Method for recovering heavy metal ions, structure for recovering heavy metal ions, and method for accumulating microorganisms

Abstract

To provide a method for recovering and removing heavy metal ions from treated water containing heavy metal ions and inhabited by microorganisms with heavy metal metabolism ability, and a method for accumulating the microorganisms in the treated water that is simple and can be implemented with low energy.SOLUTION: A method includes placing a conductor in the treated water, supplying electrons to the conductor to form a precipitate in which the microorganisms are accumulated and concentrating the heavy metal ions in the precipitate.SELECTED DRAWING: Figure 2

Description

Technical Field

[0001] The present invention relates to a method for recovering heavy metal ions. More specifically, it relates to a method for recovering heavy metal ions from treated water containing heavy metal ions and inhabited by microorganisms having the ability to metabolize heavy metals. Further, the present invention relates to a structure and an apparatus for recovering heavy metals. Furthermore, the present invention relates to a method for accumulating microorganisms in the treated water.

Background Art

[0002] Mine wastewater generated by mine development, etc., contains heavy metal ions, so there are concerns about its pollution impact on agriculture and the environment, and long-term treatment is required. Conventionally, various treatment methods have been developed and improved for removing heavy metal ions from mine wastewater.

[0003] The treatment methods for water containing heavy metal ions, such as mine wastewater, can be broadly classified into active treatment using chemicals and electricity, and passive treatment using energy obtained in natural environments such as gravity, microbial metabolism, and photosynthesis. As active treatment, classically, a method of adding slaked lime to precipitate heavy metal ions as hydroxides and an electrodialysis method are known. As passive treatment, for example, a method for oxidizing divalent iron salts in mine wastewater using iron-oxidizing bacteria has been known for a long time. The method using iron-oxidizing bacteria is useful for the removal and recovery of iron, but it cannot be applied to the removal of other harmful metals or the recovery of low-concentration useful metals. In contrast, Patent Document 1 discloses a treatment method for mine wastewater including a treatment step using iron-oxidizing bacteria and a dearsenification step of adsorbing arsenic-containing ions by an adsorbent, and it is described that this method is applicable to mine wastewater containing heavy metals other than iron.

Prior Art Documents

Patent Documents

[0004]

Patent Document 1

Summary of the Invention

[0005] Conventional active treatments generally require the input of large amounts of chemicals and electrical energy, and also present problems such as the alkalization of wastewater. On the other hand, passive treatments generally require reservoir facilities and treatment after groundwater pumping, which presents land acquisition problems. Furthermore, while the recovery and utilization of valuable metals such as rare metals in mine wastewater is desirable, it is difficult to specifically recover low concentrations of valuable metals from the metals mixed in mine wastewater, which poses a challenge in technological development.

[0006] The object of the present invention is to provide a novel method and apparatus for recovering and removing heavy metal ions from treated water containing heavy metal ions, such as mine wastewater. Specifically, the object of the present invention is to provide a method for removing harmful heavy metal ions from treated water containing heavy metal ions, such as mine wastewater, and a method for recovering valuable heavy metals from treated water containing heavy metal ions, such as mine wastewater. [Means for solving the problem]

[0007] Electrodeposition requires complex equipment to control the deposition of substances on the electrode surface, which is necessary for its continuous use as a treatment method for mine wastewater. However, while the inventors were observing the electrolytic reaction of mine wastewater, they discovered that the electrochemical reaction could be sustained for a long period of time with simple equipment, and that heavy metal ions were concentrated in the precipitate formed on the electrode surface. This invention was completed after further investigation based on the above findings.

[0008] Specifically, the present invention is as follows: <1> A method for recovering heavy metal ions from treated water containing heavy metal ions and inhabited by microorganisms capable of metabolizing heavy metals, Placing a conductor in the water to be treated, and The method comprising supplying electrons to the conductor to form a precipitate on which the microorganisms are accumulated, and concentrating the heavy metal ions in the precipitate. <2> The treated water mentioned above is mine wastewater, factory wastewater, environmental water, or groundwater. <1> Methods used. <3> The heavy metal ions mentioned above are ions of one or more metals selected from the group consisting of iron, manganese, arsenic, and antimony. <1> or <2> Methods used. <4> The above microorganism is a rod-shaped bacterium that possesses extracellular fibers. <1> ~ <3> One of the methods described above. <5> The above precipitate is a porous crystal containing calcium carbonate. <1> ~ <4> One of the methods described above. <6> <1> ~ <5> A water treatment method for removing heavy metal ions from water containing heavy metal ions, comprising recovering heavy metal ions by any of the methods described above.

