Cancer treatments for non-human mammals

Abstract

[Problem] To provide a therapeutic agent for cancer in non-human mammals. [Solution] A therapeutic agent for cancer in non-human mammals (in particular, a therapeutic agent for canine bladder cancer) which comprises, as an active ingredient, O-(5-amino-2-phenylbenzoxazol-7-yl)methyl-3,5-dichloro-L-tyrosine or a pharmaceutically acceptable salt thereof, and a method which is for predicting drug efficacy, against canine cancer, of O-(5-amino-2-phenylbenzoxazol-7-yl)methyl-3,5-dichloro-L-tyrosine or a pharmaceutically acceptable salt thereof, and which comprises the step for measuring either one or both of the amounts of LAT1 protein and LAT1 mRNA that are contained in canine urine.

Description

Technical Field

[0001] This invention relates to a therapeutic agent for cancer in non-human mammals.

Background Art

[0002] International Publication WO2015 / 173970 pamphlet describes an anti-tumor agent composition containing an LAT1 inhibitor. International Publication WO2019 / 130637 pamphlet describes a therapeutic agent for cancer containing O-(5-amino-2-phenylbenzoxazol-7-yl)methyl-3,5-dichloro-L-tyrosine (JPH203) or a pharmaceutically acceptable salt thereof as an active ingredient. It has not been shown that JPH203 is effective in treating cancer in animals other than humans.

Prior Art Documents

Patent Documents

[0003]

Patent Document 1

Patent Document 2

Summary of the Invention

Problems to be Solved by the Invention

[0004] An object of this invention is to provide a therapeutic agent for cancer in mammals other than humans. Another object of this invention is to provide a method for analyzing whether administration of JPH203 is effective for treating cancer.

Means for Solving the Problems

[0005] This invention is based on the finding that JPH203 is also effective in treating cancer in mammals other than humans. In particular, this invention is based on the finding that JPH203 is effective in treating solid cancer (especially bladder cancer) in dogs.

[0006] The first invention relates to a therapeutic agent for cancer in non-human mammals. The therapeutic agent for cancer in non-human mammals comprises O-(5-amino-2-phenylbenzoxazole-7-yl)methyl-3,5-dichloro-L-tyrosine (JPH203) or a pharmaceutically acceptable salt thereof as an active ingredient.

[0007] Examples of non-human mammals include dogs and cats. Examples of cancers treated with this drug include lung cancer, hepatocellular carcinoma, kidney cancer, bladder cancer, mammary gland tumors, melanoma, or angiosarcoma, among which it is particularly effective in treating lung cancer, hepatocellular carcinoma, and bladder cancer, and among which it is particularly effective in treating bladder cancer.

[0008] The second invention relates to a method for predicting the efficacy of O-(5-amino-2-phenylbenzoxazole-7-yl)methyl-3,5-dichloro-L-tyrosine or a pharmaceutically acceptable salt thereof against canine cancer, comprising the step of measuring either or both the amount of LAT1 protein and / or LAT1 mRNA contained in a canine-derived sample (e.g., excised canine cancer tissue, blood, or urine, particularly canine urine). [Effects of the Invention]

[0009] The examples demonstrate that JPH203 is also effective in treating cancers in non-human mammals. In other words, this invention can provide a therapeutic agent for cancers in non-human mammals. Furthermore, this invention can provide a method for analyzing whether JPH203 administration is effective for treating cancer in a given target population. [Brief explanation of the drawing]

[0010] [Figure 1A] Figure 1A is a graph that replaces the diagram showing the evaluation of LAT1 mRNA expression in various canine cancers by real-time PCR. [Figure 1B] Figure 1B is a graph that replaces the diagram showing the evaluation of LAT1 mRNA expression in cBC organoids by real-time PCR. [Figure 1C]Figure 1C is a Western blotting gel electrophoresis image and graph that replaces the diagram showing protein expression by Western blotting. [Figure 1D] Figure 1D is a fluorescence micrograph that replaces the diagram showing protein expression by immunofluorescence staining. [Figure 2A] Figure 2A is a fluorescence microscope image, an optical microscope image, and a graph showing the ratio of the number of cells that take up amino acids, as an alternative to the diagram. [Figure 2B] Figure 2B is a graph that replaces the diagram showing the cell viability within bladder cancer organoids 72 hours after JPH203 treatment. [Figure 3A] Figure 3A is a photograph, replacing the diagram, showing a Western blotting pattern illustrating the time-dependent effect on the mTOR signaling pathway in the cBC1 organoid of JPH203. [Figure 3B] Figure 3B is a graph that replaces the diagram showing the Western blotting effect of JPH203 on the mTOR signaling pathway in the cBC1 organoid. [Figure 3C] Figure 3C is a schematic diagram of the PI3K / Akt / mTOR signaling pathway and the mechanism of JPH203 therapy. [Figure 4A] Figure 4A is a graph, instead of a diagram, that shows the tumor size measurement results demonstrating the tumor growth inhibitory effect of JPH203 on immunodeficient mice with canine bladder tumors. [Figure 4B] Figure 4A is a graph, instead of a diagram, that shows the results of measuring the average tumor weight, demonstrating the tumor growth inhibitory effect of JPH203 on immunodeficient mice with canine bladder tumors. [Figure 4C] Figure 4C is a photograph replacing the diagram showing tumors evaluated from mice sacrificed 19 days after JPH203 treatment. [Figure 4D] Figure 4D is a Western blotting gel electrophoresis image and graph, replacing the original drawing, that confirms LAT1 expression in tumor tissue collected from mice sacrificed 19 days after JPH203 treatment. [Figure 4E]Figure 4E is a photograph replacing the drawing by immunohistochemical staining that confirmed the expression of LAT1 in tumor tissues collected from the mice sacrificed on the 19th day after JPH203 treatment. [Figure 5A] Figure 5A is a photograph and graph replacing the drawing showing immunohistochemical staining (IHC) of mTOR and phosphorylated-mTOR in tumor tissues collected from the mice sacrificed on the 19th day after JPH203 treatment. [Figure 5B] Figure 5B is a photograph of TUNEL staining replacing the drawing in tumor tissues collected from the mice sacrificed on the 19th day after JPH203 treatment. [Figure 6] Figure 6 is a graph replacing the drawing showing the expression of the LAT1 gene in 5 types of cancer organoids. [Figure 7] Figure 7 is a graph replacing the drawing showing the tumor cell survival rate in canine liver cancer and lung cancer. [Figure 8] Figure 8 is a graph replacing the drawing showing the tumor cell survival rate in feline mammary tumors, canine melanomas, and canine angiosarcomas, and the table in the figure is a table replacing the drawing showing the cancer cell survival rate of each animal individual.

