Method for detecting target nucleic acids using dried filter paper blood samples
By delaying fluorescence detection and analyzing data from a predetermined number of cycles in real-time PCR with a fluorescently labeled probe, the method addresses baseline disturbances in dried filter paper blood, enabling accurate nucleic acid detection and quantification.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- SEKISUI MEDICAL CO LTD
- Filing Date
- 2021-02-19
- Publication Date
- 2026-04-21
AI Technical Summary
Existing methods for detecting target nucleic acids in dried filter paper blood using real-time PCR face challenges due to baseline disturbances caused by impurities, particularly in systems using fluorescent dyes, which are affected by hemoglobin in whole blood, leading to inaccurate results.
A method involving real-time PCR with a fluorescently labeled probe that delays fluorescence detection from the start of the PCR cycle and performs quantitative analysis using data from a predetermined number of cycles onward, reducing baseline disturbances.
This approach allows for accurate detection and quantification of target nucleic acids without complex algorithms, preventing false judgments and ensuring precise results.
Smart Images

Figure 0007848443000001 
Figure 0007848443000002
Abstract
Description
Technical Field
[0001] The present invention relates to a method for detecting a target nucleic acid by real-time PCR. More specifically, the present invention relates to a method for detecting a target nucleic acid in dried filter paper blood by real-time PCR using a fluorescent dye, and specifically detecting the target nucleic acid contained in the dried filter paper blood by delaying the timing of fluorescence detection from the start of the PCR cycle.
Background Art
[0002] In neonatal screening tests where dried filter paper blood (hereinafter sometimes referred to as dried filter paper blood or simply filter paper blood), which is filter paper containing blood after being dried, is used as a sample, congenital diseases that have attracted attention in recent years as genetic tests include primary immunodeficiency disease (PID) and spinal muscular atrophy (SMA). Since the dried filter paper blood used in the test contains many substances (such as hemoglobin) that inhibit the PCR amplification reaction, generally, a method using a sample obtained by extracting and purifying nucleic acids from the filter paper blood is used. On the other hand, reagents that reduce the influence of PCR reaction inhibitors due to contaminants in the sample are also commercially available (manufactured by Shimadzu Corporation; Ampdirect (registered trademark)). When using this reagent, a technique has been disclosed in which a direct PCR reaction can be performed from dried filter paper blood, and the presence or absence of the target gene in the dried filter paper blood is confirmed by detecting the PCR amplification product by electrophoresis (Patent Document 1).
[0003] However, even when using such a reagent, when detecting the PCR amplification product by optical means, the precipitation of blood components generated by hemoglobin contained in the blood or heat denaturation during the PCR reaction inhibits the optical path, making it impossible to obtain accurate results. Therefore, a method for defining the addition ratio of the whole blood sample to the reaction solution during the PCR amplification reaction has been disclosed (Patent Document 2). However, in addition to the effects derived from whole blood components, the dried filter paper sections containing blood present in the PCR reaction solution may also interfere with the optical path of the optical detection, potentially preventing sufficient mitigation of the effects.
[0004] Dried blood on filter paper is prepared by impregnating filter paper with blood, drying it, and then removing it as punched sections (sometimes referred to as "dried blood on filter paper punch sections" in this specification) using a punching tool. These sections are then used for detecting target nucleic acids. The inventors have found a method for directly amplifying target nucleic acids from dried blood on filter paper by real-time PCR without the need for complicated pretreatment, by setting the size of the punch section, the amount of total blood contained in the punch section, and the amount of PCR reaction reagent within a predetermined range, and by attaching a cap to the PCR reaction tube during the PCR reaction. This method allows for the optical detection and quantification of the amplified product. A patent application has been filed for this method (Japanese Patent Application No. 2019-166510).