[0009] <7> A structure for recovering heavy metal ions from treated water containing heavy metal ions, The material comprises a conductor and a precipitate that covers at least a portion of the surface of the conductor, A structure containing microorganisms capable of metabolizing heavy metals in the above precipitate. <8> The above precipitate is a porous crystal containing calcium carbonate. <7> The structure described above. <9> The above conductor is a carbon material. <7> or <8> The structure described above. <10> The above carbon material is carbon cloth. <9> The structure described above. <11> The above microorganism is a microorganism belonging to the class Gamma-Proteobacteria that possesses a 16S rRNA gene consisting of one of the following (a1), (b1), (a2), or (b2): <7> ~ <10> A structure described in any of the following; (a1) A polynucleotide consisting of the sequence described in Sequence ID No. 1, (a2) A polynucleotide consisting of the sequence described in Sequence ID No. 3, (b1) A polynucleotide consisting of the sequence described in Sequence ID No. 2, (b2) A polynucleotide consisting of the sequence described in Sequence ID No. 4. <12> A device for recovering heavy metal ions from treated water containing heavy metal ions, <7> ~ <11> A structure as described in any of the above, and an apparatus including means for supplying electrons to the conductor. <13> A method for accumulating microorganisms in treated water that contains heavy metal ions and has the ability to metabolize heavy metal ions, The method comprising placing a conductor in water to be treated, and supplying electrons to the conductor to form a precipitate on which the microorganisms have accumulated. [Effects of the Invention]

[0010] The present invention provides a method for recovering heavy metal ions using simple equipment and low energy. Using the method of the present invention, valuable heavy metals can be recovered from treated water containing heavy metal ions, such as mine wastewater. Furthermore, harmful heavy metal ions can be removed from mine wastewater and other sources. Moreover, microorganisms with heavy metal metabolic capabilities can be accumulated in the treated water using the same method. [Brief explanation of the drawing]

[0011] [Figure 1] This figure shows the results of X-ray diffraction measurements of the precipitate formed on the cathode surface in the example. [Figure 2] This is an electron microscope image of the precipitate accumulated on the cathode surface in the example. [Figure 3] This graph shows the relative frequency distribution of constituent microorganisms based on OTU (Operational Taxonomic Unit) analysis of 97% sequence homology of 16S rRNA genes in the microbial community accumulated on the cathode surface in the example. [Figure 4]In the examples, it is a phylogenetic tree based on the 16S rRNA gene of the dominant strain (ASV1, ASV3, ASV4, ASV5) and its relatives in the microbial community accumulated on the precipitate accumulated on the cathode surface. The phylogenetic tree was created by the neighbor-joining method, and the characters shown in parentheses are GenBank accession numbers. [Mode for Carrying Out the Invention]

[0012] Hereinafter, the present invention will be described in detail. The description of the constituent elements described below may be based on typical embodiments or specific examples, but the present invention is not limited to such embodiments.

[0013] [Method for Recovering Heavy Metal Ions] The method for recovering heavy metal ions of the present invention includes disposing a conductor in the water to be treated, and supplying electrons to the conductor.

[0014] [Water to be Treated] The water to be treated in the method of the present invention contains heavy metal ions. The water to be treated preferably contains calcium ions in addition to heavy metal ions. Further, the water to be treated preferably contains bicarbonate ions. Further, the water to be treated is water in which microorganisms having the ability to metabolize heavy metals inhabit. In the method of the present invention, water in an environment in which microorganisms having the ability to metabolize heavy metals inhabit or water collected from such an environment becomes the water to be treated. Examples of the water to be treated include mine wastewater (mine water and wastewater) (such as mine drainage), factory wastewater, groundwater, environmental water (river water, lake water, seawater, etc.). The water to be treated may be sludge, muddy water, or a suspension of these in water.

[0015] In water in an environment containing heavy metal ions such as mine wastewater and factory wastewater, microorganisms having the ability to metabolize these heavy metal ions inhabit. Further, groundwater and environmental water contain heavy metal ions, and many microorganisms use these heavy metal ions for their life activities there.

[0016] [Microorganisms Having the Ability to Metabolize Heavy Metals] In this specification, heavy metal metabolic ability means the ability to utilize heavy metals (heavy metal ions and / or nonionic heavy metals) as substrates for redox reactions, and in particular, the ability to utilize heavy metals as substrates for energy production necessary for maintaining life. In this specification, microorganisms with heavy metal metabolic ability mean microorganisms that can continue to live in an environment where heavy metals are present, and in particular, microorganisms that utilize heavy metals as substrates for energy production necessary for maintaining life. For example, microorganisms that oxidize or reduce heavy metals during respiration are a type of microorganism with heavy metal metabolic ability. Microorganisms that transfer electrons during the oxidation and reduction of heavy metals also include electromicroorganisms that can survive by using electricity as energy. Examples of microorganisms with heavy metal metabolic ability include iron-oxidizing bacteria, iron-reducing bacteria, and arsenic-reducing bacteria.

