Wheat receptor-like protein kinase TaMLR1 and its use

Abstract

This invention provides a method for breeding disease-resistant wheat varieties. [Solution] The wheat receptor-like protein kinase TaMLR1 provided by this application has a specific amino acid sequence, and the open reading frame (ORF) sequence encoding the wheat receptor-like protein kinase TaMLR1 is described in a specific nucleic acid sequence. In this disclosure, gene editing is performed on wild-type material Fielder to obtain TaMLR1 gene-edited mutant plants exhibiting resistance to wheat yellow rust, powdery mildew, and Fusarium head blight. This disclosure provides a novel technical approach for breeding disease-resistant varieties, confirms the negative regulatory role of this gene in wheat disease resistance, and provides a novel genetic resource for broad-spectrum disease-resistant breeding of wheat.

Description

Technical Field

[0001] The present disclosure belongs to the technical field of biotechnology and relates to the wheat receptor-like protein kinase TaMLR1 and its use.

Background Art

[0002] Reference to Sequence Listing A computer-readable XML file named "GWP20241208067_seqlist" created on January 10, 2025, with a file size of approximately 16,805 bytes contains the sequence listing for this application, is submitted together with this application, and the whole is incorporated herein by reference.

[0003] Wheat (Triticum aestivum) is one of the most widely planted and high-yielding grains in the world, and according to statistics, it supports 30 - 45% of the world's population. However, wheat production is severely threatened by three major fungal diseases, namely wheat stripe rust, powdery mildew, and fusarium head blight (FHB), which occur in almost all major wheat-growing regions of the world. Specifically, wheat stripe rust is caused by Puccinia striiformis f. sp. tritici, powdery mildew is caused by Blumeria graminis f. sp. tritici, and FHB is caused by Fusarium spp. The pathogenicity of these pathogens often varies, so frequent epidemics of these diseases and the gradual overcoming of resistance in existing varieties occur. Therefore, the rational use of resistance genes to create disease-resistant materials is the most economical and effective sustainable development strategy for the control of wheat stripe rust, powdery mildew, and FHB.

[0004] Receptor-like protein kinases (RLKs) are a large group of transmembrane proteins in plants that play a crucial role in cell-to-cell and cell-to-environment communication. RLKs are a group of single-pass transmembrane proteins located in the cell membrane, consisting of an extracellular receptor domain that senses external signals, a transmembrane domain, and an intracellular kinase domain. In a typical RLK signaling pathway, the extracellular receptor domain first senses and recognizes an external signal, transmitting it to one side of the cytoplasm. The cytoplasmic kinase domain then interacts with downstream proteins to initiate biochemical reactions (e.g., phosphorylation). Finally, the signal is transmitted to the nucleus via a nuclear-cytoplasmic shuttle messenger, regulating the expression of downstream genes for signal output and thus enabling adaptation to rapid environmental changes.

[0005] Currently, the primary and dominant method for controlling wheat yellow rust, powdery mildew, and FHB in wheat is chemical control, but the environmental and food safety risks associated with the use of chemical pesticides are a widespread concern. Breeding for disease resistance is one of the most economical and effective means of controlling these diseases. However, achieving long-term control of these diseases is difficult due to the long discovery cycle of resistance genes, the difficulty of breeding disease-resistant varieties, and the rapid virulence variation of pathogens. Editing of susceptibility genes is a novel approach to enabling plants to acquire disease resistance in the context of disease resistance breeding. [Overview of the project]

[0006] The object of the embodiments of this disclosure is to solve the problems of reproductive isolation and cross incompatibility in conventional breeding for disease resistance. This problem makes it difficult to achieve directional improvement of the desired trait in a shorter growing period, and also presents several difficulties in sustained control of wheat yellow rust under current technological conditions due to the rapid mutation of the pathogenicity of the wheat yellow rust fungus.

[0007] Based on the aforementioned objectives, this disclosure provides the wheat receptor-like protein kinase TaMLR1 and its use to satisfy this need in the art. Embodiments of this disclosure aim to further explore the innate immune defense mechanisms of wheat and to extract susceptibility genes from wheat invaded by pathogens such as wheat yellow rust, powdery mildew, and Fusarium head blight (Gibberella zeae). Through functional studies, some embodiments of this disclosure seek to provide a novel avenue for creating disease-resistant wheat material for the control of wheat yellow rust using susceptibility genes.

