Method for determining the degree of bulb weight in onion seed plants, method for producing large-bulb onion seed plants, molecular marker for bulb weight in onion seed plants, and determination kit for determining large-bulb onion seed plants.
The use of molecular markers on chromosome 8 of onions for selecting large-bulb varieties addresses the inefficiencies of conventional breeding methods, enabling rapid and reliable identification of suitable onion plants for commercial processing.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- NAT AGRI & FOOD RES ORG
- Filing Date
- 2023-07-07
- Publication Date
- 2026-04-20
AI Technical Summary
Conventional breeding methods for large-fruited onions are time-consuming and environmentally dependent, requiring over 10 years and lacking molecular marker-based techniques, leading to inefficiencies in selecting suitable onion varieties for commercial processing.
A method using specific molecular markers, such as SNPs and InDels, located within a genetic distance of 5 cM from bases on chromosome 8 of onion plants, to determine and select large-bulb onion individuals, enabling rapid identification of plants with high bulb weight potential.
This approach allows for efficient selection of large-bulb onion varieties, reducing the time and environmental variability issues, ensuring consistent yield and suitability for commercial processing.
Smart Images

Figure 0007847860000034 
Figure 0007847860000035 
Figure 0007847860000036
Abstract
Description
Technical Field
[0001] The present invention relates to a method for determining the degree of bulb weight in onion plants, a production method for producing large-bulb onion plants, a molecular marker related to bulb weight in onion plants, and a determination kit for determining large-bulb onion plants.
Background Art
[0002] Approximately 60% of domestic onions are used for commercial processing, and the demand for commercial processing is high. When processing onions, peeling and cutting operations are performed. Compared with ordinary onions, large-bulb onions can obtain the required processing amount with fewer bulbs, so they have high processing suitability. In addition, the number of plants (individuals) that can be cultivated per unit area of onions is limited, and the bulb weight of each individual is directly related to the yield. Therefore, large-bulb onions also contribute greatly to increasing the yield per unit. In addition, in Hokkaido, the main production area of onions, in 2021, due to high temperature and little rain, the onions became small-bulbed, and the yield decreased by 30% compared with the previous year. However, large-bulb onions also contribute to ensuring bulb weight and stabilizing the yield in abnormal weather years. Thus, large-bulb onions are essential for expanding the production areas of future commercial processing vegetables and forming a supply chain.
[0003] Conventionally, as a breeding method for large-bulb onions, a method of actually cultivating onions, measuring traits such as the weight of harvested bulbs, and selecting large-bulb individuals to systemize and breed varieties has been used. As a breeding method for onions, a breeding method for non-pungent and non-tear-producing onions using molecular markers described in Patent Document 1 is known.
Prior Art Documents
Patent Documents
[0004]
Patent Document 1
Summary of the Invention
Problems to be Solved by the Invention
[0005] Conventional breeding methods for large-fruited onions require significant time and effort for cultivation, harvesting, and trait measurement. In particular, because onions are biennial crops, conventional breeding selection based on trait evaluation can take over 10 years. Furthermore, onion growth is strongly influenced by the growing environment; offspring of large-fruited individuals selected in one year may not produce large-fruited onions in another, making it difficult to accurately select individuals with high potential for large-fruited onions. Moreover, no breeding method for large-fruited onions utilizing molecular markers, such as that described in Patent Document 1, is known. Since no large-fruited onion varieties suitable for commercial processing have been developed, there is a need for an efficient method of breeding large-fruited onions.
[0006] One aspect of the present invention aims to provide a technique for selecting large-fruited onion individuals, in view of the above problems. [Means for solving the problem]
[0007] A method for determining the degree of bulb weight in an onion plant according to one aspect of the present invention is: In onion plants, a base corresponding to any of the following bases (a) to (d): (a) The 125th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 1; (b) The 57th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 2; (c) The 115th or 117th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 3; and (d) The 45th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 4; The process includes determining at least one base located within a genetic distance of 5 cM from, or a sequence of polynucleotides containing said base, as a molecular marker for bulb weight in onion plants.
[0008] A method for producing large-fruited onion seed plants according to one aspect of the present invention includes a selection step of selecting large-fruited onion seed plants from onion seed plants by the method described in claim 1 or 2.
[0009] A molecular marker relating to bulb weight in onion plants according to one aspect of the present invention is The bases (SNPs) corresponding to the bases (a) to (d) below: (a) The 125th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 1; (b) The 57th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 2; (c) The 115th or 117th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 3; and (d) The 45th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 4; It contains at least one base located within a genetic distance of 5 cM from, or a contiguous polynucleotide containing said base.
[0010] A determination kit for determining large-fruited onion varieties according to one aspect of the present invention is: In onion plants, a base corresponding to any of the following bases (a) to (d): (a) The 125th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 1; (b) The 57th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 2; (c) The 115th or 117th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 3; and (d) The 45th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 4; The primer includes a region that amplifies at least one base located within a genetic distance of 5 cM from, or a region containing a contiguous polynucleotide including said base. [Effects of the Invention]
[0011] According to one aspect of the present invention, a technique for selecting large-bulb onion individuals can be provided.
Brief Description of the Drawings
[0012] [Figure 1] It is a distribution diagram of the molecular markers created in Example 1. [Figure 2] It is a diagram showing the association analysis results of Example 1. [Figure 3] It is a diagram showing the bulb weight for each genotype of each marker in Example 1. [Figure 4] It is a diagram showing the bulb weight for each genotype of each marker in Example 2. [Figure 5] It is a diagram showing the waveform data of the second marker in Example 2. [Figure 6] It is a diagram showing the determination results of the genotypes of the first marker and the fourth marker in Example 3. [Figure 7] It is a diagram showing the results of agarose gel electrophoresis in Example 4. [Figure 8] It is a diagram showing the linkage map created in Example 5. [Figure 9] It is a diagram showing the results of QTL analysis in Example 5. [Figure 10] It is a diagram showing the bulb weight for each genotype of each marker in Example 5. [Figure 11] It is a diagram showing the results of agarose gel electrophoresis in Example 6. [Figure 12] It is a diagram showing the results of fragment analysis in Example 6. [Figure 13] It is a diagram showing the results of fragment analysis of the marker in Example 6. [Figure 14] It is a diagram showing the results of fragment analysis of the marker in Example 6. [Figure 15] It is a diagram showing the bulb weight for each genotype of each marker in Example 6.
Modes for Carrying Out the Invention
[0013] The present invention will now be described in detail. All references cited herein are incorporated herein by reference. Unless otherwise specified herein, "A to B" representing a numerical range means "greater than or equal to A (including A and greater than A), and less than or equal to B (including B and less than B)."
[0014] As used herein, the term “polynucleotide” is interchangeable with “nucleic acid” or “nucleic acid molecule,” and refers to a polymer of nucleotides. Here, nucleic acid may exist in the form of DNA (e.g., cDNA or genomic DNA) or RNA (e.g., mRNA). DNA or RNA may be double-stranded or single-stranded. Single-stranded DNA or RNA may be a coding strand (sense strand) or a non-coding strand (antisense strand). As used herein, base notation shall be in the single-letter notation as defined by IUPAC and IUB, as appropriate.
[0015] In one embodiment of the present invention, the onion plant species includes onion (Allium cepa) and shallot, a variety of onion. Examples of onion varieties include 'Sapporo Yellow', 'Momiji No. 3', and 'Kita Momiji 2000'.
[0016] Onion seed plants may be candidate plants for breeding material or plants obtained in the breeding process. Candidate plants for breeding material include, for example, parent plants used in crosses and plants used in molecular breeding using genetic engineering technology. Plants obtained in the breeding process include, for example, plants obtained by intraspecific hybridization of plants belonging to the aforementioned varieties of onion seed plants, and their progeny lines. Onion seed plants may also be plants obtained by interspecific hybridization, such as a hybrid plant between an onion seed plant of one variety and an onion seed plant of another variety, and their progeny lines. Furthermore, onion seed plants may be plants obtained by interspecific hybridization of varieties known to produce large onions, and their progeny lines. Onion seed plants may also be plants obtained by intraspecific hybridization of individuals known to produce large onions, and their progeny lines.
[0017] In this specification, "plant" may refer to a part or the whole of a plant body. Examples of parts of a plant body include reproductive material (seeds, bulbs, etc.), scales, leaves, flowers, roots, etc.
[0018] In this specification, an onion variety is considered large-bulbed if its bulb weight is relatively heavier than that of other onion varieties. Here, bulb weight refers to the weight of the bulb of an individual onion variety and is also called bulb weight. Since bulb weight in onion varieties is proportional to the lateral diameter of the bulb, the lateral diameter of the bulb may be used instead of, or in conjunction with, bulb weight as an indicator of large-bulbed characteristics.
[0019] [Molecular markers related to bulb weight in onion plants] A molecular marker according to one aspect of the present invention is a molecular marker relating to bulb weight in onion plants. The molecular marker is a molecular marker capable of selecting large-bulb onion plants, and is a molecular marker for detecting single nucleotide polymorphism (SNP) alleles, or base insertions and deletions (InDel), that can be used to select onion plants having large bulbs.
[0020] The molecular markers are the bases corresponding to the bases listed below (a) to (d): (a) The 125th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 1; (b) The 57th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 2; (c) The 115th or 117th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 3; and (d) The 45th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 4; It contains at least one base located within a genetic distance of 5 cM from, or a contiguous polynucleotide containing said base.
[0021] A molecular marker according to one aspect of the present invention can be used to identify a gene locus related to bulb weight on chromosome 8 of an onion plant. A gene locus related to bulb weight refers to a quantitative trait locus or gene region that affects bulb weight. The quantitative trait locus (QTL) generally refers to a chromosomal region involved in the expression of a quantitative trait. QTLs can be defined using a molecular marker that indicates a specific locus on a chromosome. Techniques for defining QTLs using such molecular markers are well known in the art.
