Oral components
The oral composition with cinnamaldehyde, arginine, and galactose-containing oligosaccharide addresses the imbalance in oral microbiota by selectively suppressing pathogenic bacteria and promoting non-pathogenic bacteria, improving oral health and preventing diseases.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2022-06-30
- Publication Date
- 2026-04-07
AI Technical Summary
Existing oral compositions fail to selectively inhibit the growth of pathogenic bacteria while promoting non-pathogenic bacteria, thereby failing to maintain a balanced oral microbiota, which is crucial for preventing and suppressing oral diseases.
An oral composition containing cinnamaldehyde, arginine, and an oligosaccharide with galactose as a constituent sugar, which selectively suppresses pathogenic bacteria and promotes non-pathogenic bacteria, particularly Streptococcus oralis, to improve the oral microbiota balance.
The composition effectively increases the proportion of non-pathogenic bacteria, enhancing the balance of oral microbiota and preventing oral diseases such as dental caries and periodontal disease by selectively inhibiting pathogenic bacteria like Fusobacterium nucleatum and promoting Streptococcus oralis growth.
Smart Images

Figure 0007841967000001 
Figure 0007841967000002 
Figure 0007841967000003
Abstract
Description
Technical Field
[0006] , , ,
[0001] The present invention relates to an oral composition.
Background Art
[0002] Streptococcus oralis (hereinafter also referred to as S. oralis) is known as one of the non - pathogenic bacteria among the bacteria in the oral cavity. S. oralis belongs to the mitis group of the genus Streptococcus. Other bacterial species belonging to the mitis group are also classified as non - pathogenic bacteria, like S. oralis.
[0003] Patent Document 1 discloses an oral composition that selectively inhibits the growth of pathogenic bacteria without affecting the growth of bacterial species belonging to the mitis group of the genus Streptococcus. That is, an oral composition having a selective antibacterial action against pathogenic bacteria in the oral cavity is disclosed. As described in Patent Document 1, it is known that increasing the proportion of non - pathogenic bacteria in the oral flora to improve the oral flora balance is useful for preventing and suppressing the progression of oral diseases.
Prior Art Documents
Patent Documents
[0004]
Patent Document 1
Summary of the Invention
[0007] The above oral composition preferably increases the proportion of non-pathogenic bacteria by selectively suppressing the growth of pathogenic bacteria among pathogenic bacteria and non-pathogenic bacteria in the oral cavity.
[0008] The above oral composition preferably increases the proportion of non-pathogenic bacteria by selectively promoting the growth of non-pathogenic bacteria among pathogenic bacteria and non-pathogenic bacteria in the oral cavity. [Effects of the Invention]
[0009] The oral composition of the present invention can improve the effect of improving the balance of the bacterial flora in the oral cavity. [Modes for carrying out the invention]
[0010] The following describes one embodiment of the oral composition. The oral composition of this embodiment contains cinnamaldehyde, arginine, and an oligosaccharide containing galactose as a constituent sugar, and is intended to improve the balance of the bacterial flora in the oral cavity.
[0011] <Cinnamaldehyde> The oral composition contains cinnamaldehyde, a type of aromatic aldehyde. Cinnamaldehyde is an extract obtained, for example, from cinnamon. Cinnamon can be obtained from the bark of trees belonging to the genus Cinnamomum in the family Lauraceae.
[0012] The oral composition may contain one type of cinnamon-derived cinnamaldehyde, or it may contain a combination of two or more types of cinnamon-derived cinnamaldehyde.
[0013] The method for extracting cinnamaldehyde is not particularly limited, and any known extraction method may be used as appropriate. The cinnamaldehyde contained in the oral composition may be purified after extraction.