[0005] However, even with the above improvements, in a method that directly amplifies target nucleic acids from dried blood on filter paper using real-time PCR and optically detects and quantifies the amplified product, baseline disturbances may occur due to impurities contained in the dried blood on filter paper. This tendency was particularly high in measurement systems that use fluorescent dyes, which are thought to be easily affected by hemoglobin contained in whole blood. Here, a method has been proposed to determine the baseline endpoint (termination cycle) of the amplification curve in order to prevent a degradation of baseline quality caused by noisy data in real-time PCR (Patent Document 3). This method estimates the baseline endpoint by calculating the derivative of the amplification curve and processing the amplification curve by peak analysis of the obtained first derivative. However, this method requires new software to execute a complex algorithm. [Prior art documents] [Patent Documents]
[0006] [Patent Document 1] Japanese Patent Publication No. 2004-283165 [Patent Document 2] Patent No. 5144518 [Patent Document 3] Special Publication No. 2008-545380 [Overview of the project] [Problems that the invention aims to solve]
[0007] The present invention aims to provide a simple method for detecting target nucleic acids in dried filter paper blood punch pieces by real-time PCR using a fluorescent dye, thereby reducing the effects of baseline disturbance. [Means for solving the problem]
[0008] In this invention, in a method for detecting target nucleic acids in dried filter paper blood punch pieces by real-time PCR using a fluorescently labeled probe, we have found a method for accurately detecting and quantifying target nucleic acids in dried filter paper blood without conveniently detecting baseline disturbances caused by impurities contained in the dried filter paper blood. This is achieved by delaying the timing of fluorescence detection from the start of the PCR cycle, and by performing quantitative analysis of the target nucleic acids using data from a predetermined number of optically detected data onwards. In other words, the present invention has the following configuration. <1> A method for detecting target nucleic acids in blood via real-time PCR, including the following steps: (1) A step of amplifying a target nucleic acid in dried filter paper blood by subjecting a sample solution containing dried filter paper blood punch pieces and PCR reagent to a thermal cycle, wherein the PCR reagent includes a fluorescently labeled probe. (2) A step of optically detecting the fluorescence intensity of the sample solution after each thermal cycle. (3) A process of performing quantitative analysis of target nucleic acids using data from a predetermined number of cycles onward from the optically detected data. <2> The predetermined number of cycles in (3) above is 10 cycles or more and 25 cycles or less. <1> Methods used. <3> The data after the predetermined number of cycles in (3) above is data obtained by optical detection that starts later than the start of the thermal cycle. <1> or <2> Methods used. <4> PCR reagents include, in addition to a fluorescently labeled probe, at least a primer, polymerase, and dNTPs. <1> ~ <3> One of the methods described above. <5> The fluorescently labeled probe comprises a fluorescent substance and a quencher, and includes a partial sequence complementary to the template for the nucleic acid amplification reaction, and the amplified target nucleic acid is detected by detecting the fluorescence generated by irradiation of the fluorescent substance with excitation light. <1> ~ <4> One of the methods described above. <6> The fluorescent label has a fluorescence detection wavelength in the range of 500 nm to 600 nm. <1> ~ <5> One of the methods described above. <7> The target nucleic acid is the nucleic acid of one or more genes selected from the group consisting of TREC, KREC, and SMN1. <1> ~ <6> One of the methods described above. <8> (2) The step of optically detecting the fluorescence intensity of the sample solution for each thermal cycle is a step based on photometric parameters set in the thermal cycler. The photometric parameters are set for a predetermined number of cycles from the start of the thermal cycle, and the photometric parameters are set thereafter, so that optical detection starts later than the start of the thermal cycle. <3> ~ <6> One of the methods described above. <9> A method for reducing baseline disturbance in a method for detecting target nucleic acids in dried filter paper blood by real-time PCR, which includes the following steps. (1) A step of amplifying a target nucleic acid in dried filter paper blood by subjecting a sample solution containing dried filter paper blood punch pieces and PCR reagent to a thermal cycle, wherein the PCR reagent includes a fluorescently labeled probe. (2) A step of optically detecting the fluorescence intensity of the sample solution after each thermal cycle. (3) A step of performing quantitative analysis of the target nucleic acid using data after a predetermined number of cycles among the optically detected data <10> The method according to <9>, wherein the predetermined number of cycles in (3) is 10 cycles or more and 25 cycles or less. <11> The method according to <9> or <10>, wherein the data after the predetermined number of cycles in (3) is data obtained by optical detection that starts after the start of the thermal cycle. <12> The method according to any one of <9> to <11>, wherein the PCR reagent contains at least primers, polymerase, and dNTP in addition to the fluorescently labeled probe. <13> The method according to any one of <9> to <12>, wherein the fluorescently labeled probe has a fluorescent substance and a quencher and contains a partial sequence complementary to the template of the nucleic acid amplification reaction, and the amplified target nucleic acid is detected by detecting fluorescence generated by irradiation of excitation light to the fluorescent substance. <14> The method according to any one of <9> to <13>, wherein the fluorescent label has a fluorescence detection wavelength in the range of 500 nm to 600 nm. <15> The method according to any one of <9> to <14>, wherein the target nucleic acid is a nucleic acid of one or more genes selected from the group consisting of TREC, KREC, and SMN1. <16><000008According to the present invention, a method for directly subjecting dried filter paper blood to real-time PCR without pretreatment, amplifying a target nucleic acid in a dried filter paper blood punch piece by real-time PCR using a fluorescently labeled probe, and detecting the amplification product can prevent false judgment due to a bad baseline and enable detection and quantification.