[0017] The heavy metal substrate may be a heavy metal ion, or it may be a solid metal (nonionic heavy metal) such as an iron mineral or electrode (e.g., Lovley and Holmes, 2022, Nat Rev Microbiol 20:5-19).

[0018] Microorganisms are unique among all living organisms in that they have evolved special biological mechanisms that allow them to metabolize and utilize metals, which are widely distributed on Earth, as energy substrates. Some microorganisms are known to produce crystalline metal particles as part of their metal metabolism (Hochella et al. 2008 Science 319:1631-35). Compared to conventional engineering-based treatment methods, technologies that utilize the metabolic functions of microorganisms for environmental remediation and valuable metal recovery offer advantages such as selectivity of recovered metals by utilizing the substrate specificity of catalytic reactions, efficiency at low concentrations, and cost and environmental impact reduction, making them promising technologies. Although microorganisms with heavy metal metabolism capabilities are attracting attention for their usefulness, their environmental behavior and diversity have not yet been clarified, and at this stage, the need to input energy and substrates to control culture conditions, similar to engineering-based treatments, is a major obstacle to technological development.

[0019] However, the inventors have discovered that microorganisms with heavy metal metabolism capabilities, already present in the treated water under various environmental conditions, can be accumulated with minimal energy. Furthermore, they have found that it is possible to continuously recover heavy metals from the treated water using these microorganisms.

[0020] Depending on the type of water to be treated, such as wastewater, industrial wastewater, environmental water, or groundwater, different types of microorganisms may accumulate in the precipitate. The microorganisms with heavy metal metabolism capabilities that accumulate in the precipitate by the method of the present invention may be one species or multiple species.

[0021] Microorganisms (microbial communities) that possess heavy metal metabolism capabilities may also possess other functions, such as carbon fixation ability, nitrogen fixation ability, and arsenic resistance.

[0022] [Precipitate] Microorganisms accumulate in precipitates formed on the surface of conductors. In this case, it is sufficient that at least some of the microorganisms in the treated water accumulate. The precipitate is a deposit formed on the surface of a conductor by supplying electrons to the conductor placed in the treated water. The precipitate usually forms as a porous crystal. The pore size of each pore in the porous crystal should be 0.05 to 5.0 μm, preferably 0.1 to 1.0 μm. Furthermore, it is preferable that the precipitate is a crystal mainly composed of calcium carbonate.

[0023] The precipitate can be formed using calcium ions and magnesium ions dissolved in the treated water as materials, but if necessary, an ion source (such as slaked lime) may be added to the treated water when carrying out the method of the present invention. The precipitate itself has the function of adsorbing heavy metal ions, and together with microorganisms, it is thought to hold heavy metal ions accumulated by the microorganisms for metabolic purposes. In this specification, precipitates containing calcium carbonate in which such microorganisms have accumulated are sometimes referred to as biominerals. The precipitate is similar to crystals formed in environmental water containing calcium carbonate, and is composed of calcite crystals and aragonite crystals.

[0024] As the electrolytic reaction progresses, it is thought that metal deposits form on the conductor, or non-conductive substances such as calcium carbonate precipitate due to the increased alkalinity of the electron-supplied conductor, and the electrochemical reaction stops. However, the inventors have found that electrochemical activity and biomineral production continue even after precipitates form on the surface of the conductor. In other words, a structure in which the surface of a conductor is covered with precipitates where microorganisms have accumulated and heavy metal ions have concentrated can be used directly for the recovery of heavy metal ions. This is thought to be because, even in a state where non-conductive substances such as calcium carbonate have precipitated, the metal metabolic ability of microorganisms promotes the electroactivity on the electrode, thereby promoting and sustaining the formation of precipitates, and thus functioning as a natural metal adsorbent.

[0025] [Heavy metal ions] Heavy metal ions that can be recovered from treated water by the method of the present invention include ions of metals selected from the group consisting of iron (Fe), manganese (Mn), arsenic (As), zinc (Zn), selenium (Se), and antimony (Sb). Since the method of the present invention can recover trace amounts of heavy metal ions contained in treated water, the method of the present invention is particularly suitable for recovering arsenic and antimony ions present at low concentrations.