[0022] Molecular markers according to one aspect of the present invention include, as an example, SNP markers, AFLP (Amplified Fragment Length Polymorphism) markers, RFLP markers, microsatellite markers, SCAR markers, CAPS markers, InDel markers, and the like.
[0023] At least one base located within a genetic distance of 5 cM from the bases corresponding to (a) to (d) above, or a contiguous polynucleotide containing such base, is, for example, an SNP marker described in this embodiment or an SNP marker that can be identified therewith. An SNP marker that can be identified with an SNP marker described in this embodiment is an SNP marker located within a genetic distance of 5 cM from an SNP marker described in this embodiment.
[0024] In one embodiment of the present invention, the molecular marker is a base located within a genetic distance of 5 cM from a base corresponding to any of the bases (a) to (d) above. As described above, it can be predicted that a gene related to sphere weight exists in the vicinity of the bases corresponding to the bases (a) to (d) above. Therefore, a base located within a genetic distance of 5 cM from a base corresponding to any of the bases (a) to (d) above can be used as a molecular marker for sphere weight, similar to the bases corresponding to the bases (a) to (d) above. As shown in the examples described later, the bases corresponding to the bases (a) to (d) above are each located within a genetic distance of 5 cM. The molecular marker is preferably a base located within a genetic distance of 3 cM from a base corresponding to the bases (a) to (d) above, and more preferably a base located within a genetic distance of 2 cM.
[0025] In another embodiment of the present invention, the molecular marker is a base located within 10 kb of a base corresponding to any of the bases (a) to (d) above. As shown in the examples described later, the bases corresponding to (a) to (d) above are each located on the same linkage group, and strong QTLs have been detected in their vicinity. Therefore, it can be predicted that genes related to sphere weight exist in the vicinity of the bases corresponding to (a) to (d) above. That is, a base located within 10 kb of a base corresponding to any of the bases (a) to (d) above can be used as a molecular marker related to sphere weight, similar to the bases corresponding to (a) to (d) above. The molecular marker is preferably a base located within 8 kb, and more preferably within 5 kb, of a base corresponding to any of the bases (a) to (d) above.
[0026] In yet another embodiment of the present invention, the molecular marker is a base that is genetically located within 5 cM of the base corresponding to the base in (a) and within 5 cM of the base corresponding to the base in (d). Alternatively, the molecular marker is a base that is genetically located within 3 cM, 2 cM, or 1 cM of the base corresponding to the base in (a) and within 3 cM, 2 cM, or 1 cM of the base corresponding to the base in (d).
[0027] In one embodiment of the present invention, the molecular marker may be a base that is in linkage disequilibrium with the bases corresponding to (a) to (d) above. "Linkage disequilibrium" means that two alleles are inherited in a linkage with each other at a greater frequency than when they are inherited independently. In one embodiment of the present invention, the molecular marker is a base that is in linkage disequilibrium with the bases corresponding to (a) to (d) above, and preferably a base that has a linkage disequilibrium coefficient r2 ≥ 0.9 with any of the bases corresponding to (a) to (d) above.
[0028] Furthermore, a base that is in linkage disequilibrium with a base corresponding to any of the bases (a) to (d) above is more preferably a base that has a linkage disequilibrium coefficient r2 ≥ 0.95 with any of the bases (a) to (d) above. Moreover, a base that is in linkage disequilibrium with a base corresponding to any of the bases (a) to (d) above is even more preferably a base that has a linkage disequilibrium coefficient r2 ≥ 1 with any of the bases (a) to (d) above. A base that is in linkage disequilibrium with any of the bases (a) to (d) above can be identified, for example, by sequencing DNA collected from multiple onion seed plants using a sequencer and searching for bases that are in linkage disequilibrium.
[0029] An SNP marker may be (i) the base corresponding to the SNP, (ii) a sequence of polynucleotides containing the SNP, or (iii) a sequence of polynucleotides containing two or more SNPs.
[0030] (i: SNP marker) Using a molecular marker according to one aspect of the present invention, the degree of bulb weight in onion plants can be determined.
[0031] Here, SNP refers to a DNA polymorphism in which a single nucleotide variant is observed within a specific region of the DNA base sequence. In the context of SNP markers, SNPs are single nucleotide polymorphisms based on the genome sequence of the onion (Allium cepa). The genome sequence of the onion, the reference plant (Onion genome sequence v1.2), is published in the genome database (https: / / www.oniongenome.wur.nl).
[0032] "(a) to (d) bases" refers to the SNP markers described in this embodiment. "(a) to (d) bases equivalent to the SNP markers described in this embodiment" refers to SNP markers that can be identified with the SNP markers described in this embodiment. "(a) to (d) bases" are mutations in the gene region related to bulb weight on chromosome 8. The locus related to bulb weight on chromosome 8 consists of a base sequence derived from a reference onion plant. In other onion plants, there may be regions with different base sequences from the reference base sequence, even in parts other than SNPs. Since the genomic region where this SNP marker is located is conserved among many onion plants, this SNP marker can be identified by methods such as homology searches.
[0033] In other onion species, if there is a locus on chromosome 8 related to bulb weight (i.e., a locus that is highly conserved among plants), then "bases corresponding to (a) to (d)" refers to bases on the locus on chromosome 8 related to bulb weight that have been determined to correspond to (a) to (d) by methods such as homology searches. For example, the polynucleotides described in (a2) to (d2) and (a3) to (d3) below are examples of loci on chromosome 8 related to bulb weight.
[0034] A molecular marker according to one aspect of the present invention is an SNP marker comprising the above-mentioned (a) to (d) SNPs. This SNP marker is a newly identified SNP marker by the present inventors, and those skilled in the art can identify the genomic location of this SNP marker based on the base sequence representing each SNP.
[0035] The SNP in (a) (hereinafter also referred to as SNP(a)) indicates a polymorphism of the 125th base or a corresponding base in the polynucleotide consisting of the base sequence shown in Sequence ID No. 1. The SNP in (b) (hereinafter also referred to as SNP(b)) indicates a polymorphism of the 57th base or a corresponding base in the polynucleotide consisting of the base sequence shown in Sequence ID No. 2. Furthermore, the SNP in (c) (hereinafter also referred to as SNP(c)) indicates a polymorphism of the 115th or 117th base or a corresponding base in the polynucleotide consisting of the base sequence shown in Sequence ID No. 3. Furthermore, the SNP in (d) (hereinafter also referred to as SNP(d)) indicates a polymorphism of the 45th base or a corresponding base in the polynucleotide consisting of the base sequence shown in Sequence ID No. 4. Note that SNP(a), SNP(b), SNP(c), and SNP(d) correspond to CHR8_77892311 (first marker), Scaffold_9797_10963 (second marker), CHR8_82152739(82152741) (third marker), and Scaffold_62471_59198 (fourth marker), respectively, in the embodiments described later.
[0036] According to one aspect of the present invention, a molecular marker can be used to determine that an onion plant is large-fruited when the allele of the base corresponding to SNP(a) is homozygous for C or heterozygous for C / T. Furthermore, when the allele of the base corresponding to SNP(b) is homozygous for T or heterozygous for T / C, the onion plant can be determined to be large-fruited. Additionally, for the allele of the base corresponding to SNP(c), when the 115th base is homozygous for T or heterozygous for T / C, or when the 117th base is homozygous for A or heterozygous for A / T, the onion plant can be determined to be large-fruited. Furthermore, when the allele of the base corresponding to SNP(d) is homozygous for T or heterozygous for T / C, the onion plant can be determined to be large-fruited. Alternatively, molecular markers may be used to determine the degree of bulb weight in onion plants, or whether or not onion plants have a large bulb characteristic, by analyzing at least two of the SNPs (a) to (d) as a haplotype block.
[0037] SNPs that are located within a genetic distance of 5 cM from the bases corresponding to (a) to (d) represent, for example, a polymorphism of the 89th base or a corresponding base in a polynucleotide consisting of the base sequence shown in SEQ ID NO: 21 (5th marker in the example). Another example of a SNP located within a genetic distance of 5 cM from the bases corresponding to (a) to (d) represents a polymorphism of the 109th base or a corresponding base in a polynucleotide consisting of the base sequence shown in SEQ ID NO: 22 (6th marker in the example). Another example of a SNP located within a genetic distance of 5 cM from the bases corresponding to (a) to (d) represents a polymorphism of the 70th base or a corresponding base in a polynucleotide consisting of the base sequence shown in SEQ ID NO: 23 (7th marker in the example). Another example of a SNP located within a genetic distance of 5 cM from the bases corresponding to (a) to (d) represents a polymorphism of the 67th base or a corresponding base in a polynucleotide consisting of the base sequence shown in SEQ ID NO: 24 (8th marker in the example). Furthermore, other examples of SNPs that are located within a genetic distance of 5 cM from the bases corresponding to (a) to (d) indicate a polymorphism of the 34th base or a corresponding base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 25 (marker 9 in the example).
[0038] A molecular marker according to one aspect of the present invention is a polynucleotide whose allele, corresponding to the 89th base of the nucleotide sequence shown in Sequence ID No. 21, is homozygous for T or T / AWhen the allele is heterozygous for , the onion plant can be determined to be a large-fruited variety. Also, when the allele of the base corresponding to the 109th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 22 is homozygous for C or heterozygous for C / A, the onion plant can be determined to be a large-fruited variety. Furthermore, when the allele of the base corresponding to the 70th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 23 is homozygous for T or heterozygous for T / C, the onion plant can be determined to be a large-fruited variety. Also, when the allele of the base corresponding to the 67th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 24 is homozygous for A or heterozygous for A / G, the onion plant can be determined to be a large-fruited variety. Also, when the allele of the base corresponding to the 34th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 25 is G When the plant is homozygous for one type of onion or heterozygous for the other type of onion (G / T), it can be determined that the onion variety is large in size.