Mode for Carrying Out the Invention

[0011] Hereinafter, the mode for carrying out the present invention will be described with reference to the drawings. The present invention is not limited to the mode described below, and also includes those appropriately modified by those skilled in the art within an obvious range from the following mode.

[0012] The first invention relates to a therapeutic agent for cancer in non-human mammals. The therapeutic agent for cancer in non-human mammals contains an effective amount of O-(5-amino-2-phenylbenzoxazole-7-yl)methyl-3,5-dichloro-L-tyrosine (JPH203) or a pharmaceutically acceptable salt thereof as an active ingredient. O-(5-amino-2-phenylbenzoxazole-7-yl)methyl-3,5-dichloro-L-tyrosine is known as a LAT1 inhibitor and is a known compound called JPH203 or nanvuranlat. JPH203 is commercially available and can be obtained by purchase.

[0013] The pharmaceutically acceptable salt is the salt of O-(5-amino-2-phenylbenzoxazole-7-yl)methyl-3,5-dichloro-L-tyrosine. Examples of salts include inorganic salts, organic salts, inorganic base salts, organic base salts, and acidic or basic amino acid salts. Examples of inorganic salts include hydrochlorides, hydrobroms, sulfates, nitrates, and phosphates. Examples of organic salts include acetates, succinates, fumarates, maleates, tartrates, citrates, lactates, stearates, benzoates, methanesulfonates, and p-toluenesulfonates. Examples of inorganic base salts include alkali metal salts such as sodium and potassium salts, alkaline earth metal salts such as calcium and magnesium salts, aluminum salts, and ammonium salts. Examples of organic base salts include diethylamine salts, diethanolamine salts, meglumine salts, and N,N'-dibenzylethylenediamine salts. Examples of acidic amino acid salts are aspartates and glutamates. Examples of basic amino acid salts are arginine salts, lysine salts, and ornithine salts.

[0014] Examples of non-human mammals include dogs, cats, or horses. Of these, dogs are preferred. Examples of cancer in cancer treatment agents include brain cancer, head and neck cancer, esophageal cancer, thyroid cancer, small cell carcinoma, non-small cell carcinoma, breast cancer, stomach cancer, gallbladder and bile duct cancer, liver cancer, pancreatic cancer, colon cancer, rectal cancer, ovarian cancer, choriocarcinoma, endometrial cancer, cervical cancer, renal pelvis and ureteral cancer, bladder cancer, prostate cancer, penile cancer, testicular cancer, fetal cancer, Wilms' cancer, skin cancer, malignant melanoma, neuroblastoma, osteosarcoma, Ewing's tumor, and soft tissue sarcoma. Examples of cancer may also include lung cancer, hepatocellular carcinoma, kidney cancer, bladder cancer, mammary gland tumors, melanoma, and angiosarcoma. Of these, as demonstrated by the examples, JPH203 can be preferably used for lung cancer, hepatocellular carcinoma, and bladder cancer, and is particularly preferably used for bladder cancer. Some embodiments of the agents disclosed in this specification may be administered orally or parenterally. Parenteral administration may include pulmonary formulations (e.g., using a nebulizer), nasal formulations, transdermal formulations (e.g., ointments, creams), and injectable formulations. In the case of injectable formulations, they may be administered systemically or locally by intravenous injection (e.g., intravenous infusion), intramuscular injection, intraperitoneal injection, subcutaneous injection, etc.

[0015] The agent of the present invention may contain known active ingredients other than JPH203 (for example, active ingredients for the treatment of cancer).

[0016] The method of administering the agent of the present invention should be appropriately selected depending on the age, weight, and symptoms of the organism to be administered. The dosage of JPH203 may be 10 μg to 100 mg, 0.1 mg to 100 mg, 10 mg to 100 mg, or 0.1 mg to 10 mg per kg of body weight per dose. However, the above therapeutic agent is not limited to these dosages. The frequency of administration may also be adjusted as appropriate.

[0017] The agent of the present invention can be formulated according to conventional methods and may contain pharmaceutically acceptable carriers and additives. Examples of such carriers and additives include water, pharmaceutically acceptable organic solvents, collagen, polyvinyl alcohol, polyvinylpyrrolidone, carboxyvinyl polymer, sodium carboxymethylcellulose, sodium polyacrylate, sodium alginate, water-soluble dextran, sodium carboxymethyl starch, pectin, methylcellulose, ethylcellulose, xanthan gum, acacia gum, casein, agar, polyethylene glycol, diglycerin, glycerin, propylene glycol, petrolatum, paraffin, stearyl alcohol, stearic acid, human serum albumin, mannitol, sorbitol, lactose, and pharmaceutically acceptable surfactants. The above additives are selected individually or in appropriate combinations depending on the dosage form of the therapeutic agent of the present invention. For example, when used as an injectable formulation, the active ingredient can be dissolved in a solvent (e.g., physiological saline, buffer solution, glucose solution, etc.), and Tween 80, Tween 20, gelatin, human serum albumin, etc. can be added to this solution.

