Antibodies that bind to human NTCP and can inhibit hepatitis B virus (HBV) infection of human liver cells.

Abstract

The present invention provides a NTCP-binding antibody capable of inhibiting infection of human hepatocytes with hepatitis B virus (HBV) particles. The present invention also provides a NTCP-binding antibody that is capable of inhibiting infection of human hepatocytes with hepatitis B virus (HBV) particles and that reduces the effect of NTCP on transport of bile acid.

Description

Technical Field

[0001] The present invention relates to an antibody that binds to human sodium taurocholate cotransporting polypeptide (sodium taurocholate cotransporting polypeptide or NTCP) capable of inhibiting the infection of hepatitis B virus (HBV) to human hepatocytes. The present invention also relates to an antibody that binds to human NTCP capable of inhibiting the infection of hepatitis B virus (HBV) to human hepatocytes, and the antibody has a reduced influence on the transport of bile acids by NTCP.

Background Art

[0002] Hepatitis B virus (HBV) is a liver-directed virus that establishes persistent infection in humans. The age at the time of HBV infection is extremely important in determining the risk of chronicity. The risk is over 90% for infection under 1 year old, 30% for infection between 1 and 5 years old, and 0-2% for adults. Therefore, many chronic HBV infections are acquired through mother-to-child transmission at birth or during infancy and childhood. In addition, infection in children can occur from other HBV-positive close relatives.

[0003] According to the estimate of the World Health Organization (WHO) in 2002, the number of infected persons with hepatitis B virus is 2 billion worldwide, and the number of persistent infected persons with hepatitis B virus is 350 million. Many of the virus-infected persons recover, but ~10% of the infected persons cannot remove the virus. HBV infection causes various liver diseases such as fulminant hepatic failure, chronic hepatitis, liver cirrhosis and liver cancer.

[0004] Hepatitis B virus (HPV) binds to NTCP on the cell membrane via the preS1 domain of the viral L protein. Inhibiting HPV binding to the cell membrane is thought to prevent HPV infection and its spread within the body, and development of such inhibitors is needed. However, NTCP has an important function as a bile acid transporter, and while HPV inhibitors targeting NTCP developed to date can suppress HPV cell infection, they also significantly inhibit bile acid transport, potentially causing side effects in patients (Non-Patent Literature 1-4). Recently, a cyclic peptide that suppresses viral infection without significantly inhibiting bile acid transport has been reported (Non-Patent Literature 5). [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Hepatology (2014);59(5):1726-37 [Non-Patent Document 2] Intervirology (2014) 57: 151-157 [Non-Patent Document 3] BMB reports (2008), 640-652 [Non-Patent Document 4] J Virology (2005) 79: 1613-1622 [Non-Patent Document 5] Cell Chemical Biology (2018) 25: 906-915 Brief Description of the Invention

[0006] The present invention provides an antibody that binds to NTCP and can inhibit the infection of human liver cells by hepatitis B virus (HBV) particles. The present invention also provides an antibody that binds to NTCP and can inhibit the infection of human liver cells by hepatitis B virus (HBV) particles, wherein the effect of NTCP on bile acid transport is reduced.

[0007] The inventors identified an antibody capable of inhibiting the infection of human liver cells by hepatitis B virus (HBV) particles. They also identified an NTCP variant to which this antibody does not bind. This revealed the amino acid residue on NTCP necessary for the antibody's binding. Furthermore, since this NTCP variant was resistant to HBV infection of cells, it became clear that the aforementioned amino acid residue is also an essential amino acid on NTCP for HBV infection of cells. The inventors further found that the antibody binding to this amino acid sequence does not significantly affect the bile acid transport function of the NTCP protein.

[0008] The present invention provides, for example, the following inventions. [1] An antibody that binds to human sodium taurocholate cotransport polypeptide (human NTCP) and can inhibit infection of human liver cells by hepatitis B virus (HBV) particles, Under culture conditions suitable for hepatocyte culture, IC regarding the above infection inhibition 50 An antibody that, at a given concentration, does not inhibit the uptake of bile acids into hepatocytes by human NTCP by more than 50%. [2] An antibody that binds to human NTCP and can inhibit infection of human liver cells by hepatitis B virus (HBV) particles, (1) A human NTCP having the amino acid sequence described in SEQ ID NO: 11 binds with a stronger affinity than at least one human NTCP variant having an amino acid sequence selected from the group consisting of the amino acid sequences described in SEQ ID NOs: 12-14, or (2) An antibody having a heavy chain variable region having the amino acid sequence described in SEQ ID NO: 3 and a light chain variable region having the amino acid sequence described in SEQ ID NO: 4 competes with an antibody for binding to human NTCP. antibody. [3] An antibody as described in [1] or [2] above, A heavy chain variable region having CDR1 having the amino acid sequence described in SEQ ID NO: 5, CDR2 having the amino acid sequence described in SEQ ID NO: 6, and CDR3 having the amino acid sequence described in SEQ ID NO: 7, and Light chain variable region having CDR1 having the amino acid sequence described in SEQ ID NO: 8, CDR2 having the amino acid sequence described in SEQ ID NO: 9, and CDR3 having the amino acid sequence described in SEQ ID NO: 10. An antibody that possesses this trait. [4] An antibody described in any of [1] to [3] above, An antibody having a heavy chain variable region having the amino acid sequence described in SEQ ID NO: 3 and a light chain variable region having the amino acid sequence described in SEQ ID NO: 4. [5] A pharmaceutical composition comprising an antibody and a pharmaceutically acceptable carrier as described in any of the above [1] to [4]. [6] The pharmaceutical composition described in [5] above for use in treating infections caused by hepatitis B virus. [Brief explanation of the drawing]

[0009] [Figure 1A] Figure 1A plots the relationship between the inhibitory effect (horizontal axis) on infection of recombinant HBV (HBV / NL) in which the NanoLuc gene of Promega was incorporated into the core region of HBV by the obtained antibody obtained in the supernatant of hybridoma clone culture, and cell viability (vertical axis). [Figure 1B] Figure 1B shows the concentration-dependent inhibitory effects of purified N6HB426-20 antibody, N6HB426-s102 antibody, and preS1 on live HBV infection. [Figure 2A] Figures 2A-2C show the concentration-dependent inhibitory effects of purified N6HB426-20 antibody, N6HB426-20 antibody, and preS1 on live HBV infection. Figure 2A shows the concentration-dependent inhibitory effect of N6HB426-20 antibody on live HBV infection. [Figure 2B] Figure 2B shows the concentration-dependent inhibitory effects of purified N6HB426-20-A antibody, N6HB426-20-B antibody, and recombinant N6HB426 mouse IgG2a antibody on HBV infection. The test was performed with an anti-ovalbumin antibody (Anti-OVA) unrelated to NTCP binding as a control group. [Figure 2C]Figure 2C shows the concentration-dependent inhibitory effect of purified N6HB426-20 antibody on HBV genotypes C and D against HBV. [Figure 3] Figure 3 shows the results of an assay for the uptake of bile acids into liver cell lines. In this test system, bile acid uptake was inhibited by 90% in the presence of 1000 nM preS1, but the inhibition was limited to a maximum of 2% in the presence of the same amount of purified N6HB426 antibody. [Figure 4] Figure 4 shows that NTCP-expressing cell lines with the triple mutation become immune to HBV infection. The tyrosine at position 146 and the aspartic acids at positions 149 and 152 of the NTCP amino acid sequence were converted to alanine, respectively. This triple mutation inhibited viral infection and did not affect viral infection in the presence of an NTCP-unreactive anti-OVA antibody, an NTCP-specific antibody without neutralizing activity (HE1-8-10), or an N6HB426 antibody. The assay measured infection with recombinant HBV / NL virus, in which the Promega NanoLuc gene was incorporated into the core region of HBV, using a luciferase assay. [Figure 5A] Figure 5A (left) shows the binding strength of the N6HB426-20 antibody against wild-type and Y146A mutant human NTCP, and the non-neutralizing anti-NTCP antibody N3T92-14-34. Figure 5A (right) shows a strong reduction in viral infectivity against hepatocytes expressing the Y146A mutant, while showing no effect on infectivity against hepatocyte lines expressing D149A and D152A mutants. [Figure 5B] Figure 5B shows the binding strength of the N6HB426-20 antibody against the wild-type human NTCP and the Y146A, D149A, and D152A triple amino acid residue mutations, as well as the N3T92-14-34 anti-NTCP antibody, which does not exhibit neutralizing activity. [Figure 6] Figure 6 summarizes the antibody binding ability to each NTCP variant and the HBV infectivity. [Figure 7]Figure 7 shows the infectivity of HBV against other NTCP variants, both in the presence and absence of various antibodies. Specifically, infection experiments were conducted using variants in which phenylalanine and proline at amino acid positions 274 and 275 of the NTCP sequence were replaced with alanine, and variants in which valine and isoleucine at positions 278 and 279 were replaced with alanine. The results suggest that viral infection of the host was inhibited in hepatocytes expressing these variants. On the other hand, infection experiments using variants in which proline and glutamic acid at positions 276 and 277 were replaced with alanine showed no effect on viral infection of hepatocytes expressing these variants. [Figure 8] Figure 8 shows the binding strength of the N6HB426-20 antibody against the wild-type human NTCP and the P276A and E277A biamino acid mutants, as well as the N3T92-14-34 anti-NTCP antibody, which does not exhibit neutralizing activity. [Figure 9] Figure 9 summarizes the antibody binding ability to each NTCP variant and the HBV infectivity. [Figure 10] Figure 10 shows the infection inhibitory effect of the N6HB426-20 antibody in in vivo infection experiments. [Figure 11] Figure 11 shows the changes in bile acid concentration during in vivo infection experiments. [Figure 12a] Figure 12a shows the inhibitory effect of the N6HB426 human chimeric IgG4 antibody on HBV cell infection. [Figure 12b] Figure 12b shows the inhibitory effect of various antibodies on HBV cell infection compared to PreS1. [Figure 12c] Figure 12c shows the effects of various antibodies on cell survival. [Figure 13] Figure 13 shows experimental results regarding the inhibitory effect of the N6HB426 human chimeric IgG4 antibody on bile acid uptake by hepatocytes. [Figure 14] Figure 14 shows the experimental results regarding ADCC activity using the N6HB426 human chimeric IgG4 antibody. [Figure 15]Figure 15 shows the experimental results regarding the amount of HBs antigen after treatment with N6HB426 human chimeric IgG4 antibody. [Figure 16] Figure 16 shows the experimental results regarding the amount of HBe antigen after treatment with N6HB426 human chimeric IgG4 antibody. Specific description of the invention

[0010] In this specification, "subject" means a human being. A human being may be, for example, a healthy person, or a person infected with HBV (e.g., an infant or child infected by mother-to-child transmission, a patient with acute hepatitis B, an asymptomatic carrier (i.e., a carrier, a carrier with chronic infection), a patient with chronic hepatitis, a patient with fulminant hepatitis, a patient with cirrhosis, and a patient with liver cancer). Furthermore, a human being may be a person within 28 days of birth (neonatal period), a person between 29 days and 1 year of age (infancy), a person between 1 and 6 years of age (childhood), a person between 6 and 12 years of age (school age), a person between 12 and 18 years of age (adolescence), or a person 18 years of age or older (adult).

[0011] In this specification, “treatment” is used to encompass both therapeutic and preventive measures. In this specification, “treatment” means the treatment, cure, prevention, or improvement of remission of a disease or disorder, or the reduction of the rate of progression of a disease or disorder. In this specification, “prevention” means reducing the likelihood of developing a disease or condition, or delaying the onset of a disease or condition.

[0012] In this specification, "hepatitis B virus" (HBV) is a member of the genus Orthohepardna in the family Hepadnaviridae. HBV is known to cause hepatitis B. The HBV viral particle (virion) has an icosahedral nucleocapsid core and a lipid envelope covering its outside. The core contains viral DNA and DNA polymerase with reverse transcriptase activity. The components of HBV are hepatitis B surface antigen (HBsAg or HBs antigen), HBcAg, hepatitis B virus DNA polymerase, and HBX. HBsAg consists of L protein, M protein, and S protein. When HBV infects cells, it binds to NTCP on the cell surface via the preS1 domain of the L protein and infects cells by endocytosis. The presence or absence of HBV infection can be determined by the presence or absence of HBs antigen in the blood. In this specification, NTCP is a protein unless otherwise specified.

