Methods for manufacturing model animals

Abstract

To provide an animal model having a calcific substance in muscular fiber and being stable for a long period of time, production method of animal models capable of highly efficiently inducing the calcific substance into the muscular fiber and being stable for the long period of time, and calcification agent of the muscular fiber capable of highly efficiently inducing the calcific agent into the muscular fiber.SOLUTION: An animal model include a calcific substance containing hydroxyapatite crystal in muscular tissue. A production method of an animal model is characterized by administering notexin to a non-human animal and inducing the calcific substance into the muscular tissue. A calcification agent of the muscular tissue is characterized by including the notexin.SELECTED DRAWING: Figure 9

Description

Technical Field

[0001] The present invention relates to a model animal, a method for producing the same, and a calcifying agent.

Background Art

[0002] Skeletal muscle tissue is composed of flexible muscle fibers and is particularly important for motor function. However, in certain pathological conditions, such as genetic diseases, severe trauma, brain contusion, burns, around artificial joints, etc., it is known that hard tissues that have calcified firmly are formed in the muscle tissue. The ectopic calcifications formed within the muscle tissue often remain for a long time and cause impairments in pain, motor function, etc. To date, there has been no conclusion in the discussion as to whether such hard tissues are bone tissues, and there are also problems that the properties of the calcifications, their formation mechanisms, prevention methods, and treatment methods have not been clarified. Therefore, there is a need to provide a model animal for ectopic calcification.

[0003] As a model animal for ectopic calcification diseases, a model animal has been proposed in which [substance] is injected into the Achilles tendon of a rat to induce calcification in the Achilles tendon (see Patent Document 1). Mycobacter butyricum However, since the Achilles tendon is formed from collagen fibers (see Non-Patent Document 1) and has a completely different structure from muscle fibers, it cannot be used as a model for the aforementioned pathological conditions of muscle tissue. Therefore, for the study of the properties of the calcifications formed in muscle tissue, their formation mechanisms, prevention methods, and treatment methods, the establishment of a stable model in which hard tissues that have calcified firmly are formed in muscle tissue is strongly desired.

[0004]

Prior Art Documents

Patent Documents

[0005]

Patent Document 1

Non-Patent Documents

[0006] [Non-Patent Document 1] Takeo Sakai and Katsumasa Kawahara (eds.), "Normal Structure and Function of the Human Body," Japan Medical News Co., Ltd. [Overview of the project] [Problems that the invention aims to solve]

[0007] The present invention aims to solve the aforementioned problems in the conventional era and achieve the following objectives. Specifically, the present invention aims to provide a model animal having calcifications in muscle tissue and being stable for a long period of time, a method for producing a model animal that can efficiently induce calcifications in muscle tissue and is stable for a long period of time, and a calcifying agent for muscle fibers that can efficiently induce calcifications in muscle tissue. [Means for solving the problem]

[0008] The means to solve the aforementioned problem are as follows: <1> This is a model animal characterized by having calcified tissue within its muscle tissue. <2> The calcified material contains hydroxyapatite crystals. <1> It is a model animal as described in [the text]. <3> The calcified material does not contain osteoblasts and osteoclasts. <1> from <2> It is a model animal described in one of the following. <4> The aforementioned model of ectopic calcification is a pathological model. <1> from <3> It is a model animal described in one of the following. <5> This method for producing a model animal is characterized by administering notexin to a non-human animal to induce calcification in muscle tissue. <6> The model animal has calcifications in its muscle tissue. <5> This is a method for manufacturing the model animals described. <7> The animal is a rodent. <5> from <6> This is a method for producing a model animal as described in any of the following. <8> This is a muscle fiber calcification agent characterized by containing notexin. [Effects of the Invention]

[0009] According to the present invention, the aforementioned problems of the conventional method can be solved and the aforementioned objectives can be achieved, and a stable model animal having calcifications in muscle tissue for a long period of time can be provided, a method for producing a stable model animal that can efficiently induce calcifications in muscle tissue for a long period of time can be provided, and a calcifying agent for muscle fibers that can efficiently induce calcifications in muscle tissue can be provided. [Brief explanation of the drawing]