[0026] Heavy metal ions may be insoluble in the precipitate or on the precipitate surface, for example, as salts, or they may be adsorbed on the precipitate surface or the surface inside the pores. Heavy metal ions may be concentrated as ions of any valency that each metal can take, but for example, arsenic and antimony are preferably concentrated as pentavalent ions.

[0027] The concentration of heavy metal ions in the treated water is not particularly limited, but for example, it should be in the range of 10 ppb to 100 ppm. Heavy metal ions present in the treated water at concentrations undetectable can also be concentrated in the precipitate by the method of the present invention.

[0028] [conductor] Examples of conductors used in the method of the present invention include precious metals such as copper, platinum, silver, and gold, metals plated with these metals, iron, stainless steel, titanium, carbon materials, metal oxides, and metal sulfides. Examples of carbon materials include glassy carbon, graphite, carbon paper, carbon felt, carbon cloth, biomass carbonized materials such as activated carbon and charcoal, and graphite sheets and graphene. Furthermore, the conductor is preferably one selected from the carbon fiber group consisting of carbon paper, carbon felt, and carbon cloth. A laminate made by stacking multiple of these materials may also be used. The conductor described above is placed in the water to be treated in the method of the present invention. The conductor may be placed so that the entire body is submerged in the water to be treated, or a portion of it may be placed so that only a part of it is submerged in the water to be treated.

[0029] [Supplying electrons to a conductor] Electrons can be supplied to the conductor by an electrode paired with the conductor, a power supply (DC power supply), and wiring connecting the power supply and the electrode.

[0030] The above-mentioned conductor can be used as the cathode electrode and placed together with the anode electrode in the water to be treated. By applying a voltage between the two electrodes using a power supply and conducting an electric current, electrons can be supplied to the conductor. As the anode electrode, metals, metal oxides, metal sulfides, or carbon materials (e.g., carbon fibers, graphite sheets, graphene, biomass carbonized materials) can be used.

[0031] The voltage applied between the cathode electrode and the anode electrode is not particularly limited, but for example, 0.05 to 1.0 A / m 2 A supply current density of 0.1 to 0.4 A / m is sufficient. 2 The current density is preferably such that the supply current density is such that the current density is such that the current density is such that the current density is such that the current density does not inhibit the growth of microorganisms accumulating on the precipitate on the surface of the cathode electrode.

[0032] [Device] The apparatus used to carry out the method of the present invention includes the above-mentioned conductor (cathode electrode) and means for supplying electrons to the conductor. The conductor may be a structure before the deposition of precipitate, or it may be a structure in which precipitate has accumulated and at least a portion of its surface is already covered with precipitate. The means for supplying electrons to the conductor usually includes the above-mentioned anode electrode, power supply, and wiring. The apparatus may further include a switch for turning the current on and off. The cathode electrode and anode electrode may be placed in an electrolytic cell located in an environment where the water to be treated is present (e.g., the sea, river, pond, wastewater discharge point). Means for supplying new water to be treated to the electrolytic cell may also be used.

[0033] [Heavy metal ion recovery] As described above, heavy metal ions in the treated water concentrate in the precipitate, so the recovery of heavy metal ions can be carried out simply by recovering the precipitate together with the conductor used in the reaction. Furthermore, from the precipitate recovered after separation from the conductor, heavy metal ions can be recovered as salts or as nonionic metals using known methods.

[0034] [Water treatment methods] The method for recovering heavy metal ions according to the present invention can also be used as a water treatment method to remove heavy metal ions from water containing heavy metal ions, such as mine wastewater.

[0035] <Structure> A structure obtained by the above procedure, which includes placing a conductor in water to be treated and supplying electrons to the conductor, comprising a conductor and the aforementioned precipitate coating at least a portion of the surface of the conductor, contains microorganisms with heavy metal metabolic ability in the precipitate and can be used to recover heavy metal ions from water to be treated that contains heavy metal ions. Specifically, the structure can be used as a cathode electrode in combination with means for supplying electrons to the conductor. The water to be treated in this case may not contain microorganisms with heavy metal metabolic ability, and may be, for example, a solution in which heavy metal ions are dissolved in sterile water.

[0036] In the structure, the precipitate only needs to cover at least a portion of the conductive surface. Furthermore, the precipitate only needs to be formed to a thickness of, for example, 0.1 mm to 10 cm from the conductive surface, but is not particularly limited.

[0037] <Methods for accumulating microorganisms and microorganisms> As can be seen from the description of the method for recovering heavy metal ions, the procedure for recovering heavy metal ions involves placing the aforementioned conductor in the water to be treated and supplying electrons to the conductor, thereby accumulating microorganisms in the water to be treated. The accumulated microorganisms can be allowed to grow in water containing heavy metal ions by receiving electrons from the conductor and the conductor coated with precipitate.