[0013] HBV itself is thought to have no cytotoxicity, or only mild cytotoxicity. Hepatocyte damage is thought to be primarily due to the host's immune response to eliminate HBV-infected cells. In infancy, the host's immune response is underdeveloped, and although HBV DNA proliferation is active, hepatitis symptoms are rarely observed, making infants and young children as asymptomatic carriers. Here, "host" refers to the entity to which HBV has infected. Upon reaching adulthood, the immune response to HBV becomes active, and the host develops active hepatitis. Hepatitis subsides when HBV DNA proliferation is suppressed due to the disappearance of HBe antigen or the appearance of HBe antibodies. On the other hand, if hepatitis persists and the HBe antigen-positive state continues for a long period, cirrhosis progresses from HBe antigen-positive chronic hepatitis. When HBe antigen seroconversion occurs, hepatitis subsides in most cases, the amount of HBV DNA decreases to below 2000 IU / mL, and the host becomes an inactive carrier. In contrast, in 10-20% of cases that undergo seroconversion, HBV re-proliferates in an HBe antigen-negative state, and hepatitis (called HBe antigen-negative chronic hepatitis) recurs. After HBe antigen seroconversion, in some cases, HBs antigen disappears, HBs antibodies appear, and a period of remission may occur. The spontaneous HBs antigen disappearance rate in persistent HBV infections is approximately 1% per year. In cases of infection after reaching adulthood, an immune response occurs early after infection, and the host develops acute hepatitis. While it is common for the virus to be eliminated after acute hepatitis and for the hepatitis to subside, an increasing number of hosts are developing chronic hepatitis without remission. Inhibitors of HBV infection in cells may prevent primary HBV infection, suppress the increase in HBV DNA, suppress HBV activation, suppress the transition from inactive to active carriers, suppress the progression to active hepatitis, alleviate hepatitis, suppress HBV regrowth, suppress the transition to chronic hepatitis, or prevent viral spread and infection within the body of chronically infected patients.

[0014] In this specification, "antibody" refers to a protein having a structure in which two heavy chains (H chains) and two light chains (L chains) stabilized by a pair of disulfide bonds are associated. Antibodies may be specific to an antigen. Specific binding means binding that is not nonspecific adsorption. Specificity can be ensured by the animal's immunity to the antigen. Being specific may mean having a stronger affinity for the antigen than for at least one or more other proteins. Also, for example, having a strong binding affinity to a particular antigen (e.g., a KD value of 10) -9 M or less, 10 -10 M or less, 10 -11 M or less, or 10 -12 Antibodies (M or less) are antibodies that can specifically bind to the antigen in question. The heavy chain consists of a heavy chain variable region VH, heavy chain constant regions CH1, CH2, CH3, and a hinge region located between CH1 and CH2, while the light chain consists of a light chain variable region VL and a light chain constant region CL. Of these, the variable region fragment (Fv) consisting of VH and VL is directly involved in antigen binding and is the region that gives diversity to the antibody. Furthermore, the antigen-binding region consisting of VL, CL, VH, and CH1 is called the Fab region, and the region consisting of the hinge region, CH2, and CH3 is called the Fc region. Of the variable regions, the region that directly contacts the antigen exhibits considerable amino acid sequence diversity among antibodies and is called the complementarity-determining region (CDR). Regions other than the CDRs, where the amino acid sequence is nearly constant among antibodies, are called the framework region (FR). There are three CDRs in the variable regions of the light chain and heavy chain, and these are called heavy chain CDR1-3 and light chain CDR1-3, respectively, starting from the N-terminus. The antibody may be a monoclonal antibody or a polyclonal antibody. Furthermore, the antibody of the present invention may be any isotype of IgG, IgM, IgA, IgD, or IgE. It may be produced by immunizing non-human animals such as mice, rats, hamsters, guinea pigs, rabbits, or chickens, or it may be a recombinant antibody, a chimeric antibody, a humanized antibody, a fully humanized antibody, etc. A chimeric antibody is an antibody in which fragments of antibodies derived from different species are linked together. Examples of IgG subclasses in humans include IgG1, IgG2, IgG3, and IgG4. The antibody of the present invention may be any of these subclasses, but may be one or more selected from the group consisting of IgG1, IgG2, IgG3, and IgG4, for example, it may be IgG2, for example, IgG3, for example, IgG4. A "humanized antibody" refers to an antibody (i.e., a CDR graft antibody) in which the corresponding positions of a human antibody are substituted with amino acid sequences characteristic of non-human antibodies. For example, an antibody produced by immunizing a mouse or rat has heavy chains CDR1-3 (HCDR1-3, respectively) and light chains CDR1-3 (LCDR1-3, respectively), and all other regions, including the four framework regions (FRs) of both the heavy and light chains, are derived from a human antibody. Such antibodies are sometimes called CDR-grafted antibodies. The term "humanized antibody" may include human chimeric antibodies and CDR-grafted humanized antibodies. A fully humanized antibody is an antibody derived from a chromosome-transplanted non-human animal (e.g., a mouse) that possesses the human immunoglobulin gene locus and has the same gene sequence as a human antibody. In this specification, the term "antigen-binding fragment" of an antibody refers to a fragment of an antibody that binds to an antigen. Specifically, examples include, but are not limited to, Fab consisting of VL, VH, CL, and CH1 regions; F(ab')2 in which two Fabs are linked by a disulfide bond at a hinge region; Fv consisting of VL and VH; scFv, a single-chain antibody in which VL and VH are linked by an artificial polypeptide linker; and bispecific antibodies such as diabody type, scDb type, tandem scFv type, and leucine zipper type. In the present invention, the antibody may be an isolated monoclonal antibody (for example, an isolated human chimeric antibody, an isolated humanized antibody, or an isolated human antibody).

[0015] In this specification, “isolated” means separated from at least other components. “Isolated” is used to include separation from impurities to a degree suitable for use in a pharmaceutical product.

[0016] The inventors have found that HBV binds to the wild type of human sodium taurocholate cotransporting polypeptide (NTCP) (e.g., NTCP having the amino acid sequence described in SEQ ID NO: 11), but its binding affinity to mutants of human NTCP having the Y146A amino acid mutation (e.g., mutants of NTCP having the amino acid sequence described in SEQ ID NO: 12) is reduced. The inventors have also found that an antibody that binds to the wild type of human NTCP but shows lower affinity to mutants of human NTCP having the Y146A amino acid mutation inhibits HBV infection of human cells via human NTCP. The inventors have also found that the binding affinity to mutants of human NTCP having the Y146A, D149A, and D152A amino acid mutations (e.g., mutants of NTCP having the amino acid sequence described in SEQ ID NO: 13) is reduced. The inventors also found that an antibody that binds to the wild-type human NTCP but shows lower affinity to mutants of human NTCP having amino acid mutations at Y146A, D149A, and D152A inhibits HBV infection of human cells via human NTCP. The inventors also found that an antibody that binds to the wild-type human NTCP but shows lower affinity to mutants of human NTCP having amino acid mutations at P276A and E277A (for example, a mutant of NTCP having the amino acid sequence described in SEQ ID NO: 14) inhibits HBV infection of human cells via human NTCP. The inventors found that the antibody does not substantially inhibit the bile acid uptake ability of human NTCP. The inventors further found that amino acids 276 and 277 of human NTCP appear unrelated to viral infection but form an antibody epitope.

[0017] (A) In one aspect of the present invention, An antibody that binds to human NTCP and can inhibit the infection of human liver cells by hepatitis B virus (HBV) particles, Under culture conditions suitable for hepatocyte culture, IC regarding the above infection inhibition 50An antibody that does not inhibit the uptake of bile acids into hepatocytes by human NTCP by 50% or more at a certain concentration is provided. In this embodiment, for example, the above antibody has an IC 50 at a certain concentration that does not inhibit the uptake of bile acids into hepatocytes by human NTCP by 50% or more, 45% or more, 40% or more, 35% or more, 30% or more, 25% or more, 20% or more, 15% or more, 10% or more, or 5% or more, or does not substantially inhibit it. The concentration of the antibody can be, for example, the IC 50 concentration related to the above infection inhibition. The inhibition can be represented by the ratio of the amount of bile acid uptake in the presence of the antibody to the amount of bile acid uptake in the absence of the antibody. Not substantially inhibiting means that the inhibition is below the detection limit or is an inhibition of a degree that has no technical meaning.

[0018] The infection of hepatitis B virus (HBV) particles into human hepatocytes and its inhibition can be confirmed by an in vitro assay system using HBV particles and human hepatocytes. More specifically, a human hepatocyte line HepG2 that forcibly expresses human NTCP is contacted with HBV in the presence or absence of an antibody, and after removing non-infected HBV particles by medium exchange, based on the amount of HBs antigen released from the cells into the medium, the infection of HBV particles into human hepatocytes can be evaluated. Whether the infection is inhibited by the antibody can be determined by comparing the amount of HBs antigen in the medium in the absence of the antibody with the amount of HBs antigen in the presence of the antibody. Labeled HBV particles can be used to confirm the amount of infection and the inhibition of infection based on the amount of label taken up into the cells. The IC The infection of hepatitis B virus (HBV) particles into human hepatocytes and its inhibition can be confirmed by an in vitro assay system using HBV particles and human hepatocytes. More specifically, a human hepatocyte line HepG2 that forcibly expresses human NTCP is contacted with HBV in the presence or absence of an antibody, and after removing non-infected HBV particles by medium exchange, based on the amount of HBs antigen released from the cells into the medium, the infection of HBV particles into human hepatocytes can be evaluated. Whether the infection is inhibited by the antibody can be determined by comparing the amount of HBs antigen in the medium in the absence of the antibody with the amount of HBs antigen in the presence of the antibody. Labeled HBV particles can be used to confirm the amount of infection and the inhibition of infection based on the amount of label taken up into the cells. The IC 50 Regarding infection inhibition can be determined in the above in vitro assay system using a dilution series of the antibody solution. IC 50 is the concentration of the antibody that inhibits infection by 50%.

[0019] (A’) In a certain embodiment of the present invention, An antibody that binds to human NTCP, which can inhibit the binding between hepatitis B virus (HBV) particles and human NTCP, and Under culture conditions suitable for hepatocyte culture, IC regarding the above infection inhibition 50 At this concentration, the antibody does not inhibit the uptake of bile acids into hepatocytes by human NTCP by more than 50%. This is provided. In this embodiment, for example, the antibody is used to inhibit infection under culture conditions suitable for culturing hepatocytes. 50 At concentrations such as 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% or more, the uptake of bile acids into hepatocytes by human NTCP may not be inhibited, or may not be substantially inhibited. The antibody concentration may be, for example, in the IC regarding the inhibition of infection described above. 50 The concentration can be as follows. Inhibition can be expressed by the ratio of bile acid uptake in the presence of the antibody to the amount of bile acid uptake in the absence of the antibody. Substantially no inhibition means that the inhibition is below the detection limit or is technically insignificant.

[0020] The binding and inhibition of labeled hepatitis B virus (HBV) particles to human NTCP can be confirmed by an in vitro assay system using HBV particles and human liver cells using a standard method. More specifically, binding can be detected by contacting HepG2, a human liver cell line overexpressing human NTCP, with labeled HBV in the presence or absence of the antibody, removing HBV particles that did not bind to the cell surface by washing, and then detecting the HBV particles that bound to the cell surface based on the label. Whether or not binding was inhibited by the antibody can be determined by comparing the amount of labeling on the cell surface in the absence of the antibody with the amount of labeling on the cell surface in the presence of the antibody. IC regarding binding inhibition 50 This can be determined using a dilution series of antibody solutions in the above in vitro assay system. 50 This is the concentration of the antibody that inhibits binding by 50%. Furthermore, those skilled in the art can confirm binding inhibition using conventional methods.

[0021] Antibodies that bind to human NTCP can be produced by immunizing animals with human NTCP or its extracellular domain. Antibodies that bind to human NTCP can also be produced by immunizing animals with cells that express human NTCP. In this case, the animals can be genetically modified animals (e.g., mice, rats, and rabbits) in which the gene encoding NTCP has been disrupted. Polyclonal antibodies that bind to human NTCP can be recovered, for example, from the blood of the immunized animals. Monoclonal antibodies that bind to human NTCP can also be obtained, for example, from hybridomas obtained by fusing spleen cells and myeloma cells of an immunized animal. The hybridoma can be converted into a single clone by limiting dilution. The culture supernatant of the clone may contain monoclonal antibodies. Therefore, antibodies obtained from each clone can be screened for desired binding or functional properties to obtain monoclonal antibodies with the desired binding or functional properties.