[0010] [Figure 1] Figure 1 compares a CT image of calcific myonecrosis in humans with a micro-X-ray CT image of calcification in a model animal of the present invention. [Figure 2] Figure 2 shows HE staining images of muscle tissue from mice administered with notexin, mice administered with cardiotoxin, and unadministered mice in Test Example 1. [Figure 3] Figure 3 shows micro-X-ray CT scans of muscle tissue from mice treated with notexin, mice treated with cardiotoxin, and untreated mice in Test Example 2. [Figure 4] Figure 4 shows the results of von Kossa staining and alizarin red S staining of muscle tissue from notexin-treated and untreated mice in Test Example 3. [Figure 5A] Figure 5A shows the results of X-ray diffraction of muscle tissue from untreated mice in Test Example 4. The vertical axis represents intensity (cps), and the horizontal axis represents 2θ (deg). [Figure 5B] Figure 5B shows the results of X-ray diffraction of calcifications in muscle tissue of mice administered with notexin in Test Example 4. The arrows indicate peaks of hydroxyapatite crystals. The vertical axis represents intensity (cps), and the horizontal axis represents 2θ (deg). [Figure 6] Figure 6 shows scanning electron microscope images of calcifications in the muscle tissue of mice administered with notexin and mice that were not administered with notexin in Test Example 4. [Figure 7]FIG. 7 is a diagram showing the results of alizarin red S staining, ALP staining, and TRAP staining of the muscle tissues of BMP transplanted mice and notexin-administered mice in Test Example 5. [Figure 8A] FIG. 8A shows the results of the follow-up observation of the muscle tissues of non-notexin-administered mice and mice 1 day, 2 days, and 3 days after notexin administration in Test Example 6-1 by HE staining, von Kossa staining, and tissue immunostaining. [Figure 8B] FIG. 8B shows the results of the expression levels of TNF-α and IL-6 RNAs in the muscle tissues of non-notexin-administered mice and notexin-administered mice in Test Example 6-2. The vertical axis indicates the relative mRNA expression level. [Figure 9] FIG. 9 shows the results of the follow-up observation of the hindlimbs of mice before notexin administration, 1 week, 3 weeks, 6 months, and 16 months after notexin administration in Test Example 7 by micro-CT. [Mode for Carrying Out the Invention]

[0011] (Model Animal and Method for Producing Model Animal) The model animal of the present invention is an animal having calcified substances in muscle tissue. The method for producing a model animal of the present invention includes an administration step of administering notexin to a non-human animal, and further includes other steps as necessary. The model animal of the present invention is preferably produced by the method for producing a model animal of the present invention. Hereinafter, the model animal of the present invention will be described together with the description of the method for producing a model animal.

[0012] (Administration Step) The administration step is a step of administering notexin to a non-human animal. Thereby, calcified substances are induced in the muscle tissue of the non-human animal.

[0013] -Notexin- The notexin is snake venom derived from Tiger snake. The aforementioned notexin may be a commercially available product or may be prepared from tiger snake. A commercially available notexin can be obtained from Latoxan.

[0014] Conventionally, cardiotoxin derived from Naja mossambica, a type of snake venom, has been widely used as a muscle tissue damage and regeneration inducer. However, administering cardiotoxin to non-human animals does not induce calcification in muscle tissue. The fact that administering notexin, another type of snake venom, can induce calcification in muscle tissue was an unexpected finding for the inventors.

[0015] There are no particular restrictions on the form of the notexin, and it can be appropriately selected depending on the purpose. It may be administered as is, but it is preferable to administer it in the form of a notexin solution mixed with a solvent.

[0016] The solvent is not particularly limited and can be appropriately selected depending on the purpose. Examples include water, physiological saline, and buffer solutions. These may be used individually or in combination of two or more.

[0017] There are no particular restrictions on the concentration of notexin in the notexin solution, and it can be appropriately selected depending on the type of non-human animal. However, the lower limit is preferably 0.5 μg / mL or higher, more preferably 1.0 μg / mL or higher, and particularly preferably 1.5 μg / mL or higher. The upper limit is preferably 20 μg / mL or lower, more preferably 10 μg / mL or lower, and particularly preferably 5 μg / mL or lower. The lower limit and upper limit can be appropriately combined, and the concentration of notexin in the notexin solution is preferably 0.5 μg / mL to 20 μg / mL, more preferably 1.0 μg / mL to 10 μg / mL, and particularly preferably 1.5 μg / mL to 5 μg / mL.