[0039] Furthermore, other examples of molecular markers that include bases within a 10kb range from the bases corresponding to (a) to (d), or consecutive polynucleotides containing such bases, include the 10th to 26th markers shown below. The molecular marker may also consist of at least two of the 1st to 26th markers as a haplotype block.
[0040] The tenth marker is an insertion / deletion (InDel) polymorphism at the base corresponding to the 99th base of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 36. The eleventh marker is an InDel polymorphism at the base corresponding to the 113th base of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 37. The twelfth marker is an InDel polymorphism at the bases corresponding to the 207th to 208th bases of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 37.
[0041] The 13th marker is an InDel polymorphism at the base corresponding to the 241st base of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 38. The 14th marker is an InDel polymorphism at the bases corresponding to the 299th to 300th bases of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 38. The 15th marker is an InDel polymorphism at the base corresponding to the 249th base of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 39. The 16th marker is an InDel polymorphism at the bases corresponding to the 84th to 86th bases of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 40.
[0042] Marker 17 is an InDel polymorphism at the base corresponding to the 70th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 41. Marker 18 is an InDel polymorphism at the bases corresponding to the 55th to 70th bases of the polynucleotide consisting of the base sequence shown in Sequence ID No. 42. Marker 19 is an InDel polymorphism at the base corresponding to the 45th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 43. Marker 20 is an InDel polymorphism at the bases corresponding to the 43rd to 44th bases of the polynucleotide consisting of the base sequence shown in Sequence ID No. 44. Marker 21 is an InDel polymorphism at the bases corresponding to the 92nd to 94th bases of the polynucleotide consisting of the base sequence shown in Sequence ID No. 44. Marker 22 is an InDel polymorphism at the bases corresponding to the 147th to 148th bases of the polynucleotide consisting of the base sequence shown in Sequence ID No. 44. Marker 23 is an InDel polymorphism at the bases corresponding to the 215th to 233rd bases of the polynucleotide consisting of the base sequence shown in Sequence ID No. 44.
[0043] Marker 24 is an InDel polymorphism at the base corresponding to the 129th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 45. Marker 25 is an InDel polymorphism at the base corresponding to the 78th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 46. Marker 26 is an InDel polymorphism at the base corresponding to the 194th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 46.
[0044] The 10th marker allows us to determine that an onion plant is of the large-fruited variety when the base corresponding to the 99th base of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 36 is A. The 10th marker allows us to determine that an onion plant is of the small-fruited variety when the base corresponding to the 99th base of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 36 is substituted with 36 bases (AAAACATTTTTGATGATGATCATGAAGTGAAGAGTA).
[0045] The 11th marker indicates that the onion plant is of the large-fruited variety when the base corresponding to the 113th base of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 37 is G. The 11th marker indicates that the onion plant is of the small-fruited variety when the base corresponding to the 113th base of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 37 is substituted with 27 bases (GTGTTGCACAATGACACTTTTGTCGG).
[0046] The 12th marker can be used to determine that an onion plant is of the large-fruited variety if the bases corresponding to positions 207 and 208 of the polynucleotide consisting of the base sequence shown in Sequence ID No. 37 are TG. The 12th marker is a deletion type in which the bases corresponding to positions 207 and 208 of the polynucleotide consisting of the base sequence shown in Sequence ID No. 37 are T.
[0047] The 13th marker allows us to determine that an onion plant is of the large-fruited variety when the base corresponding to the 241st base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 38 is T. In the 13th marker, when the base corresponding to the 241st base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 38 is substituted with 89 bases (TTTGCAAGACGATTTGAAAGAAAAAGAAAACGAGGGAAAAAGAAAAGAAAGTAAAAAGAAATAAATAATGGTTGGTCGACCGATAAAAT), we can determine that an onion plant is of the small-fruited variety.
[0048] The 14th marker can be used to determine that an onion plant is of the large-fruited variety if the bases corresponding to positions 299 to 300 of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 38 are CC. The 14th marker is a deletion type in which the bases corresponding to positions 299 to 300 of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 38 are C.
[0049] The 15th marker indicates that if the base corresponding to the 249th base of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 39 is A, the onion plant can be determined to be a large-fruited variety. The 15th marker indicates that if the base corresponding to the 249th base of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 39 is substituted with a 5-base combination (ATTTA), the onion plant can be determined to be a small-fruited variety.
[0050] The 16th marker allows us to determine that an onion plant is of the large-fruited variety when the bases corresponding to positions 84 through 86 of the polynucleotide consisting of the base sequence shown in Sequence ID No. 40 are AAA. The 16th marker allows us to determine that an onion plant is of the small-fruited variety when the bases corresponding to positions 84 through 86 of the polynucleotide consisting of the base sequence shown in Sequence ID No. 40 are A deletion type.
[0051] The 17th marker indicates that if the base corresponding to the 70th base of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 41 is A, the onion plant can be determined to be a large-fruited variety. In the 17th marker, if the base corresponding to the 70th base of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 41 is substituted with 20 bases (ATATATATAGGCCATGTGTG), the onion plant can be determined to be a small-fruited variety.
[0052] Marker 18 allows us to determine that an onion plant is of the large-fruited variety when the bases corresponding to positions 55 through 70 of the polynucleotide consisting of the base sequence shown in Sequence ID No. 42 are TTGTACAAAAACAATT. Marker 18 allows us to determine that an onion plant is of the small-fruited variety when the bases corresponding to positions 55 through 70 of the polynucleotide consisting of the base sequence shown in Sequence ID No. 42 are of the T deletion type.
[0053] Marker 19 allows us to determine that an onion plant is of the large-fruited variety when the base corresponding to the 45th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 43 is C. In Marker 19, when the base corresponding to the 45th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 43 is substituted with 14 bases (CCATCTATTCCATC), we can determine that an onion plant is of the small-fruited variety.
[0054] The 20th marker allows us to determine that an onion plant is of the large-fruited variety when the bases corresponding to the 43rd to 44th positions of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 44 are AC. The 20th marker allows us to determine that an onion plant is of the small-fruited variety when the bases corresponding to the 43rd to 44th positions of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 44 are A deletion type.
[0055] The 21st marker allows us to determine that an onion plant is of the large-fruited variety when the bases corresponding to positions 92 through 94 of the polynucleotide consisting of the base sequence shown in Sequence ID No. 44 are AAA. The 21st marker allows us to determine that an onion plant is of the small-fruited variety when the bases corresponding to positions 92 through 94 of the polynucleotide consisting of the base sequence shown in Sequence ID No. 44 are A deletion type.
[0056] The 22nd marker indicates that if the bases corresponding to positions 147 and 148 of the polynucleotide consisting of the base sequence shown in Sequence ID No. 44 are TC, the onion plant can be determined to be a large-fruited variety. The 22nd marker indicates that if the bases corresponding to positions 147 and 148 of the polynucleotide consisting of the base sequence shown in Sequence ID No. 44 are T-deleted, the onion plant can be determined to be a small-fruited variety.
[0057] The 23rd marker indicates that if the bases corresponding to positions 215 to 233 of the polynucleotide consisting of the base sequence shown in Sequence ID No. 44 are GTCTAGGGATTCGGCTTT, the onion plant can be determined to be a large-fruited variety. The 23rd marker indicates that if the bases corresponding to positions 215 to 233 of the polynucleotide consisting of the base sequence shown in Sequence ID No. 44 are G-deleted, the onion plant can be determined to be a small-fruited variety.
[0058] The 24th marker indicates that if the base corresponding to the 129th base of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 45 is T, the onion plant can be determined to be a large-fruited variety. In the 24th marker, if the base corresponding to the 129th base of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 45 is substituted with a 6-base combination (TAAAAT), the onion plant can be determined to be a small-fruited variety.
[0059] Marker 25 allows us to determine that an onion plant is of the large-fruited variety when the base corresponding to the 78th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 46 is T. In Marker 25, when the base corresponding to the 78th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 46 is substituted with a triple base (TGT), we can determine that an onion plant is of the small-fruited variety.
[0060] Furthermore, if the 26th marker indicates that the onion plant is of the large-fruited variety, and the base corresponding to the 194th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 46 is T, then the onion plant is of the small-fruited variety.
[0061] (ii: Polynucleotides containing SNPs) A molecular marker according to one aspect of the present invention may be a continuous polynucleotide containing SNP(a) (hereinafter also referred to as polynucleotide(a)), a continuous polynucleotide containing SNP(b) (hereinafter also referred to as polynucleotide(b)), a continuous polynucleotide containing SNP(c) (hereinafter also referred to as polynucleotide(c)), or a continuous polynucleotide containing SNP(d) (hereinafter also referred to as polynucleotide(d)).
[0062] Polynucleotide (a) is a polynucleotide consisting of (a1) a region containing SNP(a) in the base sequence shown in Sequence ID No. 1, (a2) a base sequence in which one or more bases are substituted, deleted, added or inserted to the base sequence other than SNP(a) in the base sequence of the polynucleotide of (a1), and which has the function of determining whether or not the onion plant has a large-fruiting characteristic, or (a3) a base sequence in which there is 90% or more identity with respect to the base sequence other than SNP(a) in the base sequence of the polynucleotide of (a1), and which has the function of determining whether or not the onion plant has a large-fruiting characteristic.