[0014] Cinnamaldehyde may be used in a chemically synthesized form. Cinnamaldehyde may also be used in combination with an extract and a chemically synthesized form. The cinnamaldehyde content in the oral composition is not particularly limited, but is, for example, 0.01% by mass or more and 0.4% by mass or less. Hereinafter, the content of each component in the oral composition will be expressed using "%" instead of "% by mass". The upper limit of the cinnamaldehyde content is preferably 0.3%, more preferably 0.2%. The lower limit of the cinnamaldehyde content is preferably 0.05%, more preferably 0.1%.
[0015] <Arginine> The oral composition contains arginine, a type of amino acid. Specific examples of arginine are not particularly limited, but include, for example, L-arginine and dihydroxypropylarginine. These arginines may also be in the form of salts, such as hydrochloride salts.
[0016] The oral composition may contain, in addition to arginine, one or more other amino acids in combination. The arginine content in the oral composition is not particularly limited, but is, for example, 0.5% to 2.0%. The upper limit of the above content is preferably 1.75%, more preferably 1.5%. The lower limit of the above content is preferably 0.75%, more preferably 1.0%.
[0017] <Sugars> The oral composition contains oligosaccharides, which include galactose as a constituent sugar. An oligosaccharide containing galactose as a constituent sugar is a compound in which two or more monosaccharides are combined into one molecule by a glycosidic bond, and specifically refers to a specific oligosaccharide in which one or more of the monosaccharides constituting this compound are galactose.
[0018] As the oligosaccharide containing galactose as a constituent sugar, lactose, which is a kind of disaccharide, is preferable. Other examples include melibiose, raffinose, stachyose, galactooligosaccharide, soybean oligosaccharide, lactulose oligosaccharide, milk oligosaccharide, and the like.
[0019] The oral composition may contain one kind of the above oligosaccharide, or may contain a combination of two or more kinds of the above oligosaccharides. The oral composition may contain the above oligosaccharide as a hydrate.
[0020] In addition to the oligosaccharide containing galactose as a constituent sugar, the oral composition may contain a combination of one or more other sugars. The types of sugars are not particularly limited, and examples include monosaccharides, disaccharides, oligosaccharides, and sugar alcohols.
[0021] Examples of the monosaccharide include, for example, galactose, mannose, arabinose, and their hydrates. Examples of the disaccharide include, for example, maltose, sucrose, and their hydrates.
[0022] Examples of the oligosaccharide include, for example, xylooligosaccharide, gentiobiose oligosaccharide, maltooligosaccharide, cyclic oligosaccharide, and their hydrates. Examples of sugar alcohols include those obtained by industrially reducing the above-mentioned monosaccharides, disaccharides, or oligosaccharides, such as sorbitol, lactitol, reduced isomaltulose (Palatinit (registered trademark)), trehalose, pentaerythritol, dipentaerythritol, tripentaerythritol, arabitol, ribitol, mannitol, threitol, glycerol, talitol, galactitol, allitol, dulcitol, iditol, inositol, maltitol, isomaltitol, and turanitol.
[0023] The content of oligosaccharides containing galactose as a constituent sugar in the oral composition is not particularly limited, but for example, it is 1.0% or more and 4.0% or less. The upper limit value of the above content is preferably 3.0%, more preferably 2.0%. The lower limit value of the above content is preferably 1.5%, more preferably 2.0%.
[0024] In the oral composition, when the content of cinnamaldehyde is within the above numerical range, the content of arginine is within the above numerical range, and the content of lactose is within the above numerical range, the effect of improving the bacterial flora balance in the oral cavity can be enhanced.
[0025] <Application form, use, and dosage form> The application form of the oral composition is not particularly limited, and for example, it can be used as a pharmaceutical product, quasi-drug, or cosmetic. As the use of the oral composition, known ones can be appropriately adopted. For example, chewing agents, orally disintegrating agents, orally dissolving agents, tongue care agents, oral cooling agents, dentifrices, mouth rinses, gargles, liquid dentifrices, biofilm dispersants, halitosis preventives, gingival massage agents, oral wetting agents, tongue coating removers, oral coatings, oral bactericides, throat bactericides, oral and throat agents, periodontal disease therapeutics, denture adhesives, denture coating agents, denture stabilizers, denture preservatives, denture cleaners, implant care agents, etc. can be mentioned as uses.
