Encapsulation of messenger RNA

Abstract

To provide encapsulation of messenger RNA.SOLUTION: The present invention provides an improved process for lipid nanoparticle formulation and mRNA encapsulation. In some embodiments, the present invention provides a process of encapsulating messenger RNA (mRNA) in lipid nanoparticles, comprising a step of mixing an mRNA solution and a lipid solution, where the mRNA solution and / or the lipid solution are at a predetermined temperature greater than ambient temperature. The present invention provides, among other things, an improved process for lipid nanoparticle formulation and mRNA encapsulation. In particular, the present invention is based on the surprising discovery that pre-heating an mRNA solution and / or a lipid solution prior to the mixing results in significantly improved encapsulation efficiency and mRNA recovery rate, and more homogeneous and smaller particle sizes (e.g., less than 100 nm).SELECTED DRAWING: None

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims priority to U.S. Provisional Patent Application No. 62 / 020,163, filed on 2 July 2014, whose disclosure is incorporated herein by reference in its entirety. [Background technology]

[0002] Messenger RNA therapy (MRT) is becoming an increasingly important approach for treating a variety of diseases. MRT inevitably involves administering messenger RNA (mRNA) to patients who require treatment to produce mRNA-encoded proteins in their bodies. Lipid nanoparticles are often used to encapsulate mRNA for efficient in vivo delivery. However, current methods for producing mRNA-carrying lipid nanoparticles suffer from problems such as poor encapsulation efficiency, low mRNA recovery, and / or heterogeneous particle size. [Overview of the Initiative] [Means for solving the problem]

[0003] The present invention provides, in particular, improved processes for lipid nanoparticle formulations and mRNA encapsulation. Specifically, the present invention is based on the remarkable discovery that preheating the mRNA solution and / or lipid solution before mixing results in significantly improved encapsulation efficiency, mRNA recovery rate, and more homogeneous and smaller particle sizes (e.g., less than 100 nm).

[0004] Therefore, in some embodiments, the present invention provides a process for encapsulating messenger RNA (mRNA) within lipid nanoparticles, comprising the step of mixing an mRNA solution with a lipid solution, wherein the mRNA solution and / or lipid solution are at a predetermined temperature above ambient temperature. In some embodiments, preferred predetermined temperatures for the present invention are about 30°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, or 70°C or higher. In some embodiments, preferred predetermined temperatures for the present invention are in the range of about 25-70°C, about 30-70°C, about 35-70°C, about 40-70°C, about 45-70°C, about 50-70°C, or about 60-70°C. In a particular embodiment, a preferred predetermined temperature for the present invention is about 65°C.

[0005] In some embodiments, the mRNA solution and the lipid solution are heated separately to a predetermined temperature before mixing. In some embodiments, the mRNA solution is heated to a predetermined temperature and the lipid solution is at ambient temperature before mixing. In some embodiments, the mRNA solution is heated to a predetermined temperature by adding the mRNA stock solution at ambient temperature to a heated buffer solution. In some embodiments, the buffer solution has a pH of about 4.5 or less (e.g., about 4.4, 4.2, 4.0, or 3.8 or less).

[0006] In some embodiments, the mRNA solution and the lipid solution are mixed by a low-pulse flow pump. In some embodiments, a gear pump is preferred. In some embodiments, a peristaltic pump is preferred. In some embodiments, a volute pump is preferred.

[0007] In some embodiments, the mRNA solution is administered at approximately 150-250 ml / min, 250-500 ml / min, 500-1000 ml / min, 1000-2000 ml / min, and 2000-30 The mixture is mixed at a flow rate in the range of 00 ml / min, 3000-4000 ml / min, or 4000-5000 ml / min. In some embodiments, the mRNA solution is mixed at a flow rate of approximately 200 ml / min, approximately 500 ml / min, approximately 1000 ml / min, approximately 2000 ml / min, approximately 3000 ml / min, approximately 4000 ml / min, or approximately 5000 ml / min.

[0008] In some embodiments, the lipid solution is mixed at flow rates ranging from approximately 25–75 ml / min, approximately 75–200 ml / min, approximately 200–350 ml / min, approximately 350–500 ml / min, approximately 500–650 ml / min, approximately 650–850 ml / min, or approximately 850–1000 ml / min. In some embodiments, the lipid solution is mixed at a flow rate of approximately 50 ml / min, 100 ml / min, 150 ml / min, 200 ml / min, 250 ml / min, 300 ml / min, 350 ml / min, 400 ml / min, 450 ml / min, 500 ml / min, 550 ml / min, 600 ml / min, 650 ml / min, 700 ml / min, 750 ml / min, 800 ml / min, 850 ml / min, 900 ml / min, 950 ml / min, or 1000 ml / min.

[0009] In some embodiments, the process according to the present invention includes the step of first producing an mRNA solution by mixing a citrate buffer with the mRNA stock solution. In certain embodiments, a suitable citrate buffer contains about 10 mM citrate, about 150 mM NaCl, and a pH of about 4.5. In some embodiments, a suitable mRNA stock solution contains mRNA at concentrations of about 0.10 mg / ml, 1 mg / ml, about 10 mg / ml, about 50 mg / ml, or about 100 mg / ml or higher.

[0010] In some embodiments, the citrate buffer is mixed at a flow rate in the range between about 100 - 300 ml / min, 300 - 600 ml / min, 600 - 1200 ml / min, 1200 - 2400 ml / min, 2400 - 3600 ml / min, 3600 - 4800 ml / min, or 4800 - 6000 ml / min. In some embodiments, the citrate buffer is mixed at a flow rate of about 220 ml / min, about 600 ml / min, about 1200 ml / min, about 2400 ml / min, about 3600 ml / min, about 4800 ml / min, or about 6000 ml / min.

[0011] In some embodiments, the mRNA stock solution is mixed at a flow rate in the range between about 10 - 30 ml / min, about 30 - 60 ml / min, about 60 - 120 ml / min, about 120 - 240 ml / min, about 240 - 360 ml / min, about 360 - 480 ml / min, or about 480 - 600 ml / min. In some embodiments, the mRNA stock solution is mixed at a flow rate of about 20 ml / min, about 40 ml / min, about 60 ml / min, about 80 ml / min, about 100 ml / min, about 200 ml / min, about 300 ml / min, about 400 ml / min, about 500 ml / min, or about 600 ml / min.

[0012] In some embodiments, the lipid solution contains one or more cationic lipids, one or more helper lipids, one or more cholesterol-based lipids, and PEG lipids in ethanol. In some embodiments, the mRNA solution and the lipid solution are mixed into 20% ethanol, resulting in a suspension of lipid nanoparticles. In some embodiments, the lipid nanoparticles are further purified by tangential flow filtration.

[0013] In some embodiments, more than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified nanoparticles have a size of less than about 100 nm (e.g., about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, or less than about 50 nm). In some embodiments, substantially all of the purified nanoparticles have a size of less than 100 nm (e.g., about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, or less than about 50 nm). It has a size.

[0014] In some embodiments, over 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% of the purified nanoparticles have a size in the range of approximately 40–90 nm (e.g., approximately 40–85 nm, approximately 40–80 nm, approximately 40–75 nm, approximately 40–70 nm, approximately 40–65 nm, or approximately 40–60 nm). In some embodiments, substantially all of the purified nanoparticles have a size in the range of approximately 40–90 nm (e.g., approximately 40–85 nm, approximately 40–80 nm, approximately 40–75 nm, approximately 40–70 nm, approximately 40–65 nm, or approximately 40–60 nm).

[0015] In some embodiments, the purified nanoparticles have an encapsulation efficiency of approximately 80%, 85%, 90%, 95%, 96%, 97%, 98%, or more than 99%. In some embodiments, the process according to the present invention results in the recovery of mRNA of approximately 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or more than 99%.

[0016] In some embodiments, the present invention provides a process for encapsulating messenger RNA (mRNA) within lipid nanoparticles, comprising: (a) separately heating an mRNA solution and / or a lipid solution to a predetermined temperature above ambient temperature; (b) mixing the heated mRNA solution and / or heated lipid solution to produce a suspension of lipid nanoparticles; and (c) purifying the lipid nanoparticles.

[0017] In another embodiment, the present invention provides compositions of lipid nanoparticles produced by processes described herein. In some embodiments, the present invention provides compositions comprising purified lipid nanoparticles, wherein more than about 90% of the purified lipid nanoparticles have individual particle sizes less than about 100 nm (e.g., about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, or less than about 50 nm), and more than about 70% of the purified lipid nanoparticles encapsulate mRNA within each individual particle. In some embodiments, more than about 95%, 96%, 97%, 98%, or 99% of the purified lipid nanoparticles have individual particle sizes less than about 100 nm (e.g., about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, or less than about 50 nm). In some embodiments, substantially all purified lipid nanoparticles have individual particle sizes less than about 100 nm (e.g., about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, or less than about 50 nm). In some embodiments, more than 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified lipid nanoparticles encapsulate mRNA within each individual particle. In some embodiments, substantially all purified lipid nanoparticles encapsulate mRNA within each individual particle. In some embodiments, the composition according to the present invention contains at least about 1 mg, 5 mg, 10 mg, 100 mg, 500 mg, or 1000 mg of encapsulated mRNA.

[0018] In some embodiments, each individual lipid nanoparticle comprises one or more cationic lipids, one or more helper lipids, one or more cholesterol-based lipids, and PEG lipids. In some embodiments, the one or more cationic lipids include C12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE (imidazole-based), HGT5000, HGT5001, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, ClinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, and DLin-K-XT. The selection is made from the group consisting of C2-DMA, HGT4003, and combinations thereof.

[0019] In some embodiments, one or more noncationic lipids are selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), and DOPG (2-dioleoyl-sn-glycero-3-phospho(1'-rac-glycerol)).

[0020] In some embodiments, one or more cholesterol-based lipids are cholesterol or PEGylated cholesterol. In some embodiments, one or more PEGylated lipids are C6-C 20 It contains poly(ethylene) glycol chains up to 5 kDa in length, covalently attached to lipids having alkyl chains (or multiple alkyl chains) of a certain length.