[0008] In one embodiment, this disclosure relates to wheat receptor-like protein kinase TaMLR1. Wheat receptor-like protein kinase TaMLR1 has the amino acid sequence of SEQ ID NO: 1. The sequence of the open reading frame (ORF) encoding wheat receptor-like protein kinase TaMLR1 is described in SEQ ID NO: 2.

[0009] In another embodiment, this disclosure relates to the use of wheat receptor-like protein kinase TaMLR1 in the breeding of disease-resistant wheat varieties.

[0010] In some embodiments, in the uses provided by this disclosure, the ORF sequence encoding wheat receptor-like protein kinase TaMLR1 is expressed by Agrobacterium-mediated gene transformation and negatively regulates the interaction between wheat and wheat yellow rust fungus. Furthermore, editing of wheat receptor-like protein kinase TaMLR1 can enhance the resistance of wheat to wheat yellow rust, powdery mildew, and FHB.

[0011] In yet another embodiment, the present disclosure relates to a method for breeding disease-resistant wheat varieties, comprising the steps of expressing wheat receptor-like protein kinase TaMLR1 in a plant or transforming a plant with an ORF sequence encoding wheat receptor-like protein kinase TaMLR1.

[0012] In some embodiments, a method for breeding disease-resistant wheat varieties provided by the present disclosure includes the step of transforming plant cells with an ORF sequence encoding wheat receptor-like protein kinase TaMLR1 to obtain a plant variety having genetically edited wheat receptor-like protein kinase TaMLR1.

[0013] In some embodiments, a method for breeding disease-resistant wheat varieties provided by this disclosure includes the steps of constructing an edited vector containing an ORF sequence encoding wheat receptor-like protein kinase TaMLR1, and transforming immature plant embryos using an Agrobacterium-mediated gene transformation method to obtain a plant variety having genetically edited wheat receptor-like protein kinase TaMLR1.

[0014] In some embodiments, in a method for breeding disease-resistant wheat varieties provided by the present disclosure, the plant is a monocotyledonous plant, the monocotyledonous plant is a cereal, and the cereal is wheat.

[0015] In some embodiments, the wheat strains in the method for breeding disease-resistant wheat varieties provided by this disclosure include a fielder.

[0016] Compared to the prior art, the embodiments of this disclosure have the following beneficial effects or advantages.

[0017] (1) Compared to conventional techniques for breeding disease resistance, genetic engineering techniques for plant disease resistance provide breakthroughs in interspecific reproductive isolation and cross-incompatibility, enabling directional improvement of target traits in a relatively short period, thereby providing more comprehensive, sustained, and broad-spectrum protection for crops. This disclosure, through genetic function studies, has found that the wheat receptor-like protein kinase TaMLR1 plays a negative role in regulating defense responses to wheat yellow rust, powdery mildew, and Fusarium head blight. Gene editing of the wheat receptor-like protein kinase TaMLR1 is shown to significantly enhance wheat resistance to these pathogens and provide a novel idea for breeding broad-spectrum disease-resistant materials.

[0018] (2) This disclosure provides a method for breeding broad-spectrum disease-resistant wheat varieties. This method includes gene editing techniques for knocking out the wheat receptor-like protein kinase TaMLR1 in wheat plants to enhance the resistance of wheat to wheat rust, powdery mildew, and Fusarium head blight. Transgenic wheat obtained by the method of this disclosure has been confirmed to exhibit resistance to major prevalent microspecies of wheat rust. This disclosure provides a novel technological concept for breeding disease-resistant wheat varieties from a molecular biology perspective and effectively solves the technological challenges of this disclosure. [Brief explanation of the drawing]

[0019] [Figure 1]Figure 1 schematically shows the phenotypic results of wheat with genetically edited wheat receptor-like protein kinase TaMLR1 after inoculation with wheat yellow rust fungus, powdery mildew fungus, and Fusarium head blight fungus. The incidence was observed in TaMLR1 gene-edited wheat (TaMLR1-KO) inoculated with wheat yellow rust fungus, powdery mildew fungus, and Fusarium head blight fungus. TaMLR1-KO is TaMLR1 gene-edited wheat, Fielder is a wild-type wheat variety, and CYR31, CYR33, and CYR34 are wheat yellow rust fungus strains that show compatibility interactions with Fielder.