[0018] There are no particular restrictions on the amount of the notexin solution administered to the non-human animal, and it can be appropriately selected depending on the type of non-human animal. However, the lower limit is preferably 10 μL or more, more preferably 100 μL or more, and particularly preferably 150 μL or more. The upper limit is preferably 1,000 μL or less, more preferably 500 μL or less, and particularly preferably 300 μL or less. The lower limit and upper limit can be appropriately combined, and the amount of the notexin solution administered to the non-human animal is preferably 10 μL to 1,000 μL, more preferably 100 μL to 500 μL, and particularly preferably 150 μL to 300 μL.

[0019] There are no particular restrictions on the method of administering the notexin, and it can be appropriately selected depending on the purpose. However, a method that allows the notexin to be administered directly or indirectly into muscle tissue is preferred, such as intramuscular administration or subcutaneous administration. Among these, intramuscular administration is preferred as the method of administering the notexin.

[0020] There are no particular restrictions on the number of times the notexin is administered; it can be appropriately selected according to the purpose, and it may be administered as a single dose or multiple times, but a single dose is simpler and preferable. The method for producing the model animal described above can suitably induce calcification in muscle tissue even with a single dose of notexin.

[0021] There are no particular restrictions on the time elapsed since the administration of notexin to the aforementioned model animals, and it can be appropriately selected according to the intended use of the model animals. Therefore, any non-human animal that has been administered notexin, such as an animal immediately after administration of notexin, an animal 7 days after administration of notexin, an animal 3 weeks after administration of notexin, an animal 6 months after administration of notexin, an animal 16 months after administration of notexin, or an animal that has been administered notexin for 16 months or more, is within the scope of the present invention. In other words, the method for producing the aforementioned model animals is characterized by inducing calcifications in the muscle tissue of the non-human animal, and the model animals obtained by the method for producing the aforementioned model animals include not only those that have calcifications in their muscle tissue, but also animals that have been administered notexin to the non-human animal but before the calcifications have been completely formed in the muscle tissue (a state in which calcifications are being induced in the muscle tissue or in the process of calcifications being formed in the muscle tissue). Furthermore, the aforementioned animal models have the advantage of being able to stably retain calcifications in their muscle tissue for a long period of time, making them suitable for various purposes. For example, depending on the application, such as analyzing the characteristics of muscle fiber calcification, analyzing the mechanism by which calcifications are formed in muscle fibers, analyzing the physiological role of muscle fiber calcification, elucidating the pathogenesis of various diseases involving calcification in muscle tissue, researching methods for preventing or treating the aforementioned diseases, or screening and developing preventive or therapeutic drugs for the aforementioned diseases, a model animal having a calcification process or state can be appropriately selected.

[0022] -Non-human animals- The aforementioned non-human animals are not particularly limited and can be appropriately selected depending on the purpose. Examples include rodents, lagomorphs, carnivores, artiodactyla, primates, canis, mustelae, suis, and primates. Examples of the aforementioned rodents include mice, rats, gerbils, Okinawa mice, Sikkim mice, Chinese hamsters, and guinea pigs. Other non-human animals include, for example, rabbits, dogs, cats, ferrets, goats, sheep, cows, pigs, crab-eating macaques, rhesus macaques, and marmosets. Among these, rodents are preferred as non-human animals because they are easy to handle and useful as experimental animals, mice and rats are more preferred, and mice are particularly preferred.

[0023] <Model Animals> The calcified material found in the aforementioned model animal is formed by administering the notexin to a non-human animal. The aforementioned calcified material can be confirmed using micro X-ray CT (for example, CosmoScan GX, manufactured by Rigaku Corporation).

[0024] The calcified material contains calcium phosphate hydroxyapatite crystals and does not contain osteoblasts or osteoclasts. The presence of calcium phosphate hydroxyapatite crystals in the calcified material can be confirmed by methods such as von Kossa staining, alizarin red S staining, X-ray diffraction, and scanning electron microscopy.

[0025] In addition to having calcifications in the muscle tissue, the aforementioned animal models also exhibit characteristics of an inflammatory response. Specifically, hematoxylin-eosin (HE) staining reveals infiltration of cell groups considered to be inflammatory cells, and furthermore, infiltration of CD11b, a marker for monocyte-macrophages, increased expression of TNF-α mRNA, and increased expression of IL-6 mRNA are observed. These inflammatory responses can be confirmed by methods such as HE staining, immunohistochemistry, and reverse transcription PCR (RT-PCR).