[0021] In some embodiments, the present invention is used to encapsulate mRNA containing one or more modified nucleotides. In some embodiments, the present invention is used to encapsulate unmodified mRNA. The present invention provides, for example, the following items: (Item 1) A process for encapsulating messenger RNA (mRNA) within lipid nanoparticles, comprising the step of mixing an mRNA solution with a lipid solution, wherein the mRNA solution and / or the lipid solution are at a predetermined temperature above ambient temperature. (Item 2) The process described in item 1, wherein the predetermined temperature is approximately 30°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, or 70°C or higher. (Item 3) The process according to item 1 or 2, wherein the predetermined temperature is in the range of approximately 25-70°C, approximately 30-70°C, approximately 35-70°C, approximately 40-70°C, approximately 45-70°C, approximately 50-70°C, or approximately 60-70°C. (Item 4) The process according to any one of the preceding items, wherein the predetermined temperature is approximately 65°C. (Item 5) The process according to any one of the preceding items, wherein the mRNA solution and the lipid solution are heated separately to the predetermined temperature before mixing. (Item 6) The process according to any one of items 1 to 4, wherein before the mixing, the mRNA solution is heated to the predetermined temperature and the lipid solution is at ambient temperature. (Item 7) The process according to any one of the preceding items, wherein the mRNA stock solution at ambient temperature is added to a heated buffer solution and brought to the predetermined temperature, thereby heating the mRNA solution to the predetermined temperature. (Item 8) The process according to item 7, wherein the buffer solution has a pH of approximately 4.5 or less. (Item 9) The process according to any one of the preceding items, wherein the mRNA solution and the lipid solution are mixed by a low-pulse flow pump. (Item 10) The process described in item 9, wherein the pump is a gear pump. (Item 11) The process described in item 9, wherein the pump is a centrifugal pump. (Item 12) The process described in any one of the preceding items, wherein the mRNA solution is mixed at a flow rate in the range of approximately 150-250 ml / min, 250-500 ml / min, 500-1000 ml / min, 1000-2000 ml / min, 2000-3000 ml / min, 3000-4000 ml / min, or 4000-5000 ml / min. (Item 13) The process described in any one of the preceding items, wherein the mRNA solution is mixed at a flow rate of approximately 200 ml / min, approximately 500 ml / min, approximately 1000 ml / min, approximately 2000 ml / min, approximately 3000 ml / min, approximately 4000 ml / min, or approximately 5000 ml / min. (Item 14) The process according to any one of the preceding items, wherein the lipid solution is mixed at a flow rate in the range of approximately 25-75 ml / min, approximately 75-200 ml / min, approximately 200-350 ml / min, approximately 350-500 ml / min, approximately 500-650 ml / min, approximately 650-850 ml / min, or approximately 850-1000 ml / min. (Item 15) The process according to any one of the preceding items, wherein the lipid solution is mixed at a flow rate of approximately 50 ml / min, approximately 100 ml / min, approximately 150 ml / min, approximately 200 ml / min, approximately 250 ml / min, approximately 300 ml / min, approximately 350 ml / min, approximately 400 ml / min, approximately 450 ml / min, approximately 500 ml / min, approximately 550 ml / min, approximately 600 ml / min, approximately 650 ml / min, approximately 700 ml / min, approximately 750 ml / min, approximately 800 ml / min, approximately 850 ml / min, approximately 900 ml / min, approximately 950 ml / min, or approximately 1000 ml / min. (Item 16) The process according to any one of the preceding items, wherein the process includes the step of first producing the mRNA solution by mixing a citrate buffer with the mRNA stock solution. (Item 17) The process described in item 16, wherein the citrate buffer contains approximately 10 mM citrate, approximately 150 mM NaCl, and a pH of approximately 4.5. (Item 18) The process according to item 16 or 17, wherein the mRNA stock solution contains the mRNA at concentrations of approximately 1 mg / ml, approximately 10 mg / ml, approximately 50 mg / ml, or approximately 100 mg / ml or higher. (Item 19) The process according to any one of items 16 to 18, wherein the citrate buffer is mixed at a flow rate in the range of approximately 100–300 ml / min, 300–600 ml / min, 600–1200 ml / min, 1200–2400 ml / min, 2400–3600 ml / min, 3600–4800 ml / min, or 4800–6000 ml / min. (Item 20) The process according to any one of items 16 to 19, wherein the citrate buffer is mixed at a flow rate of approximately 220 ml / min, approximately 600 ml / min, approximately 1200 ml / min, approximately 2400 ml / min, approximately 3600 ml / min, approximately 4800 ml / min, or approximately 6000 ml / min. (Item 21) The process described in any one of items 16 to 20, wherein the mRNA stock solution is mixed at a flow rate in the range of approximately 10–30 ml / min, approximately 30–60 ml / min, approximately 60–120 ml / min, approximately 120–240 ml / min, approximately 240–360 ml / min, approximately 360–480 ml / min, or approximately 480–600 ml / min. (Item 22) The said mRNA stock solution is about 20 ml / min, about 40 ml / min, about 60 ml / min, about 80 ml / min, about 100 ml / min, about 200 ml / min, about 300 ml / min, about 400 ml / min, about The process described in any one of items 16-21, where the mixture is mixed at a flow rate of 500 ml / min or approximately 600 ml / min. (Item 23) The process according to any one of the preceding items, wherein the lipid solution comprises one or more cationic lipids, one or more helper lipids, one or more cholesterol-based lipids, and PEG lipids in ethanol. (Item 24) The process according to any one of the preceding items, wherein the mRNA solution and the lipid solution are mixed in 20% ethanol to result in a suspension of lipid nanoparticles. (Item 25) The process described in item 24, wherein the lipid nanoparticles are further purified by tangential flow filtration. (Item 26) The process according to item 25, wherein more than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified nanoparticles have a size of less than 100 nm. (Item 27) The process according to item 26, wherein substantially all of the purified nanoparticles have a size of less than 100 nm. (Item 28) The process according to any one of items 25 to 27, wherein more than 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% of the purified nanoparticles have a size in the range of 50 to 80 nm. (Item 29) The process according to any one of items 25 to 28, wherein substantially all of the purified nanoparticles have a size in the range of 50 to 80 nm. (Item 30) The process according to any one of items 25 to 29, wherein the purified nanoparticles have an encapsulation rate greater than approximately 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%. (Item 31) The process described in any one of the preceding items, wherein the process results in the recovery of more than approximately 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of mRNA. (Item 32) A process for encapsulating messenger RNA (mRNA) within lipid nanoparticles, comprising: a. separately heating the mRNA solution and / or the lipid solution to a predetermined temperature above the ambient temperature; b. Mixing the heated mRNA solution and / or the heated lipid solution to produce a suspension of lipid nanoparticles; and c. The process comprising purifying the lipid nanoparticles. (Item 34) A composition of lipid nanoparticles produced by a process described in any one of the preceding items. (Item 35) A composition comprising purified lipid nanoparticles, wherein more than 90% of the purified lipid nanoparticles have individual particles with a size of less than 100 nm, and more than 70% of the purified lipid nanoparticles have mRNA encapsulated within each individual particle. (Item 36) The composition according to item 35, wherein about 95%, 96%, 97%, 98%, or more than 99% of the purified lipid nanoparticles have individual particle sizes of less than about 100 nm. (Item 37) The composition according to either item 35 or 36, wherein substantially all of the purified lipid nanoparticles have individual particle sizes less than about 100 nm. (Item 38) The composition according to any one of items 35 to 37, wherein about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or more than 99% of the purified lipid nanoparticles encapsulate mRNA within each individual particle. (Item 39) The composition according to any one of items 35 to 38, wherein substantially all of the purified lipid nanoparticles encapsulate mRNA within each individual particle. (Item 40) The composition according to any one of items 35 to 39, wherein the composition comprises at least 1 mg, 5 mg, 10 mg, 100 mg, 500 mg, or 1000 mg of encapsulated mRNA. (Item 41) A composition according to any one of items 35 to 40, wherein each individual lipid nanoparticle comprises one or more cationic lipids, one or more helper lipids, one or more cholesterol-based lipids, and PEG lipids. (Item 42) The process described in item 24 or the composition described in item 41, wherein the one or more cationic lipids are selected from the group consisting of C12-200, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE (imidazole type), HGT5000, HGT5001, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, ClinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, HGT4003, and combinations thereof. (Item 43) The one or more noncationic lipids mentioned above are DSPC(1,2-distearoyl-sn-glycosyl Cello-3-phosphocholine), DPPC(1,2-dipalmitoyl-sn-glycero-3- Phosphocholine), DOPE(1,2-(dioleyl-sn-glycero-3-phosphoetano (Dioleamine), DOPC (1,2-Dioleyl-sn-glycero-3-phosphotizyl) Phosphorus)DPPE(1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine) ), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine) A process described in item 24 or a composition described in item 41, selected from (1) , DOPG (2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)). (Item 44) The process described in item 24 or the composition described in item 41, wherein one or more cholesterol-based lipids are cholesterol or PEGylated cholesterol. (Item 45) One or more PEG-modified lipids, C6-C 20 A process according to item 24 or a composition according to item 41, comprising poly(ethylene) glycol chains up to 5 kDa in length covalently attached to a lipid having alkyl chains of a certain length. (Item 46) The process or composition according to any one of the preceding items, wherein the mRNA comprises one or more modified nucleotides. (Item 47) The process or composition according to any one of the preceding items, wherein the mRNA is unmodified.

[0022] Other characteristics, purposes, and advantages of the present invention are evident in the embodiments, drawings, and claims below. However, it should be understood that the embodiments, drawings, and claims are given only as examples, not limitations, while illustrating embodiments of the present invention. Various changes and modifications within the scope of the present invention will be apparent to those skilled in the art.

[0023] The drawings are for illustrative purposes only and are not intended to be restrictive. [Brief explanation of the drawing]

[0024] [Figure 1] A schematic diagram of an exemplary, large-scale formulation process for lipid nanoparticle-encapsulated mRNA using a homogeneous flow pump is shown. [Figure 2] This shows an exemplary system for the purification and buffer exchange of lipid nanoparticles. [Figure 3] A schematic diagram of an exemplary, scaled-up lipid nanoparticle encapsulation mRNA formulation process using a peristaltic pump is shown. [Figure 4] An exemplary alternative tangential flow filtration system for purification and buffer exchange is shown. [Figure 5] An alternative schematic diagram of an exemplary, scaled-up lipid nanoparticle encapsulation mRNA formulation process using a peristaltic pump is shown.

[0025] definition To facilitate understanding of this invention, certain terms are first defined below. Further definitions of these terms and other terms are provided throughout this specification.

[0026] Approximately or About: As used herein, the terms “approximately” or “about” refer to a value that is similar to the given reference value when applied to one or more values. In certain embodiments, unless otherwise stated or the context makes it clear that, “approximately” or “about” refers to a range of values ​​that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less than 1% of the given reference value (except where such a number exceeds 100% of the possible value).

[0027] Encapsulation: As used herein, the term “encapsulation” or its grammatical equivalent refers to the process of confining individual mRNA molecules within nanoparticles.

[0028] To improve, increase, or decrease: As used herein, the terms “improve,” “increase,” or “decrease” or their grammatical equivalents refer to values ​​relative to baseline measurements, such as measurements in the same individual before the commencement of the treatment described herein, or measurements in a control(s) in the absence of the treatment described herein. A “control(s)” is an individual of approximately the same age as the subject being treated and suffering from the same form of disease as the subject being treated.

[0029] Impurities: As used herein, the term “impurity” refers to a limited amount of internal material in a liquid, gas, or solid that differs from the chemical composition of the target material or compound. Impurities are also referred to as contaminants.

[0030] In vitro: As used herein, the term "in vitro" refers to events that occur in an artificial environment rather than within a multicellular organism, such as in a test tube or reaction vessel, or within a cell culture.