[0026] The dosage form of the oral composition is not particularly limited, and can be applied to ointments, pastes, pasta preparations, sprays, gels, liquids, suspensions, gums, etc., by including a solvent such as water or alcohol.
[0027] The type of water used as a solvent is not particularly limited; for example, distilled water, pure water, ultrapure water, purified water, tap water, etc., can be used. The type of alcohol used as a solvent is not particularly limited; for example, ethanol can be used. A mixture of water and alcohol can also be used.
[0028] When the oral composition is in liquid form, the content of a solvent such as water is not particularly limited, but it is preferably 60% by mass or more and 99.8% by mass or less, and more preferably 70% by mass or more and 90% by mass or less.
[0029] <Other ingredients> Oral compositions may contain other components besides those mentioned above, depending on the intended use, form, and application. Examples of other components include antibacterial agents, anti-inflammatory agents, fragrances, humectants, abrasives, alcohols, thickeners, sweeteners, medicinal components, colorants, stabilizers, and pH adjusters. Other components that are known to be incorporated into oral compositions may be used. Oral compositions may contain only one of the above-mentioned other components individually, or they may contain two or more in combination.
[0030] Examples of antibacterial agents include cetylpyridinium chloride, parabens, sodium benzoate, triclosan, chlorhexidine hydrochloride, isopropylmethylphenol, benzalkonium chloride, benzethonium chloride, and hinokitiol.
[0031] Examples of anti-inflammatory agents include glycyrrhizinate, tranexamic acid, and ε-aminocaproic acid. Furthermore, it is undesirable for oral compositions to contain components that exhibit a non-selective action, such as killing both pathogenic and non-pathogenic bacteria. Even if an oral composition contains such components, it is preferable that the amount is extremely small, so as to have little effect on the selective antibacterial action of the oral composition.
[0032] Examples of fragrances include anethole, eugenol, carvone, wintergreen, methyl salicylate, thymol, clove oil, sage oil, ocimene oil, and citronellol.
[0033] Examples of abrasives include calcium carbonate, magnesium carbonate, dicalcium phosphate, tricalcium phosphate, magnesium phosphate, silica, zeolite, sodium metaphosphate, aluminum hydroxide, magnesium hydroxide, calcium pyrophosphate, red iron oxide, calcium sulfate, and anhydrous silicic acid.
[0034] Examples of alcohols include ethyl alcohol, lauryl alcohol, and myristyl alcohol. Examples of thickening agents include sodium polyacrylate, carrageenan, sodium carboxymethylcellulose, sodium alginate, xanthan gum, hydroxyethylcellulose, crystalline cellulose, hydroxypropyl methylcellulose, methylcellulose, and propylene glycol alginate.
[0035] Examples of medicinal ingredients include fluorides such as sodium monofluorophosphate, sodium fluoride, stannous fluoride, and strontium fluoride; condensed phosphates such as sodium pyrophosphate and sodium polyphosphate; phosphates such as sodium monohydrogen phosphate and trisodium phosphate; vitamins such as ascorbic acid, sodium ascorbate, pyridoxine hydrochloride, and tocopherol acetate; glucanase enzymes such as dextranase and mutanase; degrading enzymes such as proteases and lysozyme; inorganic salts such as zinc chloride, zinc citrate, strontium chloride, and potassium nitrate; chelating compounds such as chlorophyll and glycerophosphate; lipid-dissolving polyethylene glycol; sodium chloride; and aluminum lactate.
[0036] Examples of coloring agents include legally approved pigments such as Green No. 1, Green No. 3, Blue No. 1, Yellow No. 4, Yellow No. 5, Red No. 102, and Red No. 3, as well as sodium copper chlorophyll and titanium dioxide.
[0037] Examples of stabilizers include sodium edetate, sodium thiosulfate, sodium sulfite, calcium lactate, lanolin, triacetin, castor oil, and magnesium sulfate.