[0026] The aforementioned animal models can be used to analyze the characteristics of muscle fiber calcification induced by pathological conditions in muscle tissue, such as genetic diseases, severe trauma, brain contusions, burns, and around artificial joints, as well as its formation mechanisms and physiological roles. Furthermore, as shown in Figure 1, the CT images of calcific myonecrosis in humans (see Barron SL & MacGrory BJ, Arthroplast Today, 2018, 4(4), pp. 421-425) and the micro-X-ray CT images of calcifications in the model animal of the present invention are very similar. Therefore, the model animal is useful as a pathological model for various diseases involving calcification (ectopic calcification) in muscle tissue, such as fibrodysplasia ossificans progressiva (FOP) and calcific myonecrosis. Moreover, it is expected to be useful in elucidating the pathogenesis of these diseases and in developing methods for prevention, treatment, preventive drugs, and therapeutic drugs for these diseases.

[0027] (Calcification agent for muscle fibers) The muscle fiber calcifying agent of the present invention contains notexin and, if necessary, other components.

[0028] <Notexin> The aforementioned notexin is as described in the <administration step> section of the (method for manufacturing model animals) above.

[0029] The content of the notexin mentioned above is not particularly limited as long as it can induce calcification in muscle tissue, and can be appropriately selected depending on the target patient and other factors.

[0030] <Other ingredients> The aforementioned other components are not particularly limited and can be appropriately selected from pharmacologically acceptable carriers according to the purpose, such as additives, auxiliaries, and solvents. These may be used individually or in combination of two or more.

[0031] There are no particular limitations on the additives or auxiliary agents, and they can be appropriately selected according to the purpose. Examples include disinfectants, preservatives, binders, thickeners, adhesives, binders, colorants, stabilizers, pH adjusters, buffers, isotonic agents, solvents, antioxidants, UV inhibitors, crystal precipitation inhibitors, defoamers, property improvers, and preservatives.

[0032] The aforementioned disinfectant is not particularly limited and can be appropriately selected depending on the purpose. Examples include cationic surfactants such as benzalkonium chloride, benzethonium chloride, and cetylpyridinium chloride.

[0033] There are no particular restrictions on the preservatives mentioned above, and they can be appropriately selected depending on the purpose. Examples include para-hydroxybenzoic acid esters, chlorobutanol, cresol, thimerosal, and phenoxyethanol.

[0034] There are no particular limitations on the binder, thickener, or adhesive, and they can be appropriately selected depending on the purpose. Examples include starch, dextrin, cellulose, methylcellulose, ethylcellulose, carboxymethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose, carboxymethyl starch, pullulan, sodium alginate, ammonium alginate, propylene glycol alginate, guar gum, locust bean gum, acacia gum, xanthan gum, gelatin, casein, polyvinyl alcohol, polyethylene oxide, polyethylene glycol, ethylene-propylene block polymer, sodium polyacrylate, and polyvinylpyrrolidone.

[0035] The aforementioned binder is not particularly limited and can be appropriately selected depending on the purpose. Examples include water, ethanol, propanol, simple syrup, glucose solution, starch solution, gelatin solution, carboxymethylcellulose, hydroxypropylcellulose, hydroxypropyl starch, methylcellulose, ethylcellulose, shellac, calcium phosphate, and polyvinylpyrrolidone.

[0036] There are no particular restrictions on the coloring agent, and it can be appropriately selected depending on the purpose. Examples include titanium dioxide and iron oxide.

[0037] The aforementioned stabilizer is not particularly limited and can be appropriately selected depending on the purpose. Examples include tragacanth, gum arabic, gelatin, sodium pyrosulfite, ethylenediaminetetraacetic acid (EDTA), thioglycolic acid, and thiolactic acid.

[0038] There are no particular limitations on the pH adjusting agent or buffering agent, and they can be appropriately selected depending on the purpose. Examples include sodium citrate, sodium acetate, and sodium phosphate.

[0039] The isotonic agent is not particularly limited and can be appropriately selected depending on the purpose. Examples include sodium chloride, potassium chloride, and glucose.

[0040] The solvent is not particularly limited and can be appropriately selected depending on the purpose. Examples include water, physiological saline, and buffer solutions.