[0031] In vivo: As used herein, the term “in vivo” refers to events occurring within multicellular organisms such as humans and non-human animals. In the context of cell-based systems, the term may be used to refer to events occurring within living cells (as opposed to, for example, in vitro systems).

[0032] Isolated: As used herein, the term “isolated” means (1) a substance and / or entity that has been separated from at least some of the components with which it was originally associated (either in nature or in an experimental setting) when it was first produced, and / or (2) a substance and / or entity that has been produced, prepared, and / or manufactured by human hands. Isolated substances and / or entities may be separated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% of the other components with which they were originally associated. In some embodiments, the isolated agent is pure to about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99%. As used herein, a substance is "pure" if it is substantially free of other components. As used herein, the calculation of the purity percentage (%) of an isolated substance and / or entity should not include excipients (e.g., buffers, solvents, water, etc.).

[0033] Messenger RNA (mRNA): As used herein, the term “messenger RNA (mRNA)” refers to a polynucleotide that encodes at least one polypeptide. As used herein, mRNA includes both modified and unmodified RNA. mRNA may contain one or more coding and non-coding regions.

[0034] Nucleic Acids: As used herein, the term “nucleic acid” means, in its broadest sense, any compound and / or substance that is incorporated into or can be incorporated into a polynucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is incorporated into or can be incorporated into a polynucleotide chain via phosphodiester bonds. In some embodiments, “nucleic acid” means individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, “nucleic acid” means a polynucleotide chain comprising individual nucleic acid residues. In some embodiments, “nucleic acid” encompasses RNA as well as single-stranded and / or double-stranded DNA and / or cDNA. Furthermore, the terms “nucleic acid,” “DNA,” “RNA,” and / or similar terms include nucleic acid analogs, i.e., analogs having something other than a phosphodiester backbone. For example, so-called “peptide nucleic acids” are known in the art, have peptide bonds instead of phosphodiester bonds in their backbone, and are considered to be within the scope of the present invention. The term “nucleotide sequence encoding an amino acid sequence” includes all nucleotide sequences that are denatured from each other and / or encoding the same amino acid sequence. Nucleic acid sequences encoding proteins and / or RNA may contain introns. Nucleic acids can be purified from natural sources, produced using recombinant expression systems, and optionally purified or chemically synthesized. Where appropriate, for example, in the case of chemically synthesized molecules, nucleic acids may contain nucleoside analogs such as chemically modified bases or sugars, or analogs with backchain modifications. Unless otherwise specified, nucleic acid sequences are oriented from 5' to 3'. In some embodiments, nucleic acids are natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynylcytidine, C-5 propynyluridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyluridine, C5-propynylcytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); inserted bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioates and 5'-N-phosphoramidite bonds), or comprising the same. In some embodiments, the present invention specifically relates to “unmodified nucleic acids” meaning nucleic acids (e.g., polynucleotides and residues, including nucleotides and / or nucleosides) that have not been chemically modified to facilitate or achieve delivery.

[0035] Salt: As used herein, the term "salt" refers to an ionic compound that results from or may result from a neutralization reaction between an acid and a base.

[0036] Substantially: As used herein, the term “substantially” refers to a qualitative state exhibiting all or nearly all of the characteristics or properties of the subject. Those skilled in the biological art will understand that biological and chemical phenomena rarely, if any, reach completion and / or progress toward completion or achieve or avoid absolute results. The term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0037] Yield: As used herein, the term “yield” refers to the percentage (%) of mRNA recovered after encapsulation compared to the total mRNA as a starting material. In some embodiments, the term “recovery” is used interchangeably with the term “yield.” [Modes for carrying out the invention]

[0038] The present invention provides improved processes for formulating lipid nanoparticles and encapsulating mRNA. In some embodiments, the present invention provides a process for encapsulating messenger RNA (mRNA) within lipid nanoparticles, comprising the step of mixing an mRNA solution with a lipid solution, wherein the mRNA solution and / or the lipid solution are at a predetermined temperature above ambient temperature.

[0039] Various aspects of the present invention are described in detail in the following sections. The use of these sections is not intended to limit the present invention. Each section may be applied to any aspect of the present invention. In this application, the use of "or" means "and / or" unless otherwise stated.

[0040] mRNA The present invention may be used to encapsulate any mRNA. mRNA is typically considered a type of RNA that carries information from DNA to ribosomes. The presence of mRNA is typically very short and involves processing and translation, followed by degradation. Typically in eukaryotes, mRNA processing involves the addition of a “cap” to the N-terminal (5') end and a “tail” to the C-terminal (3') end. A typical cap is a 7-methylguanosine cap, which is guanosine that binds to the first transcribed nucleotide through a 5'-5'-triphosphate bond. The presence of the cap is important in providing resistance to nucleases found in most eukaryotic cells. The tail is typically a polyadenylation event, where a polyadenylated portion is added to the 3' end of the mRNA molecule. The presence of this “tail” plays a role in protecting mRNA from exonuclease degradation. Messenger RNA is translated by ribosomes into a set of amino acids that make up proteins.

[0041] mRNA may be synthesized according to any various known methods. For example, mRNA according to the present invention may be synthesized via in vitro transcription (IVT). Briefly, IVT is typically performed with a buffer system that may include a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, DTT, and magnesium ions, and a suitable RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), deoxyribonuclease I, pyrophosphatase, and / or a ribonuclease inhibitor. The exact conditions will vary depending on the specific application.

[0042] In some embodiments, mRNA synthesized in vitro may be purified before formulation and encapsulation to remove undesirable impurities, including various enzymes and other reagents used during mRNA synthesis.

[0043] The present invention may be used to formulate and encapsulate mRNA of various lengths. In some embodiments, the present invention may be used to formulate and encapsulate in vitro synthesized mRNA of lengths of about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, or 20 kb or longer. In some embodiments, the present invention may be used to formulate and encapsulate in vitro synthesized mRNA of lengths in the range of about 1 to 20 kb, about 1 to 15 kb, about 1 to 10 kb, about 5 to 20 kb, about 5 to 15 kb, about 5 to 12 kb, about 5 to 10 kb, about 8 to 20 kb, or about 8 to 15 kb.

[0044] The present invention may be used to formulate and encapsulate unmodified mRNA or mRNA containing one or more modifications that typically improve stability. In some embodiments, the modifications are selected from modified nucleotides, modified sugar phosphate backbones, and 5' and / or 3' untranslated regions.

[0045] In some embodiments, mRNA modification may include nucleotide modification of the RNA. Modified mRNA according to the present invention may include, for example, main chain modification, sugar modification, or base modification. In some embodiments, mRNA may be modified with purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), as well as modified nucleotide analogs or derivatives of purines and pyrimidines, such as 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine , 3-methylcytosine, 4-acetylcytosine, 5-methylcytosine, 2,6-diaminopurine, 1-methylguanine, 2-methylguanine, 2,2-dimethylguanine, 7-methylguanine, inosine, 1-methylinosine, pseudouracil (5-uracil), dihydrouracil, 2-thiouracil, 4-thiouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-(carboxyhydroxymethyl These may be synthesized from naturally occurring nucleotides and / or nucleotide analogs (modified nucleotides), including but not limited to phosphoramidic acids, phosphorothioates, peptide nucleotides, methylphosphonates, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, and inosine. The preparation of such analogues is, for example, made obvious to the full extent by reference if the disclosure is made obvious to the full extent by reference. This information is already known to those skilled in the art from U.S. Patent Nos. 4,373,071, 4,401,796, 4,415,732, 4,458,066, 4,500,707, 4,668,777, 4,973,679, 5,047,524, 5,132,418, 5,153,319, 5,262,530 and 5,700,642, which are included in the details.

[0046] Typically, mRNA synthesis involves the addition of a "cap" to the N-terminus (5') and a "tail" to the C-terminus (3'). The presence of the cap is important in providing resistance to nucleases found in most eukaryotic cells. The presence of the "tail" plays a role in protecting mRNA from exonuclease degradation.

[0047] Therefore, in some embodiments, mRNA contains a 5' cap structure. The 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates; then, guanosine triphosphate (GTP) is added to the terminal phosphate via guanylyltransferase, creating a 5'5'5 triphosphate bond; then, the 7-nitrogen of guanine is methylated by methyltransferase. 2'-O-methylation may also occur at the first and / or second bases following the 7-methylguanosine triphosphate residue. Examples of cap structures include, but are not limited to, m7GpppNp-RNA, m7GpppNmp-RNA, and m7GpppNmpNmp-RNA (where m refers to a 2'-O methyl residue).

[0048] In some embodiments, the mRNA includes a 5' and / or 3' untranslated region. In some embodiments, the 5' untranslated region includes one or more elements that affect mRNA stability or translation, such as iron-responsive elements. In some embodiments, the 5' untranslated region may be about 50 to 500 nucleotides long.

[0049] In some embodiments, the 3' untranslated region includes one or more polyadenylation signals, binding sites to proteins that affect the stability of mRNA position within the cell, or binding sites to miRNAs. In some embodiments, the 3' untranslated region may be 50 to 500 nucleotides long or longer.

[0050] While mRNA provided from an in vitro transcription reaction may be desirable in some embodiments, other sources of mRNA are intended to be within the scope of the present invention, including mRNA produced from bacteria, fungi, plants, and / or animals.

[0051] The present invention may be used to formulate and encapsulate mRNA encoding various proteins. Non-limiting examples of mRNA suitable for the present invention include mRNA encoding spinal motor neuron 1 (SMN), alpha-galactosidase (GLA), argininosuccinate synthase (ASS1), firefly luciferase, factor IX (FIX), phenylalanine hydroxylase (PAH), and cystic fibrosis membrane conductance receptor (CFTR). Exemplary mRNA sequences are detailed in the Examples section.

[0052] mRNA solution mRNA may be provided in a solution mixed with a lipid solution so that the mRNA can be encapsulated within lipid nanoparticles. A suitable mRNA solution may be any aqueous solution containing encapsulated mRNA at various concentrations. For example, a suitable mRNA solution may contain mRNA at approximately 0.01 mg / ml, 0.05 mg / ml, 0.06 mg / ml, 0.07 mg / ml, 0.08 mg / ml, 0.09 mg / ml, 0.1 mg / ml, 0.15 mg / ml, 0.2 mg / ml, 0.3 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0. The mRNA solution may contain mRNA at concentrations of 6 mg / ml, 0.7 mg / ml, 0.8 mg / ml, 0.9 mg / ml, or 1.0 mg / ml or higher. In some embodiments, a suitable mRNA solution contains mRNA at concentrations of approximately 0.01-1.0 mg / ml, 0.01-0.9 mg / ml, 0.01-0.8 mg / ml, 0.01-0.7 mg / ml, 0.01-0.6 mg / ml, 0.01-0.5 mg / ml, 0.01-0.4 mg / ml, 0.01-0.3 mg / ml, 0.01-0.2 mg / ml, 0.01-0.1 mg / ml, 0.05-1.0 mg / ml, 0.05-0.9 mg / ml It may be contained in concentrations within the range of ml, 0.05-0.8 mg / ml, 0.05-0.7 mg / ml, 0.05-0.6 mg / ml, 0.05-0.5 mg / ml, 0.05-0.4 mg / ml, 0.05-0.3 mg / ml, 0.05-0.2 mg / ml, 0.05-0.1 mg / ml, 0.1-1.0 mg / ml, 0.2-0.9 mg / ml, 0.3-0.8 mg / ml, 0.4-0.7 mg / ml, or 0.5-0.6 mg / ml. In some embodiments, a suitable mRNA solution may contain mRNA at concentrations up to approximately 5.0 mg / ml, 4.0 mg / ml, 3.0 mg / ml, 2.0 mg / ml, 1.0 mg / ml, 0.09 mg / ml, 0.08 mg / ml, 0.07 mg / ml, 0.06 mg / ml, or 0.05 mg / ml.

