Example 3 were directly realized in the bioreactor. Furthermore, it is inferred that this performance can be further improved in the future by improving the initial OD and culture conditions.

[0101] Having described in detail certain aspects of the present invention, it will be clear to those with ordinary skill in the art that such specific technologies are merely preferred embodiments and do not limit the scope of the invention. Therefore, the substantial scope of the invention is defined by the appended claims and their equivalents.

Claims

1. A recombinant strain of acid-resistant yeast YBC strain (KCTC13508BP) in which the gene encoding the enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate is deleted or weakened, the gene encoding alcohol dehydrogenase is further deleted or weakened, the gene encoding pirubate decarboxylase is further deleted or weakened, the gene encoding the enzyme that converts lactate to pirubate is further deleted or weakened, and the gene encoding lactate dehydrogenase is introduced, thereby possessing lactic acid production ability.

2. The recombinant strain according to claim 1, wherein the gene encoding the enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate is a gene encoding a protein that has 90% or more identity with the protein represented by the amino acid sequence of SEQ ID NO:

3.

3. The recombinant strain according to claim 1, characterized in that the gene encoding the enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate is the GPD1 or GPD2 gene.

4. The recombinant strain according to claim 1, characterized in that the gene encoding the enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate is GPD1, and the gene is represented by the base sequence of SEQ ID NO: 1 or SEQ ID NO:

2.

5. The recombinant strain according to claim 1, characterized in that the gene encoding the alcohol dehydrogenase is represented by SEQ ID NO: 6 or SEQ ID NO:

7.

6. The recombinant strain according to claim 1, characterized in that the gene encoding the pirubate decarboxylase is represented by SEQ ID NO: 8 or SEQ ID NO:

9.

7. The recombinant strain according to claim 1, characterized in that the gene encoding the enzyme that converts lactate to pirubate is represented by Sequence ID No. 10 or Sequence ID No.

11.

8. The recombinant strain according to claim 1, characterized in that the glycerol production ability is reduced compared to the parent strain, the acid-resistant yeast YBC strain (KCTC13508BP), due to the deletion or weakening of the gene encoding the enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate.

9. This recombinant strain of acid-resistant yeast YBC strain (KCTC13508BP) is characterized by the deletion of the GPD1 gene, which encodes an enzyme that converts dihydroxyacetone phosphate to glycerol-3-phosphate; the CYB2 gene, which encodes an enzyme that converts lactate to pirubate; the ADH gene, which encodes alcohol dehydrogenase; and the PDC gene, which encodes pirubate decarboxylase, and has been replaced with a gene encoding lactate dehydrogenase, thereby possessing lactic acid-producing ability.

10. The recombinant strain according to claim 9, characterized in that the gene encoding lactate dehydrogenase is introduced into one or more gene positions of the deleted CYB2 gene, ADH gene, PDC gene, and GPD1 gene, and is regulated by the promoter of the deleted gene.

11. The recombinant strain according to claim 10, wherein the promoter of the GPD1 gene has the nucleotide sequence represented by SEQ ID NO: 4 or SEQ ID NO:

5.

12. A method for producing lactic acid, including the following steps; (a) A step of culturing a recombinant bacterial strain according to any one of claims 1 to 11 to produce lactic acid; and (b) A step of obtaining the lactic acid produced.

Citation Information

Patent Citations

  • Yeast of genetically engineered issatchenkiaorientalis species or related species and fermentation method using this yeast

    JP2008545429A

  • Polypeptide conferring acid tolerant property to yeast cell, polynucleotide encoding the same, yeast cell having increased amount of the polypeptide, method of producing a product by using the yeast cell, and method of producing acid-tolerant yeast cell

    US20150064752A1

  • Acid-resistant yeast with supressed ethanol production pathway and method for producing lactic acid using same

    WO2019203436A1

  • Recombinant acid-resistant yeast in which alcohol production is inhibited and method for producing lactic acid by using same

    WO2020075986A2