[0018] The second invention relates to a method for predicting the efficacy of O-(5-amino-2-phenylbenzoxazole-7-yl)methyl-3,5-dichloro-L-tyrosine or a pharmaceutically acceptable salt thereof against canine cancer, comprising the step of measuring either or both the amount of LAT1 protein and / or LAT1 mRNA contained in a canine-derived sample (e.g., excised canine cancer tissue, blood, or urine, particularly canine urine).

[0019] For example, urine can be collected from a dog with cancer for which the drug's efficacy in dogs has been established. Then, the amount (concentration) of LAT1 protein and / or LAT1 mRNA in the urine can be measured. Substances that bind to LAT1 protein and substances that bind to LAT1 mRNA are well known. For example, the amount of LAT1 protein and LAT1 mRNA in the urine can be measured using a marker attached to the LAT1 protein or LAT1 mRNA and the substance that binds to them. If the amount of LAT1 protein and LAT1 mRNA are above a threshold, it can be determined that JPH203 is effective as a cancer treatment agent. [Examples]

[0020] L-type amino acid transporter 1 (LAT1) controls the uptake of neutral amino acids across the cell membrane and has been frequently overexpressed in various human cancers. Overexpression of LAT1 is associated with high tumor growth and shortened patient survival and is used as a prognostic biomarker in several tumors. In previous studies, selective inhibition of LAT1 by the small molecule compound JPH203 showed potent anticancer effects in human leukemia cells and colon tumors. In this example, we confirmed increased LAT1 expression in canine bladder cancer (cBC) and found that JPH203 effectively suppressed tumor growth in vitro and in vivo. Bladder cancer (BC) cells were surgically collected from dogs with spontaneously occurring tumors at a veterinary clinic in Japan, and a 2.5D cancer organoid culture system was generated according to previous reports. Increased LAT1 expression was observed in two cBC organoid lines by real-time PCR, immunofluorescence staining, and Western blotting, compared to other canine cancers and normal bladder cells. In BC organoids overexpressing LAT1, dose-dependent cytotoxicity was observed after JPH203 treatment, with an IC50 of 11.9 μM. Furthermore, intracellular amino acid uptake was inhibited by more than 90% after treatment. In vivo, intraperitoneal administration of JPH203 significantly reduced the growth and weight of xenografts derived from mouse cBC organoids, along with induction of apoptosis and a decrease in LAT1 expression, compared to mice treated with a vehicle. Therefore, this study first verified that JPH203 is a promising therapeutic agent for cBC through the downregulation of overexpressed LAT1.

[0021] JPH203, an L-amino acid transporter 1 (LAT1) inhibitor, was provided by Codec Chemical Co., Ltd. (Tokyo, Japan). In the experiment, PrestoBlue TMCell viability reagents were purchased from Thermo Fisher Scientific Inc. (Massachusetts, USA), and amino acid uptake assay kits were purchased from Dojindo Laboratories Co., Ltd. (Kumamoto, Japan). Tween® 20 was purchased from Sigma-Aldrich Chemical (St. Louis, Missouri, USA), and dimethyl sulfoxide (DMSO) was purchased from Wako Pure Chemical Corporation (Osaka, Japan). Regarding cell culture, the components of the culture medium are as follows:

[0022] Advanced Dulbecco's Modified Eagle's Medium (DMEM) / F12 (Termo Fisher Scientific Inc.) was supplemented with 10 mM 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES; WAKO Pure Chemical Corporation), 1% GlutaMax (Termo Fisher Scientific Inc.), 10 mM nicotinamide (Sigma-Aldrich Chemical), 1 mM N-acetyl-L-cysteine ​​(Sigma-Aldrich Chemical), 0.5 μM A83-01 (Adooq Bioscience, Irvine, California, USA), 1% penicillin-streptomycin (PS; WAKO Pure Chemical Corporation), and 5% fetal bovine serum (FBS; Termo Fisher Scientific Inc.).

[0023] I purchased the SLC7A5(LAT1) antibody (catalog no. orb158412) from Biorbyt Ltd. (Cambridge, UK). We purchased mTOR antibody (catalog No. 2972), Phospho-mTOR(Ser2481) antibody (catalog No. 2974), Akt antibody (catalog No. 9272), Phospho-Akt(Ser473) antibody (catalog No. 4060), 4E-BP1(53H11) rabbit antibody (catalog No. 9644), Phospho-4E-BP1(Thr37 / 46)(236B4) rabbit antibody (catalog No. 2855), S6 ribosomal protein (54D2) mouse antibody (catalog No. 2317), and Phospho-S6 ribosomal protein(Ser235 / 236)(D57.2.2E) rabbit antibody (catalog No. 4858) from Cell Signaling Technology Inc. (Danvers, Massachusetts, USA). I purchased VCP antibodies (catalog no. GTX113030) from Gene Tex Inc. (Irvine, California, USA).