[0038] As shown in the examples, the inventors carried out the method of the present invention at the wastewater discharge site in Ichinokawa, Saijo City, Ehime Prefecture, and accumulated microorganisms in the sediment. Then, DNA was extracted from the recovered sediment and 16S rRNA gene amplicon sequencing analysis was performed, and it was found that specific microorganisms were accumulated as dominant strains in the sediment. As a result of the analysis, it was confirmed that there were sediments in which strains having a 16S rRNA gene consisting of (a1) and strains having a 16S rRNA gene consisting of (b1) below were accumulated, and sediments in which strains having a 16S rRNA gene consisting of (a2) and strains having a 16S rRNA gene consisting of (b2) below were accumulated. (a1) A polynucleotide consisting of the sequence described in Sequence ID No. 1, (a2) A polynucleotide consisting of the sequence described in Sequence ID No. 3, (b1) A polynucleotide consisting of the sequence described in Sequence ID No. 2, (b2) A polynucleotide consisting of the sequence described in Sequence ID No. 4.

[0039] The 16S rRNA genes of these strains all showed less than 90% sequence homology to the cultured isolates, indicating they were new microorganisms. Phylogenetic analysis revealed they belong to the class Gamma-Proteobacteria.

[0040] The newly identified microorganisms are rod-shaped bacteria measuring 0.5–0.7 μm × 1.3–2.4 μm in size and possess cilia (extracellular fibers) (Figure 2).

[0041] The novel microorganisms described above accumulate as dominant strains in the precipitate formed on conductors supplied with electrons, and are thought to promote electrical activity on the conductors that serve as electrodes. Furthermore, the assembly sequences of the novel microorganisms obtained from metagenomic analysis of DNA extracted from the precipitates contained gene sequences related to metal metabolism. Therefore, all of the novel microbial strains described above are microorganisms with heavy metal ion metabolism capabilities and can be used in the method for recovering heavy metal ions of the present invention.

[0042] Furthermore, the above assembly sequence also included gene sequences related to carbon fixation, nitrogen fixation, and arsenic resistance.

[0043] Based on the analysis results compiled using the method of the present invention, it is considered that microbial species possessing the following 16S rRNA genes, not limited to the novel strains described above, have the ability to metabolize heavy metal ions. (a) Polynucleotides consisting of the base sequence of Sequence ID No. 1 or 3; (aa) A polynucleotide consisting of a sequence having high identity with the base sequence of Sequence ID No. 1 or 3; (b) Polynucleotides consisting of the base sequence of Sequence ID No. 2 or 4; (bb) A polynucleotide consisting of a sequence having high identity with the base sequence of Sequence ID No. 2 or 4.

[0044] High identity means, for example, 90% or more, preferably 95% or more, more preferably 98.0% or more, even more preferably 98.5% or more, even more preferably 99.0% or more, even more preferably 99.4% or more, and particularly preferably 99.73% or more.

[0045] With respect to a base sequence (sometimes simply called a sequence), identity refers to the percentage of matching nucleotides shared between two sequences when they are aligned in the most optimal manner. The identity percentage can be calculated as (number of matching positions / total number of positions) × 100, and can be calculated using commercially available algorithms. Such calculations can also be performed using algorithms or programs well known to those skilled in the art (e.g., BLASTN, BLASTP, BLASTX, ClustalW). [Examples]

[0046] The present invention will be described in more detail below with reference to examples. The materials, reagents, amounts and proportions of substances, and procedures shown in the following examples can be modified as appropriate, as long as they do not depart from the spirit of the present invention. Therefore, the scope of the present invention is not limited to the following examples.

[0047] The experiment was conducted at the wastewater discharge point in Ichinokawa, Saijo City, Ehime Prefecture. A metal plate anode electrode and a carbon cloth (manufactured by Tsukuba Institute of Materials and Information) cathode electrode were placed in the wastewater, and the current density between the electrodes was 0.1 to 0.4 A / m². 2 The device was energized in this manner. After 51 days of energization, a precipitate was observed on the surface of the cathode electrode. A portion of this precipitate was collected, and the treatment process was continued thereafter.