Brief Description of Drawings
[0010] [Figure 1] It is a figure showing an amplification curve when the RNaseP gene was amplified by real-time PCR of the present invention (Example 1). [Figure 2] It is a figure showing an amplification curve when the RNaseP gene was amplified by conventional real-time PCR (Comparative Example 1).
Modes for Carrying Out the Invention
[0011] (Dried filter paper blood) The dried filter paper blood used in the present invention is blood (whole blood) in a filter paper obtained by drying after including whole blood in a filter paper (filter paper), and is sometimes simply referred to as dried filter paper blood. Dried filter paper blood is usually cut out from a filter paper containing and dried blood and used as a paper section. Typically, it is taken out as a punch hole-shaped section (punch piece) by a punching tool. A section of the filter paper in the shape of the punch piece containing blood is particularly referred to as a dried filter paper blood punch piece. The size of the punch piece used in the present invention preferably makes the amount of blood contained in the reaction solution within a predetermined range, preferably 1.2 to 2.0 mm in diameter, and more preferably 1.5 mm to 1.8 mm. Further, as the amount of whole blood contained in the punch piece, when converted from the size of the punch piece, it is preferably 0.95 v / v% to 6.6 v / v% with respect to the total reaction solution amount of PCR, and more preferably 1.4 v / v% to 5.2 v / v%. As the dried filter paper blood used in the present invention, for example, filter paper blood collected from the heel of a newborn such as newborn mass screening, filter paper blood collected as optional screening at the same time, etc. are used, but it is not limited thereto.
[0012] (target nucleic acid) The target nucleic acid in this invention is not particularly limited and includes DNA and RNA derived from whole blood, as well as foreign nucleic acids introduced into whole blood by viruses, etc. Among these, nucleic acids derived from the whole blood of newborns are preferred, and more specifically, nucleic acids derived from genes such as TREC, KREC, SMN1, and SMN2 are preferred.
[0013] (Real-time PCR) PCR is a widely used method for exponentially amplifying the region of the target nucleic acid sandwiched between primers by repeating a thermal cycle consisting of denaturation, annealing, and extension steps, each cycle being a temperature change, in the presence of the target nucleic acid, four types of deoxynucleoside triphosphates (dNTPs), a pair of primers, and polymerase. The number of thermal cycles is adjusted as appropriate depending on the reagents, samples, and reaction time, but is usually around 25 to 40 times. In this invention, the term "real-time PCR method" refers to a method of monitoring the process of generating amplification products of target nucleic acids by PCR over time using optical means or the like. In this invention, optically detecting the fluorescence intensity of the sample solution for each thermal cycle means optically detecting the fluorescence intensity produced from the sample solution at the end of each thermal cycle.