[0022] Inhibition of bile acid uptake into hepatocytes can be confirmed under culture conditions suitable for hepatocyte culture. Bile acid uptake into hepatocytes can be confirmed, for example, by pre-treating human NTCP-expressing HepG2 cell lines with an antibody (e.g., at 37°C for 30 minutes) and then [ 3 The cells are treated with an assay solution containing [H]-taurocholic acid, for example, at 37°C for 15 minutes, to assess the uptake of taurocholic acid into the cells. 3 This can be confirmed by detecting the amount of H. And, the uptake of taurocholic acid into cells in the absence of antibodies or in the presence of isotype antibodies (such as IgG antibodies) (more specifically, the uptake of taurocholic acid into cells) 3 By comparing the amount of [H], it is possible to confirm whether or not the uptake of bile acids into hepatocytes is inhibited.

[0023] (B) In one aspect of the present invention, An antibody that binds to human NTCP, (1) A human NTCP having the amino acid sequence described in SEQ ID NO: 11 binds with a stronger affinity than one or more human NTCP variants selected from the group consisting of human NTCP variants having the amino acid sequences described in SEQ ID NOs: 12-14, or (2) An antibody having a heavy chain variable region having the amino acid sequence described in SEQ ID NO: 3 and a light chain variable region having the amino acid sequence described in SEQ ID NO: 4 competes with an antibody having the amino acid sequence described in SEQ ID NO: 4 antibody The present invention provides the following: The antibody can inhibit the binding of HBV particles to human NTCP on the surface of human hepatocytes and / or inhibit the infection of human hepatocytes by HBV particles.

[0024] In (1) above, the human NTCP having the amino acid sequence described in SEQ ID NO: 11 is an example of wild-type human NTCP. Also in (1) above, the mutant human NTCP having the amino acid sequence described in SEQ ID NO: 12 has the Y146A amino acid mutation in the amino acid sequence described in SEQ ID NO: 11. Also in (1) above, the mutant human NTCP having the amino acid sequence described in SEQ ID NO: 13 has the Y146A, D149A, and D152A amino acid mutations in the amino acid sequence described in SEQ ID NO: 11. Also in (1) above, the mutant human NTCP having the amino acid sequence described in SEQ ID NO: 14 has the P276A and P277A amino acid mutations in the amino acid sequence described in SEQ ID NO: 11. In other words, in (1) above, an antibody that has the property of binding with a stronger affinity to human NTCP having the amino acid sequence described in SEQ ID NO: 11 than to human NTCP mutant having the amino acid sequence described in SEQ ID NO: 12 can bind to the amino acids of human NTCP to which HBV binds. Furthermore, in (1) above, an antibody having the property of binding with stronger affinity to human NTCP having the amino acid sequence described in SEQ ID NO: 11 than to human NTCP variant having the amino acid sequence described in SEQ ID NO: 13 can bind to the amino acids of human NTCP to which HBV binds. Furthermore, in (1) above, an antibody having the property of binding with stronger affinity to human NTCP having the amino acid sequence described in SEQ ID NO: 11 than to human NTCP variant having the amino acid sequence described in SEQ ID NO: 14 can bind to the amino acids of human NTCP to which HBV binds. The antibody of the present invention can inhibit the binding of HBV particles to human NTCP on the surface of human hepatocytes and / or inhibit the infection of human hepatocytes by HBV particles.

[0025] The antibody described in (1) above may be an antibody that has the characteristic of binding to human NTCP having the amino acid sequence described in SEQ ID NO: 11 with an affinity 1.5 times or more, 2 times or more, 3 times or more, 4 times or more, 5 times or more, 6 times or more, 7 times or more, 8 times or more, 9 times or more, 10 times or more, 50 times or more, 100 times or more, or 1000 times or more stronger than binding to a human NTCP variant having the amino acid sequence described in SEQ ID NO: 12. The antibody described in (1) above, for example, against human NTCP having the amino acid sequence described in SEQ ID NO: 11, is 10 -7 M or less, 10 -8 M or less, 10 -9 M or less or 10 -10 In contrast to a human NTCP variant having a KD value of M or less, the amino acid sequence described in Sequence ID No. 12 is 10 -4 M or above, 10 -3 M or higher, or 10 -2 It may be an antibody with a KD value of M or higher. The antibody described in (1) above may, for example, bind to human NTCP having the amino acid sequence described in SEQ ID NO: 11, but substantially not bind to human NTCP variants having the amino acid sequence described in SEQ ID NO: 12. The antibody described in (1) above may further have the characteristic of binding to human NTCP having the amino acid sequence described in SEQ ID NO: 11 with an affinity 1.5 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 50 times, 100 times, or 1000 times stronger than binding to a variant of human NTCP having the amino acid sequence described in SEQ ID NO: 12.

[0026] The antibody described in (1) above may be an antibody that has the characteristic of binding to human NTCP having the amino acid sequence described in SEQ ID NO: 11 with an affinity 1.5 times or more, 2 times or more, 3 times or more, 4 times or more, 5 times or more, 6 times or more, 7 times or more, 8 times or more, 9 times or more, 10 times or more, 50 times or more, 100 times or more, or 1000 times or more stronger than binding to human NTCP variant having the amino acid sequence described in SEQ ID NO: 13. The antibody described in (1) above, for example, against human NTCP having the amino acid sequence described in SEQ ID NO: 11, is 10 -7 M or less, 10 -8 M or less, 10 -9 M or less or 10 -10 In contrast to a human NTCP variant having the amino acid sequence described in Sequence ID No. 13, 10 -4 M or above, 10 -3 M or higher, or 10 -2 This antibody may exhibit a KD value of M or higher. The antibody described in (1) above may, for example, bind to human NTCP having the amino acid sequence described in SEQ ID NO: 11, but substantially not bind to human NTCP variants having the amino acid sequence described in SEQ ID NO: 13. The antibody described in (1) above may further have the characteristic of binding to human NTCP having the amino acid sequence described in SEQ ID NO: 11 with an affinity 1.5 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 50 times, 100 times, or 1000 times stronger than binding to a variant of human NTCP having the amino acid sequence described in SEQ ID NO: 13.

[0027] The antibody described in (1) above, for example, against human NTCP having the amino acid sequence described in SEQ ID NO: 11, is 10 -7 M or less, 10 -8 M or less, 10 -9 M or less or 10 -10 In contrast to a KD value of M or less, a variant of human NTCP having the double amino acid mutations P276A and E277A in the amino acid sequence of SEQ ID NO: 11 (a variant of human NTCP having the amino acid sequence of SEQ ID NO: 14) showed 10 -4 M or above, 10 -3 M or higher, or 10 -2 It may also have the additional characteristic of exhibiting a KD value of M or higher.

[0028] The antibody described in (1) above may be an antibody that has the characteristic of binding to human NTCP having the amino acid sequence described in SEQ ID NO: 11 with an affinity 1.5 times or more, 2 times or more, 3 times or more, 4 times or more, 5 times or more, 6 times or more, 7 times or more, 8 times or more, 9 times or more, 10 times or more, 50 times or more, 100 times or more, or 1000 times or more stronger than binding to human NTCP variant having the amino acid sequence described in SEQ ID NO: 14. The antibody described in (1) above, for example, against human NTCP having the amino acid sequence described in SEQ ID NO: 11, is 10 -7 M or less, 10 -8 M or less, 10 -9 M or less or 10 -10 In contrast to a human NTCP variant having the amino acid sequence described in Sequence ID No. 14, which exhibits a KD value of M or less, 10 -4 M or above, 10 -3 M or higher, or 10 -2 This antibody may exhibit a KD value of M or higher. The antibody described in (1) above may, for example, bind to human NTCP having the amino acid sequence described in SEQ ID NO: 11, but substantially not bind to human NTCP variants having the amino acid sequence described in SEQ ID NO: 14. The antibody described in (1) above may further have the characteristic of binding to human NTCP having the amino acid sequence described in SEQ ID NO: 11 with an affinity 1.5 times or more, 2 times or more, 3 times or more, 4 times or more, 5 times or more, 6 times or more, 7 times or more, 8 times or more, 9 times or more, 10 times or more, 50 times or more, 100 times or more, or 1000 times or more stronger than binding to a variant of human NTCP having the amino acid sequence described in SEQ ID NO: 14.

[0029] The antibody described in (2) above can compete with an antibody having a heavy chain variable region having the amino acid sequence described in SEQ ID NO: 3 and a light chain variable region having the amino acid sequence described in SEQ ID NO: 4. Here, antibody competition can occur when antibodies bind to the same or overlapping binding sites. Therefore, competing antibodies can bind to the same or overlapping binding sites. The antibody of the present invention can inhibit the binding of HBV particles to human NTCP on the surface of human hepatocytes and / or inhibit the infection of human hepatocytes by HBV particles.

[0030] Antibody competition can be confirmed in vitro by a competition assay. If a competition assay can neutralize the binding of the desired antibody by, for example, at least 20%, preferably at least 20-50%, and more preferably at least 50%, then the antibody can be considered to compete for binding to the same antigen. Competitive antibodies can be confirmed by a cross-blocking assay, preferably a competition ELISA assay. In a cross-blocking assay, the antigen is coated, for example, on a microtiter plate, and the presence of a candidate competing antibody is added and incubated to form a binding bond between the antigen and the candidate antibody. Then, the desired antibody is labeled and added to the wells for further incubation, followed by washing. The amount of bound antibody can then be quantified to determine whether the antibodies competed. If there is competition, the amount of label remaining in the well should be small. Therefore, the amount of label remaining in the well can be used as an indicator to confirm whether the antibodies compete with each other. Competition includes competition between antibodies.

[0031] In one aspect of the present invention, the antibody in (1) or (2) above may be the antibody defined in (A) above. That is, the antibody in (1) or (2) above, under culture conditions suitable for culturing hepatocytes, provides IC for infection inhibition. 50At the specified concentrations, the antibody may not inhibit, or substantially inhibit, the uptake of bile acids into hepatocytes by human NTCP by 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, or 10% or more. "Substantially non-inhibitory" means that the level is below the detection limit, or even if detected, the inhibition is not significant.

[0032] (C) In one aspect of the present invention, an antibody that binds to human NTCP, A heavy chain variable region having CDR1 having the amino acid sequence described in SEQ ID NO: 5, CDR2 having the amino acid sequence described in SEQ ID NO: 6, and CDR3 having the amino acid sequence described in SEQ ID NO: 7, and Light chain variable region having CDR1 having the amino acid sequence described in SEQ ID NO: 8, CDR2 having the amino acid sequence described in SEQ ID NO: 9, and CDR3 having the amino acid sequence described in SEQ ID NO: 10. antibodies that possess It will be provided.

[0033] (D) In ​​one aspect of the present invention, an antibody that binds to human NTCP, An antibody having a heavy chain variable region having the amino acid sequence described in SEQ ID NO: 3 and a light chain variable region having the amino acid sequence described in SEQ ID NO: 4. It will be provided.

[0034] The antibody that binds to human NTCP according to the present invention can bind to the amino acids of human NTCP corresponding to P276 and E277 in the amino acid sequence described in SEQ ID NO: 11. In other words, the antibody that binds to human NTCP according to the present invention can use the amino acids of human NTCP corresponding to P276 and E277 in the amino acid sequence described in SEQ ID NO: 11 as epitopes.

[0035] The present invention provides a pharmaceutical composition comprising an antibody that binds to human NTCP. The pharmaceutical composition or drug comprising the antibody of the present invention can be formulated by known pharmaceutical methods. For example, the pharmaceutical composition or drug of the present invention may contain pharmaceutically acceptable excipients. The excipients can be administered as appropriate to deliver an effective amount of the antibody of the present invention, which is the active ingredient, to the target. In some embodiments, the pharmaceutical composition or drug of the present invention can be an injectable preparation, and the injectable excipients can be a sterile aqueous solution, a pharmaceutically acceptable buffer such as Ringer's solution, Hanks' solution, or physiological saline, an isotonic solution containing glucose or other adjuvants. Examples of adjuvants include alcohols such as ethanol, polyalcohols such as polyethylene glycol, and nonionic surfactants such as polysorbate 80, which can be added during formulation. As an oily solution for injection, sesame oil, coconut oil, and soybean oil can be used, and benzyl benzoate or benzyl alcohol can be used as an adjuvant. The pharmaceutical composition or drug of the present invention can be administered parenterally in the form of an injectable preparation (e.g., intravenous or intrapleural administration).