[0053] Typically, a suitable mRNA solution may also contain a buffer and / or salt. The buffer can usually include HEPES, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate, and sodium phosphate. In some embodiments, a suitable concentration of the buffer may be in the range of about 0.1 mM to 100 mM, 0.5 mM to 90 mM, 1.0 mM to 80 mM, 2 mM to 70 mM, 3 mM to 60 mM, 4 mM to 50 mM, 5 mM to 40 mM, 6 mM to 30 mM, 7 mM to 20 mM, 8 mM to 15 mM, or 9 to 12 mM. In some embodiments, preferred concentrations of the buffer are about 0.1 mM, 0.5 mM, 1 mM, 2 mM, 4 mM, 6 mM, 8 mM, 10 mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM, 40 mM, 45 mM, or 50 mM or more.

[0054] Exemplary salts may include sodium chloride, magnesium chloride, and potassium chloride. In some embodiments, preferred concentrations of salt in mRNA solution may be in the range of about 1 mM to 500 mM, 5 mM to 400 mM, 10 mM to 350 mM, 15 mM to 300 mM, 20 mM to 250 mM, 30 mM to 200 mM, 40 mM to 190 mM, 50 mM to 180 mM, 50 mM to 170 mM, 50 mM to 160 mM, 50 mM to 150 mM, or 50 mM to 100 mM. Preferred salt concentrations in mRNA solution are about 1 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, or 100 mM or higher.

[0055] In some embodiments, a preferred mRNA solution may have a pH in the range of approximately 3.5–6.5, 3.5–6.0, 3.5–5.5, 3.5–5.0, 3.5–4.5, 4.0–5.5, 4.0–5.0, 4.0–4.9, 4.0–4.8, 4.0–4.7, 4.0–4.6, or 4.0–4.5. In some embodiments, a preferred mRNA solution may have a pH of approximately 3.5, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.2, 5.4, 5.6, 5.8, 6.0, 6.1, 6.3, and 6.5 or less.

[0056] Various methods may be used to prepare mRNA solutions suitable for the present invention. In some embodiments, mRNA may be dissolved directly in the buffer described herein. In some embodiments, the mRNA solution may be prepared by mixing the mRNA stock solution with the buffer before mixing it with the lipid solution for encapsulation. In some embodiments, the mRNA solution may be prepared by mixing the mRNA stock solution with the buffer immediately before mixing it with the lipid solution for encapsulation. In some embodiments, a suitable mRNA stock solution is about 0.2 mg mRNA may be contained in water at concentrations of 1 / ml, 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.8 mg / ml, 1.0 mg / ml, 1.2 mg / ml, 1.4 mg / ml, 1.5 mg / ml, or 1.6 mg / ml, 2.0 mg / ml, 2.5 mg / ml, 3.0 mg / ml, 3.5 mg / ml, 4.0 mg / ml, 4.5 mg / ml, or 5.0 mg / ml or higher.

[0057] In some embodiments, the mRNA stock solution is mixed with a buffer using a pump. Exemplary pumps include, but are not limited to, gear pumps, peristaltic pumps, and volute pumps.

[0058] Typically, the buffer is mixed in a larger proportion than that of the mRNA stock solution. For example, the buffer may be mixed in a proportion at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 times greater than that of the mRNA stock solution. In some embodiments, the buffer may be mixed at a flow rate in the range of approximately 100 to 6000 ml / min (e.g., approximately 100 to 300 ml / min, 300 to 600 ml / min, 600 to 1200 ml / min, 1200 to 2400 ml / min, 2400 to 3600 ml / min, 3600 to 4800 ml / min, 4800 to 6000 ml / min, or 60 to 420 ml / min). In some embodiments, the buffer solution is mixed at a flow rate of approximately 60 ml / min, 100 ml / min, 140 ml / min, 180 ml / min, 220 ml / min, 260 ml / min, 300 ml / min, 340 ml / min, 380 ml / min, 420 ml / min, 480 ml / min, 540 ml / min, 600 ml / min, 1200 ml / min, 2400 ml / min, 3600 ml / min, 4800 ml / min, or 6000 ml / min or more.

[0059] In some embodiments, the mRNA stock solution is mixed at a flow rate in the range of approximately 10 to 600 ml / min (for example, approximately 5 to 50 ml / min, approximately 10 to 30 ml / min, approximately 30 to 60 ml / min, approximately 60 to 120 ml / min, approximately 120 to 240 ml / min, approximately 240 to 360 ml / min, approximately 360 to 480 ml / min, or approximately 480 to 600 ml / min). In some embodiments, the mRNA stock solution is mixed at a flow rate of approximately 5 ml / min, 10 ml / min, 15 ml / min, 20 ml / min, 25 ml / min, 30 ml / min, 35 ml / min, 40 ml / min, 45 ml / min, 50 ml / min, 60 ml / min, 80 ml / min, 100 ml / min, 200 ml / min, 300 ml / min, 400 ml / min, 500 ml / min, or 600 ml / min or more.

[0060] Lipid solution In accordance with the present invention, the lipid solution contains a mixture of lipids suitable for forming lipid nanoparticles for encapsulating mRNA. In some embodiments, the preferred lipid solution is ethanol-based. For example, the preferred lipid solution may contain a mixture of desired lipids dissolved in pure ethanol (i.e., 100% ethanol). In another embodiment, the preferred lipid solution is isopropyl alcohol-based. In yet another embodiment, the preferred lipid solution is dimethyl sulfoxide-based. In yet another embodiment, the preferred lipid solution is a mixture of preferred solvents, but is not limited to ethanol, isopropyl alcohol, and dimethyl sulfoxide.

[0061] A suitable lipid solution may contain a mixture of desired lipids at various concentrations. For example, a suitable lipid solution may contain a mixture of desired lipids at a total concentration of approximately 0.1 mg / ml, 0.5 mg / ml, 1.0 mg / ml, 2.0 mg / ml, 3.0 mg / ml, 4.0 mg / ml, 5.0 mg / ml, 6.0 mg / ml, 7.0 mg / ml, 8.0 mg / ml, 9.0 mg / ml, 10 mg / ml, 15 mg / ml, 20 mg / ml, 30 mg / ml, 40 mg / ml, 50 mg / ml, or 100 mg / ml or more. In some embodiments, a suitable lipid solution may contain a mixture of desired lipids at a total concentration of approximately 0.1 to 100 mg / ml, 0.5 to 90 mg / ml, 1.0 to 80 mg / ml, 1.0 to 70 mg / ml, 1.0 to 60 mg / ml, or 1.0 to 50 mg The desired lipid mixture may contain a total concentration in the range of 1.0-40 mg / ml, 1.0-30 mg / ml, 1.0-20 mg / ml, 1.0-15 mg / ml, 1.0-10 mg / ml, 1.0-9 mg / ml, 1.0-8 mg / ml, 1.0-7 mg / ml, 1.0-6 mg / ml, or 1.0-5 mg / ml. In some embodiments, a suitable lipid solution may contain a total concentration of the desired lipid mixture up to approximately 100 mg / ml, 90 mg / ml, 80 mg / ml, 70 mg / ml, 60 mg / ml, 50 mg / ml, 40 mg / ml, 30 mg / ml, 20 mg / ml, or 10 mg / ml.

[0062] Any desired lipids may be mixed in any ratio suitable for encapsulating mRNA. In some embodiments, a suitable lipid solution contains a mixture of desired lipids comprising cationic lipids, helper lipids (e.g., non-cationic lipids and / or cholesterol lipids) and / or PEGylated lipids. In some embodiments, a suitable lipid solution contains a mixture of desired lipids comprising one or more cationic lipids, one or more helper lipids (e.g., non-cationic lipids and / or cholesterol lipids) and one or more PEGylated lipids.

[0063] Cationic lipids As used herein, the term “cationic lipid” refers to any of many lipid species that have an effective positive charge at a selected pH, such as physiological pH. Several cationic lipids are described in the literature, and many are commercially available. Cationic lipids particularly suitable for use in the compositions and methods of the present invention include those described in International Patent Publication WO2010 / 053572 (and in particular C12-200 as described in paragraph

[0225] ) and WO2012 / 170930, both of which are incorporated herein by reference. In certain embodiments, cationic lipids suitable for the compositions and methods of the present invention include ionizable cationic lipids described in U.S. Provisional Patent Application No. 61 / 617,468, filed March 29, 2012 (incorporated herein by reference), such as (15Z,18Z)-N,N-dimethyl-6-(9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-15,18-dien-1-amine( This includes HGT5000), (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-trien-1-amine (HGT5001), and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-trien-1-amine (HGT5002).

[0064] In some embodiments, cationic lipids suitable for the compositions and methods of the present invention include cationic lipids described in U.S. Provisional Patent Application WO2013063468 and “Lipid Formulations for Delivery of Messenger RNA,” both of which are incorporated herein by reference. In some embodiments, the cationic lipid is of formula I-c1-a: [ka] In the formula, each R 2 These are, independently, hydrogen or C 1-3 It is alkyl; Each q is independently 2 - 6; Each R’ is independently hydrogen or C 1-3 alkyl; Each R L is independently C 8-12 alkyl, and includes a compound thereof or a pharmaceutically acceptable salt thereof.

[0065] In some embodiments, each R 2 is independently hydrogen, methyl or ethyl. In some embodiments, each R 2 is independently hydrogen or methyl. In some embodiments, each R 2 is hydrogen.

[0066] In some embodiments, each q is independently 3 - 6. In some embodiments, each q is independently 3 - 5. In some embodiments, each q is 4.

[0067] In some embodiments, each R’ is independently hydrogen, methyl or ethyl. In some embodiments, each R’ is independently hydrogen or methyl. In some embodiments, each R’ is independently hydrogen.

[0068] In some embodiments, each R L is independently C 8-12 alkyl. In some embodiments, each R L is independently n - C 8-12 alkyl. In some embodiments, each R L is independently C 9-11 alkyl. In some embodiments, each R L is independently n - C 9-11 alkyl. In some embodiments, each R L is independently C 10 alkyl. In some embodiments, each R L is independently n - C 10 alkyl.

[0069] Several embodiments, each R 2 R' is independently hydrogen or methyl; each q is independently 3-5; each R' is independently hydrogen or methyl; each R L Independently, C 8-12 It is alkyl.