[0014] The characteristic feature of this invention, "the process of performing quantitative analysis of target nucleic acids using data from a predetermined number of cycles onward from optically detected data," can be broadly categorized into the following two types. (1) A process in which optical detection is started later than the start of the thermal cycle, and analysis is performed using the data obtained from this delayed optical detection. (2) A process in which fluorescence intensity is detected from the start of the thermal cycle, but detection data from the start of the thermal cycle up to a predetermined number of cycles is not used, and quantitative analysis of the target nucleic acid is performed using detection data from the predetermined number of cycles onward. (1) "Optical detection starts later than the start of the thermal cycle" means that, conventionally, optical detection starts simultaneously with the start of the thermal cycle, and fluorescence intensity is detected from the end of the first cycle. However, in the present invention, fluorescence intensity is not detected from the start of the thermal cycle until a predetermined number of cycles have been reached, and fluorescence intensity is detected only after the predetermined number of cycles has been exceeded. The predetermined number of cycles can be any number of cycles until the baseline stabilizes, and can be set appropriately depending on the type of fluorescent dye used, the amount of hemoglobin in the sample, etc. The process described in (2), "detection of fluorescence intensity from the start of the thermal cycle, but deliberately not using detection data from the start of the thermal cycle up to a predetermined number of cycles, and instead using detection data from the predetermined number of cycles onward to perform quantitative analysis of the target nucleic acid," is usually performed by arbitrarily setting the cycle width after the measurement is completed and correcting the baseline. The predetermined number of cycles is preferably at most 25 cycles, and in some cases, 20 cycles or less is preferable. Furthermore, the predetermined number of cycles is preferably at least 5 cycles, and in some cases, 10 cycles or more is preferable. Therefore, the predetermined number of cycles in the present invention is preferably 5 cycles or more and 25 cycles or less, and in some cases, 10 cycles or more and 25 cycles or less is preferable.
[0015] In the PCR reaction of the present invention, the conditions (temperature and time) of the thermal cycle can be arbitrarily set using a thermal cycler or the like, and the detection of fluorescence intensity can be arbitrarily controlled based on photometric parameters set for each thermal cycle. In the present invention, by setting unmeasured photometric parameters for a predetermined number of cycles from the start of the thermal cycle, and setting photometric parameters after the predetermined number of cycles, optical detection can be started later than the start of the thermal cycle. Therefore, the optical detection step by setting unmeasured photometric parameters and the photometric parameters after the predetermined number of cycles has elapsed is also included in the step of the present invention in which "optical detection is started later than the start of the thermal cycle."
[0016] In the present invention, the amplified target nucleic acid produced by the PCR reaction can be detected by optically detecting the fluorescence intensity generated from the amplified product. The fluorescence detection method of the present invention involves irradiating a fluorescent substance of a fluorescently labeled probe with excitation light, which generates fluorescence. This fluorescence is then optically detected to detect or quantify the amplified target nucleic acid. Examples of fluorescently labeled probes include TaqMan® probes, cycling probes, and FRET probes.
[0017] Fluorescence intensity can be detected, for example, using a fluorometer. Generally, devices that include both a PCR reaction unit (e.g., a thermal cycler) and an optical system unit (e.g., a fluorometer) are used. Specific examples include commercially available SmartCycler (trade name, manufactured by Takara Bio), LightCycler (trade name, manufactured by Roche Diagnostics), and ABI PRISM7000 (trade name, manufactured by Applied Biosystems).
[0018] (PCR reagents) The PCR reagent used in the present invention includes a fluorescently labeled probe and further includes at least a set of primers, polymerase, and various types of dNTPs (deoxynucleoside triphosphates). The fluorescently labeled probe of the present invention preferably has a fluorescent substance and a quencher, and also contains a partial sequence complementary to the template for the nucleic acid amplification reaction. Any known fluorescent dye can be used as the fluorescent dye for the fluorescently labeled probe, such as the Alexa Fluor series, CAL Fluor series, Cy series, ATTO series, DY series, DyLight series, Quasar series, FAM, TAMRA, TET, JOE, VIC, ROX, TexasRed, and HEX. However, since hemoglobin absorbs wavelengths of 500-600 nm well, it is preferable to use a fluorescent dye whose fluorescence detection wavelength falls within this range, as this will better demonstrate the effects of the present invention. For example, FAM, TET, CAL Fluor® Gold 540, JOE, VIC, HEX, CAL Fluor Orange 560, Quasar®, and Cy TM 3. NED, TAMRA, CAL Fluor Red590, and Cy3.5 are also mentioned. Furthermore, PCR reagents typically include a buffer. The buffer is not particularly limited as long as it has the function of suppressing the action of substances that inhibit DNA amplification reactions, such as positively charged substances (certain proteins, etc.) and negatively charged substances (certain sugars, dyes, etc.) that are present in the body fluids of living organisms. Examples of commercially available buffers include Ampdirect and Ampdirect plus (both manufactured by Shimadzu Corporation).