[0063] Polynucleotide (b) is a polynucleotide consisting of a base sequence containing SNP(b) in the base sequence shown in Sequence ID No. 2 (b1), a base sequence in which one or more bases are substituted, deleted, added or inserted to the base sequence other than SNP(b) in the base sequence of the polynucleotide of (b1), and which has the function of determining whether or not the onion plant has a large-fruiting characteristic, or a polynucleotide consisting of a base sequence that has 90% or more identity with respect to the base sequence other than SNP(b) in the base sequence of the polynucleotide of (b1), and which has the function of determining whether or not the onion plant has a large-fruiting characteristic.
[0064] Polynucleotide (c) is a polynucleotide consisting of a base sequence containing SNP(c) in the base sequence shown in Sequence ID No. 3 (c1), a base sequence in which one or more bases are substituted, deleted, added or inserted to the base sequence other than SNP(c) in the base sequence of the polynucleotide of (c1), and which has the function of determining whether or not an onion plant has the ability to produce large onions, or a polynucleotide consisting of a base sequence that has 90% or more identity with respect to the base sequence other than SNP(c) in the base sequence of the polynucleotide of (c1), and which has the function of determining whether or not an onion plant has the ability to produce large onions.
[0065] Polynucleotide (d) is a polynucleotide consisting of a base sequence containing SNP(d) in the base sequence shown in Sequence ID No. 4 (d1), a base sequence in which one or more bases are substituted, deleted, added or inserted to the base sequence other than SNP(d) in the base sequence of the polynucleotide of (d1), and which has the function of determining whether or not the onion plant has a large-fruiting characteristic (large-fruiting characteristic).
[0066] The polynucleotides (a1) to (d1) can be obtained, for example, from large-fruited onion varieties based on the base sequence of the gene locus related to bulb weight on chromosome 8.
[0067] The polynucleotides (a2) to (d2) may have the bases corresponding to SNPs (a) to (d) conserved in the base sequence of the polynucleotides (a1) to (d1), with the remaining base sequence containing several (e.g., 1 to 10, preferably 1 to 5, more preferably 1, 2, or 3) base modifications (substitutions, deletions, insertions, or additions). The base sequence of such a polynucleotide is obvious to those skilled in the art and can be determined by referring to the onion genome sequence described above, or by sequencing the region near the SNP on the genome of a large-fruited onion variety plant.
[0068] The polynucleotides (a3) to (d3) may have a degree of identity with respect to the other base sequences of the polynucleotides (a1) to (d1), with the bases corresponding to SNPs (a) to (d) being conserved, for example, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more. Such sequence identity can be determined, for example, by aligning the two base sequences using analysis software such as BLAST or FASTA.
[0069] When the allele of the base corresponding to SNP(a) in polynucleotide(a) is homozygous for C or heterozygous for C / T, the onion plant can be determined to be a large-fruited variety. When the allele of the base corresponding to SNP(b) in polynucleotide(b) is homozygous for T or heterozygous for T / C, the onion plant can be determined to be a large-fruited variety. When the allele of the base corresponding to SNP(c) in polynucleotide(c) is homozygous for TAA or heterozygous for TAA / CAT, the onion plant can be determined to be a large-fruited variety. When the allele of the base corresponding to SNP(d) in polynucleotide(d) is homozygous for T or heterozygous for T / C, the onion plant can be determined to be a large-fruited variety. Furthermore, by analyzing at least two of polynucleotides (a) to (d) as haplotype blocks, it is possible to determine whether or not an onion plant is a large-fruited variety.
[0070] (iii: Polynucleotides containing three SNPs) A molecular marker according to one aspect of the present invention may be a consecutive polynucleotide (hereinafter also referred to as polynucleotide(e)) containing at least two SNP(a) to SNP(d). Polynucleotide(e) contains a region between at least two sites of SNP(a) to SNP(d) together with at least two sites of SNP(a) to SNP(d). Polynucleotide(e) can be obtained, for example, by referring to the region between at least two sites of the corresponding SNP(a) to SNP(d) in a large-fruited onion plant. The base sequence of polynucleotide(e) is at least partially identical to the base sequence of a large-fruited onion plant.
[0071] The method for determining the degree of bulb weight in an onion seed plant and the method for determining whether or not an onion seed plant has a large bulb using a molecular marker according to one aspect of the present invention is not particularly limited, and for example, known SNP analysis methods for detecting SNPs can be used. Such known SNP analysis methods include methods for SNP analysis by detecting SNPs in PCR amplified fragments of an onion seed plant subject. The onion seed plant subject may be the leaves, stems, roots, etc. of a young seedling, or it may be a bulb. Furthermore, one aspect of the method for determining the degree of bulb weight in an onion seed plant and the method for determining whether or not an onion seed plant has a large bulb using a molecular marker according to one aspect of the present invention is the method for determining the degree of bulb weight in an onion seed plant according to one aspect of the present invention, which will be described later.
[0072] [Large-fruited onion varieties] A large-fruited onion plant according to one aspect of the present invention is a plant obtained by the manufacturing method described later. This large-fruited onion plant has the above-mentioned SNP identified by the above-mentioned molecular marker and is an onion plant with a heavier bulb weight than other onion plants.
[0073] Large-fruited onion seed plants according to one aspect of the present invention can be obtained by crossbreeding onion seed plants with each other and their progeny lines, or by identifying large-fruited onion seed plants from self-pollinated progeny of onion seed plants using the molecular markers described above, as shown in the production method described later. Furthermore, large-fruited onion seed plants genetically modified to possess the above-mentioned SNPs are also included within the scope of the present invention.
[0074] [Method for determining the degree of bulb weight in onion plants] A method for determining the degree of bulb weight in an onion seed plant according to one aspect of the present invention (determination method) is a base in an onion seed plant that corresponds to any of the following bases (a) to (d): (a) The 125th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 1; (b) The 57th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 2; (c) The 115th or 117th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 3; and (d) The 45th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 4; The process includes determining at least one base located within a genetic distance of 5 cM from, or a sequence of polynucleotides containing said base, as a molecular marker for bulb weight in onion plants.
[0075] A determination method according to one aspect of the present invention determines the degree of bulb weight in an onion seed plant subject using the molecular marker according to the above-described aspect of the present invention. A determination method according to one aspect of the present invention determines whether or not the test onion seed plant has the characteristic of producing large bulbs by identifying either an SNP or an InDel located within a genetic distance of 5 cM from SNP(a) to SNP(d) on the genome of the onion seed plant subject.
[0076] In a determination method according to one aspect of the present invention, the onion seed plant being tested is either a candidate plant for breeding material or a plant obtained in the breeding process. The onion seed plant being tested may be, for example, a hybrid plant of a large-bulb onion seed plant and another large-bulb onion seed plant, a hybrid plant of a large-bulb onion seed plant and another small-bulb onion seed plant, or a hybrid plant of a small-bulb onion seed plant and another small-bulb onion seed plant, and their offspring lines. Furthermore, the onion seed plant being tested may be a hybrid plant of an onion seed plant with a known bulb weight and another onion seed plant with an unknown bulb weight, or a hybrid plant obtained by crossing two onion seed plants with unknown bulb weights, and their offspring lines. In addition, the onion seed plant being tested may be an offspring of a large-bulb onion seed plant. The onion seed plant being tested may be a leaf, stem, root, etc., or it may be a bulb.
[0077] A determination method according to one aspect of the present invention determines that an onion plant is of the large-fruited type when (a') the allele of the 125th base of a polynucleotide consisting of the base sequence shown in SEQ ID NO: 1 is homozygous for C or heterozygous for C / T. The determination method also determines that an onion plant is of the large-fruited type when (b') the allele of the 57th base of a polynucleotide consisting of the base sequence shown in SEQ ID NO: 2 is homozygous for T or heterozygous for T / C. Furthermore, the determination method determines that an onion plant is of the large-fruited type when (c') the allele of the 115th or 117th base of a polynucleotide consisting of the base sequence shown in SEQ ID NO: 3 is homozygous for T or heterozygous for T / C, or homozygous for A or heterozygous for A / T. Furthermore, the determination method is as follows: (d') If the allele of the 45th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 4 is either homozygous for T or heterozygous for T / C, the onion plant is determined to be of the large-fruited variety.
[0078] Details of the molecular marker used in the determination method according to one aspect of the present invention should be referenced to the description of the molecular marker according to one aspect of the present invention described above.
[0079] In a determination method according to one aspect of the present invention, the method for examining the degree of bulb weight in onion seed plants using molecular markers is not particularly limited, and known SNP analysis methods can be used. For example, a method of SNP analysis can be used by detecting SNPs in PCR amplified fragments of onion seed plants as a subject. In a determination method according to one aspect of the present invention, the region in the DNA of the onion seed plant may be amplified using a primer that amplifies the region containing the molecular marker. For example, such a primer is a primer that amplifies a region containing any of SNP(a) to SNP(d). That is, a primer that amplifies a region containing any of SNP(a) to SNP(d) may be a determination kit for determining large-fruited onion seed plants according to one aspect of the present invention.
[0080] Amplification of the aforementioned region in the DNA of an onion seed plant can be performed, for example, by polymerase chain reaction (PCR) using DNA extracted from an onion seed plant as a template and a primer set that amplifies the region containing the SNP. Then, the base (genotype) of the SNP in the obtained amplified fragment is determined, and the degree of bulb weight in the onion seed plant is determined based on data showing the relationship between the determined base (genotype) and the degree of bulb weight in the onion seed plant. Conventional known methods can be used to determine the genotype in the amplified fragment, for example, DNA sequencing analysis, agarose gel electrophoresis, and TaqMan analysis using real-time PCR.