[0036] The antibody of the present invention can inhibit HBV infection of human hepatocytes. Therefore, according to the present invention, a pharmaceutical composition comprising the antibody that binds to human NTCP of the present invention can be used to prevent HBV infection. According to the present invention, the pharmaceutical composition of the present invention can also be used to treat HBV-infected individuals. According to the present invention, a pharmaceutical composition comprising the antibody that binds to human NTCP of the present invention can also be used to treat HBV infections. According to the present invention, a pharmaceutical composition comprising the antibody that binds to human NTCP of the present invention can also be used to treat HBV infections. According to the present invention, a pharmaceutical composition comprising the antibody that binds to human NTCP of the present invention can also be used to suppress or reduce the increase in HBV DNA. According to the present invention, a pharmaceutical composition comprising the antibody that binds to human NTCP of the present invention can also be used to treat inactive carriers. According to the present invention, a pharmaceutical composition comprising the antibody that binds to human NTCP of the present invention can also be used to suppress the conversion from inactive carriers to active carriers. According to the present invention, a pharmaceutical composition comprising the antibody that binds to human NTCP of the present invention can also be used to suppress the progression of active hepatitis. According to the present invention, a pharmaceutical composition comprising the antibody that binds to human NTCP of the present invention can also be used to sedate hepatitis. According to the present invention, a pharmaceutical composition comprising the antibody that binds to human NTCP can be used to suppress the regrowth of HBV. According to the present invention, a pharmaceutical composition comprising the antibody that binds to human NTCP can be used to suppress the chronicity of hepatitis. According to the present invention, a pharmaceutical composition comprising the antibody that binds to human NTCP can be used to treat hepatitis caused by HBV. In some embodiments, the hepatitis may be selected from the group consisting of acute hepatitis and chronic hepatitis. In some embodiments, the pharmaceutical composition of the present invention may not inhibit the uptake of bile acids. In some embodiments, the pharmaceutical composition of the present invention can be used to inhibit the binding of HBV to human NTCP.

[0037] In some embodiments, a pharmaceutical composition comprising the antibody that binds to human NTCP according to the present invention may be administered to a subject who is positive for an antigen selected from the group consisting of HBs antigen and HBe antigen. In some embodiments, a pharmaceutical composition comprising the antibody that binds to human NTCP according to the present invention may be administered to an inactive HBV carrier. In some embodiments, a pharmaceutical composition comprising the antibody that binds to human NTCP according to the present invention may be administered to a subject having HBV-induced hepatitis (e.g., acute or chronic hepatitis). In some embodiments, a pharmaceutical composition comprising the antibody that binds to human NTCP according to the present invention may be administered to a subject whose HBV DNA level is 20 IU / mL or higher.

[0038] In one aspect of the present invention, a method is provided for treating HBV infection in a subject in need, comprising administering to the subject an antibody that binds to human NTCP according to the present invention.

[0039] In one aspect of the present invention, the use of an antibody that binds to human NTCP in the preparation of a pharmaceutical composition of the present invention is provided.

[0040] The antibody that binds to human NTCP in the present invention can be used in combination with other anti-HBV therapeutic agents. That is, the pharmaceutical composition of the present invention may contain the antibody that binds to human NTCP in the present invention and other anti-HBV therapeutic agents. The pharmaceutical composition of the present invention may also be used in combination with other anti-HBV therapeutic agents. Examples of other anti-HBV therapeutic agents include interferon preparations and nucleoside analog preparations. Examples of interferon preparations include interferon and PEGylated interferon (Peg-IFN). Examples of nucleoside analog preparations include lamivudine (LAM), adefovir (ADV), entecavir (ETV), tenofovir disoproxil fumarate (TDF), and tenofovir alafenamide (TAF). The pharmaceutical composition of the present invention can also be used in combination with anti-human immunodeficiency virus (HIV) drugs having anti-HBV activity, such as emtricitabine, zidovudine, abacavir, elvitegravir, and cobicistat.

[0041] The pharmaceutical compositions of the present invention may be free from pharmaceuticals that may cause HBV reactivation (e.g., immunosuppressants, corticosteroids, anticancer agents, and antirheumatic drugs). The pharmaceutical compositions of the present invention may be free from simeprevir sodium, daclatasvir hydrochloride, asunaprevir, fososvir, ledipasvir, elpasvir, and grazoprevir hydrate. [Examples]

[0042] Example 1: Production of an antibody that binds to NTCP and can inhibit infection of human liver cells by hepatitis B virus (HBV).

[0043] Creation of NTCP knockout mice NTCP knockout mice were established using the CRISPR / Cas9 system. Specifically, PCR amplification fragments containing the T7 promoter and guide RNAs (#1: GCTCTCGCTTGGCTGCACCA+tracrRNA, #2: CTTTCATCTGACCAGCATTG+tracrRNA) were cloned into pUC19. The Cas9 gene PCR product from pX330 was subcloned downstream of the T7 promoter. Single-stranded guide RNA and Cas9 mRNA were synthesized from these constructs by in vitro transcription using the MEGAshortscript T7 Transcription Kit (Life Technologies), and then purified using the MEGAClear kit (Life Technologies). The two guide RNAs (10 ng / μl each) and Cas9 mRNA (10 ng / μl) were microinjected into 100 C57BL / 6N pronuclear stage embryos, and the following day, 2-cell stage embryos were transplanted into pseudo-pregnant mice. Founder genome editing was determined by PCR / sequencing analysis.

[0044] NTCP expression and purification (1) The N-terminus of human NTCP (SLC10A1, GenBank: NM_003049, UniProt: Q14973) wild-type and N5Q / N11Q mutants were fused with a sequence of human influenza hemagglutinin (HA) tag (YPYDVPDYA), Strep-tag II (WSHPQFEK), and bRIL (cytochrome b-562 RIL mutant, UniProt: P0ABE7, 23-128aa) tobacco mosaic virus (TEV) protease recognition sequence (ENLYFQG), and this was expressed in insect cells HighFive (Invitrogen) using a baculovirus expression system (Bac-to-Bac Baculovirus Expression System, ThermoFisher Scientific). (2) NTCP-expressing insect cells were cultured in 3 L of Express Five SFM medium (ThermoFisher Scientific) at 27°C for 48 hours with shaking, then the cells were precipitated by centrifugation and the medium was removed. (3) The cell precipitate was suspended in a low-salt buffer containing 10 mM potassium chloride and 1 mM EDTA, and the cells were lysed using a homogenizer. This was repeated twice. The solution was then replaced with a high-salt buffer containing 1 M sodium chloride, and the cells were again lysed using a homogenizer. This was repeated twice. The membrane fraction was precipitated by ultracentrifugation at 100,000 g, 4°C, for 1 hour. (4) The membrane fraction precipitate was suspended in a buffer containing 150 mM sodium chloride, 5 mM dithiothreitol, and cOmplete mini EDTA-free protease inhibitor cocktail (Roche, Cat. No. 4693159001), and 1% dodecyl maltoside (DDM, Anatrace, Cat. No. D310) was added. The mixture was then mixed at 4°C for 3 hours to solubilize the lipids and membrane proteins. (5) Ultracentrifugation was performed at 100,000 g, 4°C, for 20 minutes, and the crude membrane protein fraction containing NTCP was recovered from the ultracentrifugation supernatant. (6) Add 3 mL bed volume of StrepTactin to the crude membrane protein fraction Sepharose High Performance resin (GE Healthcare) was added, and the mixture was gently stirred overnight at 4°C. (7) StrepTactin Sepharose resin bound to NTCP was placed in a column vessel, and after removing the pass-through fraction, it was washed with Tris buffer (pH 7.0) containing 0.05% DDM, 0.002% cholesteryl hemisuccinate (CHS, Anatrace, Cat. No. CH210), 0.5 M sodium chloride, and 5 mM dithiothreitol. NTCP was eluted from the resin using an elution solution prepared by adding 2.5 mM desthiobiotin to the same buffer containing 0.1 M sodium chloride. (8) TEV protease was added to the elution fraction from 7. and the TEV protease recognition site was digested by gently stirring at 4°C overnight, thereby separating the two tags and bRIL. (9) The solution after digestion with TEV protease was passed through an anion exchange column (HiTrap Q HP, GE healthcare, Cat. No. 17115301) to adsorb the protein onto the column, and NTCP was eluted using a sodium chloride concentration gradient of 0.1 to 1 M. (10) The eluted fraction from 9. was added to a gel filtration column (Superose 6 Increase 10 / 300 GL, GE healthcare, Cat. No. 29091596), and approximately 10-16 mL of the eluted fraction was collected. (11) The NTCP from the eluted fraction in 10. was concentrated using an ultrafiltration membrane with a molecular weight cutoff of 30,000 (Amicon Ultra-15, Merck Millipore, Cat. No. UFC903096). (12) Lipid A (monophosphoryl from Salmonella enterica serotype minn, Sigma, Cat.No. L6895) and phosphatidylcholine derived from egg yolk lecithin (Avanti, Cat.No. 840051C) were pre-mixed in a 1:5 ratio, suspended in buffer, and 1.4% sodium cholate was added to disperse the lipids by sonication. A 10 mg / mL mixed lipid was then mixed with purified and concentrated NTCP. (13) Bio-Beads (Bio-Beads SM-2 20-50 Adsorbents, Bio-Rad, Cat.No. 152-3920) were added to the mixture from 12. to adsorb the surfactant bound to the surface of the membrane protein NTCP, and at the same time, liposome reconstitution was performed to incorporate NTCP into liposomes. (14) Bio-Beads were removed by spin column, and the NTCP reconstituted liposomes were dispersed by sonication. The liposomes were then precipitated by ultracentrifugation at 100,000 g, 4°C, for 1 hour, and suspended in phosphate-buffered saline. The liposome suspension was dispensed in mouse doses, rapidly frozen with liquid nitrogen, and stored at -80°C until use.

[0045] Method for preparing emulsified immunogens A mixture of human NTCP and LipidA was prepared in 100 μl of PBS, and 100 μl of TiterMax(R) Gold (TiterMax USA, Inc) was dispensed into separate syringes with stopcocks. The two mixtures were connected to a 3-way stopcock, ensuring no air was introduced, and mixed until completely emulsified.

[0046] Immunization method Three 11-17 week old female NTCP KO mice were immunized seven times with human NTCP (hNTCP) antigen using the following method. The dates in parentheses in the following text indicate the day of immunization, with the first immunization being day 0. Primary immunization (Day 0): An immunoantigen was prepared by mixing 30 μg / 100 μl of hNTCP protein antigen containing LipidA per animal with PBS(-) (Fujifilm Wako Pure Chemical Industries) and 100 μl of TiterMax(R) Gold (TiterMax USA, Inc) per animal as an adjuvant, and emulsifying the two. Under isoflurane anesthesia, 100 μl of the immunoantigen was administered subcutaneously to one site on each side of the shoulder and back (total of 2 sites, 200 μl) per animal. Second Immunization (Day 28): Mouse hepatocyte cell line Hepa1-6 (ATCC(R), CRL-1830) TM Hepa1-6-hNTCP strains expressing hNTCP were irradiated with 10 Gly of gamma rays, resulting in 1 × 10⁶ cells per organism. 7 A cell suspension was prepared in PBS(-) at a concentration of cells / 100 μl, and a solution of 33.3 μg of CpG (ODN 1826 VacciGrade, InvivoGen) dissolved in 100 μl of PBS(-) was prepared. These solutions were mixed 5 minutes before administration and allowed to stand. After 5 minutes, the mixture was gently stirred twice and administered intraperitoneally. Third immunization (day 48): hNTCP was formed in the liposome membrane and mixed with LipidA to create an antigen. 50 μg of this hNTCP / liposome antigen was mixed with 25 μg of poly I:C (SIGMA, #P0913) heat-treated at 50°C per mouse and administered subcutaneously to the right inguinal region of the mice. Fourth immunization (day 61): An immunoantigen was prepared by emulsifying 50 μg / 100 μl of hNTCP containing LipidA per animal with PBS(-) and 100 μl of TiterMax(R) Gold. This was administered subcutaneously to each side of the lumbar region in 100 μl doses under isoflurane anesthesia. Fifth immunization (Day 77): A20-hNTCP cell line, which expresses hNTCP in mouse lymphoma cell line A20 (RIKEN BRC CELL BANK, #CB2745), was irradiated with 10 Gly of gamma rays, resulting in 2 × 10⁶ cells per mouse. 7 Prepare a suspension of the individual cells in 100 μl of PBS and a solution of 33.3 μg of CpG dissolved in 100 μl of PBS. Mix these solutions 5 minutes before administration and allow to stand. After 5 minutes, gently suspend the cells again twice and administer intraperitoneally. Sixth immunization (day 89): The antigen was prepared in the same way as in the third immunization and administered subcutaneously to the left inguinal region. 7th immunization (day 105): 10 μg of NTCP per animal was diluted in 200 μl of PBS and boosted via tail vein immunization. Three days after the 7th immunization (day 108), the animal was dissected, the spleen was removed, and a hybridoma was created.