[0019] (Method for quantifying target nucleic acids) The present invention provides a method for quantifying target nucleic acids, which involves generating an amplification product complementary to the target nucleic acid in dried blood on filter paper using real-time PCR, detecting the amplification product by optical means, and quantifying the amplification product. The target nucleic acid contained in the dried blood on filter paper can be quantified by counting the number of PCR cycles required to produce a predetermined amount of the amplification product. Alternatively, as shown in the examples described later, the target nucleic acid can also be quantified by converting the copy number of 1 μL of whole blood in the dried blood on filter paper from a calibration curve of Cq values calculated from a standard sample.
[0020] The present invention provides a method for detecting target nucleic acids in dried blood filter paper by real-time PCR, comprising the following steps (1) and (2). (1) A step of amplifying a target nucleic acid in dried filter paper blood by subjecting a sample solution containing dried filter paper blood punch pieces and PCR reagent to a thermal cycle, wherein the PCR reagent includes a fluorescently labeled probe. (2) A step of optically detecting the fluorescence intensity of the sample solution after each thermal cycle. (3) A process of performing quantitative analysis of target nucleic acids using data from a predetermined number of cycles onward from the optically detected data.
[0021] The process described in (1) above should more specifically include the following steps (A) to (C). (A) Step of adding dried filter paper blood to the tube for the PCR reaction. (B) A step of adding a PCR reagent to a tube for a PCR reaction, wherein the PCR reagent includes a fluorescently labeled probe. (C) A process of amplifying the target nucleic acid in the dried filter paper blood by subjecting a sample solution containing a dried filter paper blood punch piece and PCR reagent to multiple thermal cycles.
[0022] Here, steps (A) and (B) can be performed either first or simultaneously, but it is preferable to perform step (B) after step (A). Performing (A) first makes it more certain that even if the filter paper adheres to the tube wall, the reagent solution will contain it at the bottom of the tube. It is also desirable to perform centrifugation or similar before starting the PCR reaction to ensure that the punch piece is contained at the bottom of the tube. Furthermore, in the PCR reaction, it is preferable to seal the reaction tube with a cap before starting the thermal cycle. This suppresses the generation of bubbles due to the thermal cycle, prevents the punch pieces from floating up, and reduces vibration. In this invention, "applying thermal cycling" means repeatedly changing the temperature, and also means performing thermal cycling. More specifically, it means repeatedly applying temperature changes to the PCR reaction solution using a device called a thermal cycler.
[0023] The above (3) step of performing quantitative analysis of the target nucleic acid using data from a predetermined number of cycles onward from the optically detected data can reduce baseline disturbances. In this respect, the present invention can be described as a method for reducing baseline disturbances in a method for detecting target nucleic acids in dried filter paper blood by real-time PCR. The reason for the reduction in baseline disturbance is unclear, but it is presumed that noise caused by contaminants in the dried filter paper blood, or the degree to which fluorescence produced from the fluorescently labeled probe in the PCR reaction is absorbed by hemoglobin protein increases or decreases with the number of thermal cycles, causing some fluctuation in the baseline. According to the present invention, by not performing fluorescence detection for a predetermined number of thermal cycles, it is possible to obtain an accurate baseline without being affected by the aforementioned fluctuations. Therefore, according to the present invention, it is possible to accurately optically detect and quantify target nucleic acids contained in dried filter paper blood punch pieces by real-time PCR without complicated pretreatment.