[0048] X-ray diffraction (XRD, instrument name: Ultima IV, Rigaku Co.) measurements were performed on the precipitate on the cathode electrode surface six months after electrode placement. The results are shown in Figure 1. The constituent phase was identified as mainly calcite-aragonite, and quartz (SiO2) was also detected. Furthermore, an electron microscope image (Figure 2) of the precipitate accumulated on the cathode electrode surface was obtained (SEM: ESEM Quanta 450 FEG, FEI). Microorganisms with elongated, string-like extracellular fibers (Figure 2, arrow 1) were identified in the porous precipitate (2). These extracellular fibers (nanowires) are similar to conductive cilia produced by some known metal-metabolizing microorganisms to exchange electrons with solid surfaces (Reguera et al. 2005. Nature 435:1098-1101; Gorby et al. 2006. PNAS 30:11358-11363).

[0049] Furthermore, the concentrations of each metal in the precipitate on the cathode electrode surface six months after electrode installation were measured using the following procedure. The precipitate on the cathode electrode surface was dissolved in concentrated hydrochloric acid, diluted 10-100 times with a solvent (dilute hydrochloric acid), and then the concentrations of each metal were measured using an inductively coupled plasma atomic emission spectrometer (ICP-OES: Vista-MPX, manufactured by Varian). Furthermore, when the electrodes were retrieved six months after installation, wastewater from upstream of the electrode installation site (approximately 20-30 cm) was collected, filtered through a 0.2 μm filter, and the concentrations of each metal were measured using ICP-OES as described above. The results are shown in Table 1.

[0050] [Table 1]

[0051] The results above indicate that the precipitate contained heavy metal ions such as arsenic, iron, and manganese (As, Fe, Mn) at concentrations more than 1000 times higher than those found in the wastewater, as well as antimony (Sb), a rare metal with high industrial value, at approximately 60 times the normal concentration.

[0052] Furthermore, 16S rRNA gene amplicon sequencing was performed on the microbial community accumulated in the precipitate on the cathode surface. DNA extraction was performed using the ZymoBIOMICS DNA / RNA Miniprep Kit according to the kit's protocol from cathode fragments that had been frozen and energized for 51 days. A 0.5 cm × 1.0 cm cathode fragment was submitted for DNA extraction. Regarding the extracted samples, Qubit TM DNA quantification was performed using the 1X dsDNA High Sensitivity Assay Kit (Thermo Fisher). Approximately 1 ng of extracted DNA was used as template DNA, and amplicon sequencing analysis targeting the V4-V5 region of bacterial and archaeal 16S rRNA genes was performed according to a previously reported study (Hirai et al. 2017. Microbe Environ. 32:336-343). Oligonucleotides were used as forward and reverse primers, respectively, by adding the Illumina adapter sequence (ACACTCTTTCCCTACACGACGCTCTTCCGATCT: SEQ ID NO: 5) and the Illumina multiplex PCR primer 2.0 sequence (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT: SEQ ID NO: 6) to the 5' end of multiple 5'-terminal primer sequences (U530 primer sequences) and 3'-terminal primer sequences (U907 primer sequences) covering the V4-V5 region of bacteria and archaea shown in Table 2. Using a primer cocktail (U530 / U907) containing multiple forward and reverse primer pairs, the V4-V5 region of bacterial and archaeal 16S rRNA genes was PCR-amplified.

[0053] [Table 2]

[0054] DNA amplification was confirmed by agarose gel electrophoresis, and the remaining oligonucleotides were digested with Exonuclease I and Shrimp Alkaline Phosphatase (Affymetrix). The PCR reaction product was diluted 100-fold and used as template DNA for PCR to add sequencing index and adapter sequences (Illumina Corporation). The PCR-reacted DNA was confirmed by agarose gel electrophoresis, purified with magnetic beads (AMPure XP, Beckman Coulter Corporation), and then processed using Qubit TM The DNA was quantified using a 1X dsDNA High Sensitivity Assay Kit (Thermo Fisher) and pooled at equimolar concentrations. These pooled samples were then paired-end sequenced using a MiSeq sequencer (Illumina Corporation) with a 600-cycle MiSeq sequencing kit (Illumina MiSeq Reagent Kit v3 (600 cycles)) along with an internal standard (PhiX Control v3, Illumina Corporation).

[0055] From the obtained sequence reads, sequence adapter sequences and low-quality reads were removed using Trimmomatic v0.33 (Bolger, AM, M. Lohse, and B. Usadel. 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30:2114-2120), and PCR primer sequences were removed using Cutadapt v1.10 (Martin, M. 2011. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 17:10). The obtained reads were concatenated using QIIME v1.5.0 pipelines (Caporaso, JG, J. Kuczynski, J. Stombaugh, et al. 2010. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 7:335-336) to identify and exclude chimeric sequences, and ASVs (Amplicon sequence variants) were created by clustering with 99% sequence homology using UNOISE3 (Table 3). Furthermore, OTUs (Operational Taxonomic Units) were created by clustering with 97% sequence homology using QIIME v1.5.0 pipelines, and phylogenetic estimation was performed by comparing the representative sequence of each OTU with the SILVA ribosomal RNA database.