[0047] Hybridoma generation and antibody production screening B cell enrichment Immunized mouse spleens were removed, and after hemolysis, the cells were suspended in FACS buffer (2% FCS, 1% BSA, DMEM medium). Splenocytes were treated with 2.4G2 antibody to inhibit the binding of staining antibodies to the Fc receptor. Subsequently, they were stained with a biotin-labeled antibody mix on ice for 30 minutes. The biotin-labeled antibody mix used was a mixture of anti-IgM, anti-IgD, anti-CD3, anti-Thy1.2, anti-Gr-1, anti-F4 / 80, anti-TER119, anti-DX5, anti-NK1.1, anti-CD11b, anti-CD11c, and anti-AA4.1 antibodies. After washing with MACS buffer (2 mM EDTA, 0.5% BSA-added D-PBS), streptavidin-microbeads (Miltenyi Biotec, 130-048-101) were added, and the cells were left on ice for 15 minutes. Enriched B cells were then obtained by negative selection using an LS column (Miltenyi Biotec, 130-042-401).

[0048] Cell fusion and selection using HAT medium Cell fusion of B cells and myeloma cells (P3U1) was performed using the ECFG21 cell fusion device manufactured by Neppageen Co., Ltd. Both cell types were mixed in a 1:1 ratio and suspended in ECF buffer (0.3M mannitol, 0.1mM CaCl2, 0.1mM MgCl2). The fusion conditions for the electrical fusion method were 35V 1MHz (fixed) for 10 seconds, DC:350V 30μs intervals with a 0.5-second 10% decrease, and a 7-second decay mode after fusion. After cell fusion, the cells were suspended in HAT medium (RPMI1640 containing 18% FCS and 10% BM-condimed H1) and placed in a 96-well flat-bottom plate, resulting in approximately 1.7 × 10⁶ cells. 3 Seeds were seeded in cells per well, and cultivation was started under conditions of 37°C and 5% CO2. Every 3-4 days after fusion, half of the supernatant was replaced with fresh HAT medium, and a portion of the supernatant from hybridomas that showed sufficient growth under a microscope (occupying more than 80% of the well area) was collected.

[0049] Measurement of virus neutralizing activity using purified antibodies Plasmid preparation To construct lentiviral vectors encoding human NTCP (NTCP-Myc) with a Myc tag at the C-terminus, DNA fragments encoding NTCP-Myc were inserted into EcoRI and BamHI of CSII-CMV-MCS (provided by Dr. Hiroyuki Miyoshi, RIKEN). Each mutant construct was prepared using the QuikChange site-directed mutagenesis kit (Agilent, CA, USA) according to the manufacturer's manual. Cell preparation and culture HepG2 cells or Huh7 cells were cultured in Dulbecco's modified Eagle medium (DMEM) (Thermo Fisher Scientific, Waltham, MA) supplemented with 10% fetal bovine serum, 100 U / mL penicillin, 100 μg / mL streptomycin, and 100 U / mL non-essential amino acids (Thermo Fisher Scientific, Waltham, MA). HepAD38 cells were maintained in DMEM-F-12 GlutaMAX (Thermo Fisher Scientific, Waltham) supplemented with 10% fetal bovine serum, 100 U / mL penicillin, 100 μg / mL streptomycin, 5 μg / mL insulin, and 500 ng / mL tetracycline. To establish NTCP-expressing cells, HepG2 or Huh7 cells were infected with lentiviral vectors containing nucleic acids encoding wild-type or each NTCP variant. 48 hours after infection, the cells were subjected to immunofluorescence assays or viral infection assays. PXB cells were purchased from PhoenixBio, Hiroshima, Japan, and cultured according to the supplier's protocol. Immunofluorescence assay Huh7 cells expressing wild-type NTCP or each NTCP variant were fixed with 4% paraformaldehyde and permeabilized with 0.3% Triton X-100. Each NTCP was detected using N6HB426-20 antibody or HE1-9-10 antibody (dilution 1:200) and Alexa Fluor488-conjugate goat anti-mouse IgG antibody (secondary antibody) (Thermo Fisher Scientific) (dilution 1:1000). Cell imaging was performed using a laser scanning confocal microscope with FLUOVIEW fv1000 and a fluorescence microscope with IX73 (OLYMPAS). HBV preparation and infection HBV was derived from the culture supernatant of HepAD cells (provided by Dr. Christoph Seeger, Fox Chase Cancer Center). The collected supernatant was filtered using a 0.45-μm filter (Merck Millipore, MA, USA) and concentrated approximately 500-fold using PEG6000 (Sigma-Aldrich). HepG2-NTCP-myc cells in 96-well plates were treated with PreS1, anti-OVA antibody, HE1-9-10 antibody, or N6HB426-20 antibody for 1 hour, and then washed with PBS. Cells were infected with HBV at a concentration of 100 genomic equivalents per cell in the presence of 4% PEG8000 and 2% DMSO in the presence of PreS1 or each antibody. After 24 hours of infection, cells were washed with PBS. HBV-infected cells were cultured in fresh medium containing 2% DMSO. Six days after infection, the amount of HBs antigen was measured using chemiluminescent enzyme immunoassay (Lumipulse f, Fujirebio, Tokyo, Japan). Alternatively, PXB cells were treated with PreS1, anti-OVA antibody, HE1-9-10 antibody, or N6HB426-20 antibody for 1 hour, and then washed with PBS. Cells were infected with HBV (genotype C or genotype D from HBV-infected patients) at a concentration of 100 genomic equivalents per cell in the presence of 4% PEG8000 and 2% DMSO, along with PreS1 or each antibody. Cells were washed with PBS 24 hours after infection. HBV-infected cells were cultured in fresh medium containing 2% DMSO. The amount of HBs antigen was measured 6 or 12 days after infection using chemiluminescent enzyme immunoassay (Lumipulse f, Fujirebio, Tokyo, Japan).

[0050] Antibody production screening To determine whether hybridomas secrete anti-NTCP antibodies, FACS analysis was performed using hybridoma-derived culture supernatant. NTCP-overexpressing cell lines were stained, and samples that did not stain relative to the parent cell line were selected as positive samples. Specifically, the results were as follows:

[0051] Anti-NTCP antibodies with inhibitory activity against HBV infection 61,500 hybridoma-derived culture supernatants were reacted with B lymphoma cell lines and parental cell lines that forcibly expressed hNTCP, respectively. After washing, the cells were stained with fluorescently labeled anti-mouse IgG antibody. 700 hybridoma cell lines producing antibodies that bind to NTCP were obtained through FACS screening. The culture supernatants of the positive hybridomas were screened using a pseudovirus HBV infection inhibition activity test. Nine hybridomas showing more than 50% activity inhibition were subcloned, and the culture supernatants from each clone were retested. The results are shown in Figure 1A. As shown in Figure 1A, hybridoma clones were obtained that produced antibodies with low HBV infection rates and without reducing cell viability. Furthermore, it was shown that culture supernatants derived from N6HB426-20, a subclone derived from the N6HB426 hybridoma strain (the resulting antibody is referred to as "N6HB426-20 antibody" or "N6HB426-20 monoclonal antibody"), and culture supernatants derived from N6HB426-s102 (the resulting antibody is referred to as "N6HB426-s102 antibody" or "N6HB426-s102 monoclonal antibody") exhibit activity equivalent to that of preS1 peptide inhibitors. The established clone-derived antibodies were purified, and their activity was reconfirmed in a pseudo-HBV infection inhibitory activity test obtained by incorporating the NanoLuc gene into the genome. The results are shown in Figure 1B. As shown in Figure 1B, it was revealed that the N6HB426-20 antibody and the N6HB426-s102 antibody inhibit pseudo-HBV infection in a concentration-dependent manner, similar to preS1. IC of these antibodies 50The IC50 levels were equivalent in both clones, at 0.27 μg / mL (1.8 nM) and 0.25 μg / mL (1.7 nM), respectively. In this experiment, the IC50 of preS1, the HBV ligand molecule of NTCP, was observed. 50 The concentration was 0.03 μg / mL (4.5 nM).

[0052] From the established antibodies, the N6HB426-20 antibody was selected and an infection inhibition test was performed using live HBV. Specifically, the inhibitory activity of different antibody concentrations against HBV infection using the human hepatocyte line HepG2 / NTCP-myc, which overexpresses human NTCP, as the target cells was investigated. In this experiment, the control group consisted of the anti-NTCP antibody HE1-9-10 monoclonal antibody and anti-ovalbumin (OVA) monoclonal antibody, which did not show infection inhibition. The results are shown in Figure 2A. As shown in Figure 2A, when the HBV infection inhibitory activity of the N6HB426-20 monoclonal antibody was evaluated using the amount of HBs antigen as an indicator, IC 50 The concentration was 20-30 nM, and a similar inhibitory effect to that of preS1 was obtained. Since no infection inhibitory effect was observed with anti-OVA antibody and HE1-9-10 monoclonal antibody, it was confirmed that infection inhibition is specific to the recognition site of the N6HB426-20 antibody against NTCP.

[0053] The N6HB426-20 antibody showed comparable inhibitory effects to preS1 against HBV infection in normal human hepatocytes, and no difference in inhibitory activity was observed between different purified antibody batches (see Figure 2B). Furthermore, when recombinant antibodies derived from the N6HB426-20 antibody were produced, comparable activity was obtained with these recombinant antibodies as well (see Figure 2B). In addition, the established antibody's inhibitory effect on HBV infection was suggested to be similar not only against HBV of genotype C, which is prone to tumorigenesis, but also against HBV of other genotypes, such as D (see Figure 2C).

[0054] HBV infection inhibition experiments using human hepatocyte chimeric mice The creation of uPA / SCID mice and the transplantation of human hepatocytes were carried out as previously reported (Tateno C. et al., Am. J. Pathol., 165:901-912, 2004). All mice were transplanted with human hepatocytes obtained from the same donor. Twenty-three mice in which more than 90% of the liver tissue was replaced with transplanted human hepatocytes were used in the experiment. These mice were subjected to 10 3 Human serum containing copies of HBV was administered via tail vein. 2.0 mg of purified N6HB426-20 antibody was intravenously injected one day before and two days after HBV inoculation, and 1.0 mg of the same antibody was intraperitoneally injected seven, fourteen, and twenty-one days later. As a control, the same amount of normal mouse IgG antibody (Normal Mouse IgG, Whole Molecule, Purified, Fujifilm Wako Pure Chemical Industries, Ltd.) was administered in the same manner. One mouse that died after administration on day 0 was excluded from the experiment. A total of 20 mice were used, 10 of each group. Serum was collected weekly after HBV inoculation. Three mice were used for infection confirmation and no other drugs were administered. HBV-DNA was quantified using 10 μL of mouse serum. The serum was diluted in 690 μL of PBS, and DNA extraction was performed. Serum HBV-DNA levels were measured using real-time PCR with a cobas 6800 System (Roche Diagnostics KK, Tokyo, Japan). The lower limit of quantification for this method is 3.61 log copies / mL. Additionally, bile acids were measured after diluting 10 μL of mouse serum 30-fold with PBS. All animal experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animals and the Hiroshima University Animal Experiment Regulations. Injections and blood collection from mice were performed under isofran anesthesia. Collected mouse serum was stored in liquid nitrogen in divided portions until use. Human serum was provided from one patient who provided written informed consent.

[0055] As a result, in all 10 mice administered with normal mouse IgG antibody, HBV-DNA levels rose to a quantifiable level at 4 weeks after HBV inoculation and rose further at 5 weeks (see Table 1-2 and Figure 10). However, in all 10 mice administered with N6HB426-20 antibody, serum HBV-DNA levels were not detectable at 4 weeks (see Table 1-1 and Figure 10). This result suggests that administration of N6HB426-20 antibody inhibited the establishment of HBV infection. In addition, the N6HB426-20 administration group showed a transient increase in serum bile acids (see Tables 2-1 and 2-2, and Figure 11). The increase in serum bile acids was transient, peaking at the time of HBV inoculation, and bile acid concentrations decreased after 1 week (see Table 2-1 and Figure 11). However, the inhibitory effect on HBV infection persisted long-term even after the first week, when bile acid concentrations decreased. This result indicates that the N6HB426-20 antibody inhibits the establishment of HBV infection while having a sufficiently small inhibitory effect on bile acid transport. From this, it is suggested that antibodies with the same binding characteristics as the N6HB426-20 antibody similarly inhibit the establishment of HBV infection while having a sufficiently small inhibitory effect on bile acid transport. The table below shows the measurement data for each of the 10 mice.