[0024] (Reaction tube) The tube used in this invention is a tube for PCR reaction, and should have a structure that allows for the smooth insertion of a dried filter paper blood punch piece and can be sealed with a cap. Furthermore, it is preferable that the opening at the top of the tube is circular (for example, with an inner diameter of about 2.5 mm to 10 mm) and the bottom is narrower than the opening at the top, and an inverted cone shape is preferred. The capacity of the above-mentioned tube should be sufficient to accommodate the reaction solution even after adding the PCR reaction reagent and undergoing temperature changes due to the PCR reaction. A capacity of 0.1 mL to 0.3 mL is preferred, more preferably 0.15 mL to 0.25 mL, and most preferably 0.2 mL. The PCR reaction tubes used in this invention are preferably 96-well PCR reaction tubes with 96 tubes in a row, or 8-tube strips with 8 tubes in a row. Commercially available products sold under names such as 96-well PCR plates and 8-tube PCR strips can be used. Examples of commercially available products include LightCycler480 Multiwell Plate 96 (Roche), 96-Well PCR Plate, Flat Top, Low Profile, Natural, Polypropylene, UltraFlux (Scientific Specialties, Inc.), Eppendorf PCR Plate 96, Skirtless, 150 μL, Colorless (Eppendorf), PCR Plate 96well Thin Plate 0.1ml Natural (BM Instruments), and LightCycler(R) 8-Tube Strips (Roche). The material of these reaction tubes should preferably have minimal contamination from the reaction solution and be rigid enough to maintain its shape even when subjected to internal pressure fluctuations due to temperature changes during the PCR reaction. For example, polypropylene is a suitable material. In this case, the amount of PCR reagent used in the present invention added to the reaction tube is preferably 20 to 50 μL. The present invention will be described below based on examples, but is not limited thereto. [Examples]
[0025] [Example 1] Real-time PCR using a fluorescently labeled probe (a) Test material (a-1) Primers for RNaseP gene amplification For RNaseP amplification, we used primers synthesized by Sigma-Aldrich, as described below. Forward primer; 5'-GCGGAGGGAAGCTCATCA-3' (SEQ ID NO: 1) Reverse primer; 5'-GTCTGACCTCGCGCGGA-3' (SEQ ID NO: 2)
[0026] (a-2) Probe for detecting the RNaseP gene To confirm the PCR amplification of RNaseP, the following fluorescently labeled (FAM) detection probe was used. This probe was synthesized by Primetech. Probe for detecting the RNaseP gene; 5'-(FAM)-CCACGAGCTGAGTGCGTCCTG-(BHQ1)-3' (the base sequence portion is sequence number 3)
[0027] (a-3) As a template for the PCR reaction, we used a plasmid synthesized by Eurofins, which incorporated the partial sequence of the RNaseP gene shown below into a vector. RNaseP gene partial sequence (SEQ ID NO: 4) CAACTTAATTTCTGATCATATTTTGTTGAATAAAAATAAGTAAAATGTCTTGTGAAACAAAATGCTTTTTAACATCCATATAAAGCTATCTATATATAGCTATCTATGTCTATAGCTATTTTTTTAACTTCCTTTATTTTCCTTACAGGGTTTCAGACAAAATCAAAAAGAAGGAAGGTGCTCACATTCCTTAAATTA AGGAGTAAGTCTGCCAGCATTATGAAAGTGAATCTTACTTTTTGTAAAACTTTATGGTTTGTGGAAAACAAATGTTTTTGAACATTTAAAAAGTTCAGATGTTAAAAAAGTTGAAAGGTTAATGTAAAACAATCAATATTAAAGAATTTTGATGCCAAAACTATTAGATAAAAGGTTAATCTACATCCCTACTAGAATTCTC
[0028] (b) PCR reagents The composition of the PCR reagent is shown below. PCR buffer (Ampdirect Plus; Shimadzu Corporation) 0.125 μM (final concentration) forward primer for RNaseP gene amplification 0.125 μM (final concentration) reverse primer for RNaseP gene amplification 0.125 μM (final concentration) RNaseP gene detection probe 0.025 U / μL BIOTAQ HSDNA polymerase
[0029] (c) Control dry filter paper blood Human red blood cell fraction from which white blood cells have been removed and 1% BSA (PBS-based) were mixed in a 6:4 ratio. To this mixture, a plasmid containing a partial sequence of the RNaseP gene was added at a concentration of 10,000 copies / μL. 40 μL of this mixture was then absorbed onto blood collection filter paper (Advantec Co., Ltd.), dried, and used as the control dried filter paper blood.