[0081] The primer set used in PCR is not particularly limited as long as it can amplify the DNA fragment of the region containing the target SNP, and the primer set may be designed to shorten the length of the amplified fragment. For example, the primer set may be designed so that the length of the primer amplified fragment is preferably 200 base pairs (bp) or less, 160 bp or less, 150 bp or less, 140 bp or less, 130 bp or less, 120 bp or less, or 100 bp or less. The primer set includes a forward primer and a reverse primer. The length of these primers may be, for example, 15 bp or more, 16 bp or more, 17 bp or more, 18 bp or more, 19 bp or more, 20 bp or more, or 25 bp or more, and may be 50 base pairs (bp) or less, 40 bp or less, or 30 bp or less.
[0082] A primer set that amplifies a region containing at least one of the following SNPs (a) to (d) may be a determination kit for identifying large-fruited onion species according to one aspect of the present invention.
[0083] A primer set for amplifying the region containing SNP(a) includes either (I) or (II) below: (I) A primer set comprising a first primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 5, and a second primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 6; (II) A primer set comprising a third primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 7, a fourth primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 8, and a fifth primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 9.
[0084] By using the primer set described in (I) above, a PCR amplification product can be obtained in large-fruited onion varieties in which the 125th base of the sequence shown in Sequence ID No. 1 is C, allowing detection of the base corresponding to SNP(a). Furthermore, by using the primer set described in (II) above, the region containing SNP(a) can be specifically amplified, and the genotype can be determined by measuring the fluorescence intensity.
[0085] The primer set (III) for amplifying the region containing SNP(b) is, for example, a sixth primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 10, and a seventh primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 11. Using this primer set, a PCR amplification product in large-fruited onion varieties can be obtained in which the 57th base of the nucleotide sequence shown in SEQ ID NO: 2 is T, and the base corresponding to SNP(b) can be detected.
[0086] The primer set (IV) for amplifying the region containing SNP(c) is, for example, a primer set consisting of an eighth primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 12, and a ninth primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 13. Using this primer set, in large-fruited onion varieties, a PCR amplification product can be obtained in which the 115th base of the nucleotide sequence shown in SEQ ID NO: 3 is T and the 117th base is A, and the base corresponding to SNP(c) can be detected.
[0087] The primer set that amplifies the region containing SNP(d) includes the following primer sets (V) to (VII): (V) A primer set comprising a 10th primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 14, and an 11th primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 15; (VI) A primer set comprising a 12th primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 16, a 13th primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 17, and a 14th primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 18; (VII) A primer set comprising a 15th primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 19, and a 16th primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 20.
[0088] Using the primer set described in (V) above, a PCR amplification product can be obtained in large-fruited onion varieties in which the 45th base of the base sequence shown in Sequence ID No. 4 is T, allowing detection of the base corresponding to SNP(d). Furthermore, using the primer set described in (VI) above, the region containing SNP(d) can be specifically amplified, and the genotype can be determined by measuring the fluorescence intensity. In addition, using the primer set described in (VII) above, the region containing SNP(d) can be specifically amplified, and the genotype can be determined by agarose electrophoresis.
[0089] Furthermore, the primer set may also be the following primer set for detecting bases that are genetically within 5 cM of the bases corresponding to (a) to (d). For example, a primer set consisting of a primer containing 15 or more consecutive bases in the base sequence shown in SEQ ID NO: 26 and a primer containing 15 or more consecutive bases in the base sequence shown in SEQ ID NO: 27. By using this primer set, in large-fruited onion varieties, a PCR amplification product in which the 89th base of the base sequence shown in SEQ ID NO: 21 is T can be obtained, and bases corresponding to bases that are genetically within 5 cM of the bases corresponding to (a) to (d) can be detected.
[0090] Furthermore, the primer set consists of, for example, a primer containing 15 or more consecutive bases in the base sequence shown in Sequence ID No. 28 and a primer containing 15 or more consecutive bases in the base sequence shown in Sequence ID No. 29. Using this primer set, in large-fruited onion varieties, a PCR amplification product in which the 109th base of the base sequence shown in Sequence ID No. 22 is C can be obtained, and bases corresponding to bases located within a genetic distance of 5 cM from bases corresponding to (a) to (d) can be detected.
[0091] Furthermore, the primer set consists of, for example, a primer containing 15 or more consecutive bases in the base sequence shown in Sequence ID No. 30 and a primer containing 15 or more consecutive bases in the base sequence shown in Sequence ID No. 31. By using this primer set, in large-fruited onion varieties, a PCR amplification product in which the 70th base of the base sequence shown in Sequence ID No. 23 is T can be obtained, and bases corresponding to bases located within a genetic distance of 5 cM from bases corresponding to (a) to (d) can be detected.
[0092] Furthermore, the primer set consists of, for example, a primer containing 15 or more consecutive bases in the base sequence shown in Sequence ID No. 32 and a primer containing 15 or more consecutive bases in the base sequence shown in Sequence ID No. 33. By using this primer set, in large-fruited onion varieties, a PCR amplification product in which the 67th base of the base sequence shown in Sequence ID No. 24 is A can be obtained, and bases corresponding to bases located within a genetic distance of 5 cM from bases corresponding to (a) to (d) can be detected.
[0093] Furthermore, for example, this is a primer set consisting of a primer containing 15 or more consecutive bases in the base sequence shown in SEQ ID NO: 34 and a primer containing 15 or more consecutive bases in the base sequence shown in SEQ ID NO: 35. By using this primer set, in large-fruited onion varieties, the 34th base of the base sequence shown in SEQ ID NO: 25 G A PCR amplification product is obtained, and it is possible to detect bases that are genetically located within 5 cM of the bases corresponding to (a) to (d).
[0094] Another example of a primer set for detecting bases within a 10kb range from the bases corresponding to (a) to (d) is the primer set for amplifying a region containing at least one of the 10th to 26th markers, as shown below.
[0095] For example, this primer set consists of a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 47 and a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 48. By using this primer set, the region containing the 10th marker is amplified, and in large-fruited onion varieties, a PCR amplification product is obtained in which the base corresponding to the 99th base of the polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 36 is A.
[0096] Furthermore, the primer set comprises, for example, a primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 49 and a primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 50. By using this primer set, the region containing the 11th and 12th markers is amplified, and in large-fruited onion varieties, a PCR amplification product is obtained in which at least one of the following is obtained: the base corresponding to the 113th base of the polynucleotide consisting of the nucleotide sequence shown in Sequence ID No. 37 is G, or the bases corresponding to the 207th to 208th bases are TG.
[0097] Furthermore, the primer set comprises, for example, a primer containing 15 or more consecutive bases in the base sequence shown in Sequence ID No. 51 and a primer containing 15 or more consecutive bases in the base sequence shown in Sequence ID No. 52. By using this primer set, the region containing the 13th and 14th markers is amplified, and in large-fruited onion varieties, a PCR amplification product is obtained in which at least one of the following is obtained: the base corresponding to the 241st base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 38 is T, or the bases corresponding to the 299th to 300th bases are CC.
[0098] Furthermore, the primer set includes, for example, a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 53, and a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 54. By using this primer set, the region containing the 15th marker is amplified, and in large-fruited onion varieties, a PCR amplification product is obtained in which the base corresponding to the 249th base of the polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 39 is A.
[0099] Furthermore, the primer set includes, for example, a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 55, and a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 56. By using this primer set, the region containing the 16th marker is amplified, and in large-fruited onion varieties, a PCR amplification product is obtained in which the bases corresponding to the 84th to 86th bases of the polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 40 are AAA.
[0100] Furthermore, the primer set includes, for example, a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 57, and a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 58. By using this primer set, the region containing the 17th marker is amplified, and in large-fruited onion varieties, a PCR amplification product is obtained in which the base corresponding to the 70th base of the polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 41 is A.
[0101] Furthermore, the primer set includes, for example, a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 59, and a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 60. By using this primer set, the region containing marker 18 is amplified, and in large-fruited onion varieties, a PCR amplification product is obtained in which the bases corresponding to the 55th to 70th bases of the polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 42 are TTGTACAAAAACAATT.
[0102] Furthermore, the primer set comprises, for example, a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 61, and a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 62. By using this primer set, the region containing the 19th marker is amplified, and in large-fruited onion varieties, a PCR amplification product is obtained in which the base corresponding to the 45th base of the polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 43 is C.
[0103] Furthermore, the primer set comprises, for example, a primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 63 and a primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 64. By using this primer set, the regions containing the 20th and 23rd markers are amplified. In large-fruited onion varieties, the PCR amplification product obtained is such that the bases corresponding to the 43rd to 44th bases of the polynucleotide sequence shown in Sequence ID No. 44 are AC, the bases corresponding to the 92nd to 94th bases are AAA, the bases corresponding to the 147th to 148th bases are TC, or the bases corresponding to the 215th to 233rd bases are GTCTTAGGGATTCGGCTTT.
[0104] Furthermore, the primer set comprises, for example, a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 65, and a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 66. By using this primer set, the region containing the 24th marker is amplified, and in large-fruited onion varieties, a PCR amplification product is obtained in which the base corresponding to the 129th base of the polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 45 is T.
[0105] Furthermore, the primer set comprises, for example, a primer containing 15 or more consecutive bases in the base sequence shown in Sequence ID No. 67 and a primer containing 15 or more consecutive bases in the base sequence shown in Sequence ID No. 68. By using this primer set, the region containing the 25th and 26th markers is amplified, and in large-fruited onion varieties, a PCR amplification product is obtained in which at least one of the following is obtained: the base corresponding to the 78th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 46 is T, or the base corresponding to the 194th base is T.