[0038] Examples of pH adjusting agents include citric acid, malic acid, lactic acid, tartaric acid, acetic acid, nitric acid, phosphoric acid, pyrophosphate, glycerophosphate, and various salts thereof such as potassium salts, sodium salts, and ammonium salts, as well as sodium hydroxide. It is preferable that the oral composition is adjusted to have a pH of 4 to 9, and particularly 5 to 7, by incorporating a pH adjusting agent.
[0039] <Mechanism and Effects> The operation of this embodiment will now be described. The effect of oral compositions on improving the balance of the oral bacterial flora is exerted through selective antibacterial action against pathogenic bacteria in the oral cavity.
[0040] For example, the oral composition selectively suppresses the growth of pathogenic bacteria among the pathogenic and non-pathogenic bacteria species in the oral cavity. This increases the proportion of non-pathogenic bacteria.
[0041] Oral pathogenic bacteria include caries pathogens and periodontal pathogens. An example of a caries pathogen is Streptococcus mutans, which belongs to the mutans group of the genus Streptococcus. Examples of periodontal pathogens include Porphyromonas gingivalis of the genus Porphyromonas and Fusobacterium nucleatum of the genus Fusobacterium.
[0042] Oral compositions can also increase the proportion of non-pathogenic bacterial species by selectively inhibiting the growth of Fusobacterium nucleatum (hereinafter referred to as F. nucleatum).
[0043] For example, an oral composition can selectively promote the growth of non-pathogenic bacteria among pathogenic bacteria and non-pathogenic bacteria in the oral cavity. This can increase the proportion of non-pathogenic bacteria in the oral composition.
[0044] Examples of non-pathogenic bacteria in the oral cavity include the mitis group of the genus Streptococcus. These include S. oralis, Streptococcus sanguinis, Streptococcus gordonii, and Streptococcus mitis.
[0045] Oral compositions can also increase the proportion of non-pathogenic bacterial species by selectively promoting the growth of S. oralis. In other words, oral compositions can improve the balance of the oral microbiota by selectively suppressing the growth of pathogenic bacteria while promoting the growth of S. oralis.
[0046] The effects of this embodiment will now be explained. (1) The oral composition contains cinnamaldehyde, arginine, and an oligosaccharide containing galactose as a constituent sugar. This gives the oral composition a selective antibacterial effect against pathogenic bacteria in the oral cavity. The oral composition can increase the proportion of non-pathogenic bacteria in the oral microbiota by suppressing the growth of pathogenic bacteria. For example, the oral composition can improve the balance of the oral microbiota by suitably increasing the proportion of bacteria belonging to the mitis group in the oral microbiota.
[0047] (2) The oral composition can selectively suppress the growth of F. nucleatum. That is, by selectively suppressing the growth of the pathogenic bacterium F. nucleatum, the oral composition can increase the proportion of non-pathogenic bacterial species. Therefore, it can further improve the effect of improving the balance of the bacterial flora in the oral cavity.
[0048] (3) The oral composition can selectively suppress the growth of pathogenic bacteria while selectively promoting the growth of non-pathogenic bacteria. As a result, the oral composition can suitably increase the proportion of non-pathogenic bacterial species in the oral microbiota. For example, the oral composition can suitably improve the balance of the oral microbiota by suitably increasing the proportion of bacterial species belonging to the mitis group in the oral microbiota. In other words, the oral composition can enhance the effect of improving the balance of the oral microbiota.
[0049] (4) The oral composition can selectively promote the growth of S. oralis. That is, by promoting the growth of S. oralis, the proportion of non-pathogenic bacteria belonging to the mitis group can be increased. Therefore, the effect of improving the balance of the bacterial flora in the oral cavity can be further enhanced.