[0041] The content of the other components mentioned above is not particularly limited, as long as it does not impair the effects of the present invention, and can be appropriately selected depending on the purpose.

[0042] -Dosage Form- There are no particular restrictions on the dosage form of the muscle fiber calcifying agent, and it can be appropriately selected depending on the purpose. Examples include solid preparations and liquid preparations. Among these, liquid preparations are preferred.

[0043] There are no particular restrictions on the liquid preparation, and it can be appropriately selected according to the purpose. Examples include syrups, drinks, suspensions, alcoholic preparations, mixed preparations, liquid preparations, eye drops, aerosols, and sprays.

[0044] -Manufacturing method- As for the method of producing the muscle fiber calcifying agent, there are no particular limitations as long as the notexin can be mixed with the other components as needed, and a known method can be appropriately selected according to the purpose, depending on the dosage form and other factors.

[0045] The aforementioned muscle fiber calcification agent can be suitably used to create model animals with calcified tissue and to analyze the mechanism of calcification in muscle fibers using cultured cells (e.g., myoblasts) in vitro. Furthermore, it is expected to be applied to elucidating the pathogenesis of various diseases accompanied by calcification in muscle tissue (ectopic calcification), and to research and development of methods for preventing, treating, and developing preventive and therapeutic drugs for these diseases. [Examples]

[0046] The present invention will be specifically described below with reference to test examples, but the present invention is not limited in any way to these test examples.

[0047] (Test Example 1: Induction of muscle tissue damage by snake venom administration) The effects of snake venom administration on wild-type mice were analyzed using tissue sections. Under 2% by volume isoflurane inhalation anesthesia, 9-week-old wild-type mice (C57BL / 6, obtained from CLEA Japan Co., Ltd.) were administered a single intramuscular dose of 200 μL of 2 μg / mL of notexin (Latoxan) or 10 μM of cardiotoxin (Latoxan) to the hind limb. Three days after administration, the mice were euthanized, the skin was removed, and muscle tissue from the hind limb was collected. As a control, muscle tissue from the hind limb of mice that had not received snake venom was also collected in the same manner. The collected muscle tissue was fixed in 4% paraformaldehyde-phosphate buffer (Nacalai Tesque Co., Ltd.) for two days, then dehydrated with ethanol, replaced with xylene, and embedded in paraffin. Paraffin sections were prepared using a rotary microtome (Leica), stained with hematoxylin-eosin (HE) according to standard procedures, and muscle damage was evaluated using a BZ-9000 (Keyence).

[0048] The results are shown in Figure 2. HE staining revealed that in mice treated with notexin and mice treated with cardiotoxin, muscle fiber damage and infiltration of cell groups considered to be inflammatory cells were observed compared to untreated mice.

[0049] (Test example 2: Ectopic hard tissue formation due to snake venom administration) Under 2% by volume isoflurane inhalation anesthesia, 9-week-old wild-type mice (C57BL / 6, obtained from CREA Nippon Co., Ltd.) were administered a single intramuscular dose of 200 μL of either 2 μg / mL of notexin (Latoxan) or 10 μM of cardiotoxin (Latoxan) to their hind limbs. A control group of mice that had not received snake venom was also kept at the same time. Seven days after administration, under 2% by volume isoflurane inhalation anesthesia, the muscle tissue of the hind limbs was analyzed using micro-X-ray CT (CosmoScan GX, Rigaku Corporation).

[0050] The results are shown in Figure 3. Radiopaque ectopic calcifications were observed in the muscle tissue of mice administered with notexin. On the other hand, no radiopaqueness was observed in the muscle tissue of mice administered with cardiotoxin.

[0051] (Test Example 3: Ectopic hard tissue formation induced by notexin administration) Under 2% by volume isoflurane inhalation anesthesia, 9-week-old wild-type mice (C57BL / 6, obtained from CLEA Nippon Co., Ltd.) were administered a single intramuscular dose of 2 μg / mL of notexin (Latoxan) in 200 μL into their hind limbs. Seven days after administration, the mice were euthanized, their skins were removed, and muscle tissue from the hind limbs was collected. As a control, muscle tissue from the hind limbs of mice that had not received notexin was collected in the same manner. The collected muscle tissue was fixed in 4% paraformaldehyde-phosphate buffer (Nacalai Tesque Co., Ltd.) for two days, then dehydrated with ethanol, replaced with xylene, and embedded in paraffin. Paraffin sections were prepared using a rotary microtome (Leica), stained with von Kossa or Alizarin Red S according to standard procedures, and muscle damage was evaluated using BZ-9000 (Keyence).