[0070] Several embodiments, each R 2 is hydrogen; each q is independently 3-5; each R' is hydrogen; each R L Independently, C 8-12 It is alkyl.

[0071] Several embodiments, each R 2 is hydrogen; each q is 4; each R' is hydrogen; each R L Independently, C 8-12 It is alkyl.

[0072] In some embodiments, cationic lipids are defined by formula Ig: [ka] In the formula, each R L Independently, C 8-12 The compound comprises an alkyl compound or a pharmaceutically acceptable salt thereof. In some embodiments, each R L It operates independently, nC 8-12 It is alkyl. In some embodiments, each R L Independently, C 9-11 It is alkyl. In some embodiments, each R L It operates independently, nC 9-11 It is alkyl. In some embodiments, each R L Independently, C 10 It is alkyl. In some embodiments, each R L nC 10 It is alkyl.

[0073] In certain embodiments, preferred cationic lipids are cKK-E12 or (3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione). The structure of cKK-E12 is shown below: [ka]

[0074] In some embodiments, one or more cationic lipids suitable for the present invention may be N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride or "DOTMA" (Feigner et al., (Proc. Nat'l Acad. Sci. 84, 7413 (1987); U.S. Patent No. 4,897,355). Suitable cationic lipids include, for example, 5-carboxyspermylglycine dioctadecylamide or "DOGS", 2,3-dioleyloxy-N-[2(spermine-carboxamide)ethyl]-N,N-dimethyl-1-propanaminonium or "DOSPA" (Behr et al., Proc. Nat.'l Acad. Sci. 86,6982 (1989); U.S. Patent No. 5,171,678; U.S. Patent No. 5,334,761), 1,2-dioleoyl-3-dimethylammonium-propane or "DODAP", and 1,2-dioleoyl-3-trimethylammonium-propane or "DOTAP".

[0075] Further exemplary cationic lipids include 1,2-distearyloxy-N,N-dimethyl-3-aminopropane or "DSDMA", 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane or "DODMA", 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane or "DLinDMA", 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane or "DLenDMA", N-dioleyl-N,N-dimethylammonium chloride or "DODAC", and N,N-distearyl-N,N -Dimethylammonium bromide or "DDAB", N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide or "DMRIE", 3-dimethylamino-2-(cholesta-5-en-3-beta-oxybutane-4-oxy)-1-(cis,cis-9,12-octadecadieneoxy)propane or "CLinDMA", 2-[5'-(cholesta-5-en-3-beta-oxy)-3'-oxapentoxy)-3-dimethyl-1-(cis,cis S-9',l-2'-octadecadieneoxy)propane or "CpLinDMA", N,N-dimethyl-3,4-dioleyloxybenzylamine or "DMOBA", 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane or "DOcarbDAP", 2,3-dilinoleoyloxy-N,N-dimethylpropylamine or "DLinDAP", 1,2-N,N'-dilinoleylcarbamyl-3-dimethylaminopropane or "DLincarbDAP", 1,2-dilinoleoylcarbamyl-3-dimethyl Aminopropane or "DLinCDAP", 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane or "DLin--DMA", 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane or "DLin-K-XTC2-DMA", and 2-(2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolane-4-yl)-N,N-dimethylethaneamine (DLin-KC2-DMA)) (WO2010 / 042877; Semple et al., Nature Biotech).See 28:172-176 (2010), or mixtures thereof (Heyes, J. et al., J. Controlled Release 107:276-287 (2005); Morrissey, DV. et al., Nat. Biotechnol. 23(8):1003-1007 (2005); PCT Publication WO2005 / 121348A1). In some embodiments, one or more cationic lipids include at least one imidazole, dialkylamino, or guanidinium moiety.

[0076] In some embodiments, one or more cationic lipids are XTC(2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane), MC3(((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate), ALNY-100((3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dieny (L)Tetrahydro-3αH-cyclopenta[d][1,3]dioxol-5-amine), NC98-5(4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-diundecyl-4,7,10,13-tetraazahexadecane-1,16-diamide), DODAP(1,2-dioleyl-3-dimethylammoniumpropane), HGT4003(WO2012 / 170889, the teachings are based on the whole of these. Amino alcohol lipidoids such as those disclosed in WO2010 / 053572, ICE (WO2011 / 068810, the teachings of which are incorporated herein by reference in their entirety), HGT5000 (US Provisional Patent Application No. 61 / 617,468, the teachings of which are incorporated herein by reference in their entirety), or HGT5001 (cis or trans) (Provisional Patent Application No. 61 / 617,468), DOTAP (1,2-dioleyl-3-trimethylammoniumpropane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammoniumpropane), DLinDMA (Heyes, J.; Palmer, L.; Bremner, K.; MacLachlan, I. “Cationic lipid saturation influences intracellular delivery of encapsulated nucleic acid) You may choose from acids ("J.Contr.Rel.2005,107,276-287"), DLin-KC2-DMA (Semple, SC et al., "Rational Design of Cationic Lipids for siRNA Delivery," Nature Biotech.2010,28,172-176), or C12-200 (Love, KT et al., "Lipid-like materials for low-dose in vivo gene silencing," PNAS 2010,107,1864-1869).

[0077] In some embodiments, cationic lipids constitute at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% by weight or mole of the total lipids in a preferred lipid solution. In some embodiments, cationic lipids constitute about 30–70% by weight or mole of the total lipid mixture (e.g., about 30–65%, about 30–60%, about 30–55%, about 30–50%, about 30–45%, about 30–40%, about 35–50%, about 35–45%, or about 35–40%) by weight or mole.

[0078] Noncationic / Helper Lipids As used herein, the term "noncationic lipid" refers to any neutral, zwitterionic, or anionic lipid. As used herein, the term "anionic lipid" refers to any of many lipid species that have a net negative charge at a selected pH, such as physiological pH. Noncationic lipids include distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), and dioleoylphosphatidyl This includes, but is not limited to, ethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), 16-O-monomethylPE, 16-O-dimethylPE, 18-1-transPE, 1-stearoyl-2-oleoylphosphatidiethanolamine (SOPE), or mixtures thereof.

[0079] In some embodiments, noncationic lipids may constitute at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% by weight or moles of the total lipids in a suitable lipid solution. In some embodiments, noncationic lipids(s) may constitute about 30–50% by weight or moles of the total lipids in a suitable lipid solution (e.g., about 30–45%, about 30–40%, about 35–50%, about 35–45%, or about 35–40%).

[0080] Cholesterol-based lipids In some embodiments, a preferred lipid solution comprises one or more cholesterol-based lipids. For example, preferred cholesterol-based cationic lipids include, for example, DC-Choi(N,N-dimethyl-N-ethylcarboxamide cholesterol), 1,4-bis(3-N-oleylaminopropyl)piperazine (Gao et al., Biochem. Biophys. Res. Comm. 179, 280 (1991); Wolf et al., BioTechniques). Includes Patent No. 23,139 (1997); U.S. Patent No. 5,744,335, or ICE. In some embodiments, cholesterol lipids(s) constitute at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70% by weight or moles of the total lipids in a suitable lipid solution. In some embodiments, cholesterol lipids(s) constitute about 30–50% (e.g., about 30–45%, about 30–40%, about 35–50%, about 35–45%, or about 35–40%) by weight or moles of the total lipids in a suitable lipid solution.

[0081] PEGylated lipids In some embodiments, a preferred lipid solution comprises one or more PEGylated lipids. The use of polyethylene glycol (PEG)-modified phospholipids and derivatized lipids, such as N-octanoyl-sphingosine-1-[succinyl(methoxypolyethylene glycol)-2000](C8PEG-2000 ceramide), and derivatized ceramides (PEG-CER) is also intended by the present invention. The intended PEGylated lipids are C6-C 20 This includes, but is not limited to, polyethylene glycol chains up to 5 kDa in length covalently attached to lipids by alkyl chains (may be multiple) of a certain length. In some embodiments, the PEG-modified or PEGylated lipid is PEGylated cholesterol or PEG-2K. In some embodiments, particularly useful interchangeable lipids are those with shorter acyl chains (e.g., C 14 or C 18 It is a PEG-ceramide that has )

[0082] PEG-modified phospholipids and derivatized lipids may constitute at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70% by weight or mole of the total lipids in a suitable lipid solution. In some embodiments, the PEG-modified lipid(s) constitute about 30–50% by weight or mole of the total lipids in a suitable lipid solution (e.g., about 30–45%, about 30–40%, about 35–50%, about 35–45%, or about 35–40%).

[0083] Exemplary combinations of cationic lipids, non-cationic lipids, cholesterol-based lipids, and PEG-modified lipids are described in the Examples section. For example, a suitable lipid solution may contain cKK-E12, DOPE, chol, and DMG-PEG2K; C12-200, DOPE, cholesterol, and DMG-PEG2K; HGT5000, DOPE, chol, and DMG-PEG2K; HGT5001, DOPE, chol, and DMG-PEG2K; cKK-E12, DPPC, chol, and DMG-PEG2K; C12-200, DPPC, cholesterol, and DMG-PEG2K; HGT5000, DPPC, chol, and DMG-PEG2K; or HGT5001, DPPC, chol, and DMG-PEG2K. The selection of cationic lipids, non-cationic lipids, and / or PEG-modified lipids, including lipid mixtures, and their relative molar ratios, are based on the characteristics of the selected lipids and the characteristics and properties of the encapsulated mRNA. Further considerations include, for example, alkyl chain saturation, as well as the size, charge, pH, pKa, membrane fusion properties, and toxicity of the selected lipids. Therefore, the molar ratios may be adjusted as appropriate.

[0084] Mixing process This invention is based on the discovery of an unexpected effect of temperature on mRNA encapsulation efficiency and recovery rate. Therefore, in some embodiments, the present invention relates to the mRNA solution described herein. A process for encapsulating messenger RNA (mRNA) in lipid nanoparticles by mixing with a lipid solution is provided, wherein the mRNA solution and / or lipid solution are heated to a predetermined temperature above the ambient temperature. As used herein, the term “ambient temperature” means room temperature, or the temperature surrounding the object of interest (e.g., the mRNA solution or the lipid solution) without heating or cooling. In some embodiments, the ambient temperature refers to a temperature in the range of about 20–25°C.

[0085] Therefore, a predetermined temperature above ambient temperature is typically above about 25°C. In some embodiments, a predetermined temperature suitable for the present invention is about 30°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, or 70°C or higher. In some embodiments, a predetermined temperature suitable for the present invention is in the range of about 25-70°C, about 30-70°C, about 35-70°C, about 40-70°C, about 45-70°C, about 50-70°C, or about 60-70°C. In a particular embodiment, a predetermined temperature suitable for the present invention is about 65°C.