[0050] (5) Oral compositions that improve the oral microbiota by adjusting the balance of the oral microbiota can be used to prevent oral diseases and inhibit the progression of oral diseases. Specifically, they can be used to prevent dental caries, inhibit the progression of dental caries, prevent periodontal disease, and inhibit the progression of periodontal disease. [Examples]
[0051] The oral compositions will be described in more detail based on the following examples. However, the oral compositions are not limited to those described in the Examples section. (Preparation of sample solution) Sample solutions for Comparative Example 1, Comparative Example 2, and Example 1, shown in Table 1, were prepared by mixing each component according to a conventional method. The remainder of each sample solution was sterile distilled water. Sterile distilled water was also prepared as a negative control.
[0052] [Table 1]
[0053] (Evaluation test) We conducted tests to evaluate the effects of each sample solution on the microbial flora by bringing them into contact during the biofilm formation process. The test method is described below.
[0054] Saliva was collected from one subject. Equal parts of the collected non-irritating saliva and glycerin were mixed to create the bacterial source saliva. A portion of the collected non-irritating saliva was placed on ice and UV sterilized to create the pellicle saliva. Both the bacterial source saliva and the pellicle saliva were stored frozen until use.
[0055] Pellicle saliva was dispensed into a 24-well plate. Hydroxyapatite discs (HOYA Technosurgical Co., Ltd.) were placed in the well plate and left to stand at 37°C for 1 hour to coat the surface of the hydroxyapatite discs with a pellicle film. Hereafter, the hydroxyapatite discs will be referred to as HA discs.
[0056] In this study, two systems were prepared: a horizontal system and a vertical system, depending on the orientation of the HA disc within the well. Each sample was tested in each system. The horizontal system involved placing the disc surface of the HA disc at the bottom of the well. The vertical system involved placing the HA disc, fixed with its disc surface vertical, in the well. In subsequent steps, the HA disc was handled according to the orientation of each system. By conducting tests in both the horizontal and vertical systems, evaluations could be performed in a state that simulated the actual oral environment. Specifically, the horizontal system is expected to allow for the construction of an oral plaque model representing a state where plaque has matured for a long period after brushing, or more specifically, an oral plaque model representing a state where intermediate-stage attached bacteria have established themselves. Using this oral plaque model, it is possible to capture the temporal changes in biofilm formation from the early to the mid-to-late stages. On the other hand, the vertical system is expected to allow for the construction of an oral plaque model representing the initial state of plaque formation in a short period after brushing, or more specifically, an oral plaque model representing a state where initial attached bacteria have established themselves. This oral plaque model allows us to capture the changes over time from the early to the middle stages of biofilm formation.
[0057] Culture media with the composition shown in Table 2 were prepared. The prepared culture media were sterilized in an autoclave.
[0058] [Table 2]
[0059] A bacterial suspension was prepared by diluting the source saliva 10 to 100 times using the prepared culture medium. An appropriate amount of the bacterial suspension was dispensed into a new 24-well plate. HA disks, treated with a pellicle membrane, were transferred to the 24-well plate containing the bacterial suspension. Subsequently, incubation was started at 37°C under anaerobic conditions.
[0060] Within 12 to 24 hours of starting the culture, the HA disk was removed and exposed to the sample solution for 3 minutes. Then, the HA disk was washed once with phosphate-buffered saline (PBS) and transferred to a 24-well plate containing fresh culture medium, and the culture was restarted.
[0061] After restarting the culture, the HA disk was brought into contact with the sample solution for 3 minutes every 24 hours, and the culture medium was changed. This process was repeated twice, and the culture was continued. After another 24 hours, the HA disk was removed. The removed HA disk was washed twice with PBS. The washed HA disk was placed in a tube containing sterile PBS and mixed using a vortex mixer to collect the model biofilm.
[0062] (Evaluation method) Model biofilms were analyzed by quantitative PCR (qPCR). Specifically, the total number of bacteria, the number of S. oralis bacteria, and the number of F. nucleatum bacteria contained in the model biofilms were measured. Subsequently, the relative proportions of S. oralis and F. nucleatum to the total number of bacteria in the model biofilms were calculated. The analysis method is described below.