[0052] The results are shown in Fig. 4. Von Kossa staining stains calcium phosphate, and alizarin red S staining stains calcium. From these staining images, calcification of calcium was observed in the muscle tissue of the notexin-administered mice.

[0053] (Test Example 4: Component Analysis of Heterotopic Hard Tissue) Under 2% isoflurane inhalation anesthesia, 200 μL of 2 μg / mL notexin (manufactured by Latoxan) was administered once intramuscularly to the hind limbs of 9-week-old wild-type mice (C57BL / 6, obtained from CLEA Japan, Inc.). Seven days after administration, the mice were euthanized, the skin was peeled off, and the muscle tissue of the hind limbs was collected and used as a sample for the following analysis. Also, as a control, the muscle tissue of the hind limbs of notexin-non-administered mice was collected in the same manner, and the collected tissue was fixed in alcohol and then air-dried to be used as a sample for the following analysis.

[0054] <Analysis by X-ray Diffraction> An X-ray diffractometer (MiniFlex 600, manufactured by Rigaku Corporation) was used to analyze the crystal structure of the calcified product in the collected muscle tissue. Monochromatized CuKα rays (wavelength 1.541862 Å) were used for the X-rays, the voltage of the Cu tube was set at 40 kV, and the current was set at 15 mA. The scan speed was set at 1° / sec and the step width was set at 0.02°. By measuring the diffracted X-rays of the sample fixed on the holder, an X-ray diffraction (XRD) pattern was obtained. At that time, the measurement range was 2θ = 3° to 60°.

[0055] [[ID=I6]]The results of X-ray diffraction of the calcified product in the muscle tissue of non-administered mice are shown in Fig. 5A, and the results of X-ray diffraction of the calcified product in the muscle tissue of notexin-administered mice are shown in Fig. 5B. In the notexin-administered mice, a peak of hydroxyapatite crystals (the peak indicated by an arrow in Fig. 5B) was confirmed, and it was found that the calcified product contained hydroxyapatite crystals of calcium phosphate similar to bone. On the other hand, in the non-administered mice, no peak of hydroxyapatite crystals was observed in the X-ray diffraction of the calcified product in the muscle tissue.

[0056] <Analysis by Scanning Electron Microscope> Using a scanning electron microscope (SEM: JSM-6390LA, manufactured by JEOL Ltd.), the calcified substances in the collected muscle tissues were observed. Before observation, the samples fixed on carbon tape were coated with Au-Pd. The acceleration voltage of the electron beam in SEM observation was set at 15 kV. Also, for elemental analysis of the observed calcified substances, an energy dispersive X-ray analyzer (EDS) attached to the SEM was used.

[0057] The results are shown in Fig. 6. In the mice administered with notexin, rod-shaped crystal structures recognized as the crystal structure of hydroxyapatite were observed in the muscle tissues. On the other hand, in the non-administered mice, the said rod-shaped crystal structures were not observed.

[0058] (Test Example 5: Histological Analysis of Heterotopic Hard Tissues) Regarding the heterotopic bone tissue by transplantation of bone morphogenetic protein (BMP) and the calcification of muscle tissues in notexin-administered mice, a comparative study was conducted by the following method.

[0059] <BMP-Transplanted Mice> Colla Tape (registered trademark) (manufactured by Zimmer Biomet Dental KK) cut into a circular shape with a diameter of 4 mm was impregnated with 2.0 μg of BMP-2 (manufactured by Core Frontiers Co., Ltd.), freeze-dried, and a BMP-2 pellet was prepared. Ten-week-old wild-type mice (C57BL / 6, obtained from CLEA Japan, Inc.) were anesthetized by inhalation of 2% isoflurane, the thigh was incised, and the BMP-2 pellet was transplanted into the thigh muscle. Fourteen days after transplantation of the BMP-2 pellet, the mice were euthanized, the thigh muscle was collected, the skin was peeled off, and the collected muscle tissue was fixed with 4% paraformaldehyde phosphate buffer (manufactured by Nacalai Tesque, Inc.) for 2 days, then dehydrated with ethanol, replaced with xylene, and embedded in paraffin.