[0106] PCR in SNP analysis may be either singleplex PCR, which amplifies DNA fragments in a reaction system containing a single primer set, or multiplex PCR, which amplifies genes in a reaction system containing multiple primer sets. In the case of multiplex PCR, primer sets labeled with fluorescent substances having different wavelengths (e.g., NED, 6-FAM, VIC, PET, HEX) may be mixed.
[0107] The reaction conditions for PCR can be appropriately set depending on the type of DNA polymerase and PCR instrument used, the length of the amplification fragment, etc. As for the cycle conditions, a 3-step PCR method consisting of three steps—denaturation, annealing, and extension—as one cycle, and a 2-step PCR method consisting of two steps—denaturation and annealing / extension—as one cycle, can be applied. An example of reaction conditions in 3-step PCR is to perform a denaturation step of 40-60 seconds at 90-100°C (e.g., 30 seconds at 94°C), an annealing step of 10-60 seconds (e.g., 30 seconds), and an extension step of 10-90 seconds at 65-80°C (e.g., 60 seconds at 72°C) for 10-40 cycles (e.g., 15 cycles). One example of an annealing temperature is to gradually decrease it in predetermined cycles from an initial annealing temperature of 55-70°C (e.g., 60°C) to a final annealing temperature of 40-60°C (e.g., 45°C) (for example, decreasing by 1°C per cycle). Depending on the state of the template DNA, the PCR reaction conditions may be adjusted to stably detect SNPs.
[0108] For SNP analysis, real-time PCR such as the TaqMan®-PCR method, which performs amplification by PCR and identification of SNP markers, may be used. That is, a TaqMan® probe may be used to detect SNPs contained in the amplified fragment amplified using a primer set. By using the real-time PCR method, a highly efficient discrimination method can be provided. As a method for identifying SNPs in the amplified fragment amplified by PCR, the base sequence of the amplified fragment may be determined using an automated DNA sequencer or the like for analysis.
[0109] The method for extracting DNA to be amplified by PCR from onion seed plants is not particularly limited, and known DNA extraction methods can be used. Alternatively, commercially available DNA extraction kits may be used to extract the DNA. Depending on the type of sample and the amount of impurities, appropriate pretreatment may be performed before the DNA extraction step. Furthermore, the DNA extracted from the sample may be washed or purified as needed for use as a template in the PCR reaction. In addition, restriction enzyme digestion fragments obtained by digesting the DNA extracted from the sample with two types of restriction enzymes may be amplified by PCR.
[0110] Furthermore, in a determination method according to one aspect of the present invention, gene polymorphisms in a linkage-disequilibrium state with SNP(a) to SNP(d) may be analyzed to identify SNP(a) to SNP(d). The above linkage-disequilibrium state is, for example, a linkage-disequilibrium state in which the linkage-disequilibrium coefficient is 0.9 or higher.
[0111] According to one aspect of the present invention, a determination method can be used to determine whether a test onion plant is of the large-fruited type or not using a molecular marker. Therefore, based on the determination result, large-fruited onion plants and their progeny can be selected.
[0112] According to one aspect of the present invention, it is possible to select large-fruited onion varieties at the seedling stage, significantly shortening the breeding selection period. Furthermore, by planting and growing only the large-fruited seedlings selected at the seedling stage, the efficiency of field utilization can be improved.
[0113] [Manufacturing method for producing large-fruited onion seed plants] A manufacturing method according to one aspect of the present invention is a method for producing large-fruited onion seed plants, comprising a selection step of selecting large-fruited onion seed plants from onion seed plants using a determination method according to one aspect of the present invention. Furthermore, the manufacturing method may involve repeating the selection step one or more times in the offspring of the large-fruited onion seed plants selected in the selection step.
[0114] Furthermore, the manufacturing method may include a crossbreeding step in which onion seed plants are crossbred with each other before the selection step, and in the selection step, large-fruited onion seed plants may be selected from the onion seed plants obtained by the crossbreeding step or other offspring onion seed plants by a determination method according to one aspect of the present invention.
[0115] Furthermore, the manufacturing method may include a step of obtaining self-pollinated progeny of large-fruited onion seed plants before the selection step, and in the selection step, large-fruited onion seed plants may be selected from the obtained self-pollinated progeny of large-fruited onion seed plants by a determination method according to one aspect of the present invention.
[0116] Therefore, the description of the molecular marker, the large-fruited onion seed plant, and the determination method according to one aspect of the present invention will be incorporated into the description of the method for producing the large-fruited onion seed plant.
[0117] In the hybridization process, the onion seed plants used as parent plants may include, for example, large-fruited onion seed plants, small-fruited onion seed plants, onion seed plants of unknown bulb weight, and their progeny.
[0118] Furthermore, in the crossbreeding process, the onion seed plants used as parent plants may be large-fruited onion seed plants according to one aspect of the present invention. Also, the onion seed plants used in the crossbreeding process may be large-fruited onion seed plants selected by the determination method according to one aspect of the present invention. That is, the manufacturing method according to one aspect of the present invention may further include a determination step before the crossbreeding process in which large-fruited onion seed plants are identified from the test onion seed plants by the determination method according to one aspect of the present invention.
[0119] The discrimination step involves identifying large-fruited onion seed plants from onion seed plants obtained through the crossbreeding step or their progeny lines, using a determination method according to one aspect of the present invention.
[0120] According to one embodiment of the present invention, a manufacturing method can be used to determine whether or not an onion seed plant has a large-fruiting characteristic using a molecular marker, and large-fruiting onion seed plants can be selected and manufactured based on the determination result.
[0121] The present invention is not limited to the embodiments described above, and various modifications are possible within the scope of the claims. Embodiments obtained by appropriately combining the technical means disclosed in different embodiments are also included in the technical scope of the present invention. [Examples]
[0122] [Example 1] 230 onion plants of a variety developed by the National Agriculture and Food Research Organization were cultivated in 2019 at a field (Morioka) within the Tohoku Agricultural Research Center. The bulb weight of each harvested plant was measured.
[0123] To obtain intra-line polymorphisms from cultivated onion lines, 157 molecular markers were created. The distribution of these molecular markers is shown in Figure 1. Figure 1 is a distribution map of the molecular markers created in the example.
[0124] For each individual sample of the analysis material, the genotypes of the 157 molecular markers shown in Figure 1 were obtained. The primer sets for each of the 157 molecular markers were divided into four (approximately 40 primer sets per primerplex), and multiplex PCR was performed for each primerplex (1st PCR). The composition of the 1st PCR is shown in Table 1, and the PCR conditions are shown in Table 2.
[0125] [Table 1]
[0126] [Table 2]
[0127] The 1st PCR product was purified using AMPure XP Reagent. The purified template was diluted 100-fold and used for the 2nd PCR. In the 2nd PCR, an adapter sequence for next-generation sequencing analysis and a barcode sequence for individual identification were added to the 1st PCR product. The composition of the 2nd PCR is shown in Table 3, and the PCR conditions are shown in Table 4.
[0128] [Table 3]
[0129] [Table 4]
[0130] The generated PCR products were divided into two groups: 192 samples and 38 samples. Each group was then combined and analyzed using a next-generation sequencer (Thermo Fisher Scientific Ion Torrent Proton system). Using Torrent Suite ver. 5 software (Thermo Fisher Scientific), the obtained sequence data was separated by sample, and then the sequence data for each sample was mapped to a reference sequence. Polymorphism information (marker genotypes) within each amplified region was extracted using Torrent Variant Caller software.
[0131] Association analysis was performed using the genotype and sphere weight data obtained for each individual. The R package [rrBLUP] was used for the association analysis. A -log(p) value exceeding the significance level was detected for a marker in the 40cM region of chromosome 8 (position indicated by the arrow in Figure 1). The results are shown in Figure 2. Figure 2 shows the association analysis results for the example.
[0132] Four markers, markers 1 through 4, were selected from the 40 cM region of chromosome 8. Details of markers 1 (CHR8_77892311), 2 (Scaffold_9797_10963), 3 (CHR8_82152739), and 4 (Scaffold_62471_59198) are shown in Table 5, and the primer sequences and amplification product sequences for each marker are shown in Table 6. Note that the amplification product sequences in Table 6 are nucleotide sequence information extracted from the reference sequence.
[0133] [Table 5]
[0134] [Table 6]
[0135] For each of the first to fourth markers, the distribution of each genotype in the analytical material and the sphere weight were compared, and multiple testing was performed using the Steel-Dwass method. The results are shown in Figure 3. Figure 3 shows the sphere weight for each genotype of each marker in Example 1.
[0136] As shown in Figure 3, for the first marker, individuals with homozygous C genotype and heterozygous C / T genotype had significantly heavier sphere weights compared to individuals with homozygous T genotype. Similarly, for the second marker, individuals with homozygous T genotype and heterozygous T / C genotype had significantly heavier sphere weights compared to individuals with homozygous C genotype. For the third marker, individuals with homozygous TAA genotype and heterozygous TAA / CAT genotype had significantly heavier sphere weights compared to individuals with homozygous CAT genotype. For the fourth marker, individuals with homozygous T genotype and heterozygous T / C genotype had significantly heavier sphere weights compared to individuals with homozygous C genotype.
[0137] [Example 2] As shown in Figure 3, individuals in which all four markers were heterozygous were selected, and 99 self-pollinated progeny were cultivated in a field (Morioka) at the Tohoku Agricultural Research Center in 2021. The bulb weight of each harvested individual was measured. The genotypes of the four markers were obtained using the Sanger method, as shown below.
[0138] PCR reactions were performed on each individual using the primer set shown in Table 6. The PCR composition is shown in Table 7, and the PCR conditions are shown in Table 8.