[0020] [Figure 2] Figure 2 shows a gene editing vector for the wheat receptor-like protein kinase TaMLR1. Target1 and Target2 are two sgRNA target sites in the TaMLR1 gene, TaU6 is a promoter that drives the expression of Target1 and Target2, Cas9 is a core component of the gene editing system that encodes the Cas9 protein, and zmUbi is a maize ubiquinone promoter that initiates Cas9 expression.

[0021] [Figure 3] Figure 3 schematically shows the results of polymerase chain reaction (PCR) of TaMLR1 gene-edited wheat. Transgenic plants were detected using Blb-F / R primers, and PCR products were detected by 1% agarose gel electrophoresis. M is a DNA marker, and L1-8 are different TaMLR1 gene-edited strains.

[0022] [Figure 4] Figure 4 schematically shows the detection results for TaMLR1 gene editing. In Fielder and TaMLR1 gene editing materials, the TaMLR1 gene sequence (SEQ ID NOs. 3-4) was amplified by PCR, followed by sequencing and alignment. [Modes for carrying out the invention]

[0023] The technical solutions of the present disclosure will be described in detail below in connection with examples, but the present disclosure is not limited thereto.

[0024] To enable those skilled in the art to better understand the technical solutions of the present disclosure, the present disclosure will be further described in detail below with reference to specific examples and the accompanying drawings. However, the cited examples are not intended to limit the present disclosure.

[0025] The experimental and detection methods described in the following examples are conventional methods unless otherwise specified, and the reagents and materials are commercially available unless otherwise specified.

[0026] Example

[0027] Examples of the present disclosure provided for the use of wheat receptor-like protein kinase TaMLR1 in the development of rust-resistant wheat varieties.

[0028] Using plant gene editing technology, the wheat receptor-like protein kinase TaMLR1 gene was transformed into wheat cells to obtain a wheat variety with gene-edited TaMLR1.

[0029] The use of wheat receptor-like protein kinase TaMLR1 in the breeding and improvement of disease-resistant wheat varieties provided by the examples of the present disclosure further included the steps of constructing an editing vector containing the wheat receptor-like protein kinase TaMLR1 gene, and transforming immature embryos of wheat by the Agrobacterium-mediated gene transformation method to obtain TaMLR1 gene-edited wheat.

[0030] As shown in Figure 1, the method for verifying the use of wheat receptor-like protein kinase TaMLR1 in the breeding and improvement of wheat varieties with broad-spectrum disease resistance provided by the examples of the present disclosure was carried out as follows.

[0031] In step S101, wheat with the TaMLR1 gene edited was obtained, and molecular detection was performed on the resulting TaMLR1 gene-edited wheat.

[0032] In step S102, T1 generation gene-edited plants were inoculated with wheat yellow rust fungus, powdery mildew fungus, and wheat red mold fungus to identify the resistance of the gene-edited plants.

[0033] The functional identification method provided by the embodiments of this disclosure was as follows:

[0034] The TaMLR1 gene was edited using CRISPR / Cas9 gene editing technology. After inoculating the gene-edited plants with the wheat yellow rust fungus species CYR23, their phenotype was observed for 14 days, and then disease resistance was identified.

[0035] In this disclosure, the wheat receptor-like protein kinase TaMLR1 is encoded by the ORF sequence of SEQ ID NO: 2.

[0036] In this disclosure, wheat receptor-like protein kinase TaMLR1 has the amino acid sequence of SEQ ID NO: 1.

[0037] In this disclosure, the plant is preferably a monocotyledonous plant that is a cereal capable of being successfully infected with wheat yellow rust fungus, and more preferably wheat.

[0038] In improving disease-resistant wheat varieties, the use of the wheat receptor-like protein kinase TaMLR1 provided by the examples of this disclosure was carried out as follows:

[0039] Inoculation of the acquired TaMLR1 gene-edited plants with the affinity strain CYR31 resulted in a significant decrease in wheat disease resistance. This indicates negative regulation of TaMLR1 in interactions between wheat and wheat yellow rust, powdery mildew, and Fusarium head blight.