[0024] The secondary antibodies are as follows: Goat anti-rabbit IgG H&L (Alexa Fluor® 488) (Catalog No. ab150077, Abcam, Cambridge, UK), horseradish peroxidase (HRP) conjugated anti-rabbit IgG (Catalog No. 10004301, Cayman); and Dako Envision+ dual Link System-HRP (Catalog No. K4061, Agilent Technologies Inc., Santa Clara, California, USA). Polymerase chain reaction (PCR) primers were purchased from FASMAC Co. Ltd. (Kanagawa, Japan). Hoechst 33258 solution (Catalog No. 19173-41, Nacalai Tesque Inc., Kyoto, Japan) was used for nuclear staining.

[0025] Between 2019 and 2022, tumor tissue or urine samples from dogs were collected from animal clinics in Japan. In this study, written consent was obtained from all dog owners, and the research was conducted with the approval of the Animal Experimentation Committee of Tokyo University of Agriculture and Technology. Samples were transported in cooled transport media. 2.5-dimensional (2.5D) tumor organoids or normal organoids were generated, subcultured, and processed according to the methods described in previous studies.

[0026] Quantitative real-time reverse-phase polymerase chain reaction assay Total RNA (tRNA) was extracted from 2.5D organoids using the FavorPrep Tissue Total RNA Mini Kit (FAVORGEN, Pingtung, Taiwan) according to the manufacturer's guidelines. The extracted tRNA was reverse transcribed using ReverTra Ace™ qPCR RT Master Mix (TOYOBO co., LTD., Osaka, Japan) to generate complementary DNA (cDNA). Quantitative real-time PCR was performed using the QuantiTect SYBR I Kit (QIAGEN NV, Venlo, Netherlands) and StepOne. TM The procedure was performed using a real-time PCR system (Applied Biosystems, Waltham, Massachusetts, USA). GAPDH was used as an endogenous control to quantify the data using ΔΔC. q The method was adopted. The specific canine LAT1 primers used in this example are as follows: Forward: GCTGTGGACTTTGGGACCTA (Sequence ID 1) Reversed: CTGGAGAAGGCGTAAAGCAG (Sequence ID 2)

[0027] Immunofluorescence staining of cBC 2.5D organoids was performed according to the method described above. In short, 2.5D cBC organoids (2 × 10⁻¹⁴) 5Cells were seeded in a 6-well plate with coverslips. After reaching 70% convergence, the cells were fixed in 4% paraformaldehyde (PFA) solution at room temperature for 30 minutes. After washing with PBS, the cells were blocked with 1.5% normal goat serum at room temperature for 30 minutes. Subsequently, the cells were treated with SLC7A5(LAT1) antibody at room temperature for 120 minutes. Then, the cells were treated with the secondary antibody, goat anti-rabbit IgG H&L, and the nuclear stain, Hoechst 33258, following a PBS washing process. After a 1-hour reaction at room temperature, expression was observed under darkroom conditions using a microscope (BX52-DP72, OLYMPUS, Tokyo, Japan).

[0028] The expression and phosphorylation levels of LAT1 and related signaling pathway proteins were analyzed by Western blotting according to standard guidelines. Proteins from each cell were extracted using CelLytic™ M (SIGMA-ALDRICH, Missouri, USA). Equal amounts of protein (5-10 μg) were loaded onto a sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE; Mini-PROTEAN TGX Gels, BIO-RAD, Laboratories, Inc., USA), separated, and then transported to a PVDF membrane (Clear Blot P+ membrane, ATTO Corporation, Tokyo, Japan). After blocking the proteins with skim milk, the membranes were incubated overnight at 4°C with the main antibody (SLC7A5, mTOR, p-mTOR, Akt, p-Akt, 4E-BP1, p-4E-BP1, S6 Rib, p-S6 Rib, VCP). After washing, the samples were treated with a secondary antibody (HRP-conjugated anti-rabbit IgG) at room temperature for 1 hour. Images were acquired using a LAS-3000 image analyzer (Fujifilm, Tokyo, Japan), and VCP was quantified using ImageJ software as a protein control.

[0029] The amino acid transport activity of cBC organoids was quantified using an amino acid uptake assay, following the manufacturer's guidelines. In short, 3 × 10⁶ cBC organoids were placed in a 24-well plate.4 The cells were seeded at a density and incubated overnight. The cells were washed three times with 0.1% glucose / PBS solution, and then treated with JPH203 or DMSO (control group) at 37°C for 5 minutes. After removing the solution, the organoids were nourished with a boronophenylalanine (BPA) solution containing JPH203 or DMSO, and incubated for a further 5 minutes at 37°C. They were then washed three times with 0.1% glucose / PBS solution, and a fluorescent probe solution was added. Images were acquired using a fluorescence microscope (BZ-9000; KEYENCE, Tokyo, Japan) and quantified using ImageJ software.

[0030] The experiment was approved by the Ethics Committee of Tokyo University of Agriculture and Technology, in accordance with the recommendations of the "Guidelines for the Care and Use of Laboratory Animals." Male SCID (CB-17 / IcrHsd-Prkdcscid, Japan SLC, Shizuoka, Japan) mice were obtained from Japan SLC Inc. (Shizuoka, Japan). A mouse xenograft model of 2.5D cBC organoids was performed according to the method described above. Briefly, 1 × 10⁻⁶ 6 The organoid was subcutaneously injected into the right flank of mice. After transplantation, the longest and shortest diameters of the tumor were measured using a vernier scale, and the tumor volume was calculated as V = 1 / 2 (L × W). 2 The size was estimated using the following formula: where L is the longest diameter (length) and W is the shortest diameter (width). The average tumor volume is approximately 100 mm². 3 After reaching [a certain stage] (day 1), the mice were divided into two groups (n=10) and administered JPH203 intraperitoneally at a dose of 50 mg / kg five times a week. Tumor volume and body weight were measured twice a week. After the third cycle of JPH203 treatment, the mice were anesthetized with isoflurane and the tumors were dissected. The weight of the tumors was measured, and then the tumor tissue was embedded overnight in 4% PFA for paraffin embedding. Alternatively, the tumor tissue was stored at -20°C for protein extraction. The paraffin-embedded tissues were further prepared for H&E staining and immunohistochemistry.