[0060] <Notexin-Administered Mice> A single intramuscular dose of 200 μL of 2 μg / mL of notexin was administered to the hind limbs of 9-week-old wild-type mice (C57BL / 6, obtained from CREA Nippon Co., Ltd.). Seven days after notexin administration, the mice were euthanized, the skin was removed, and muscle tissue from the hind limbs was collected. The collected muscle tissue was fixed in 4% by mass paraformaldehyde phosphate buffer (Nacalai Tesque Co., Ltd.) for two days, then dehydrated with ethanol, replaced with xylene, and embedded in paraffin.

[0061] Using a rotary microtome (Leica), paraffin sections were prepared from both the BMP transplantation group and the notexin administration group. Following standard procedures, alizarin red S staining, alkaline phosphatase (ALP) staining, and tartrate-resistant acid phosphatase (TRAP) staining were performed, and the tissue sections were observed using a BZ-9000 (Keyence).

[0062] The results are shown in Figure 7. Staining revealed that ALP-positive osteoblasts and TRAP-positive osteoclasts were observed around ectopic bone tissue in muscle tissue induced by BMP-2. On the other hand, ALP-positive osteoblasts and TRAP-positive osteoclasts were not observed in the muscle tissue of mice administered with notexin. In bone, a metabolic turnover process for bone formation is known to occur. First, bone resorption takes place by osteoclasts, followed by bone formation by osteoblasts. Since osteoblasts and osteoclasts were not observed in the muscle tissue of mice administered with notexin, it was considered that the calcifications in the muscle tissue induced by notexin administration were not bone, but rather structures in which hydroxyapatite crystals had physically precipitated.

[0063] (Test Example 6-1: Inflammatory response to notexin administration) Under 2% by volume isoflurane inhalation anesthesia, 9-week-old wild-type mice (C57BL / 6, obtained from CLEA Nippon Co., Ltd.) were administered a single intramuscular dose of 200 μL of 2 μg / mL of notexin (Latoxan) to the hind limb. After 1, 2, or 3 days, the mice were euthanized, the skin was removed, and muscle tissue from the hind limb was collected. As a control, muscle tissue from the hind limb of mice that were not administered notexin was also collected in the same manner. The collected muscle tissue was fixed in 4% paraformaldehyde-phosphate buffer (Nacalai Tesque Co., Ltd.) for 2 days, then dehydrated with ethanol, replaced with xylene, and embedded in paraffin. Paraffin sections were prepared using a rotary microtome (Leica), and H&E staining, von Kossa staining, or immunohistochemical staining were performed according to standard procedures.

[0064] For tissue immunohistochemistry, endogenous peroxidase in paraffin sections was inactivated using an enzyme blocking reagent (SP-6000, VECTOR), followed by suppression of nonspecific adsorption using a blocking agent (Blocking One Histo, Nacalai Tesque Co., Ltd.). CD11b antibody (Abcam) was reacted overnight at 4°C. For the detection of CD11b antibody, HRP-labeled Anti-Rabbit IgG (ImmPRESS Reagent, VECTOR) was used as the secondary antibody. In addition, HRP in the secondary antibody was detected and visualized using DAB (3,3'-diaminobenzidine tetrahydrochloride), and then observed using BZ-9000 (Keyence).

[0065] The results are shown in Figure 8A. Three days after notexin administration, vonkossa-positive calcium phosphate crystals were observed in the muscle tissue. Simultaneously, CD11b, a marker for monocyte macrophages, also appeared in the muscle tissue.

[0066] (Test Example 6-2: Inflammatory response to notexin administration) Under 2% by volume isoflurane inhalation anesthesia, 9-week-old wild-type mice (C57BL / 6, obtained from CREA Nippon Co., Ltd.) were administered a single intramuscular dose of 200 μL of 2 μg / mL of notexin (Latoxan) to the hind limb. Three days later, the mice were euthanized, the skin was removed, and muscle tissue from the hind limb was collected. As a control, muscle tissue from the hind limb of mice that were not administered notexin was similarly collected. Total RNA was extracted from the collected muscle tissue using Nucleo Spin RNA (Takara Bio Inc.). This total RNA was reverse transcribed into cDNA using RNA to cDNA EcoDry Premix (Takara Bio Inc.) as a template. Furthermore, quantitative reverse transcription PCR (RT-qPCR) was performed using the obtained cDNA as a template with the following primers and Premix Ex Taq (Takara Bio Inc.) on a Thermal Cycler Dice Real-time system TP800 (Takara Bio Inc.) to quantify the RNA expression levels of TNF-α and IL-6. The RNA expression levels of each gene were corrected using the RNA expression level of the GAPDH gene. [primer] -TNF-α- • Forward: ATGAGCACAGAAAGCATGA (Sequence ID: 1) • Reverse: AGTAGACAGAAGAGCGTGGT (Sequence ID: 2) -IL-6- • Forward: CCTCTGGTCTTCTGGAGTACC (Sequence ID: 3) • Reverse: ACTCCTTCTGTGACTCCAGC (Sequence ID: 4) -GAPDH- • Use the Mouse Housekeeping Gene Primer Set (manufactured by Takara Bio Inc.).