[0056] [Table 1-1] * "ND" means that data was not retrieved. *The "-" indicates that the value is below the detection limit. * "<3.61" means that although the value is below the limit of quantification, a specific amplification reaction signal for HBV was detected.

[0057] [Table 1-2] *The "-" indicates that the value is below the detection limit. * "<3.61" means that although the value is below the limit of quantification, a specific amplification reaction signal for HBV was detected.

[0058] [Table 2-1]

[0059] [Table 2-2]

[0060] The HBV infection receptor NTCP exhibits bile acid absorption function in hepatocytes in vivo, and knowing whether this absorption effect is inhibited by the reaction with the obtained antibody is an important issue when considering clinical use. Myrcludex B and Cyclosporin A, which have been developed to date, exert inhibitory effects on HBV infection through binding to NTCP, but at the same time, side effects of suppressing bile acid uptake have been observed, and clinical use has been avoided. Therefore, the inhibitory effect of antibodies on bile acid uptake was confirmed below. Specifically, human NTCP-expressing HepG2 was treated for 30 minutes in the presence or absence of antibodies (HB426-20 antibody or HB426-s102 antibody), preS1, or the preS1 isomer, which does not have NTCP binding activity (all in a 10-fold dilution series (4 points) starting from the highest concentration of 1000 nM). After washing and replacement with assay buffer for taurocholic acid absorption and acclimatization, [ 3 Add H]-taurocholic acid and allow it to be absorbed in a CO2 incubator at 37°C for 15 minutes. After washing the cells, the intracellular [ 3 [H] was measured using a scintillation counter. The assay system was confirmed to be functioning using preS1 (absorption inhibition) and preS1-isomer (no absorption inhibition). The results showed that in in vitro bile acid absorption tests, preS1 inhibited 60% of bile acid uptake at 100 nM and 96% at 1000 nM. On the other hand, under the same experimental conditions, N6HB426-20 antibody showed 3% bile acid uptake inhibition at a concentration of 1000 nM, indicating that the concentration required for infection inhibitory activity (IC) was not met. 50At concentrations of 20-30 nM, the antibody showed almost no inhibition of bile acid uptake (see Figure 3). This suggests that an appropriate dose of N6HB426-20 antibody inhibits HBV infection while having a weak inhibitory effect on bile acid uptake.

[0061] Epitope mapping of N6HB426-20 antibody To clarify the HBV infection inhibitory function, we performed epitope mapping of NTCP with the N6HB426-20 antibody and clarified its relationship with regions important for HBV infection. Using NTCP mutant transfectants obtained by alanine scanning, we evaluated the susceptibility to HBV infection, the changes in inhibitory activity by the antibody, and the contribution of specific amino acid residues to FACS analysis. As a result, it was revealed that amino acid residues 276-277 of human NTCP affected the antibody, but these amino acid residues were not a site that had a significant impact on HBV infection (see Figure 9). However, both ends of amino acid residues 276-277 (amino acid residues 274-275 and 278-279) are also epitopes for HBV infection, and it is possible that steric hindrance caused by the binding of the N6HB426 antibody to amino acid residues 276-277 inhibits the binding of HBV to amino acid residues 274-275 and 278-279 of NTCP. On the other hand, triple amino acid residue mutations of Y146A, D149A, and D152A (YDD146,149,152AAA) resulted in strong suppression of HBV infection and reduced antibody binding. Further detailed analysis of this phenomenon revealed that amino acid 146 was recognized as an epitope for viral infection and as part of the antibody epitope (Figures 4 and 5B). In particular, the Y146A monomutant showed significantly reduced binding to the N6HB426 antibody (see Figure 5A left). Furthermore, HBV infection was inhibited in human hepatocytes expressing the Y146A monomutant (see Figure 5A right). Therefore, it was revealed that Y146 is an amino acid involved in viral infection of cells and binding by the N6HB426-20 antibody. The results are summarized in Figure 6. Furthermore, the YDD146,149,152AAA triple mutant showed reduced binding to N6HB426 antibody and decreased HBV infection. Therefore, it was revealed that Y146,D149,D152 are amino acids involved in viral infection of cells and binding by N6HB426-20 antibody.Furthermore, these results suggest that the N6HB426-20 antibody and the NTCP region to which HBV binds overlap or are in close proximity, and that this region (amino acid residues 146, 149, 152 and 274-279) plays a small role in bile acid uptake by NTCP. Therefore, it is thought that an antibody against this region can prevent HBV infection while not inhibiting bile acid uptake. Thus, this example has revealed in detail the amino acid region on NTCP necessary for HBV infection, highlighting the importance of antibody properties that bind to the wild type of NTCP but not to the above-mentioned mutant. Based on these antibody properties, it is expected that a method for obtaining antibodies that separate infection inhibition from the inhibition of bile acid uptake and a test system will be established. Furthermore, it was revealed that amino acid residues 278-279 near the antibody epitope are essential for HBV infection (see Figure 7), while amino acid residues 276-277 were found to be related to the binding of the N6HB426-20 antibody (see Figure 8). As shown in Figure 7, the PE276,277AA double mutant does not inhibit HBV infection, and this infection could not be inhibited by the N6HB426-20 antibody. This suggests that the N6HB426-20 antibody uses amino acids adjacent to a site that does not have a major impact on HBV infection as its epitope, thereby inhibiting HBV infection of human hepatocytes. The results are summarized in Figure 9.

[0062] Hybridoma cloning and antibody purification Limiting Dilution Method Hybridomas producing antibodies with NTCP-dependent HBV infection inhibitory activity were diluted to 0.3 cells and 1 cell / well in HT medium (18% FCS, 10% BM-condimed H1-containing RPMI1640) after dormancy and seeded in 96-well plates. The supernatant was replaced with fresh HT medium every 3-4 days, and a portion of the supernatant was collected from clones that showed sufficient growth. Antibody production and HBV infection inhibitory activity were confirmed by FACS analysis, as in the screening described above. Cloning of hybridomas was repeated for clones that showed activity by performing two limiting dilutions.

[0063] Cell acclimatization to serum-free medium and production of monoclonal antibodies Acclimatization to serum-free medium was performed in two steps. In the first step, the concentrations of FCS, HT, and BM-condimed H1 were gradually decreased from HT medium, and cell proliferation was repeatedly confirmed. Finally, the cells were adapted to culture in RMPI-1640 medium containing 10% FCS, HT-free, and BM-condimed H1-free cells. Subsequently, the FCS concentration was reduced using serum-free PFHM-II (GIBCO, 23600042) medium, and the proliferative phase of hybridomas was confirmed. The gradual decrease in FCS concentration was continued, and the cells were finally acclimatized to serum-free medium. 5 × 10 7 Cells were isolated and transferred to celline flask culture using serum-free medium (BD 353137). After 14 days of culture at 37°C and 5% CO2, the cells and medium were collected from the cell culture chamber and centrifuged to obtain the culture supernatant containing antibodies.

[0064] Antibody purification The recovered culture supernatant was dialyzed to conjugation buffer (20 mM sodium phosphate, pH 7.0) and mixed with Protein G sepharose 4 Fast Flow (GE Healthcare) overnight at 4°C. The following day, the mixture of Protein G and culture supernatant was placed in a purification column and washed with conjugation buffer to remove non-antibody proteins. Subsequently, the antibody was eluted with Arg-antibody Elution buffer (pH 4.0, nacalai tesque 17088-15) and immediately neutralized with 1 M Tris-HCl, pH 9.0. The antibody fraction was concentrated by ultrafiltration spin column, dialyzed to PBS, and stored at 4°C after sterile filtration.

[0065] Example 3: Sequencing of the gene encoding the N6HB426 antibody 1. Total RNA extraction from hybridomas Total RNA extraction from hybridomas producing N6HB426 antibody is performed using TRIZOL. TM The following procedures were followed, in accordance with the manufacturer's manual for Reagent (Thermo Fisher Cat. No. 15596-018): (1) 10 7 TRIZOL in a pellet of individual cells TM Add 1 mL of Reagent, gently pipette to dissolve, and let stand at room temperature for 5 minutes. (2) Add 0.2 mL of chloroform, stir vigorously, and then let stand at room temperature for 5 minutes. (3) After centrifugation at 20,400 × g, 4°C, and 15 minutes, only the upper aqueous phase was collected. (4) Add 0.5 mL of isopropyl alcohol to the collected aqueous phase and mix. Let stand at room temperature for 10 minutes, then centrifuge at 20,400 × g at 4°C for 10 minutes. (5) Discard the supernatant, add 1 mL of 75% ethanol solution to the remaining precipitate, mix gently by inversion, and then centrifuge at 7,500 × g, 4°C, for 5 minutes. (6) The ethanol was completely removed and the precipitate was allowed to air dry. (7) Add 50 μL of RNase-free water to the precipitate and heat at 60°C for 10 minutes to dissolve all RNA.

[0066] 2. Synthesis of single-stranded cDNA from total RNA The RT reaction was performed using total RNA extracted from a hybridoma that produces the N6HB426 antibody as a template. TM Following the manufacturer's instructions for the RACE 5' / 3' Kit (Clontech Cat. No. 634859), single-stranded cDNA with a SMARTer II A oligonucleotide attached to the 5' end was synthesized. (1) 0.5 μg of total RNA was mixed with 1 μL of 5'-RACE CDS Primer A (12 μM) and RNase-free water to make a total volume of 11 μL. The mixture was reacted at 72°C for 3 minutes, then at 42°C for 2 minutes, and immediately afterward, 1 μL of SMARTer II A Oligonucleotide (24 μM) was added. (2) Mix 4 μL of 5× First-Strand Buffer, 0.5 μL of DTT (100 mM), 1 μL of dNTP mix (20 mM), 0.5 μL of RNase Inhibitor (40 U / l), and 2 μL of SMARTScribe Reverse Transferase (100 U / μl) with the reaction mixture from (1), and carry out the reaction at 42°C for 90 minutes and then at 70°C for 10 minutes. (3) Add 50 μl of Tricinine-EDTA Buffer to stop the reaction, and store at -20°C.

[0067] 3. Mouse antibody (IgG) sequence-specific RACE PCR reaction SMARTer TM Following the instructions for the RACE 5' / 3' Kit (Clontech Cat. No. 634859), 5' RACE PCR analysis was performed. (1) Using the cDNA synthesized in step 2 above as a template, a RACE PCR reaction was performed using the UPM (Universal primer mix) included in the kit as a forward primer and a mouse antibody (IgG) heavy chain specific primer (IgGFab(+39)_Rv(SEQ ID NO: 1)) as a reverse primer. Similarly, using the cDNA synthesized in step 2 above as a template, a RACE PCR reaction was performed using the UPM (Universal primer mix) as a forward primer and a mouse antibody (IgG) light chain specific primer (IgKFab_Rv(SEQ ID NO: 2)) as a reverse primer. The PCR enzyme used was PrimeSTAR. TM GXL DNA polymerase (Takara Bio Inc., Cat. No. R050A) was used. The PCR reaction was performed according to the manufacturer's manual included with the kit. (2) The expected size of the PCR product was confirmed by electrophoresis on an agarose gel. Each PCR product was excised from the gel, purified, and used for analysis.

[0068] 4. Cloning and DNA sequencing analysis (1) Each of the purified PCR products described above was ligated to the cloning plasmid pMD20-T (Takara Bio Inc.). (2) Transformation was performed using a standard method, and five clones were obtained for each PCR product. (3) The sequences of the inserts contained in the acquired clones were analyzed according to standard procedures. The sequencing reaction was performed using the BigDye Terminators v3.1 Cycle Sequencing Kit (ABI) and an ABI3730 Sequencer (ABI) in accordance with the manufacturer's manual. (4) The results of the nucleotide sequence analysis of 5 clones each of the heavy chain and light chain were obtained, and the nucleotide sequences were obtained by removing the vector region and regions with low accuracy from these.

[0069] 5. Sequence determination Next, the following analysis was performed using the base sequence obtained in 4-(4) above. (1) Classification of acquired sequences and acquisition of consensus sequences The base sequences of the heavy and light chains were classified by homology. Homology comparison was performed using DNA sequencing and assembly software, SEQUENCHER. TM This was performed using Gene Codes (Windows version). As a result, four contigs were obtained from the heavy chain and one from the light chain. The consensus sequence was obtained from the obtained contigs. (2) Candidate sequences of the target gene Candidate sequences for the target gene were selected from the consensus sequence. Here, all sequences containing methionine residues without stop codons upstream of the amino acid sequence of the antibody constant region gene were selected. (3) Estimation of amino acid sequence Based on the number of sequences forming contigs among the candidate sequences and the estimated gene lengths from the obtained sequences, the major contigs of the heavy and light chains were considered to be the most likely target sequences. Therefore, the amino acid sequences encoded by the consensus sequences of each major contig were designated as the amino acid sequences of the heavy and light chains.