[0031] H&E staining of xenografted tumor fragments was performed according to a standard procedure using paraffin-embedded tissue, and images were acquired using a light microscope (BX43; Olympus, Tokyo, Japan). Immunohistochemical staining was performed. After deparaffinization of the tumor tissue fragments, antigen recovery was performed with citrate buffer at 121°C for 5 minutes, and endogenous peroxidase activity was stopped with 1% peroxidase at room temperature for 30 minutes. Subsequently, the fragments were blocked with 10% normal goat serum for 30 minutes, stained with the primary antibody, and stored overnight at 4°C. After washing, the fragments were processed using the Dako Envision+ dual Link System-HRP according to the manufacturing procedure. Images were acquired using a light microscope and quantified using ImageJ software.

[0032] Data are presented as mean ± mean error (SEM). Statistical evaluation was performed using Student's t-test following one-way analysis of variance (ANOVA). Sigma Plot 14.0 (Systat Software, Inc., Palo Alto, California, USA) was used for statistical analysis. A p-value of 0.05 or less is considered statistically significant.

[0033] LAT1 gene expression was evaluated using comparative CT in patient-derived 2.5D canine tumor organoids, including those from mammary gland tumors (MT), hepatocellular carcinoma (HCC), renal tumors (KT), melanoma (ML), and bladder cancer (BC). Significantly higher LAT1 expression was observed in canine BC (cBC) organoids compared to other tumor organoids (Figure 1A). Compared to normal bladder (NB) organoids, cBC also showed significantly higher LAT1 gene expression and LAT1 protein expression (Figures 1B, C). Intracellular LAT1 expression was consistently detected in cBC organoids by immunofluorescence (Figure 1D). The percentage of LAT1-positive cells was 53.6% in cBC1 organoids and 36.8% in cBC2 organoids.

[0034] Figure 1 is a graph instead of a diagram showing LAT1 expression in canine cells. (A) and (B) mRNA expression was evaluated by real-time PCR (n=5 for cBC and NB, n=3 for others). Relative quantification was normalized by GAPDH. Abbreviations: MT, mammary tumor; HCC, hepatocellular carcinoma; KT, renal tumor; ML, melanoma; BC, bladder cancer; NB, normal bladder. Protein expression was evaluated by (C) Western blotting and (D) immunofluorescence staining. VCP was used as a protein loading control.

[0035] The effects of the LAT1 inhibitor JPH203 on amino acid uptake capacity and cell viability were investigated in patient-derived 2.5D cBC organoids. Based on the results of an amino acid uptake assay kit, JPH203 treatment significantly suppressed amino acid uptake capacity in cBC organoids compared to DMSO treatment (Figure 2A). Cell viability suppression by JPH203 was evaluated after 72 hours of treatment in cBC1 organoids with high LAT1 expression and cBC2 organoids with low LAT1 expression. As shown in Figure 2B, both cBC1 and cBC2 showed dose-dependent cell suppression by JPH203 treatment. Of the two lines of cBC organoids, cBC1 was more sensitive to JPH203 treatment. In contrast, cBC2 organoids tended to be resistant to JPH203.

[0036] Figure 2. (A) Inhibition of amino acid transporters in bladder cancer cells was detected by an amino acid uptake assay. Fluorescence was detected depending on whether BC1 cells were cultured with an amino acid analog (voronophenylalanine) and a membrane-permeable fluorescent probe, followed by treatment with JPH203. Quantification of fluorescence intensity was normalized by the number of cells in each image (n=3). (B) Cell viability of bladder cancer cells 72 hours after administration of three different doses (0.3, 3, 30 μM) of JPH203 (no treatment) compared to no treatment (0).

[0037] The effect of JPH203 on the mTOR signaling pathway in cBC1 organoids was investigated (Figure 3). mTOR phosphorylation decreased 3 hours after JPH203 treatment, and phosphorylation of ribosomal proteins S6 and Akt decreased 1 hour after treatment, with this decrease continuing up to 24 hours post-treatment. 4E-BP1 phosphorylation decreased 3 hours after JPH203 treatment but recovered to initial levels by 24 hours post-treatment. Overall protein levels of ribosomal proteins S6, 4E-BP1, Akt, and mTOR remained largely unchanged.

[0038] Figure 3. (A) and (B) Phosphorylation of proteins involved in amino acid-dependent translational regulation was identified in bladder cancer cells after JPH203 treatment by Western blotting. VCP was used as a control for protein loading. (C) Schematic diagram of the PI3K / Akt / mTOR signaling pathway and the mechanism of JPH203 treatment.

[0039] The antitumor activity of JPH203 was investigated in cBC organoids transplanted into immunodeficient mice (n=10 per group). JPH203 was administered intraperitoneally at a dose of 50 mg / kg five times per week. Tumor growth was suppressed by JPH203 12 days after administration, and a significant reduction in mean tumor size was observed on day 19 compared to control mice (Figure 4A). After the third cycle of JPH203 administration, the mice were sacrificed and the tumors were collected for further experiments. As shown in Figures 4B and 4C, the mean tumor weight was significantly reduced after JPH203 treatment, although some tumors showed a reduced response to JPH203 treatment. A 10% weight change, considered an indicator of toxicity compared to control animals, was observed on day 15 after administration in JPH203-treated mice, and two mice died on day 18.