[0063] DNA was extracted from the recovered biofilm by disrupting the bacterial cells using a lytic enzyme. DNA extraction was performed using the QIAamp DNA Mini Kit (QIAGEN) according to the prescribed procedure.
[0064] The total bacterial count, the number of S. oralis bacteria, and the number of F. nucleatum bacteria were measured using qPCR with the extracted sample DNA. A total volume of 20 μl of PCR reaction mixture was prepared. The PCR reaction mixture contained 10 μl of 2×SYBR Green Master Mix (Thermo Fisher Scientific), 2 μl of sample DNA, and primers with a final concentration of 0.25 μM.
[0065] In this study, standard DNA samples for the calibration curve were diluted 10-fold in seven steps, and PCR reactions were performed using specific primers for each step. Furthermore, a DNA sample of Fusobacterium nucleatum was used for PCR with universal primers.
[0066] The sequence of primers used is as follows: Universal primer (Forward): GTGSTGCAYGGYTGTCGTCA Universal primer (Reverse): ACGTCRTCCMCACCTTCCTC Streptococcus sp. (Forward): TCGGATCGTAAAGCTCTGTTGTA Streptococcus sp. (Reverse): GGACAACGCTCGGGACCTAC Streptococcus oralis (Forward): GATACATAGCCGACCTGAG Streptococcus oralis (Reverse): TCCATTGCCGAAGATTCC Fusobacterium nucleatum (Forward): CAACAGAAGAAGTGACGGCTAA Fusobacterium nucleatum (Reverse): CAGTTTCCAACGCAATACAGAG In the above sequence, S, Y, R, and M represent mixed bases as follows: S=G+C, Y=C+T, R=A+G, M=A+C.
[0067] The PCR reaction conditions were as follows: Initial denaturation was performed at 95°C for 10 minutes. Subsequent denaturation was performed at 95°C for 15 seconds. Annealing and extension were performed at 60°C for 1 minute. 40 cycles were repeated.
[0068] Measurements were performed using the Applied Biosystems 7500 Fast Real-Time PCR System (Thermo Fisher Scientific). Data acquisition was performed using the 7500 Fast System SDS software ver. 1.3.1 (Thermo Fisher Scientific). The number of bacteria for each standard DNA sample was calculated by creating calibration curves from the qPCR results.
[0069] (Evaluation results) Table 3 shows the relative proportions of S. oralis and F. nucleatum. As shown in Table 3, in the results of Comparative Example 1 and Comparative Example 2, the relative proportion of F. nucleatum was not smaller compared to the negative control. In contrast, in the results of Example 1, the relative proportion of F. nucleatum was smaller in both the horizontal and vertical systems. From this, it can be seen that the effect of selectively suppressing the growth of F. nucleatum is obtained by Example 1, which contains cinnamaldehyde, arginine, and lactose. In particular, in the results of the vertical system in Example 1, the relative proportion of F. nucleatum decreased to "0". In other words, comparing the results of the horizontal and vertical systems in Example 1, it can be seen that the effect of suppressing the growth of F. nucleatum is more pronounced in the vertical system than in the horizontal system.
[0070] As shown in Table 3, in Example 1, the relative proportion of S. oralis was larger in both the horizontal and vertical systems compared to the negative control. Furthermore, in Example 1, the relative proportion of S. oralis was even larger in both the horizontal and vertical systems compared to the results of Comparative Examples 1 and 2. This indicates that the effect of selectively promoting the growth of S. oralis is preferably obtained by Example 1, which contains cinnamaldehyde, arginine, and lactose. In particular, the increase in the relative proportion of S. oralis compared to the control was large in the vertical system results of Example 1. That is, comparing the horizontal and vertical system results of Example 1, it can be seen that the effect of promoting the growth of S. oralis is more pronounced in the vertical system than in the horizontal system.