[0040] TaMLR1 gene-edited plants were created using Agrobacterium-mediated gene transformation. These gene-edited plants were inoculated with wheat yellow rust fungus, powdery mildew fungus, and Fusarium head blight fungus. Phenotypic identification revealed that the TaMLR1 gene-edited plants exhibited enhanced resistance to wheat yellow rust fungus, powdery mildew fungus, and Fusarium head blight fungus.

[0041] This provides primers for amplifying cDNA.

[0042] TaMLR1-cDNA-F:ATGGTGCTCCCAACCTTACCG (SEQ ID NO: 5), and

[0043] TaMLR1-cDNA-R:AAATGTATGTCTACCTTTCACTC (Sequence ID 6).

[0044] The examples in this disclosure provide the use of wheat receptor-like protein kinase TaMLR1 in improving disease-resistant wheat varieties.

[0045] The primers designed for gene editing targets were as follows:

[0046] Target 1:

[0047] TaMLR1-Target1-F:ACTCGAGCGGAGGAATCGGTAGAC (Sequence ID 7), and

[0048] TaMLR1-Target1-R:AAACGTCTACCGATTCCTCCGCTC (Sequence ID 8).

[0049] Target2:

[0050] TaMLR1-Target2-F:ACTCGTATACGAATTTATGCCCCG (Sequence ID 9), and

[0051] TaMLR1-Target2-R:AAACCGGGGCATAAATTCGTATAC (Sequence ID 10).

[0052] The primers used to detect transgenic-positive plants were as follows:

[0053] Blp-F:GCAAGACCCTTCCTCTATATAAGG(Sequence ID 11); and

[0054] Blp-R:TCAGATCTCGGTGACGGGCAGGACC (Sequence ID 12).

[0055] In the use of wheat receptor-like protein kinase TaMLR1 in improving disease-resistant wheat varieties, as provided by the examples of this disclosure, a gene-edited vector of the TaMLR1 gene was constructed using gene-editing technology, and the gene-edited vector was transformed into recipient wheat Fielder using Agrobacterium-mediated wheat gene transformation technology. PCR, detection of positive plants, and detection of gene-edited types were performed on the resulting transformed plants. A single base insertion was confirmed in the mutant TaMLR1-KO. T1 generation L1, L2, and L3 strains were selected for inoculation with wheat yellow rust, powdery mildew, and Fusarium head blight. The TaMLR1 gene-edited plants were shown to exhibit enhanced resistance compared to Fielder.

[0056] The foregoing description demonstrates the effective implementation of this disclosure. The above-described examples are intended solely to illustrate preferred embodiments of this disclosure and are not intended to limit the scope of this disclosure. Various modifications and improvements made by those skilled in the art based on the technical solutions of this disclosure without departing from the spirit of this disclosure shall be included within the scope of the claims attached to this disclosure.

Claims

1. The process involves introducing a gene editing vector into wheat that targets an open reading frame (ORF) encoding wheat receptor-like protein kinase TaMLR1, The wheat receptor-like protein kinase TaMLR1 has the amino acid sequence of SEQ ID NO: 1, The nucleotide sequence of ORF is described in Sequence ID No. 2, The introduction of the gene editing vector results in the insertion of a single base into the ORF. A method for breeding disease-resistant, gene-edited wheat varieties.

2. A method for breeding a disease-resistant wheat variety according to claim 1, comprising: constructing a gene editing vector that targets an open reading frame (ORF) encoding the wheat receptor-like protein kinase TaMLR1; and introducing the gene editing vector into an immature wheat embryo using an Agrobacterium-mediated gene transformation method to obtain a wheat variety having a genetically edited wheat receptor-like protein kinase TaMLR1 gene sequence.

3. A method for breeding disease-resistant wheat varieties according to claim 1, wherein the gene of a gene editing vector targeting an open reading frame (ORF) encoding the wheat receptor-like protein kinase TaMLR1 is introduced into wheat by Agrobacterium-mediated gene transformation, and the resistance of wheat to wheat yellow rust, powdery mildew, and Fusarium head blight (FHB) can be enhanced by editing the ORF encoding the wheat receptor-like protein kinase TaMLR1.

Images