[0040] Furthermore, LAT1 expression was investigated in xenografted cBC tumors treated with JPH203 by Western blotting and immunohistochemistry. As shown in Figures 4D and 4E, LAT1 protein expression was significantly reduced after JPH203 treatment compared to the control group, indicating a change in LAT1 expression after LAT1-targeted therapy. Next, the regulation of mTOR phosphorylation in xenografted cBC tumors was also evaluated. Phosphate-mTOR protein expression was lower in JPH203-treated tumor tissue, but no significant changes were observed in mTOR expression (Figure 5A). In addition, the TUNEL assay was performed on xenografted tumor tissue to evaluate apoptotic cells after JPH203 treatment. As shown in Figure 5B, some apoptotic cells were observed in JPH203-treated tumor tissue, while almost none were observed in the control group.

[0041] Figure 4. Suppression of tumor growth by JPH203 in immunodeficient mice with canine bladder tumors. (A) Tumor size was measured twice a week for 19 days. (B) Mean tumor weight and (C) Photographs of tumors evaluated from mice sacrificed on day 19 after JPH203 treatment. LAT1 expression in tumor tissue collected from mice sacrificed on day 19 after JPH203 treatment was investigated by (D) Western blotting and (E) immunohistochemistry. VCP was used as a control for protein loading.

[0042] Figure 5. Immunohistochemical staining (IHC) of mTOR and phosphate-mTOR in tumor tissue collected from mice sacrificially treated with JPH203 on day 19. IHC intensity was normalized by the number of cells in each image (n=5). (B) TUNEL staining in tumor tissue collected from mice sacrificially treated with JPH203 on day 19. [Examples]

[0043] LAT1 mRNA expression in 2.5D organoids of cancer tissue from various canines. <Materials and Methods> 1. Material The following is the composition of the 2.5D organoid culture medium (the name of the reagent manufacturer is indicated in parentheses): Dulbecco's Modified Eagle Medium (DMEM) / F12 (Thermo Fisher). Scientific Inc. (Waltham, Massachusetts, USA) 1% GlutaMax (Thermo Fisher Scientific Inc.), 10 mM 4-(2-hydroxyethyl)-1-piperazine ethanesulfonic acid (HEPES; WAKO, Osaka, Japan), 1 mM N-acetyl-L-cysteine ​​(Sigma-Aldrich), 10 mM nicotinamide (Sigma-Aldrich, St. Lewis, Missouri, USA), 0.5 μM A83-01 (Adooq Bioscience, Irvine, California, USA), 50 ng / ml epidermal growth factor (EGF) (Thermo Fisher Scientific Inc.), 1% penicillin-streptomycin (PS; WAKO), and 5% fetal bovine serum (FBS; Thermo Fisher Scientific Inc.).

[0044] 2. Creation of 2.5D Organoids Tissue samples from melanoma, mammary gland tumors, kidney cancer, hepatocellular carcinoma, and lung cancer, surgically removed from dogs with cancer, were processed as follows to create 2.5D organoids. Each solid tumor tissue was aseptically shredded in a 6 cm petri dish on ice using microsurgical scissors and washed with sterile phosphate-buffered saline (PBS). The shredded tissue was placed in pre-warmed (37 °C) DMEM medium (LiberaseTH, Roche Diagnostics, Germany) containing both type I and type II collagenase at 0.125 mg / ml, and the tubes were incubated in a shaking water bath at 37 °C for 30 minutes. Subsequently, the cells were treated with trypsin TrypLE Express solution (Thermo Fisher Scientific Inc.) at 37 °C for 5 minutes. The cells were then filtered through 70 μM nylon cells. The cell pellets were cultured in 2.5D organoid medium (standard DMEM containing 10% FBS and 1% FBS).

[0045] 3. Passaging of 2.5D organoids After reaching 70-80% confluence, the cells were subcultured into new dishes. New 6 cm dishes were used in a 1:3-4 ratio. 1 ml of 5 mM ethylenediaminetetraacetic acid (EDTA) / PBS was transferred to a 6 cm dish and placed in a 37 °C CO2 incubator for 10 minutes. After detaching the cells, the solution was collected in a 15 ml tube. Subsequently, 1 ml of TrypLE was added, and the cells were isolated by heating at 37 °C for 3-5 minutes. The collected cell pellet was: The mixture was combined with 2.5D organoid medium and transferred to a new 6cm dish for use in the next experiment.

[0046] 4. Quantitative real-time reverse-phase polymerase chain reaction assay Total RNA (tRNA) was extracted from 2.5D organoids using the FavorPrep Tissue Total RNA Mini Kit (FAVORGEN, Pingtung, Taiwan) according to the manufacturer's guidelines. The extracted tRNA was reverse transcribed using ReverTra Ace™ qPCR RT Master Mix (TOYOBO Co., LTD., Osaka, Japan) to generate cDNA. Quantitative PCR was performed using the QuantiTect SYBR I Kit (QIAGEN NV, Venlo, Netherlands) and the StepOne™ Real-Time PCR System (Applied Biosystems, Waltham, Massachusetts, USA). The ΔΔC_q method was employed to quantify data using GAPDH as an endogenous control. The specific canine LAT1 primers used in this example are as follows: Forward: GCTGTGGACTTTGGGACCTA (Sequence ID 1) Reversed: CTGGAGAAGGCGTAAAGCAG (Sequence ID 2)