[0071] [Table 3]
[0072] As described above, it was found that contact with the sample solution from Example 1 during the biofilm formation process can influence the biofilm's bacterial flora. Specifically, it was found that selectively suppressing the growth of the pathogenic bacterium F. nucleatum increases the proportion of non-pathogenic bacterial species. It was also found that selectively suppressing the growth of pathogenic bacteria while promoting the growth of S. oralis increases the proportion of non-pathogenic bacterial species. By increasing the proportion of non-pathogenic bacterial species, an improvement in the balance of the oral microbiota can be expected.
[0073] The oral composition of Example 1, which yielded favorable results in both horizontal and vertical systems, can be expected to improve the balance of the oral microbiota at all stages of biofilm formation, from the early to mid-stages, and from the early to mid to late stages. Furthermore, since a more significant effect was observed in the vertical system in Example 1, it can be expected that the effect of suitably improving the balance of the oral microbiota is particularly large during the early to mid-stages of biofilm formation.
[0074] Furthermore, regarding the evaluation test described above, even when using an example in which an oligosaccharide other than lactose among oligosaccharides containing galactose as a constituent sugar was used in place of lactose in Example 1, the same effect as in Example 1 was confirmed. In other words, it can be expected that an oral composition containing cinnamaldehyde, arginine, and an oligosaccharide containing galactose as a constituent sugar will improve the balance of the bacterial flora in the oral cavity by increasing the proportion of bacterial species belonging to non-pathogenic bacteria.
[0075] (Evaluation of cinnamaldehyde content) The sample solutions shown in Table 4 were prepared by mixing each component according to a conventional method to obtain Example 2. The remainder of the sample solution was sterile distilled water. For the sample solution of Example 2, the generation of a model biofilm and the calculation of the relative proportions of S. oralis and F. nucleatum in the model biofilm were performed in the same manner as in Comparative Examples 1, 2, and 1. The HA disk was arranged horizontally. The results are shown in Table 4.
[0076] [Table 4]
[0077] As shown in Table 4, in Example 2, where the cinnamaldehyde content was 0.2%, the relative proportion of S. oralis was higher compared to Example 1. This indicates that the growth of S. oralis was more promoted. Also, the relative proportion of F. nucleatum was lower compared to Example 1. Specifically, the relative proportion of F. nucleatum decreased to "0". This indicates that the growth of F. nucleatum was more inhibited.
[0078] From these results, it can be seen that a higher cinnamaldehyde content enhances the selective promotion of S. oralis growth. It can also be seen that a higher cinnamaldehyde content enhances the selective inhibition of F. nucleatum growth. Therefore, an improvement in the balance of the oral microbiota can be expected.
[0079] According to Example 2, which showed favorable results in the horizontal system, it can be expected that the effect of suitably improving the balance of the oral microbiota will be enhanced even in the early to mid-to-late stages of the biofilm formation process. In other words, by increasing the cinnamaldehyde content, it can be expected that the effect of suitably improving the balance of the oral microbiota will be enhanced in both the early to mid-stages of biofilm formation and the early to mid-to-late stages of biofilm formation.
[0080] Furthermore, regarding the evaluation test described above, even when using an example in which an oligosaccharide other than lactose among oligosaccharides containing galactose as a constituent sugar was used in place of lactose in Example 2, the same effect as in Example 2 was confirmed.
Claims
1. An oral composition containing cinnamaldehyde, arginine, and an oligosaccharide containing galactose as a constituent sugar, for improving the balance of the oral bacterial flora.
2. By selectively suppressing the growth of pathogenic bacteria among pathogenic and non-pathogenic bacteria in the oral cavity, the proportion of non-pathogenic bacteria is increased. The oral composition according to claim 1.
3. By selectively promoting the growth of non-pathogenic bacteria among pathogenic bacteria and non-pathogenic bacteria in the oral cavity, the proportion of non-pathogenic bacteria is increased. The oral composition according to claim 1 or 2.
Citation Information
Patent Citations
Oral antimicrobial agent and oral composition
JP2016113460A