[0086] The mRNA solution, or the lipid solution, or both, may be heated to a predetermined temperature above ambient temperature before mixing. In some embodiments, the mRNA solution and the lipid solution are heated separately to a predetermined temperature before mixing. In some embodiments, the mRNA solution and the lipid solution are mixed at ambient temperature, and then heated to a predetermined temperature after mixing. In some embodiments, the lipid solution is heated to a predetermined temperature and mixed with the mRNA solution at ambient temperature. In some embodiments, the mRNA solution is heated to a predetermined temperature and mixed with the lipid solution at ambient temperature.

[0087] In some embodiments, the mRNA solution is heated to a predetermined temperature by adding the mRNA stock solution at ambient temperature to a heated buffer solution to achieve the desired predetermined temperature.

[0088] The mRNA solution and lipid solution may be mixed using a pump. Since the encapsulation procedure can occur on a wide range of scales, different types of pumps may be used to adapt to the desired scale. However, generally, it is preferable to use a low-pulse flow pump. As used herein, a low-pulse flow pump refers to any pump capable of establishing a continuous flow at a stable flow rate. Suitable pump types include, but are not limited to, gear pumps and centrifugal pumps. Exemplary gear pumps include, but are not limited to, gear pumps from Cole-Parmer or Diener. Exemplary centrifugal pumps include, but are not limited to, those manufactured by Grainger or Cole-Parmer.

[0089] The mRNA solution and the lipid solution may be mixed at various flow rates. Typically, the mRNA solution may be mixed in a larger proportion than the lipid solution. For example, the mRNA solution may be mixed in a proportion at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 times greater than that of the lipid solution.

[0090] The optimal flow rate for mixing may be determined based on the scale. In some embodiments, the mRNA solution is mixed at approximately 40-400 ml / min, 60-500 ml / min, 70-600 ml / min, 80-700 ml / min, 90-800 ml / min, 100-900 ml / min, 110-1000 ml / min, 120-1100 ml / min, 130-1200 ml / min, 140-1300 ml / min, and 150-1400 ml. The mRNA solution is mixed at flow rates ranging from 160-1500 ml / min, 170-1600 ml / min, 180-1700 ml / min, 150-250 ml / min, 250-500 ml / min, 500-1000 ml / min, 1000-2000 ml / min, 2000-3000 ml / min, 3000-4000 ml / min, or 4000-5000 ml / min. In some embodiments, the mRNA solution is mixed at flow rates ranging from approximately 200 ml / min, approximately 500 ml / min, approximately 1000 ml / min, approximately 2000 ml / min, approximately 3000 ml / min, and approximately 4000 ml / min. The mixture is mixed at a flow rate of l / min, or approximately 5000 ml / min.

[0091] In some embodiments, the lipid solution is mixed at flow rates ranging from approximately 25–75 ml / min, 20–50 ml / min, 25–75 ml / min, 30–90 ml / min, 40–100 ml / min, 50–110 ml / min, 75–200 ml / min, 200–350 ml / min, 350–500 ml / min, 500–650 ml / min, 650–850 ml / min, or 850–1000 ml / min. In some embodiments, the lipid solution is mixed at a flow rate of approximately 50 ml / min, 100 ml / min, 150 ml / min, 200 ml / min, 250 ml / min, 300 ml / min, 350 ml / min, 400 ml / min, 450 ml / min, 500 ml / min, 550 ml / min, 600 ml / min, 650 ml / min, 700 ml / min, 750 ml / min, 800 ml / min, 850 ml / min, 900 ml / min, 950 ml / min, or 1000 ml / min.

[0092] Typically, mRNA solutions and lipid solutions are mixed in the solution so that the lipids can form nanoparticles that encapsulate the mRNA. Such solutions are also referred to as formulations or encapsulation solutions. Suitable formulations or encapsulation solutions may be solvent-based, such as ethanol. For example, suitable formulations or encapsulation solutions may be based on about 10% ethanol, about 15% ethanol, about 20% ethanol, about 25% ethanol, about 30% ethanol, about 35% ethanol, or about 40% ethanol.

[0093] A suitable formulation or encapsulation solution may be based on a solvent such as isopropyl alcohol. For example, a suitable formulation or encapsulation solution may be based on about 10% isopropyl alcohol, about 15% isopropyl alcohol, about 20% isopropyl alcohol, about 25% isopropyl alcohol, about 30% isopropyl alcohol, about 35% isopropyl alcohol, or about 40% isopropyl alcohol.

[0094] A suitable formulation or encapsulation solution may be based on a solvent such as dimethyl sulfoxide. For example, a suitable formulation or encapsulation solution may be based on about 10% dimethyl sulfoxide, about 15% dimethyl sulfoxide, about 20% dimethyl sulfoxide, about 25% dimethyl sulfoxide, about 30% dimethyl sulfoxide, about 35% dimethyl sulfoxide, or about 40% dimethyl sulfoxide.

[0095] A suitable formulation or encapsulated solution may also contain buffers or salts. Exemplary buffers may include HEPES, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate, and sodium phosphate. Exemplary salts may include sodium chloride, magnesium chloride, and potassium chloride.

[0096] purification Typically, after formulation and encapsulation, lipid nanoparticles are purified and / or concentrated. Various purification techniques may be used. In some embodiments, lipid nanoparticles are purified using tangential flow filtration. Tangential flow filtration (TFF), also called cross-flow filtration, is a type of filtration in which the material being filtered passes tangentially rather than through the filter. In TFF, undesirable permeate passes through the filter, while the desired retained material passes along the filter and is collected downstream. In contrast to what is typically encountered in conventional dead-end filtration, it is important to note that in TFF, the desired material is typically contained within the retained material.

[0097] Depending on the material being filtered, TFFs are used for either microfiltration or ultrafiltration. Microfiltration is typically defined as a case where the filter has pore sizes ranging from 0.05 μm to 1.0 μm, with the extreme values ​​being between 0.05 μm and 1.0 μm, while ultrafiltration is typically defined as... This inevitably includes filters with pore sizes less than 0.05 μm. The pore size also determines the nominal molecular weight cutoff (NMWL), also known as the molecular weight cutoff (MWCO) for a particular filter. Typically, microfiltration membranes have an NMWL greater than 1,000 kilodaltons (kDa), while ultrafiltration filters have an NMWL between 1 kDa and 1,000 kDa.

[0098] The main advantage of tangential flow filtration is that impermeable particles (sometimes called "filtration cake") that can aggregate and block the filter during conventional "dead-end" filtration are instead carried along the surface of the filter. This advantage generally eliminates the need to remove and clean the filter, thus significantly reducing downtime, making tangential flow filtration widely usable in industrial processes requiring continuous operation.

[0099] Tangential flow filtration can be used for several purposes, including concentration and diafiltration. Concentration is a process in which the solvent is removed from a solution while solute molecules are retained. To efficiently concentrate a sample, membranes with NMWL or MWCO substantially lower than the molecular weight of the solute molecules to be retained are used. Typically, those skilled in the art can select filters with NMWL or MWCO 3 to 6 times lower than the molecular weight of the target molecule(s).

[0100] Diafiltration is a fractionation process that allows small, undesirable particles to pass through a filter, while larger, desired nanoparticles are retained in the retained material without changing the concentration of those nanoparticles in the solution. Diafiltration is often used to remove salts or reaction buffers from a solution. Diafiltration may be continuous or discontinuous. In continuous diafiltration, the diafiltration solution is added to the sample at the same rate as the filtrate is produced. In discontinuous diafiltration, the solution is first diluted and then concentrated back to its starting concentration. Discontinuous diafiltration may be repeated until the desired concentration of nanoparticles is reached.

[0101] The purified and / or concentrated lipid nanoparticles may be formulated in a desired buffer, such as PBS.

[0102] Providing nanoparticles that encapsulate mRNA. The process according to the present invention results in more homogeneous and smaller particle size (e.g., less than 100 nm) and significantly improved encapsulation efficiency and / or mRNA recovery rate compared to conventional processes.

[0103] Therefore, the present invention provides compositions comprising purified nanoparticles as described herein. In some embodiments, the majority of the purified nanoparticles in the composition, i.e., more than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified nanoparticles, have a size of less than about 100 nm (e.g., about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, or less than about 50 nm). In some embodiments, substantially all of the purified nanoparticles have a size of less than 100 nm (e.g., about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, or less than about 50 nm).

[0104] In addition, more homogeneous nanoparticles with a narrower nanoparticle size range are achieved by the process of the present invention. For example, about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and over 99% of the purified nanoparticles in the composition provided by the present invention. However, they have a size in the range of approximately 40–90 nm (e.g., approximately 40–85 nm, approximately 40–80 nm, approximately 40–75 nm, approximately 40–70 nm, approximately 40–65 nm, or approximately 40–60 nm). In some embodiments, substantially all purified nanoparticles have a size in the range of approximately 40–90 nm (e.g., approximately 40–85 nm, approximately 40–80 nm, approximately 40–75 nm, approximately 40–70 nm, approximately 40–65 nm, or approximately 40–60 nm).

[0105] In some embodiments, the dispersibility of nanoparticles in the composition provided by the present invention, or the measure of homogeneity in molecular size (PDI), is less than about 0.16 (e.g., less than about 0.15, 0.14, 0.13, 0.12, 0.11, 0.10, 0.09, or 0.08).

[0106] In some embodiments, about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or more than 99% of the purified lipid nanoparticles in the composition provided by the present invention encapsulate mRNA within each individual particle. In some embodiments, substantially all of the purified lipid nanoparticles in the composition encapsulate mRNA within each individual particle.

[0107] In some embodiments, the composition according to the present invention contains at least about 1 mg, 5 mg, 10 mg, 100 mg, 500 mg, or 1000 mg of encapsulated mRNA. In some embodiments, the process according to the present invention results in the recovery of more than about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of mRNA. [Examples]

[0108] While certain compounds, compositions, and methods of the present invention are described with specificity according to certain embodiments, the following examples serve merely as illustrations of the compounds of the present invention and are not intended to limit them.

[0109] Example 1. Effect of temperature on the nanoparticle encapsulation process This embodiment demonstrates that increasing the temperature during the nanoparticle encapsulation process results in an increase in yield and / or encapsulation efficiency.

[0110] lipid material The formulations described in the following examples contain, unless otherwise specified, a multi-component lipid mixture in various ratios employing one or more cationic lipids, helper lipids (e.g., non-cationic lipids and / or cholesterol lipids), and PEGylated lipids designed to encapsulate various nucleic acid materials. Cationic lipids for this process include DOTAP (1,2-dioleyl-3-trimethylammoniumpropane), DODAP (1,2-dioleyl-3-dimethylammoniumpropane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammoniumpropane), and DLinDMA (Heyes, J.; Palmer, L.; Bremner, K.; MacLachlan, I. “Cationic Lipid saturation influences intracellular delivery of encapsulated nucleic acids (J.Contr.Rel. 2005, 107, 276-287), DLin-KC2-DMA (Semple, SC et al., "Rational Design of Cationic Lipids for siRNA Delivery," Nature Biotech. 2010, 28, 172-176), C12-200 (Love, KT et al., "Lipid-like materials for low-dose in vivo gene silencing," PNAS 2010, 107, 1864-1869), cKK-E12 (3,6-bis(4-(bis(2-hydroxydodecyl) This includes, but is not limited to, amino)butyl)piperazine-2,5-dione), HGT5000, HGT5001, HGT4003, ICE, dialkylamino compounds, imidazole compounds, guanidium compounds, etc. Helper lipids may include, but are not limited to, DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimiristoyl-sn-glycero-3-phosphoethanolamine), DOPG (2-dioleoyl-sn-glycero-3-phospho(1'-rac-glycerol)), cholesterol, etc. PEGylated lipids may include, but are not limited to, poly(ethylene) glycol chains up to 5 kDa in length, covalently attached to the lipid by C6-C20 alkyl chains(s).