[0047] <Explanation of Results> Figure 6 shows the expression of the LAT1 gene in five types of cancer organoids. Melanoma organoids were prepared from the cancer tissue of two different dogs, while organoids for breast cancer, oral cancer, kidney cancer, and hepatocellular carcinoma were prepared from the cancer tissue of one dog each, using the method described above. LAT1 expression was observed in all five types of cancer. The vertical axis represents the ratio of the expression levels of glyceralaldehyde-3-phosphate dehydrogenase (GAPDH), found in surviving tissue as one of the negative targets included in the same sample, to the PCR measurement results of cancer-specific LAT1 gene. Differences between cancer types and individuals were quantified. The measured LAT1 expression was observed. In other words, similar to human cancers, LAT1 expression was found in all canine cancers, although there were differences depending on the cancer type and individual of the sample collected. [Examples]

[0048] The effect of JPH203 on cell viability in canine liver cancer and lung cancer. <Creation and Passaging of 2.5D Organoids> These methods are the same as those in Example 1 above, and the experimental method for determining sensitivity to JPH203 is the same as in the example demonstrating the efficacy of JPH203 against bladder cancer organoids. <Explanation of Results> Figure 7 is a graph that replaces the diagram showing cell survival rates in canine liver cancer and lung cancer. The results for bladder cancer organoids were qualitatively similar to those for bladder cancer, showing a concentration-dependent decrease in the survival rate of each cell type after 72 hours with JPH203 (i.e., an increase in drug efficacy). Hepatocellular carcinoma showed a slightly stronger tendency towards drug efficacy in the 30 μM group than in lung cancer.

[0049] The usefulness of JPH203 can be confirmed by demonstrating its efficacy in other types of cancer in dogs. Furthermore, the therapeutic effect of JPH203 on cancers in non-human mammals other than dogs can be demonstrated using cancer cells from various animal species. In addition, its effectiveness can be confirmed by administering a drug containing JPH203 to target species actually suffering from cancer. Since the mechanisms of action generally differ between humans and animals, its effectiveness can be confirmed by conducting actual experiments. As described in Example 4, an attempt was made to expand the range of animal species to which the efficacy of JPH203 could be applied by administering a drug containing JPH203 to feline mammary gland tumors. [Examples]

[0050] The effect of JPH203 on the survival rate of various cancer cells in feline mammary gland tumors, canine melanoma, and canine angiosarcoma. <Creation and Passaging of 2.5D Organoids> These methods are the same as in Example 1 above, and the experimental method for sensitivity to JPH203 is the same as in the example demonstrating the efficacy of JPH203 on bladder cancer organoids. However, an attempt was made to compare the concentrations of JPH203 in dogs and cats under the same conditions.

[0051] <Explanation of Results> Figure 8 is a graph that replaces a diagram showing the tumor cell survival rate in feline mammary gland tumors, canine melanoma, and canine angiosarcoma, and the table in the figure is a table that replaces a diagram showing the cell survival rate of cancer in each animal species. In Example 4, cancerous tissue was excised from cats and dogs that had developed feline mammary gland tumors, canine melanoma, and canine angiosarcoma, and 2.5D cancer organoids were created from these cancerous tissues. These cancer organoids were cultured for 72 hours with 1, 3, 10, and 30 μM JPH203 added, and the survival rate of cancer cells, which is an indicator of anticancer activity, was measured. The top three examples in Figure 8 show the results for mammary gland tumors in different cats. Similarly, the middle section shows the results for malignant melanoma in dogs, and the bottom section shows the results for canine angiosarcoma. The vertical axis of each graph shows the survival rate of each cell, and differences are observed between individual cats and dogs. The table in the figure shows the survival rate of cancer cells, expressed as a percentage with the value before JPH203 administration set to 100. As is clear from the graphs and tables, although there were differences among patients, the survival rate of cancer cells was lower than 100% in all cases. In other words, an anti-cancer effect was observed without exception. The significance of this result as an anti-cancer effect lies in the fact that repeated administrations of the drug lead to a power-up effect as the anti-cancer effect increases with each subsequent administration. This will be discussed in the "Discussion" section below. [Consideration]

[0052] <Background of this patent application; Is it possible to predict the onset of cancer?> Let's consider the changing times regarding the disclosure of cancer diagnoses in humans. In the last century, it was common practice not to tell patients the name of their cancer. The reason was simple: because cancer was a disease that could kill patients in a short time, the patient was often told that their diagnosis was "cancer," and instead, in the case of stomach cancer, they were told it was a stomach ulcer, giving them a less serious diagnosis. In other words, it was a consideration to alleviate the seriousness of the diagnosis for the patient and prevent them from falling into extreme despair. In this century, it has become common practice to inform cancer patients of their actual diagnosis. While the diversification of cancer treatment methods is one reason, another is that it allows patients to become aware of their impending death and to control and respect their own right to life. Although cancer treatments have advanced and there are now more cases where they actually contribute to extending life, the fact remains that the possibility of death remains unchanged. Since cancer still threatens the extension of life, disclosing a cancer diagnosis has now become a standard practice. However, predicting the incidence of cancer remains difficult.

[0053] <Non-human animals and prediction of cancer development> Currently, various animals have become an indispensable part of human life, such as pets. Like humans, these animals are also experiencing increased lifespans and a rise in diseases associated with aging. Among these, cancer, which is extremely difficult to treat, is considered a serious disease, similar to that seen in humans. Currently, it is estimated that there are approximately 9 million cats and 6 million dogs kept as pets in Japan. Furthermore, it is said that cancer accounts for about half of dog deaths, a considerably high rate, similar to that of humans.