[0139] [Table 7]
[0140] [Table 8]
[0141] For the PCR amplification product, PCR product 5 was treated with Exo-SAP IT using Exo-SAP IT Express regent 1 to degrade any remaining primers and other nucleotides. The Exo-SAP IT treatment conditions are shown in Table 9.
[0142] [Table 9]
[0143] Sequencing PCR was performed using the PCR product after Exo-SAP IT treatment as a template. The composition of the sequencing PCR reaction is shown in Table 10, and the PCR conditions are shown in Table 11.
[0144] [Table 10]
[0145] [Table 11]
[0146] The sequencing PCR products were precipitated in ethanol and then dissolved in 10 μl of formamide. The sequencing PCR products dissolved in formamide were subjected to electrophoresis using a DNA sequencer (ABI 3730xl), and waveform data was obtained. For the four markers, the distribution of each genotype and sphere weight was compared, and multiple testing was performed using the Steel-Dwass method. The results are shown in Figure 4. Figure 4 shows the sphere weight for each genotype of each marker in Example 2.
[0147] Furthermore, the waveform analysis data for the second marker using the Sanger method is shown in Figure 5. Figure 5 is a diagram showing the waveform data for the second marker in Example 2.
[0148] In Example 2, as in Example 1, it was shown that the four markers were useful in selecting large-fruited onions.
[0149] [Example 3] KASP markers were created for the first and fourth markers and used to identify the genotype. A KASP primer mix was prepared with a ratio of 3:3:5 for 100 μM allele-specific FAM primer, 100 μM allele-specific HEX primer, and 100 μM common primer. The primer sequences are shown in Table 12.
[0150] [Table 12]
[0151] The composition of the PCR reaction is shown in Table 13, and the PCR conditions are shown in Table 14. Primetech's KASP-TF V4.0 2X Master mix 96 / 384 Std Rox was used as the KASP Master Mix.
[0152] [Table 13]
[0153] [Table 14]
[0154] After the PCR reaction, the fluorescence levels of FAM and HEX were measured using a real-time PCR instrument, and the genotype was determined from the dot plot. Fluorescence levels were measured at 25°C for 1 minute. The results are shown in Figure 6. Figure 6 shows the genotype determination results for the first and fourth markers in Example 3. As shown in Figure 6, the genotypes of the first and fourth markers could be identified using the KASP marker.
[0155] [Example 4] For the fourth marker, a CAPS marker was created and used to identify the genotype. The primer sequences are shown in Table 15.
[0156] [Table 15]
[0157] The PCR composition and conditions are shown in Tables 16 and 17. Taq DNA Polymerase with ThermoPol Buffer (M0267X) from NEB was used as the Taq DNA Polymerase.
[0158] [Table 16]
[0159] [Table 17]
[0160] To 4 μl of PCR product, 1 unit of NEB's RsaI (#R0167S) and 0.7 μl of 10× buffer were added to make a total volume of 7 μl, and the mixture was treated with restriction enzyme overnight at 37°C.
[0161] An agarose gel was prepared in TBE solution to a concentration of 4% (w / v), and restriction enzyme-treated PCR products were subjected to electrophoresis. A 100 bp ladder was run on both sides of the PCR products. The results are shown in Figure 7. Figure 7 shows the results of agarose gel electrophoresis in Example 4.
[0162] As shown in Figure 7, the genotype of the fourth marker could be identified using the CAPS marker.
[0163] [Example 5] Individuals (F1) developed from crosses of two different onion varieties (OPP-6 (developed by the National Agriculture and Food Research Organization) and Momiji No. 3) were self-pollinated to cultivate a hybrid progeny population (F2, 245 individuals), which was then grown in the field. The bulb weight of each harvested individual was measured.
[0164] The genotype of each individual was obtained using 441 molecular markers. The primer set for each of the 441 molecular markers was divided into 10 sets (1 primerplex: approximately 44 primer sets), and multiplex PCR was performed for each primerplex (1st PCR). The composition of the 1st PCR is shown in Table 18, and the PCR conditions are shown in Table 19.
[0165] [Table 18]
[0166] [Table 19]
[0167] The 1st PCR product was purified using AMPure XP Reagent. The purified template was diluted 100-fold and used for the 2nd PCR. In the 2nd PCR, an adapter sequence for next-generation sequencing analysis and a barcode sequence for individual identification were added to the 1st PCR product. The composition of the 2nd PCR is shown in Table 20, and the PCR conditions are shown in Table 21.
[0168] [Table 20]
[0169] [Table 21]
[0170] The generated PCR products were divided into two groups: 192 samples and 53 samples. Each group was then combined and analyzed using a next-generation sequencer (Thermo Fisher Scientific Ion Torrent Proton system). Using Torrent Suite ver. 5 software (Thermo Fisher Scientific), the obtained sequence data was separated by sample, and then the sequence data for each sample was mapped to a reference sequence. Polymorphism information (marker genotypes) within each amplified region was extracted using Torrent Variant Caller software.
[0171] Linkage maps were created using the marker genotypes obtained for each individual (software: Join map 4.0). The created linkage maps are shown in Figure 8. Each marker was classified by linkage group (chromosome), and the genetic distance between markers in the linkage group was estimated. After rearranging the marker genotypes of each individual according to the linkage map, QTL analysis was performed using the obtained sphere weights (software: R / qtl). The analysis results are shown in Figure 9.
[0172] Five markers near the peak shown in Figure 9 were selected. Marker 8 (CHR8_82147275) is a SNP near marker 3, and marker 9 (Scaffold_62471_59187) is a SNP near marker 4. Details of the five markers from marker 5 to marker 9 and marker 1, which was used for comparison, are shown in Table 22, and the primer sequences and amplification product sequences of each marker are shown in Table 23. Note that the amplification product sequences in Table 23 are nucleotide sequence information extracted from the reference sequence.
[0173] [Table 22]
[0174] [Table 23]
[0175] For each of the five markers, the distribution of genotype and sphere weight was compared, and multiple testing was performed using the Steel-Dwass method. The results are shown in Figure 10. Figure 10 shows the sphere weight for each genotype of each marker in Example 5.
[0176] Figure 10 shows the results for the first marker and markers 5 through 9 for comparison. Of the markers from the first to the ninth, the distance between the first and ninth markers, which was the furthest, was approximately 5 cM. In addition, the distance between the third and eighth markers in Example 1 was 5464 bp, and the distance between the fourth and ninth markers in Example 1 was 11 bp.
[0177] As shown in Figure 10, markers 5 through 9 were also useful for selecting large-fruited onions, similar to markers 1 through 4.
[0178] [Example 6] Markers 10 through 26 were selected as candidate markers for identifying large-fruited onions. Details of each marker, including its distance from any of the 1st through 4th markers, are shown in Table 24, and the primer sequences and amplification product sequences for each marker are shown in Table 25. As shown in Table 24, marker 10 is approximately 10kb away from marker 1, and markers 11 through 26 are each within 10kb of any of the 1st through 4th markers.
[0179] [Table 24]
[0180] [Table 25]
[0181] Agarose gel electrophoresis and fragment analysis were performed on markers 18 through 20. First, multiplex PCR was performed using primer sets for each of markers 18 through 20. The PCR compositions and conditions are shown in Tables 26 and 27.
[0182] [Table 26]
[0183] [Table 27]
[0184] The entire amount of obtained PCR product was applied to a 4% agarose gel (3% Sigma Type IA, low EEO + 1% LONZA MetaPhor) and electrophoresis was performed for 2 hours under two-stage, 3:1 gel conditions at 250V. The results are shown in Figure 11. Figure 11 shows the results of agarose electrophoresis for the three markers, markers 18 to 20. As shown in Figure 11, the genotypes of markers 18 to 20 could be identified by electrophoresis.
[0185] Next, fragment analysis of markers 18 to 20 was performed as follows. First, multiplex PCR was performed using primer sets for each of markers 18 to 20. The PCR composition and conditions are shown in Tables 28 and 29.
[0186] [Table 28]
[0187] [Table 29] Electrophoresis plates were prepared. First, 1000 μl of HiDi-Formamide (Thermo / 4311320) and 10 μl of GeneScan 600 LIZ dye Size Standard v2.0 (Thermo / 4408399) were mixed to create a suspension. 10 μl of the prepared suspension was dispensed into each 96-well PCR plate, and 0.5 μl of PCR product was added to each well. 10 μl of sterile water was dispensed into the empty wells. The PCR plates were heated at 95°C for 5 minutes and then rapidly cooled on ice. Electrophoresis was performed on the prepared electrophoresis plates using an ABI3730 sequencer. The electrophoresis conditions are shown in Table 30.
[0188] [Table 30]
[0189] The results obtained by electrophoresis were analyzed using GeneMapper software (Applied Biosystems). The results are shown in Figure 12. As shown in Figure 12, the genotypes of markers 18 to 20 could be identified by fragment analysis of these markers.
[0190] Fragment analysis was performed on markers 13 through 17. First, PCR was performed on each marker using its respective primer set. The PCR compositions and conditions are shown in Tables 31 and 32.
[0191] [Table 31]
[0192] [Table 32]
[0193] Electrophoresis plates were prepared. First, 1000 μl of HiDi-Formamide (Thermo / 4311320) and 10 μl of GeneScan 600 LIZ dye Size Standard v2.0 (Thermo / 4408399) were mixed to create a suspension. 10 μl of the prepared suspension was dispensed into each 96-well PCR plate, and 0.5 μl of PCR product was applied to each well. 10 μl of sterile water was dispensed into the empty wells. The PCR plates were heated at 95°C for 5 minutes and then rapidly cooled on ice. Electrophoresis was performed on the prepared PCR plates using an ABI3730 sequencer. The electrophoresis conditions are shown in Table 33.