[0056] Based on the above results, the electrode after 51 days of energization was (0.1 mA / m 2 In ) Operational Taxonomic Unit (OTU) analysis with 97% sequence homology, a new dominant species of microorganism belonging to Gamma-Proteobacteria (ASV1, ASV4) was detected, showing a relative occurrence rate of approximately 80% (Figure 3). In addition, other electrode pieces (0.4 mA / m) were analyzed. 2From this, sequences with 97% OTU sequence homology and slightly different lineages (ASV3, ASV5) were obtained. In contrast, in electrode samples without current, lineages with an occurrence frequency of 2% or less accounted for more than 95%, and novel dominant microbial species that accumulated on electrodes after current application were confirmed in only a few percent. The dominant species that accumulated on the current-applied electrodes each showed the possibility of being two strains that differed at the strain level with 99% sequence homology. Phylogenetic trees of these four strains were constructed using the maximum likelihood method (Figure 4), and the results showed that the only closely related sequences of the dominant strains were sequences of uncultured lineages obtained from the environment, and the sequence homology with cultured isolates was 90% or less. Therefore, all of these dominant strains are considered to be new microorganisms of uncultured lineages. Furthermore, since the same dominant strains (ASV1, ASV4) accounted for 55-75% of the relative occurrence frequency in the electrodes 6 months after electrical stimulation, it can be seen that this new microbial dominant species had already become dominant 51 days after electrical stimulation and remained the most dominant strain for several months thereafter (6 months after electrical stimulation), indicating that it is a microorganism that proliferates in response to the electrode reaction.

[0057] [Table 3]

[0058] All of the above sequences showed a sequence homology of less than 90% with closely related cultured strains in Blast searches, suggesting that the dominant species are all novel microorganisms from uncultured lines. Electron microscopy revealed that this novel microorganism is a rod-shaped bacterium, and its 16S rRNA gene sequence indicated its affinacy with Gamma-Proteobacteria. Closely related known cultured strains include Acidiferrobacter thiooxydanse strain DSM2392 (89.10%, Evalue 4e-131) and Nitrosococcus oceani strain ATCC19707 (88.83%, Evalue 5e-130). Closely related sequences from uncultured lines were found in groundwater from former coal mines and groundwater contaminated with chlorinated hydrocarbons. Furthermore, the metagenomic sequences of DNA extracted from electrode pieces were sequenced using Illumina Hiseq / Miseq and assembled. From the sequence information of the MAG (Metagenome Assembled Genome) of this new Gamma-Proteobacteria microorganism, enzymes related to iron metabolism (Bacterioferritin (EC 1.16.3.1): SEQ ID NO: 24), enzymes related to carbon fixation (Ribulose bisphosphate carboxylase large chain (EC 4.1.1.39): SEQ ID NO: 25; Ribulose bisphosphate carboxylase small chain (EC 4.1.1.39): SEQ ID NO: 26), enzymes related to nitrogen fixation (Nitrogenase (molybdenum-iron) alpha chain (EC 1.18.6.1): SEQ ID NO: 27; Nitrogenase (molybdenum-iron) beta chain (EC 1.18.6.1): SEQ ID NO: 28), and enzymes related to arsenic resistance (Arsenate reductase (EC 1.20.4.4) The genes for thioredoxin-coupled, LMWP family (SEQ ID NO: 29) and Arsenite / antimonite (H+ antiporter ArsB: SEQ ID NO: 30) were detected. [Industrial applicability]

[0059] The present invention provides a method for recovering heavy metal ions, such as antimony, which have high industrial value, from wastewater and other sources, without the need for large-scale input of chemicals or energy, or investment in facilities such as alkalization or reservoirs. In particular, when recovering concentrated metals, it is only necessary to recover conductive materials such as carbon cloth used as electrodes in the microbial activation reaction at the site, and a major advantage is that there is no need for large-scale construction such as the installation of microbial reaction tanks or the removal and recovery of reservoir bottom sediment. [Explanation of symbols]

[0060] 1. Microorganisms and nanowires [Sequence Listing Free Text]

[0061] Sequence IDs 1-4: 16S rRNA gene sequences of new microbial strains (ASV1, ASV3, ASV4, ASV5) from uncultured lines. Sequence ID 5: Illumina Adapter Array Sequence ID 6: Illumina Multiplex PCR Primer 2.0 Sequence Sequence IDs 7-23: Primer sequences Sequence IDs 24-30: Amino acid sequences of enzymes and other genes identified from MAG (Metagenome Assembled Genome) sequence information from new microbial strains.