[0054] <Types of cancer and disease names> Cancers are classified into solid cancers, which are characterized by a visible mass, and non-solid cancers, which do not present as a mass. On the other hand, many different types of cancer are named by adding "cancer" to the name of the organ, tissue, or system in which the cancer is found, such as stomach cancer, liver cancer, skin cancer, etc. Based on observations over a certain period, cancers can also be classified as benign or malignant. Based on the judgment of physicians, veterinarians, and dentists, and the results of examinations, the stage of cancer progression may be expressed as grades I to IV. More importantly, it is necessary to understand that while there are similarities among cancers with the same name, there are a wide range of differences and they cannot be considered identical. In other words, when viewed from individual to individual, there is no uniform pathology; there are as many types as there are patients, and it is crucial to keep in mind that there are significant individual differences.

[0055] <Regarding gene polymorphisms of molecules that cause cancer> The gene sequences that express cancer-causing target molecules differ significantly between humans and non-human mammals. Furthermore, it is known that even within humans (abbreviated as h), the gene sequences encoding cancer-causing target molecules differ depending on race (genetic polymorphisms exist). In non-human mammals such as dogs (abbreviated as c) and cats (abbreviated as f), the differences in genetic polymorphisms between phylogenetic trees in biological development are thought to be even greater than those between human races. Because the gene sequences of cancer-causing target molecules and the amino acid sequences of the various target molecules expressed differ significantly between humans and non-human mammals, there are cases where anticancer drugs that are effective in humans are ineffective in cancers of non-human mammals. As mentioned above, just as there are racial differences among humans, there are many different breeds of dogs and cats, so further detailed research is desired.

[0056] <About this invention> Despite the fact that the amino acid sequences of LAT1 differ between humans (human LAT1; hLAT1), dogs (canine LAT1; cLAT1), and cats (feline LAT1; fLAT1) (with only about 80-90% homology), it has not yet been thoroughly demonstrated whether JPH203 binds to canine cLAT1 and inhibits its function. Furthermore, the amino acid sequence of fLAT1 in cats also differs from that of humans and dogs. Therefore, just because JPH203 inhibits hLAT1 in human cancer does not mean that it will be effective in canine or feline cancer.

[0057] Since drugs are foreign substances to the body, there is a mechanism to excrete them from the body. This process is called pharmacokinetics and consists of four steps: drug absorption, distribution, metabolism, and excretion. Metabolism is extremely important, and the differences between humans and non-humans, as well as its significance, will be explained below. One of the important factors related to evaluating the anticancer effect of this drug is the enzyme that metabolizes it. This drug is known to lose its efficacy in the body when it is catalyzed and metabolized by N-acetyltransferase. What is important here is that there are significant species differences in the enzymatic activity of this drug between humans, dogs, and cats. Specifically, the human liver mainly contains NAT2 (N-acetyltransferase 2), a metabolic enzyme that metabolizes this drug and reduces its effect. In contrast, dogs have a nearly complete genetic deficiency of this enzyme. Cats also have a similar deficiency, although the degree of deficiency is weaker than in dogs ((Veterinary Toxicology <Second Edition> Edited by the Japanese Society of Comparative Pharmacology and Toxicology, Hiroki Teraoka, Mayumi Ishizuka, Koichi Sato, Kazuichi Nakamura, Kindai Shuppan Co., Ltd., March 1, 2022)). These differences suggest that JPH203 is metabolized by NAT2 in the human body, meaning it is present in the body for a shorter time than in dogs and cats. Therefore, it is presumed that the duration of JPH203's efficacy in dogs and cats is longer, and that its effects are stronger and longer-lasting than in humans.

[0058] Next, based on the data presented, the following points can be made regarding the anti-cancer effects of this drug. The results in Figure 8 suggest that there are significant differences in the anti-cancer effects between humans and non-humans (dogs and cats). 1) When 2.5D organoids prepared from the cancerous tissues of three cats with mammary gland cancer (mammary gland tumors), three dogs with melanoma, and three dogs with angiosarcoma were treated with JPH203 at concentrations of 1, 3, 10, and 30 μM for 72 hours, the survival rate of cancer cells decreased in all cases (confirmation of anticancer effect). 2) On the other hand, although data is not shown, in the case of human cancer, it is rare for the effects of anticancer drugs to be observed in all 9 cancer patients with the same disease name. Therefore, in the comparison of effects between humans and these animals, the observation of a common trend in anticancer effects in dogs and cats, as described in 1) above, is in contrast to that in humans. From a comparison of these data, it can be inferred that LAT1 expressed in tumor cells of dogs and cats has some degree of common sensitivity to JPH203. 3) Next, let's consider what happens when this drug is administered to living organisms. In typical clinical practice, it is expected that the drug will be administered multiple times to both non-human and human cancer patients. That is, as seen in the data, the anti-cancer effect of the first administration was lower in all cases than the survival rate of cancer cells that were not treated with anti-cancer drugs (100%). It is estimated that repeating this procedure several times will result in a power-up decrease in the survival rate of cancer cells. In other words, the anti-cancer effect of JPH203 in dogs and cats is considered to be stable and far higher than its effect in humans.

[0059] <Summary of Results> 1. The sensitivity (effect) of LAT1 to this drug was found to be almost identical in dogs and cats, albeit to varying degrees. This result was in stark contrast to that observed in humans. 2. Significant differences in the metabolic enzyme activity of this drug were found between humans, dogs, and cats, and it was discovered that dogs and cats are genetically deficient in this enzyme. From this, it was inferred that the residence time of this drug in the body is extended compared to humans, and consequently, a longer duration of its therapeutic effect is possible. [Industrial applicability]

[0060] This invention can be favorably utilized in the field of veterinary medicine.

Claims

[Claim 1] A therapeutic agent for canine bladder cancer containing O-(5-amino-2-phenylbenzoxazole-7-yl)methyl-3,5-dichloro-L-tyrosine or a pharmaceutically acceptable salt thereof as an active ingredient.

Images