[0070] The amino acid sequences of the heavy and light chain variable regions of the N6HB426-20 antibody obtained by the above method are shown below. The amino acid sequence of the heavy chain variable region is shown in Sequence ID No. 3. The amino acid sequence of the light chain variable region is shown in Sequence ID No. 4. According to the numbering by Kabat et al. (Kabat, EA et al., Sequences of Proteins of Immunological Interest, 5th ed., 1991, Bethesda: US Dept. of Health and Human Services, PHS, NIH.), in Sequence ID No. 3 of the heavy chain variable region, positions 31-35 correspond to CDR1 (Sequence ID No. 5; HCDR1), positions 50-66 correspond to CDR2 (Sequence ID No. 6; HCDR2), and positions 99-115 correspond to CDR3 (Sequence ID No. 7; HCDR3). Similarly, according to Kabat et al.'s numbering, in the light chain variable region of sequence number 4, positions 24-35 correspond to CDR1 (sequence number 8; LCDR1), positions 51-57 to CDR2 (sequence number 9; LCDR2), and positions 90-98 to CDR3 (sequence number 10; LCDR3). Below, CDR1-3 of the heavy chain and light chain are shown in underlined bold, respectively. The following shows the CDR regions estimated by Kabat's numbering.

[0071] [ka] [ka]

[0072] The heavy chain variable region and light chain variable region of the determined N6HB426 antibody were ligated in-frame with the constant region of the mouse IgG2a antibody to produce the N6HB426-20-IgG2a antibody. The inhibitory effect of the N6HB426-20-IgG2a antibody on HBV infection of hepatocytes is as described above (see Figure 2B).

[0073] Example 4: Preparation and evaluation of recombinant mouse IgG2a antibody and human chimeric IgG4 antibody

[0074] (1) Production of recombinant mouse IgG2a antibody The N6HB426-20 antibody was constructed by substituting the constant region of the N6HB426-20 antibody with the constant region of a mouse antibody. Specifically, the 3' end of the gene encoding CH2 and CH3 (SEQ ID NO: 16), which are part of the constant region from the Hinge region of the N6HB426 antibody's heavy chain variable region to CH1 (SEQ ID NO: 15), was ligated to the 5' end of the gene encoding the murine IgK secretory sequence (GenBank: AAH80787.1) (SEQ ID NO: 17). The 5' end of the completed gene was then ligated to the 3' end of the gene encoding the murine IgK secretory sequence (GenBank: AAH80787.1) (SEQ ID NO: 17), and incorporated into the expression vector pcDNA3.4 to complete the recombinant N6HB426-20 antibody heavy chain protein expression construct. Furthermore, the 3' end of the gene encoding the murine IgK secretory sequence (GenBank: AAH80787.1) (SEQ ID NO: 17) was ligated to the 5' end of the gene encoding the N6HB426 antibody from the light chain variable region to the constant region CL (SEQ ID NO: 18), and this was incorporated into the expression vector pcDNA3.4 to complete the recombinant N6HB426-20 antibody light chain protein expression construct.

[0075] Cellular expression of recombinant antibodies is performed using ThermoFisher Scientific's Expi293. TM The process was carried out in accordance with the Expression System User Guide. 7 μg of recombinant N6HB426-20 antibody heavy chain protein expression construct and 22 μg of recombinant N6HB426-20 antibody light chain protein expression construct were both diluted in 1.5 ml of Opti-MEM, and then 80 μl of ExpiFectamine was added. TM 1.5 ml of Opti-MEM containing 293 Reagent was allowed to stand at room temperature for 5 minutes. The two solutions were mixed and allowed to stand at room temperature for 20 minutes, after which 30 ml of Expi293 was incubated at 37°C in the presence of 8% CO2. TM 2.5 × 10⁶ cells cultured in Expression Medium 6 It was added to individual Expi293F cells. After 20 hours, 150 μl of ExpiFectamine was added. TM293 Transfection Enhancer 1 and 1.5 ml of ExpiFectamine TM Six days after adding 293 Transfection Enhancer 2, the culture medium was collected. The collected culture medium was centrifuged at 11,000xg for 20 minutes at 4°C, and the supernatant was filtered through a 0.45 μm filter and passed through a column packed with Protein G Sepharose 4 Fast Flow (GE Healthcare cat. No. 17061805). After passing five times the column volume of washing buffer (20 mM Tris-HCl (pH 7.5), 1 M NaCl) through the column, the antibody bound to Protein G Sepharose was eluted with 0.1 M glycine-HCl buffer (pH 2.7), and a neutralizing solution (1 M Tris-HCl (pH 9)) equivalent to 10% of the eluate volume was added to the eluate. The eluate after neutralization was concentrated using Amicon Ultra-15, Ultracel-50 regenerated cellulose membrane, 15 mL sample volume (Millipore, cat. No. UFC905024) while replacing the buffer with PBS according to the user guide, until the antibody concentration reached 2 mg / ml or higher. Recombinant mouse IgG2a antibody was obtained by the above method.

[0076] (2) Production of recombinant N6HB426 human chimeric IgG4 antibody It was prepared by substituting the constant region of the N6HB426-20 antibody with the constant region of a human antibody. Specifically, the 5' end of a gene encoding the constant region of the human IgG4 antibody, from CH1 to Hinge, through CH2 to CH3 (Sequence ID 20), was ligated to the 3' end of the gene encoding the heavy chain variable region (Sequence ID 19) of the N6HB426-20 antibody. The 3' end of a gene encoding the murine Igκ secretory sequence (GenBank: AAH80787.1) (Sequence ID 17) was ligated to the 5' end of the completed gene, and this was incorporated into the expression vector pcDNA3.4 to complete the expression construct of a recombinant N6HB426 human chimeric IgG4 antibody heavy chain protein having the sequence shown in Sequence ID 21. Furthermore, the 5' end of the gene encoding the human Igκ-type light chain constant region (UniProtKB / Swiss-Prot: P01834.2) (Sequence ID 23) was ligated to the 3' end of the gene encoding the light chain variable region (Sequence ID 22) of the N6HB426-20 antibody. The 3' end of the gene encoding the murine Igκ secretory sequence (GenBank: AAH80787.1) (Sequence ID 17) was ligated to the 5' end of the completed gene, and this was incorporated into the expression vector pcDNA3.4 to complete the expression construct of a recombinant N6HB426 human chimeric antibody light chain protein having the sequence shown in Sequence ID 24.

[0077] Cellular expression of recombinant antibodies is performed using ThermoFisher Scientific's Expi293. TM The process was carried out in accordance with the Expression System User Guide. 7 μg of recombinant N6HB426 human chimeric IgG4 antibody heavy chain protein expression construct and 22 μg of recombinant N6HB426 human chimeric antibody light chain protein expression construct were both diluted in 1.5 ml of Opti-MEM, and then 80 μl of ExpiFectamine was added. TM 1.5 ml of Opti-MEM containing 293 Reagent was allowed to stand at room temperature for 5 minutes. The two solutions were mixed and allowed to stand at room temperature for 20 minutes, after which 30 ml of Expi293 was incubated at 37°C in the presence of 8% CO2. TM 2.5 × 10⁶ cells cultured in Expression Medium6 It was added to individual Expi293F cells. After 20 hours, 150 μl of ExpiFectamine was added. TM 293 Transfection Enhancer 1 and 1.5 ml of ExpiFectamine TM Six days after adding 293 Transfection Enhancer 2, the culture medium was collected. The collected culture medium was centrifuged at 11,000 × g for 20 minutes at 4°C, and the supernatant was filtered through a 0.45 μm filter and passed through a column packed with Protein G Sepharose 4 Fast Flow (GE Healthcare cat. No. 17061805). After passing five times the column volume of washing buffer (20 mM Tris-HCl (pH 7.5), 1 M NaCl) through the column, the antibody bound to Protein G Sepharose was eluted with 0.1 M glycine-HCl buffer (pH 2.7), and a neutralizing solution (1 M Tris-HCl (pH 9)) equivalent to 10% of the eluate volume was added to the eluate. The eluate after neutralization was concentrated using Amicon Ultra-15, Ultracel-50 regenerated cellulose membrane, 15 mL sample volume (Millipore, cat. No. UFC905024) while replacing the buffer with PBS according to the user guide, until the antibody concentration reached 2 mg / ml or higher. This yielded recombinant N6HB426 human chimeric IgG4 antibody.

[0078] (3) Measurement of antigen-binding affinity of the obtained antibody Using the CM5 chip immobilized with the N6HB426 antibody obtained in (1) and (2) above, a BIAcore at 25°C TM-Surface plasmon resonance assays were performed using 2000 (BIAcore, Inc., Piscataway, NJ) to measure the association rate (Ka) and dissociation rate (Kd). In short, a carboxymethylated dextran biosensor chip (CM5, BIAcore Inc.) was activated with N-ethyl-N'-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) according to the provider's instructions. Anti-mouse IgG antibody was diluted to 30 μg / ml with 10 mM sodium acetate (pH 5.2) and injected at a flow rate of 5-10 μl / min so that the reaction units (RU) of the bound protein were approximately 9,000-14,000 RU. On the other hand, anti-human IgG antibodies were diluted to 25 μg / ml with 10 mM sodium acetate (pH 5.0) and injected at a flow rate of 5-10 μl / min so that the reaction units (RUs) of the bound protein were approximately 9,000-14,000 RUs. After injection of each anti-IgG antibody, 1 M ethanolamine was injected to block the unresponsive group. For kinetic measurements, N6HB426 antibody, diluted to 10 μg / ml with running buffer (HBS-P: 10 mM HEPES pH 7.5, 150 mM NaCl, 0.005% NP40), was immobilized on a CM5 chip via anti-mouse IgG antibody. Epitope region-containing peptide fragments (AFPPEVIGPLFFFPLLYMIFQLGEG-biotin: SEQ ID NO: 24), diluted to various concentrations with running buffer, were added to the chip at 25°C at a flow rate of 10 μl / min for 2 minutes. On the other hand, recombinant N6HB426 human chimeric IgG4 antibody was diluted to 10 μg / ml with running buffer and then immobilized on a sensor chip (CM5) via anti-human IgG antibody. Epitope region-containing peptide fragments, diluted to various concentrations with running buffer, were then added to the sensor chip at 25°C at a flow rate of 10 μl / min for 2 minutes.

[0079] The association rate (Ka) and dissociation rate (Kd) were calculated using a simple one-to-one Langmuir binding model (BIAcore Evaluation software version 3.1) by monitoring in real time the change in the refractive index of the solution correlated with the change in the surface mass of the chip caused by the binding of peptide fragment molecules to the N6HB426 antibody on the sensor chip, and simultaneously fitting sensorgrams of antigen-antibody association and dissociation. The equilibrium dissociation constant (KD) was calculated as the Kd / Ka ratio. The results are shown in Table 3.

[0080] [Table 3]

[0081] As shown in Table 3, although slightly inferior to the binding affinity (KD = 38.8 pM) of the antibody produced by the hybridoma, both the recombinant mouse antibody and the human chimeric antibody still maintained strong binding affinity, exhibiting KD values ​​on the order of 100 pM.

[0082] (4) Pseudovirus assay Anti-HBV assays were performed using N6HB426-20 mouse IgG (hybridoma-producing antibody), recombinant N6HB426 human chimeric IgG4 antibody, or negative control anti-OVA antibody (0.03 μg / mL to 100 μg / mL each), with PreS1 (0.03 ng / mL to 3 ng / mL) as a comparative control. To verify the operation of the anti-HBV infection inhibition assay system, the HBV prophylactic agent human anti-HBs immunoglobulin (HBIG: 0.0026 U / mL to 2.6 U / mL) was used. 5 × 10⁶ cells were cultured in a 96-well plate. 4HepG2-human NTCP cell lines were seeded in cells / well and cultured for 2 hours with the test reagent. Subsequently, recombinant pseudo-HBV with the NanoLuc gene (HBV / NL) inserted was used for infection. 24 hours after infection, cells were washed three times with PBS. Eight days post-infection, NanoLuc activity and cell viability of host cells were averaged from three repeated measurements. NanoLuc activity was determined using the Nano-Glo luciferase assay system (Promega), and cell viability was evaluated using the CellTiter-Glo 2.0 assay system (Promega). The inhibition rate of pseudovirus infection by the addition of antibodies, etc., was determined as a percentage (%), with the difference between the NanoLuc activity of cells in uninfected wells and the NanoLuc activity of cells in untreated wells set to 100. The concentration of the test reagent showing a 50% inhibitory effect was determined as the IC50. 50 The values ​​were calculated. Cell viability was expressed as the number of surviving cells at the maximum concentration of added reagents, as a ratio to the control group.