Claims

1. A method for recovering heavy metal ions from treated water containing heavy metal ions and inhabited by microorganisms capable of metabolizing heavy metals, Placing a conductor in the water to be treated, and This includes supplying electrons to the conductor to form a precipitate on which the microorganisms are accumulated, and concentrating the heavy metal ions in the precipitate, The heavy metal ion is an ion of one or more metals selected from the group consisting of iron, manganese, arsenic, and antimony. The method wherein the microorganism is a microorganism belonging to the class Gamma-Proteobacteria that has a 16S rRNA gene consisting of (a1), (b1), (a2), (b2), (aa), or (bb) as described below; (a1) A polynucleotide consisting of the sequence described in Sequence ID No. 1, (a2) A polynucleotide consisting of the sequence described in Sequence ID No. 3, (b1) A polynucleotide consisting of the sequence described in Sequence ID No. 2, (b2) A polynucleotide consisting of the sequence described in Sequence ID No. 4, (aa) A polynucleotide consisting of a sequence having 98.0% or more identity with the base sequence of Sequence ID No. 1 or 3, (bb) A polynucleotide consisting of a sequence having 98.0% or more identity with the base sequence of Sequence ID No. 2 or 4.

2. The method according to claim 1, wherein the water to be treated is mine wastewater, factory wastewater, environmental water, or groundwater.

3. The method according to claim 1 or 2, wherein the microorganism is a rod-shaped bacterium having extracellular fibers.

4. The method according to any one of claims 1 to 3, wherein the precipitate is a porous crystal containing calcium carbonate.

5. A water treatment method for removing heavy metal ions from water containing heavy metal ions, comprising recovering heavy metal ions by the method described in any one of Claims 1 to 4.

6. A structure for recovering heavy metal ions from treated water containing heavy metal ions, The material comprises a conductor and a precipitate that covers at least a portion of the surface of the conductor, The precipitate contains microorganisms having heavy metal metabolism capabilities, The heavy metal ion is an ion of one or more metals selected from the group consisting of iron, manganese, arsenic, and antimony. The structure is a microorganism belonging to the class Gamma-Proteobacteria, having a 16S rRNA gene consisting of (a1), (b1), (a2), (b2), (aa), or (bb) as described below; (a1) A polynucleotide consisting of the sequence described in Sequence ID No. 1, (a2) A polynucleotide consisting of the sequence described in Sequence ID No. 3, (b1) A polynucleotide consisting of the sequence described in Sequence ID No. 2, (b2) A polynucleotide consisting of the sequence described in Sequence ID No. 4, (aa) A polynucleotide consisting of a sequence having 98.0% or more identity with the base sequence of Sequence ID No. 1 or 3, (bb) A polynucleotide consisting of a sequence having 98.0% or more identity with the base sequence of Sequence ID No. 2 or 4.

7. The structure according to claim 6, wherein the precipitate is a porous crystal containing calcium carbonate.

8. The structure according to claim 6 or 7, wherein the conductor is a carbon material.

9. The structure according to claim 8, wherein the carbon material is carbon cloth.

10. A device for recovering heavy metal ions from treated water containing heavy metal ions, A structure according to any one of claims 6 to 9, and an apparatus comprising means for supplying electrons to the conductor.

11. A method for accumulating microorganisms in treated water that contains heavy metal ions and has the ability to metabolize heavy metal ions, This includes placing a conductor in the water to be treated, and supplying electrons to the conductor to form a precipitate on which the microorganisms have accumulated. The heavy metal ion is an ion of one or more metals selected from the group consisting of iron, manganese, arsenic, and antimony. The method wherein the microorganism is a microorganism belonging to the class Gamma-Proteobacteria that has a 16S rRNA gene consisting of (a1), (b1), (a2), (b2), (aa), or (bb) as described below; (a1) A polynucleotide consisting of the sequence described in Sequence ID No. 1, (a2) A polynucleotide consisting of the sequence described in Sequence ID No. 3, (b1) A polynucleotide consisting of the sequence described in Sequence ID No. 2, (b2) A polynucleotide consisting of the sequence described in Sequence ID No. 4, (aa) A polynucleotide consisting of a sequence having 98.0% or more identity with the base sequence of Sequence ID No. 1 or 3, (bb) A polynucleotide consisting of a sequence having 98.0% or more identity with the base sequence of Sequence ID No. 2 or 4.

Images