[0030] (d) Conditions for the PCR reaction PCR reactions were performed under conditions combining the previously unmeasured photometric parameters of the present invention shown below. (i) 95℃: 15 minutes (ii) 95℃: 15 seconds, 63℃: 60 seconds (10 cycles) No light measurement setting (iii) 95℃: 15 seconds, 63℃: 60 seconds (30 cycles) Photometering settings (iv)37℃: 5 minutes
[0031] (e) Real-time PCR measurement (e-1) Measurement method The measurement was performed using the following procedure. (i) From the control dried filter paper blood, circular punch pieces with a diameter of 1.5 mm were collected using a puncher. (ii) The punch pieces were placed into tubes for the PCR reaction (Roche LightCycler(R) 8-Tube Strips, made of polypropylene). (iii) After adding 40 μL of the above PCR reagent to each tube, the tubes were sealed with caps (the ones that came with the tubes). (iv) Using a thermal cycler (LightCycler96; Roche), real-time PCR measurement of the RNaseP gene (excitation: 470 nm / detection: 514 nm) was performed with the above parameters.
[0032] (e-2) Measurement results The results of the amplification curves of the PCR reaction measured under the PCR reaction conditions of the present invention are shown in FIG. 1. As a result of measuring each of the 20 punch pieces with parameters combined with unmeasured parameters, it was confirmed that baseline correction was favorably performed without substantially including the disturbances that occurred in Comparative Example 1 described later. Thus, with respect to the baseline disturbance caused by contaminants contained in dried filter paper blood, by incorporating parameters that do not detect fluorescence, it was possible to set so that the baseline disturbance was not detected for convenience. Therefore, according to the method of the present invention, when measuring a specific gene in dried filter paper blood, it is possible to suppress the frequency of reexamination due to poor baseline and provide an accurate and efficient quantification method.
[0033] 〔Comparative Example 1〕 Real-time PCR using a fluorescently labeled probe with conventional parameters (a) Real-time PCR measurement Real-time PCR was performed using a FAM-labeled fluorescent probe in the same manner except that the parameters of the (d) PCR reaction conditions in Example 1 above were changed as follows, and the RNaseP gene was measured for 44 punch pieces. <PCR reaction conditions: Conventional parameters> (i) 95°C: 15 minutes (ii) 95°C: 15 seconds, 63°C: 60 seconds (40 cycles) Measurement settings (iii) 37°C: 5 minutes
[0034] (b) Measurement results The amplification curves of the PCR reaction measured for 44 punch pieces are shown in FIG. 2. In 6 out of 44 amplification curves, baseline distortion was still observed even after processing with the baseline correction function built into the instrument. The reason for this is unclear, but it may be related to the amount of hemoglobin protein eluted from the sample, which was a dried filter paper blood punch piece. Specifically, it is possible that the fluorescence of the fluorescent substance FAM was absorbed by the protein in the early stages of the reaction, causing the fluorescence value to temporarily become relatively low, and then the influence of the hemoglobin protein weakened as the number of thermal cycles progressed. In such cases, a transient increase in fluorescence value occurs, and the instrument's calculation unit processes it as if the amplification reaction occurred at the point indicated by the arrow in the proliferation curve (number of cycles), resulting in a very small calculated Cq value. Therefore, if the calibration curve is fitted based on the Cp value in question, the target nucleic acid concentration in the sample will be incorrectly calculated to be much higher than the actual concentration. [Industrial applicability]
[0035] The present invention provides a method for detecting target nucleic acids in dried filter paper blood punch pieces using real-time PCR with a fluorescently labeled probe. By delaying the timing of fluorescence detection from the start of the PCR thermal cycle, and performing quantitative analysis of the target nucleic acid using data from a predetermined number of cycles onward from the optically detected data, it is possible to prevent misjudgments due to poor baseline conditions and achieve accurate quantification. The method of the present invention can be applied to the quantification of specific genes, for example, to the TREC / KREC gene fragment quantification method used in newborn screening tests for PID and the SMN1 gene quantification method used in newborn screening tests for SMA.