[0083] A comparative study was conducted to evaluate the inhibitory effect of recombinant antibodies, in which the Fc region of hybridoma-producing antibodies was modified to human IgG4, on HBV cell infection. 50 We attempted to evaluate the values. In the HBV host cell infection test using NanoLuc activity, HBIG IC 50 The value (0.013 ± 0.001 U / mL) met the evaluation criteria for anti-HBV inhibition of the measurement system. The inhibition curve and calculated IC obtained in this study 50 This is shown in Figure 12 (a and b, respectively). As shown in Figure 12a, the inhibition curves of the hybridoma-producing antibody and the recombinant N6HB426 human chimeric IgG4 antibody are equivalent, and IC 50 The values ​​were all 1.7 μg / mL. As shown in Figure 12b, IC was higher than in the PreS1-added group. 50The value was low, indicating a strong inhibitory effect. As shown in Fig. 12c, since the viability of host cells was equivalent to that of the untreated group in all reagent-added groups, it was shown that the suppression of NanoLuc activity was a result of HBV infection suppression. From the above, it was found that the recombinant antibody with the Fc region changed to human IgG4 had HBV infection inhibitory activity equivalent to that of the hybridoma-produced antibody.

[0084] Example 5: Effect of recombinant N6HB426 human chimeric IgG4 antibody on in vitro bile acid transporter activity The HepG2-human NTCP cell line was seeded in a 48-well culture plate at 2×10 5 cells / well. The next day, after treatment with different concentrations (1, 10, 100, 1000 nM) of PreS1, PreS1-isomer, and recombinant N6HB426 human chimeric IgG4 antibody for 30 minutes, + the cells were washed with sodium 3 Ringer's solution (prepared by adjusting 145 mM NaCl, 4.8 mM KCl, 1.2 mM MgSO4, 1.2 mM KH2PO4, 1.5 mM CaCl2, 20 mM glucose, and 10 mM HEPES solution to pH 7.4 with Tris), re-cultured at 37°C for 10 minutes, and then 3 [H]-taurocholic acid (PerkinElmer, NET322) was added at a final concentration of 1 μM. 3 The cellular uptake of [H]-taurocholic acid was carried out by culturing at a temperature setting of 37°C for 15 minutes. After washing with ice-cold phosphate-buffered saline (PBS), the cells were lysed with 100 μl of 1% Triton X-100 aqueous solution for 5 minutes and suspended in 900 μl of liquid scintillation cocktail (Ultima Gold XR, PerkinElmer). 3 The amount of intracellular uptake of [H]-taurocholic acid was measured using a liquid scintillation counter (LSC-6100, Aloka).

[0085] The results are shown in Figure 13. As shown in Figure 13, bile acid uptake was suppressed to 1 / 20 by the addition of Pre-S1 1000 nM, a human NTCP-binding peptide, but no suppression of uptake was observed in the negative control pre-S1 isomer. No inhibitory effect on bile acid uptake was observed with the addition of N6HB426 human chimeric IgG4 antibody, an anti-human NTCP antibody, at 1000 nM.

[0086] Example 6: ADCC activity of recombinant N6HB426 human chimeric IgG4 antibody Daudi-human NTCP transfectant was used for target cells. Natural killer cell line KHYG-1 mouse FcγRIII or human FcγRIIIa transfectant were used for effector cells to evaluate the ADCC activity of mouse antibodies or human chimeric antibodies. Target cells were labeled by culturing the fluorescent dye calcein-AM (1 μg / ml, Nacalai Tesque #06735-81) at 37°C for 1 hour. After washing the target cells, 1 × 10⁶ cells were placed in a 96 U bottom well plate. 4 Cells were seeded at a rate of cells / well, and various antibodies (final concentrations: 0.01, 0.1, 1, 10 μg / ml) were added before adding effector cells. The effector:target (E:T) cell ratio was 10:1. After culturing at 37°C and 5% CO2 for 3 hours, the culture supernatant was collected, and the calcein-AM leaked from the target cells was measured by fluorescence intensity at a wavelength of 485 nm (ARVO ×3, ​​PerkinElmer, Inc.). The background was culture supernatant from target cells only. For measuring the maximum release, the supernatant obtained by lysing cells with 1% Triton X-100 was used. The ADCC activity percentage of each sample was calculated as lysis rate = (experimental sample - background release) / (maximum release - background release) × 100.

[0087] The results are shown in Figure 14. As shown in Figure 14, the chimeric antibody against the human CD20 antigen (Ritximab) reacted with CD20-positive cell lines and exhibited KHYG-1-FcγRIII-dependent cytotoxic activity. However, ADCC activity of recombinant N6HB426 human chimeric IgG4 antibody against NTCP-expressing cells was not detected at any concentration.

[0088] Example 7: Verification of human chimeric antibodies and their virus-neutralizing ability A 96-well flat-bottom plate, with 7 x 10 units per well. 4 100 PXB cells (PhoenixBio, Hiroshima, Japan) were seeded and cultured in 65 μL of dHCGM medium (DMEM supplemented with 10% FBS, 20 mM HEPES, 44 mM NaHCO3, 100 U / mL Penicillin, 100 μg / mL Streptomycin, 15 μg / mL L-proline, 0.25 μg / mL Insulin, 50 nM Dexamethasone, 5 ng / mL EGF, 0.1 mM Asc-2P, 2% DMSO) at 37°C and 5% CO2 (Day 0). The culture medium was changed 1 and 3 days after the start of culture, and on day 8 (Day 8), it was changed to antibody-supplemented medium (60 μL). The antibody-supplemented medium consisted of 54 μL of dHCGM medium, 2% DMSO, PBS(-), and either normal mouse IgG (Fujifilm Wako Pure Chemical Industries, Tokyo, Japan) as a negative control or recombinant N6HB426 human chimeric IgG4 antibody as a test group. Normal mouse IgG was added at a concentration of 100 μg / mL, and recombinant N6HB426 human chimeric IgG4 antibody was added at concentrations of 0.01 μg / mL, 0.1 μg / mL, 1 μg / mL, 10 μg / mL, and 100 μg / mL. After changing to the antibody-supplemented medium, the cells were incubated at 37°C and 5% CO2 for 2 hours, followed by the addition of 5 μL of an infection source (dHCGM medium, 2% DMSO) containing HBV at a concentration of 10 genomic equivalents per cell. The medium was changed the day after HBV inoculation (day 9) and two days later (day 10). Nine days after HBV vaccination (day 17), the culture supernatant was collected and the levels of HBs antigen and HBe antigen were measured.

[0089] The results are shown in Figure 15 (HBs antigen amount) and Figure 16 (HBe antigen amount). As shown in Figure 15, the amount of HBs antigen decreased in a dose-dependent manner as the antibody amount increased. Similarly, as shown in Figure 16, the amount of HBe antigen decreased in a dose-dependent manner as the antibody amount increased. These results suggest that the antibody of the present invention has neutralizing activity against infection by live HBV virus.

[0090] Sequence List Sequence ID 1: IgGFab(+39)_Rv primer Sequence ID 2: IgKFab_Rv primer Sequence ID 3: Amino acid sequence of the heavy chain variable region of the N6HB426-20 antibody Sequence ID 4: Amino acid sequence of the light chain variable region of the N6HB426-20 antibody Sequence ID 5: Amino acid sequence of the heavy chain CDR1 of the N6HB426-20 antibody Sequence ID 6: Amino acid sequence of the heavy chain CDR2 of the N6HB426-20 antibody Sequence ID 7: Amino acid sequence of the heavy chain CDR3 of the N6HB426-20 antibody Sequence ID 8: Amino acid sequence of the light chain CDR1 of the N6HB426-20 antibody Sequence ID 9: Amino acid sequence of the light chain CDR2 of the N6HB426-20 antibody SEQ ID NO: 10: Amino acid sequence of the light chain CDR3 of the N6HB426-20 antibody Sequence ID 11: An example of the amino acid sequence of wild-type human NTCP Amino acid sequence of human NTCP with the amino acid mutation Y146A (SEQ ID NO: 12) Sequence ID 13: Amino acid sequence of human NTCP with triple amino acid mutations Y146A, D149A, and D152A Sequence ID 14: A variant of human NTCP with double amino acid mutations P276A and E277A. SEQ ID NO: 15: Amino acid sequence of the region from the variable region to the fixed CH1 of the N6HB426-20 antibody heavy chain. Sequence ID 16: Amino acid sequence from the Hinge region to CH2 and CH3 Sequence ID 17: murine IgK secretory sequence Sequence ID 18: From the light chain variable region to the steady-state region CL Sequence ID 19: N6HB426-20 antibody heavy chain variable region Sequence ID 20: Human IgG4 from CH1 to Hinge, through CH2 to CH3 Sequence ID 21: N6HB426 Human Chimeric IgG4 Antibody Heavy Chain Sequence ID 22: Light chain variable region Sequence ID 23: Human Igκ-type light chain constant region Sequence ID 24: N6HB426 Human Chimeric Antibody Light Chain

Claims

1. An antibody that binds to human sodium taurocholate cotransport polypeptide (human NTP) and can inhibit the infection of human liver cells by hepatitis B virus (HBV) particles, Under culture conditions suitable for hepatocyte culture, at the IC50 concentration related to the above-mentioned infection inhibition, the uptake of bile acids into hepatocytes by human NTPs does not inhibit by more than 50%, and (1) Human NTCP having the amino acid sequence described in SEQ ID NO: 11 binds with a stronger affinity than at least one human NTCP variant having an amino acid sequence selected from the group consisting of the amino acid sequences described in SEQ ID NOs: 12 to 14, or (2) The antibody having a heavy chain variable region having the amino acid sequence described in SEQ ID NO: 3 and a light chain variable region having the amino acid sequence described in SEQ ID NO: 4 competes for binding to human NTPs by at least 50%. and, A heavy chain variable region having CDR1 having the amino acid sequence described in SEQ ID NO: 5, CDR2 having the amino acid sequence described in SEQ ID NO: 6, and CDR3 having the amino acid sequence described in SEQ ID NO: 7, and An antibody having a light chain variable region having CDR1 having the amino acid sequence described in SEQ ID NO: 8, CDR2 having the amino acid sequence described in SEQ ID NO: 9, and CDR3 having the amino acid sequence described in SEQ ID NO:

10.

2. An antibody that binds to human sodium taurocholate cotransport polypeptide (human NTP), which can inhibit the infection of human liver cells by hepatitis B virus (HBV) particles, Under culture conditions suitable for hepatocyte culture, at the IC50 concentration related to the above-mentioned infection inhibition, the uptake of bile acids into hepatocytes by human NTPs does not inhibit by more than 50%, and (1) To a human NTCP having the amino acid sequence described in SEQ ID NO: 11, it binds with a stronger affinity than to at least one human NTCP variant having an amino acid sequence selected from the group consisting of the amino acid sequences described in SEQ ID NOs: 12 to 14, or (2) The antibody having a heavy chain variable region having the amino acid sequence described in SEQ ID NO: 3 and a light chain variable region having the amino acid sequence described in SEQ ID NO: 4 competes for binding to human NTPs by at least 50%. and A heavy chain variable region having the amino acid sequence described in SEQ ID NO: 3 and a light chain variable region having the amino acid sequence described in SEQ ID NO: 4 antibody.

3. (1) The antibody according to claim 1 or 2, which binds to human NTCP having the amino acid sequence described in SEQ ID NO: 11 with a stronger affinity than to at least one human NTCP variant having an amino acid sequence selected from the group consisting of the amino acid sequences described in SEQ ID NOs: 12 to 14.

4. (2) The antibody according to claim 1 or 2, wherein it competes for at least 50% of binding to human NTPs with an antibody having a heavy chain variable region having the amino acid sequence described in SEQ ID NO: 3 and a light chain variable region having the amino acid sequence described in SEQ ID NO:

4.

5. The antibody according to any one of claims 1 to 4, which is a humanized antibody.

6. An antibody according to any one of claims 1 to 4, which is a human antibody.

7. A pharmaceutical composition comprising an antibody according to any one of claims 1 to 6 and a pharmaceutically acceptable carrier.

8. The pharmaceutical composition according to claim 7, for use in treating infections caused by hepatitis B virus.

Images