[0194] [Table 33]
[0195] The results obtained by electrophoresis were analyzed using GeneMapper software (Applied Biosystems). The results are shown in Figures 13 and 14. As shown in Figures 13 and 14, the genotypes of markers 13 to 17 could be identified by fragment analysis of these markers.
[0196] Furthermore, the distribution of genotype and bulb weight was compared, and multiple testing was performed using the Steel-Dwass method. The results are shown in Figure 15. Figure 15 shows the bulb weight for each genotype of each marker in Example 6. As shown in Figure 15, markers 18-20 were shown to be useful for identifying large-bulb onions, similar to markers 1-4. Markers 18-20 are all within 10kb of marker 3. Marker 10 is approximately 10kb from marker 1, and markers 11-17 and 21-26 are also within 10kb of any of markers 1-4. Therefore, it is inferred that these markers are also useful for identifying large-bulb onions, similar to markers 1-4 and 18-20. [Industrial applicability]
[0197] This invention can be used in fields such as agriculture and plant breeding.
Claims
1. A method for determining the degree of bulb weight in onion plants, In onion plants, a base corresponding to any of the following bases (a) to (d): (a) The 125th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 1; (b) The 57th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 2; (c) The 115th or 117th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 3; and (d) The 45th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 4; The process includes determining at least one base located within a genetic distance of 5 cm from, or a sequence of polynucleotides containing said base, as a molecular marker for bulb weight in onion seed plants. As the first marker, if the allele at the 125th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 1 is either homozygous for C or heterozygous for C / T, then the onion plant is determined to be of the large-fruited variety. As a second marker, if the allele at the 57th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 2 is homozygous for T or heterozygous for T / C, then the onion plant is determined to be of the large-fruited variety. As a third marker, if the allele at the 115th or 117th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 3 is homozygous for T at the 115th base or heterozygous for T / C, or homozygous for A at the 117th base or heterozygous for A / T, then the onion plant is determined to be of the large-fruited variety. As a fourth marker, if the allele at the 45th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 4 is homozygous for T or heterozygous for T / C, then the onion plant is determined to be of the large-fruited variety. As a fifth marker, if the allele of the base corresponding to the 89th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 21 is homozygous for T or heterozygous for T / A, then the onion plant is determined to be of the large-fruited variety. As a sixth marker, if the allele of the base corresponding to the 109th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 22 is homozygous for C or heterozygous for C / A, then the onion plant is determined to be of the large-fruited variety. As a seventh marker, if the allele of the base corresponding to the 70th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 23 is homozygous for T or heterozygous for T / C, then the onion plant is determined to be of the large-fruited variety. As the eighth marker, if the allele of the base corresponding to the 67th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 24 is homozygous for A or heterozygous for A / G, then the onion plant is determined to be of the large-fruited variety. A method for determining that an onion plant is of the large-fruited variety, in which, as a ninth marker, the allele of the base corresponding to the 34th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 25 is homozygous for G or heterozygous for G / T.
2. A method for determining the degree of bulb weight in an onion seed plant, In onion plants, a base corresponding to any of the following bases (a) to (d): (a) The 125th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 1; (b) The 57th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 2; (c) The 115th or 117th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 3; and (d) The 45th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 4; The process includes determining at least one base located within a genetic distance of 5 cm from, or a sequence of polynucleotides containing said base, as a molecular marker for bulb weight in onion seed plants. The molecular marker is at least one base within a 10 kb range from a base corresponding to any of the bases (a) to (d) above, or a continuous polynucleotide containing said base. As the 18th marker, if the bases corresponding to positions 55 through 70 of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 42 are TTGTACAAAAAATT, the onion plant is determined to be a large-fruited variety. If the 18th marker is a deletion type where the bases corresponding to positions 55 through 70 of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 42 are T, the onion plant is determined to be a small-fruited variety. As the 19th marker, if the base corresponding to the 45th base of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 43 is C, the onion plant is determined to be a large-fruited variety. If, in the 19th marker, the base corresponding to the 45th base of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 43 is substituted with 14 bases (CCATCTATTCCATC), the onion plant is determined to be a small-fruited variety. When the 20th marker is AC, corresponding to the 43rd to 44th bases of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 44, and the 21st marker is AAA, corresponding to the 92nd to 94th bases of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 44, and the 22nd marker is TC, corresponding to the 147th to 148th bases of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 44, and the 23rd marker is GTCTTTAGGGATTCGGCTTT, then the onion plant is determined to be a large-fruited variety, and the 20th marker A method for determining that an onion plant is small-fruited if, in the case of the 21st marker, the base corresponding to the 43rd to 44th bases of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 44 is a deletion type in which the base corresponding to the 92nd to 94th bases of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 44 is a deletion type in which the base corresponding to the 147th to 148th bases of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 44 is a deletion type in which the base corresponding to the 215th to 233rd bases of the polynucleotide consisting of the base sequence shown in SEQ ID NO: 44 is a deletion type in which the plant is small-fruited.
3. The method according to claim 1 or 2, wherein the molecular marker is a base corresponding to any of the bases (a) to (d) above, or a continuous polynucleotide containing said base.
4. The method according to claim 1 or 2, wherein in the determination step, the region in the DNA of the onion plant is amplified using a primer that amplifies the region containing the molecular marker.
5. A method for producing large-fruited onion seed plants, A selection process for selecting large-fruited onion seed plants using the method described in claim 1 or 2. A manufacturing method that includes this.
6. The manufacturing method according to claim 5, wherein the selection process is repeated one or more times in the progeny of large-fruited onion seed plants selected in the selection process.
7. A primer set for amplifying regions containing molecular markers related to bulb weight in onion plants, Used for amplifying the region in the DNA of the onion seed plant according to the method of claim 1 or 2, The molecular marker is a base (SNP) corresponding to any of the bases listed below (a) to (d): (a) The 125th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 1; (b) The 57th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 2; (c) The base of the 115th or 117th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 3; and (d) The 45th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 4; It contains at least one base located within a genetic distance of 5 cm from, or a contiguous polynucleotide containing said base. As the first marker, the 125th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 1, As a second marker, the 57th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 2, As a third marker, the 115th or 117th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 3, As the fourth marker, the 45th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 4, As the fifth marker, the base corresponding to the 89th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 21, As the sixth marker, the base corresponding to the 109th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 22, As the seventh marker, the base corresponding to the 70th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 23, As the eighth marker, the base corresponding to the 67th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 24, and As the ninth marker, at least one region containing any of the bases corresponding to the 34th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 25 is amplified. Primer set consisting of at least one of the following: A primer set comprising a first primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 5, and a second primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 6; A primer set comprising: a third primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 7; a fourth primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 8; and a fifth primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 9; A primer set comprising a sixth primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 10, and a seventh primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 11; A primer set comprising an eighth primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 12, and a ninth primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 13; A primer set comprising a tenth primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 14, and an eleventh primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 15; A primer set comprising: a 12th primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 16; a 13th primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 17; and a 14th primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 18; A primer set comprising a 15th primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 19, and a 16th primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 20; A primer set comprising a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 26, and a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 27; A primer set comprising a primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 28, and a primer containing 15 or more consecutive bases in the nucleotide sequence shown in Sequence ID No. 29; A primer set comprising a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 30, and a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 31; A primer set comprising a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 32, and a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 33; and A primer set comprising a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO: 34, and a primer containing 15 or more consecutive bases in the nucleotide sequence shown in SEQ ID NO:
35.
8. This is a testing kit for identifying large-fruited onion varieties. In onion plants, a base corresponding to any of the following bases (a) to (d): (a) The 125th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 1; (b) The 57th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 2; (c) The base of the 115th or 117th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 3; and (d) The 45th base of a polynucleotide consisting of the base sequence shown in Sequence ID No. 4; A diagnostic kit comprising a primer that amplifies at least one base located within a genetic distance of 5 cm from, or a region containing a contiguous polynucleotide including said base, As the first marker, if the allele at the 125th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 1 is either homozygous for C or heterozygous for C / T, then the onion plant is determined to be of the large-fruited variety. As a second marker, if the allele at the 57th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 2 is homozygous for T or heterozygous for T / C, then the onion plant is determined to be of the large-fruited variety. As a third marker, if the allele at the 115th or 117th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 3 is homozygous for T at the 115th base or heterozygous for T / C, or homozygous for A at the 117th base or heterozygous for A / T, then the onion plant is determined to be of the large-fruited variety. As a fourth marker, if the allele at the 45th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 4 is homozygous for T or heterozygous for T / C, then the onion plant is determined to be of the large-fruited variety. As a fifth marker, if the allele of the base corresponding to the 89th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 21 is homozygous for T or heterozygous for T / A, then the onion plant is determined to be of the large-fruited variety. As a sixth marker, if the allele of the base corresponding to the 109th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 22 is homozygous for C or heterozygous for C / A, then the onion plant is determined to be of the large-fruited variety. As a seventh marker, if the allele of the base corresponding to the 70th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 23 is homozygous for T or heterozygous for T / C, then the onion plant is determined to be of the large-fruited variety. As the eighth marker, if the allele of the base corresponding to the 67th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 24 is homozygous for A or heterozygous for A / G, then the onion plant is determined to be of the large-fruited variety. This is a testing kit that determines that an onion plant is of the large-fruited variety when, as the ninth marker, the allele of the base corresponding to the 34th base of the polynucleotide consisting of the base sequence shown in Sequence ID No. 25 is homozygous for G or heterozygous for G / T.
Citation Information
Patent Citations
Discrimination method of onion
JP2019058087A