[0111] Messenger RNA material Codon-optimized human spinal motor neuron 1 (SMN) messenger RNA, argininosuccinate synthase (ASS1) messenger RNA, modified cystic fibrosis membrane conductance regulator (SNIM® CFTR, 25% pseudouridine, 25% 5-methylcytidine) messenger RNA, firefly luciferase (FFL) messenger RNA, factor IX (FIX) messenger RNA, phenylalanine hydroxylase (PAH) messenger RNA, and alpha-galactosidase (GLA) messenger RNA were synthesized by in vitro transcription from gene-encoding plasmid DNA templates, and subsequently, 5' cap structures (cap 1) were created (Fechter, P.; Brownlee, GG “Recognition of mRNA cap structures by viral and cellular proteins” J. Gen. Virology). A 3' poly-A tail approximately 250 nucleotides long was added, as determined by (2005, 86, 1239-1249) and gel electrophoresis. The 5' and 3' untranslated regions present in each mRNA product are represented as X and Y, respectively, and defined as described (below). Codon-optimized human spinal motor neuron 1 (SMN) mRNA: XAUGGCCAUGAGCAGCGGAGGCAGCGGCGGAGGAGUGCCCGAGCAGGAGGACAGCGUGCUGUUCAGGAGAGGCACCGGCCAGAGCGAUGAGCGAUAUCUGGGACGAUACCGCUCUGAUCAAGGCCUACGACAAGGCCGUGGCCAGCUUCAAGCACGCCCUGAAAAACGGCGACAUCUGCGAGACCAGCGGCAAGCCCA AGACAACCCCCAAGAGAAAGCCCGCCAAGAGAAUAAGAGCCAGAAAAAGAACACCGCGCCAGCCUGCAGCAGUGGAAGGUGGGCGACAAGUCAGCGCCAUCUGGAGCGAGGACGGCUGCAUCUACCCCGCCACCAUCGCCAUGCAUCGACUUCAAGAGAGAGACCUGCGUGGUCGUGUACACGGCUACGGCAACACA GAGGAGCAGAACCUGAGCGACCUGUGCCCCAUUUGUGAGGUGGCCAAUAAACAUCGAACAGACGCCCAGGAGAACGAGAAUGAAAGCCAGGUGAGCACCGACGAGAGCAGAACAGCAUGUCCUCCCUUGGAACAGCUUCCUCCUCCUCCACCAUGCCCGGACCAGACUGGGACCCGGAAACCUGGCCUGAGUUCAACGGACCACCCCCUCCCUCCCACCUCUCUCUCUCUCUCUCUCUCUCUCCCACGGACCCCCUAUAUCCCACCACCCCCUCCAUCUGCCCCUCCAUCUCCCCGACUCCCCGACUCCCCGACUCGCCCUGACGCCGAGCAGCCGAGCAGCCGAGCAGCCGAGCAGCCGAGCAUGCCUGAUCAUCCU GGUACAUGAGCGGCUACCACACAGGAUACUACAUGGGCUUCAGACAGAACCAGAAGGGAGGCAGAUGCUCCCACUCCCUGAACUGAY ヒトカルファ-ガラクトシダーズ(GLA)mRNA: Codon-optimized human argininosuccinate synthase (ASS1) mRNA: XAUGAGCAGCAAGGGCAGCGUGGUGCUGGCCUACAGCGGCGGCCUGGACACCAGCUGCAUCCUGGUGUGGCUGAAGGAGCAGGGCUACGACGUGAUCGCCUACCUGGCCAACAUCGGCCAGAAGGAGGACUUCGAGGAGGCCCGCAAGAAGGCCCUGAAGCUGGGCGCCAAGAAGGUGUUCAUCGAGGACGUGAGCCGCGAGUUCGUGGAGGAGUUCAUCUGGCCCGCCAUCCAGAGCAGCGCCCUGUACGAGGACCGCUACCUGCUGGGCACCAGCCUGGCCCGCCCCUGCAUCGCCCGCAAGCAGGUGGAGAUCGCCCAGCGCGAGGGCGCCAAGUACGUGAGCCACGGCGCCACCGGCAAGGGCAACGACCAGGUGCGCUUCGAGCUGAGCUGCUACAGCCUGGCCCCCCAGAUCAAGGUGAUCGCCCCCUGGCGCAUGCCCGAGUUCUACAACCGCUUCAAGGGCCGCAACGACCU GAUGGAGUACGCCAAGCAGCACGGCAUCCCCAUCCCCGUGACCCCCAAGAACCCCUGGAGCAUGGACGAGAACCUGAUGCACAUCAGCUACGAGGCCGGCAUCCUGGAGAACCCCAAGAACCAGGCCCCCCCCGGCCUGUACACCAAGACCCAGGACCCCGCCAAGGCCCCCAACACCCCCGACAUCCUGGAGAUCGAGUUCAAGAAGGGCGUGCCCGUGAAGGUGACCAACGUGAAGGACGGCACCACCCACCAGACCAGCCUGGAGCUGUUCAUGUACCUGAACGAGGUGGCCGGCAAGCACGGCGUGGGCCGCAUCGACAUCGUGGAGAACCGCUUCAUCGGCAUGAAGAGCCGCGGCAUCUACGAGACCCCCGCCGGCACCAUCCUGUACCACGCCCACCUGGACAUCGAGGCCUUCACCAUGGACCGCGAGGUGCGCAAGAUCAAGCAGGGCCUGGGCCUGAAGUUCGCCGAGCUGGUGUACACCGGCUUCUGGCACAGCCCCGAGUGCGAGUUCGUGCGCCACUGCAUCGCCAAGAGCCAGGAGCGCGUGGAGGGCAAGGUGCAGGUGAGCGUGCUGAAGGGCCAGGUGUACAUCCUGGGCCGCGAGAGCCCCCUGAGCCUGUACAACGAGGAGCUGGUGAGCAUGAACGUGCAGGGCGACUACGAGCCCACCGACGCCACCGGCUUCAUCAACAUCAACAGCCUGCGCCUGAAGGAGUACCACCGCCUGCAGAGCAAGGUGACCGCCAAGUGAY Codon-optimized firefly luciferase mRNA: GCGGCGAGCUGUGCGUCCGUGGCCCCAUGAUCAUGAGCGGCUACGUUAACAACCCCGAGGCUACAAACGCUCUCAUCGACAAGGACGGCUGGCUGCACAGCGGCGACAUCGCCUACUGGGACGAGGACGAGCACUUCUUCAUCGUGGACCGGCUGAAGAGCCUGAUCAAAUACAAGGGCUACCAGGUAGCCCCAGCCGAACUGGAGAGCAUCCUGCUGCAACACCCCAACAUCUUCGACGCCGGGGUCGCCGGCCUGCCCGACGACGAUGCCGGCGAGCUGCCCGCCGCAGUCGUCGUGCUGGAACACGGUAAAACCAUGACCGAGAAGGAGAUCGUGGACUAUGUGGCCAGCCAGGUUACAACCGCCAAGAAGCUGCGCGGUGGUGUUGUGUUCGUGGACGAGGUGCCUAAAGGACUGACCGGCAAGUUGGACGCCCGCAAGAUCCGCGAGAUUCUCAUUAAGGCCAAGAAGGGCGGCAAGAUCGCCGUGUAAY Human Factor IX (FIX) mRNA: Codon-optimized human phenylalanine hydroxylase (PAH) mRNA: Codon-optimized cystic fibrosis transmembrane conductance regulator (CFTR) mRNA: AUGCAGCGGUCCCCGCUCGAAAAGGCCAGUGUCGUGUCCAAACUCUUCUUCUCAUGGACUCGGCCUAUCCUUAGAAAGGGGUAUCGGCAGAGGCUUGAGUUGUCUGACAUCUACCAGAUCCCCUCGGUAGAUUCGGCGGAUAACCUCUCGGAGAFTERWORDCUCGAACGGGAAUGGGACCGCGAACUCGCGUCUAAGAAAAACCCGAAGCUCAUCAACGCACUGAGAAGGUGCUUCUUCUGGCGGUUCAUGUUCUACGGUAUCUUCUUGUAUCUCGGGGAGGUCACAAAAGCAGUCCAACCCCUGUUGUUGGGUCGCAUUAUCGCCUCGUACGACCCCGAUAACAAAGAAGAACGGAGCAUCGCGAUCUACCUCGGGAUCGGACUGUGUUUGCUUUUCAUCGUCAGAACACUUUUGUUGCAUCCAGCAAUCUUCGGCCUCCAUCACAUCGGUAUGCAGAUGCGAAUCGCUAUGUUUAGCUUGAUCUACAAAAAGACACUGAAACUCUCGUCGCGGGUGUUGGAUAAGAUUUCCAUCGGUCAGUUGGUGUCCCUGCUUAGUAAUAA It should be noted that there seems to be an "AFTERWORD" in the original sequence in ID=3 which might be an error or something unexpected. If this is a real part of the sequence, it should be translated as "后记" but it's not clear how it fits in the context of this patent text. 5' and 3' UTR sequences X= GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACACCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUCCCCGUGCCAAGAGUGACUCACCGUCCUUGACACG Y=CGGGUGGCAUCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAAGUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUCAAGCU

[0112] Lipid nanoparticle formulations Ethanol solutions of lipid mixtures (cationic lipids, helper lipids, diionic lipids, PEG lipids, etc.) were prepared, brought to the reported volume, and heated to the selected temperature. Separately, a buffered aqueous solution of mRNA (10 mM citrate / 150 mM NaCl, pH 4.5) was prepared from a 1 mg / mL stock solution and heated to the selected temperature for 5-10 minutes.

[0113] For small-scale formulations, the lipid solution was rapidly injected into an mRNA aqueous solution using a syringe pump (3.71 mL / sec), and the resulting suspension was shaken to obtain 20% ethanol containing lipid nanoparticles. The resulting nanoparticle suspension was diafiltration with 1×PBS (pH 7.4), concentrated, and stored at 2–8°C.