[0067] The results are shown in Figure 8B. Three days after notexin administration, the mRNA expression levels of the inflammatory cytokines TNF-α and IL-6 increased approximately 100-fold in the notexin-administered group compared to the control group. This inflammatory response is expected to be an important mechanism that promotes the precipitation of calcium phosphate crystals in muscle tissue.

[0068] (Test Example 7: Persistence of ectopic calcification induced by notexin administration) Under 2% by volume isoflurane inhalation anesthesia, 200 μL of 2 μg / mL of notexin (Latoxan) was administered intramuscularly as a single dose to the hind limbs of 9-week-old wild-type mice (C57BL / 6, obtained from CREA Nippon Co., Ltd.). Muscle tissue from the hind limbs of the same mice was analyzed using micro-X-ray CT (CosmoScan GX, Rigaku Corporation) under 2% by volume isoflurane inhalation anesthesia before notexin administration, and 1 week, 3 weeks, 6 months, and 16 months after notexin administration.

[0069] The results are shown in Figure 9. Ectopic calcification caused by notexin administration persisted for more than one year. The results of Test Example 4 indicated that the calcified material in muscle tissue is a hydroxyapatite crystal of calcium phosphate, similar to that in bone. However, the results of Test Example 5 suggest that, unlike bone tissue, osteoclasts that resorb bone do not enter the body, and therefore, the calcified material is thought to remain in the body for a long period of time. [Industrial applicability]

[0070] The animal model of the present invention can be used to analyze the characteristics, formation mechanisms, and physiological roles of calcification in muscle tissue induced by pathological conditions of muscle tissue, such as genetic diseases, severe trauma, cerebral contusions, burns, and around artificial joints. Furthermore, the animal model of the present invention is useful as a pathological model for various diseases involving calcification (ectopic calcification) in muscle tissue, such as fibrodysplasia ossificans progressive (FOP) and calcific myonecrosis. Moreover, it is expected to be applicable to elucidating the pathogenesis of these diseases and to the development of methods for prevention, treatment, preventive drugs, and therapeutic drugs for the aforementioned diseases. Furthermore, the method for producing model animals according to the present invention can efficiently induce calcification within muscle tissue and is suitably usable as a method for producing model animals that are stable over a long period of time. Furthermore, the muscle fiber calcification agent of the present invention can be suitably used to create model animals having calcified tissue within muscle tissue, and to analyze the mechanism of calcification in muscle fibers using cultured cells (e.g., myoblasts) in vitro. In addition, it is expected to be applied to elucidating the pathogenesis of various diseases accompanied by calcification (ectopic calcification) within muscle tissue, and to research and development of methods for preventing, treating, preventing, and treating these diseases.

Claims

1. A method for producing a model mouse, comprising administering 200 μL to 1,000 μL of a notexin solution containing 2 μg / mL to 20 μg / mL to a wild-type mouse, characterized in that it induces calcification in the muscle tissue that contains hydroxyapatite crystals and does not contain osteoblasts or osteoclasts.

2. The method for producing the model mouse according to Claim 1, wherein the model mouse has the calcified material in its muscle tissue for six months or more after administration of the notexin solution.

3. The method for producing a model mouse according to claim 1 or 2, wherein in the administration, 200 μL to 300 μL of the notexin solution in a concentration of 2 μg / mL to 5 μg / mL is administered to the wild-type mouse.

4. A method for producing a model mouse according to any one of claims 1 to 3, wherein the model mouse has the calcified material in its muscle tissue for 16 months or more after administration of the notexin solution.

Images