Claims
1. A method for detecting target nucleic acids in blood using real-time PCR, including the following steps: (1) A step of amplifying a target nucleic acid in dried filter paper blood by subjecting a sample solution containing dried filter paper blood punch pieces and PCR reagent to a thermal cycle, wherein the PCR reagent contains a fluorescently labeled probe, and the size of the dried filter paper blood punch pieces is 1.5 mm to 1.8 mm in diameter, the step (2) A step of optically detecting the fluorescence intensity of a sample solution for each thermal cycle, wherein the step is based on photometric parameters set in the thermal cycler, and the photometric parameters are set for a predetermined number of cycles from the start of the thermal cycle, and the photometric parameters are set thereafter, so that optical detection starts later than the start of the thermal cycle. (3) A step of performing quantitative analysis of target nucleic acids using data from a predetermined number of cycles onward from optically detected data, wherein the predetermined number of cycles is 11 cycles or more and 25 cycles or less.
2. The method according to claim 1, wherein the data after the predetermined number of cycles in (3) above is data obtained by optical detection that is started later than the start of the thermal cycle.
3. The method according to claim 1 or 2, wherein the PCR reagent comprises, in addition to a fluorescently labeled probe, at least a primer, polymerase, and dNTPs.
4. The method according to any one of claims 1 to 3, wherein the fluorescently labeled probe has a fluorescent substance and a quencher and includes a partial sequence complementary to the template for the nucleic acid amplification reaction, and the amplified target nucleic acid is detected by detecting the fluorescence generated by irradiation of the fluorescent substance with excitation light.
5. The method according to any one of claims 1 to 4, wherein the fluorescent label has a fluorescence detection wavelength in the range of 500 nm to 600 nm.
6. The method according to any one of claims 1 to 5, wherein the target nucleic acid is the nucleic acid of one or more genes selected from the group consisting of TREC, KREC, and SMN1.
7. A method for reducing baseline disturbance in a method for detecting target nucleic acids in dried filter paper blood by real-time PCR, which includes the following steps. (1) A step of amplifying a target nucleic acid in dried filter paper blood by subjecting a sample solution containing dried filter paper blood punch pieces and PCR reagent to a thermal cycle, wherein the PCR reagent contains a fluorescently labeled probe, and the size of the dried filter paper blood punch pieces is 1.5 mm to 1.8 mm in diameter, the step (2) A step of optically detecting the fluorescence intensity of a sample solution for each thermal cycle, wherein the step is based on photometric parameters set in the thermal cycler, and the photometric parameters are set for a predetermined number of cycles from the start of the thermal cycle, and the photometric parameters are set thereafter, so that optical detection starts later than the start of the thermal cycle. (3) A step of performing quantitative analysis of target nucleic acids using data from a predetermined number of cycles onward from optically detected data, wherein the predetermined number of cycles is 11 cycles or more and 25 cycles or less.
8. The method according to claim 7, wherein the predetermined number of cycles in (3) is 25 cycles or less.
9. The method according to claim 7 or 8, wherein the data after the predetermined number of cycles in (3) above is data obtained by optical detection that is started later than the start of the thermal cycle.
10. The method according to any one of claims 7 to 9, wherein the PCR reagent comprises, in addition to a fluorescently labeled probe, at least a primer, polymerase, and dNTPs.
11. The method according to any one of claims 7 to 10, wherein the fluorescently labeled probe has a fluorescent substance and a quencher and includes a partial sequence complementary to the template for the nucleic acid amplification reaction, and the amplified target nucleic acid is detected by detecting the fluorescence generated by irradiation of the fluorescent substance with excitation light.
12. The method according to any one of claims 7 to 11, wherein the fluorescent label has a fluorescence detection wavelength in the range of 500 nm to 600 nm.
13. The method according to any one of claims 7 to 12, wherein the target nucleic acid is the nucleic acid of one or more genes selected from the group consisting of TREC, KREC, and SMN1.
14. The method according to any one of claims 9 to 13, wherein the step of optically detecting the fluorescence intensity of the sample solution for each thermal cycle in (2) is a step based on photometric parameters set in the thermal cycler, and the photometric parameters are set for a predetermined number of cycles from the start of the thermal cycle, and the photometric parameters are set thereafter, so that optical detection starts later than the start of the thermal cycle.
Citation Information
Patent Citations
Renzokuchuzosochi niokeru igatashindoyokudosochi
JP1976044518A
Method for typing HLA
JP2004283165A
Baselining amplified data
JP2008545380A
Direct quantification of unprocessed nucleic acid samples
US20150111214A1
Simple genetic testing method, copy number measurement method, and supporting technology for same
WO2018025856A1