[0114] Typical example at 25℃ Fixed volumes of 50 mg / mL ethanolic solutions of cKK-E12, DOPE, Chol, and DMG-PEG2K were mixed and diluted with ethanol to a final volume of 3 mL. Separately, a buffered aqueous solution of FFL mRNA (10 mM citrate / 150 mM NaCl, pH 4.5) was prepared from a 1 mg / mL stock solution. The lipid solution was rapidly injected into the mRNA aqueous solution and shaken to obtain a final suspension in 20% ethanol. The resulting nanoparticle suspension was filtered, diafiltration with 1×PBS (pH 7.4), concentrated, and stored at 2-8°C. Final concentration = 0.20 mg / mL FFL mRNA (encapsulated). Z ave =91nm PDI(0.16).

[0115] Formulation at 37℃ Fixed volumes of 50 mg / mL ethanolic solutions of cKK-E12, DOPE, Chol, and DMG-PEG2K were mixed and diluted with ethanol to a final volume of 3 mL. Separately, a buffered aqueous solution of FIX mRNA (10 mM citrate / 150 mM NaCl, pH 4.5) was prepared from a 1 mg / mL stock solution. The lipid solution was rapidly injected into the mRNA aqueous solution and shaken to obtain a final suspension in 20% ethanol. The resulting nanoparticle suspension was filtered, diafiltration with 1×PBS (pH 7.4), concentrated, and stored at 2-8°C. Final concentration = 0.20 mg / mL FIX mRNA (encapsulated). Z ave =64nm; PDI(0.12).

[0116] Formulation at 65℃ Fixed volumes of 50 mg / mL ethanolic solutions of cKK-E12, DOPE, Chol, and DMG-PEG2K were mixed and diluted with ethanol to a final volume of 3 mL. Separately, a buffered aqueous solution of FIX mRNA (10 mM citrate / 150 mM NaCl, pH 4.5) was prepared from a 1 mg / mL stock solution. The lipid solution was rapidly injected into the mRNA aqueous solution and shaken to obtain a final suspension in 20% ethanol. The resulting nanoparticle suspension was filtered, diafiltration with 1×PBS (pH 7.4), concentrated, and stored at 2-8°C. Final concentration = 0.20 mg / mL FIX mRNA (encapsulated). Zave =73nm; PDI(0.13).

[0117] The effect of temperature on the nanoparticle encapsulation process Both ethanol-lipid solutions and mRNA buffer solutions (10 mM citrate / 150 mM NaCl, pH 4.5) were heated at different select temperatures before the formulation process to determine the effect of temperature on the final yield and encapsulation efficiency of the formulation.

[0118] The effect of temperature on the nanoparticle formulation process was evaluated in terms of size, size dispersibility, encapsulation efficiency, and yield (or recovery). Exemplary data are shown in Table 1. As can be seen, increases in temperature (e.g., above ambient temperature) result in increased encapsulation efficiency and / or yield / recovery, as well as decreased particle size and / or size dispersibility. [Table 1]

[0119] Example 2. Larger-scale formulation process This embodiment illustrates an exemplary scaled-up formulation process for encapsulating mRNA at increased temperatures.

[0120] Figure 1 shows an exemplary scaled-up formulation process. An Ismatec programmable digital drive pump (Cole Parmer model CP78008-10) was used. A Micropump A-mount aspiration shoe pump head 316 SS body / graphite gear / PTFE seal, 0.084 mL / rev, no internal bypass (Cole Parmer part number 07002-27) and Pharma Pure tube size #14, 0.06" ID, 1 / 16" (Spectrum Labs part number ACTU-P14) (-25N) was used.

[0121] Nanoparticle formulations and mRNA encapsulation are prepared by mixing the mRNA with an ethanol-lipid solution in citrate buffer (10 mM citrate buffer, 150 mM NaCl, pH 4.5) using a "T" junction (or "Y" junction). Exemplary flow rates for the mRNA-containing citrate buffer and the lipid-containing ethanol solution are 200 ml / min and 50 ml / min, respectively. Both pumps are started simultaneously during this process. The initial and final fractions of the formulation were discarded, and only the intermediate formulation was collected. Precise flow rate and low pulse flow are two critical parameters of this process.

[0122] Purification and buffer exchange The formulations obtained from the above steps are purified and their buffers are exchanged using a KrosFlo® Research IIi tangential flow filtration system from Spectrum Labs, employing a modified polyethersulfone hollow fiber filter module. Buffer exchange is performed with 6x volume sterile PBS (pH 7.4) in a continuous diafiltration configuration. See Figure 2. The formulations are analyzed for size (PDI) and encapsulation (yield). Exemplary data are shown in Table 2. [Table 2-1] [Table 2-2]

[0123] This process enables the achievement of a very narrow particle size range and high encapsulation efficiency (e.g., an average of over 90%).

[0124] To examine the importance of low-pulse homogeneous flow, a peristaltic pump with some pulsating flow was used for the formulation process. See Figure 3. Citrate buffer containing mRNA and pure ethanol containing lipids were mixed at flow rates of 200 ml / min and 50 ml / min, respectively. Exemplary results are shown in Table 3. As can be seen, the use of a peristaltic pump in this process results in formulations of larger nanoparticles. This is likely due to heterogeneous mixing caused by the pulsating flow. [Table 3]

[0125] Equivalents and Scope Those skilled in the art will recognize, or can verify by ordinary experiment alone, many equivalents to the specific embodiments of the invention described herein. The scope of the invention is not intended to be limited by the foregoing description, but is expressed in the following claims.

Claims

1. A process for encapsulating messenger RNA (mRNA) within lipid nanoparticles, wherein the process involves, The step includes mixing the mRNA solution and the lipid solution; Here, the mRNA solution is mixed at a flow rate ranging from 150 to 5000 ml / min; The lipid solution is mixed at a flow rate in the range of 25 to 1000 ml / min; The process wherein the mRNA solution and / or lipid solution are at a predetermined temperature above ambient temperature, and the mRNA solution and lipid solution are mixed by a low-pulse flow pump.

2. The process according to claim 1, wherein the predetermined temperature is approximately 30°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, or 70°C or higher.

3. The aforementioned predetermined temperatures are approximately 25-70°C, approximately 30-70°C, approximately 35-70°C, and approximately 40-70°C. Claim 1, which is in the range of °C, approximately 45 to 70°C, approximately 50 to 70°C, or approximately 60 to 70°C. Or the process described in 2.

4. The process according to any one of claims 1 to 3, wherein the predetermined temperature is approximately 65°C.

5. The process according to any one of claims 1 to 4, wherein the mRNA solution and the lipid solution are heated separately to the predetermined temperature before mixing.

6. The process according to any one of claims 1 to 4, wherein, before the mixing, the mRNA solution is heated to the predetermined temperature and the lipid solution is at ambient temperature.

7. The process according to any one of claims 1 to 6, wherein the mRNA stock solution at ambient temperature is added to a heated buffer solution and brought to the predetermined temperature, thereby heating the mRNA solution to the predetermined temperature.

8. The process according to claim 7, wherein the buffer solution has a pH of approximately 4.5 or less.

9. The process according to any one of claims 1 to 8, wherein the pump is a gear pump.

10. The process according to any one of claims 1 to 8, wherein the pump is a centrifugal pump.

11. The process according to any one of claims 1 to 10, wherein the mRNA solution is mixed at a flow rate in the range of approximately 150 to 250 ml / min, 250 to 500 ml / min, 500 to 1000 ml / min, 1000 to 2000 ml / min, 2000 to 3000 ml / min, 3000 to 4000 ml / min, or 4000 to 5000 ml / min, or is mixed at a flow rate of approximately 200 ml / min, approximately 500 ml / min, approximately 1000 ml / min, approximately 2000 ml / min, approximately 3000 ml / min, approximately 4000 ml / min, or approximately 5000 ml / min.

12. The lipid solution is mixed at a flow rate in the range of approximately 25-75 ml / min, approximately 75-200 ml / min, approximately 200-350 ml / min, approximately 350-500 ml / min, approximately 500-650 ml / min, approximately 650-850 ml / min, or approximately 850-1000 ml / min, or The process according to any one of claims 1 to 11, wherein the mixture is mixed at a flow rate of approximately 50 ml / min, approximately 100 ml / min, approximately 150 ml / min, approximately 200 ml / min, approximately 250 ml / min, approximately 300 ml / min, approximately 350 ml / min, approximately 400 ml / min, approximately 450 ml / min, approximately 500 ml / min, approximately 550 ml / min, approximately 600 ml / min, approximately 650 ml / min, approximately 700 ml / min, approximately 750 ml / min, approximately 800 ml / min, approximately 850 ml / min, approximately 900 ml / min, approximately 950 ml / min, or approximately 1000 ml / min.

13. The process according to any one of claims 1 to 12, wherein the process includes the step of first producing an mRNA solution by mixing a buffer with an mRNA stock solution.

14. The process according to claim 13, wherein the buffer is a citrate buffer.

15. The process according to claim 14, wherein the citrate buffer comprises about 10 mM citrate, about 150 mM NaCl, and a pH of about 4.

5.

16. The process according to any one of claims 13 to 15, wherein the mRNA stock solution contains the mRNA at concentrations of approximately 1 mg / ml, approximately 10 mg / ml, approximately 50 mg / ml, and approximately 100 mg / ml or higher.

17. The process according to any one of claims 13 to 16, wherein the lipid solution comprises one or more cationic lipids, one or more helper lipids, one or more cholesterol-based lipids, and PEG lipids in ethanol.

18. The process according to any one of claims 13 to 17, wherein the mRNA solution and the lipid solution are mixed in 20% ethanol to yield a suspension of lipid nanoparticles.

19. The process according to claim 18, wherein the lipid nanoparticles are further purified by tangential flow filtration.

20. The process according to claim 19, wherein more than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified nanoparticles, or substantially all of the purified nanoparticles, have a size of less than 100 nm.

21. The process according to claim 19 or 20, wherein about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and more than 99% of the purified nanoparticles, or substantially all of the purified nanoparticles, have a size in the range of 50 to 80 nm.

22. The process according to any one of claims 19 to 21, wherein the purified nanoparticles have an encapsulation rate greater than approximately 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%.

23. The process according to any one of claims 1 to 22, wherein the process results in the recovery of more than approximately 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of mRNA.

24. The process according to claim 17, wherein the one or more cationic lipids are selected from the group consisting of C12-200, MC3, DLinDMA, DLinC2DMA, cKK-E12, ICE (imidazole type), HGT5000, HGT5001, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLInDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, HGT4003, and combinations thereof.

25. The process according to claim 17, wherein the one or more noncationic lipids are selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleyl-sn-glycero-3-phosphotidylcholine)DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), and DOPG (2-dioleoyl-sn-glycero-3-phospho(1'-rac-glycerol)).

26. The process according to claim 17, wherein the one or more cholesterol-based lipids are cholesterol or PEGylated cholesterol.

27. The one or more PEG-modified lipids mentioned above are C 6 -C 20 It has alkyl chains of a certain length (multiple chains are possible). The process according to claim 17, comprising poly(ethylene) glycol chains covalently attached to the lipid, with a maximum length of 5 kDa.

28. The process according to any one of claims 1 to 27, wherein the mRNA comprises one or more modified nucleotides.

29. The process according to any one of claims 1 to 28, wherein the mRNA is unmodified.

Images