Compositions and methods for kallikrein (KLKB1) gene editing
The CRISPR/Cas system targets the KLKB1 gene to reduce prekallikrein and bradykinin levels, addressing the inadequacies of current HAE treatments by providing a long-term solution for hereditary angioedema.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- INTELLIA THERAPEUTICS INC
- Filing Date
- 2021-02-05
- Publication Date
- 2026-07-01
AI Technical Summary
Hereditary angioedema (HAE) is caused by excess bradykinin due to a deficiency in the C1 inhibitor protein, leading to vascular leakage and swelling, for which current treatments are inadequate in providing long-term or permanent solutions.
The use of a CRISPR/Cas system to knock out the KLKB1 gene, reducing prekallikrein production and bradykinin levels through guide RNAs and RNA guide DNA binders, such as Cas9, to inhibit the kallikrein-kinin pathway.
This approach substantially reduces bradykinin production, potentially offering a long-term treatment by significantly decreasing the frequency and severity of HAE attacks and associated symptoms.
Smart Images

Figure 0007883437000100 
Figure 0007883437000101 
Figure 0007883437000102
Abstract
Description
[Technical Field]
[0001] This application claims priority to U.S. Provisional Patent Application No. 62 / 971,906 filed on 7 February 2020, U.S. Provisional Patent Application No. 62 / 981,965 filed on 26 February 2020, and U.S. Provisional Patent Application No. 63 / 019,076 filed on 1 May 2020, the contents of each of these, in whole, are incorporated herein by reference for all purposes.
[0002] This application includes an electronically submitted sequence listing in ASCII format, the entirety of which is incorporated herein by reference. The name of the above ASCII copy, created on 4 February 2021, is 01155-0031-00PCT_ST25.txt, and its size is 184,584 bytes. [Background technology]
[0003] Hereditary angioedema (HAE) affects 1 in 50,000 people and accounts for 15,000 to 30,000 emergency room visits annually. HAE is a rare autosomal dominant hereditary vascular disorder characterized by recurrent events of severe swelling (angioedema). The most common areas of the body where swelling occurs are the limbs, face, GI ducts, and airways. Minor trauma or stress may trigger an attack, but swelling often occurs without a known trigger. Events involving the intestines cause severe abdominal pain, nausea, and vomiting. Airway swelling can restrict breathing and may lead to life-threatening airway obstruction or suffocation. Symptoms of HAE typically begin in childhood and worsen during adolescence. On average, untreated individuals experience attacks every 1-2 weeks, and most events last about 3-4 days. There are three types of hereditary angioedema, known as type I, type II, and type III, and the different types have similar signs and symptoms.
[0004] Hereditary angioedema is caused by an excess of bradykinin in the blood, which promotes events of vascular permeability and swelling. Most HAE patients have a deficiency in the C1 inhibitor protein (also called C1 esterase inhibitor or C1-INH). In the absence of C1-INH, bradykinin levels rise, initiating vascular leakage and potentially causing swelling attacks. Its production is controlled via the kallikrein-kinin (contact) pathway, which is intrinsically inhibited by C1-INH. Bradykinin peptides are formed when high molecular weight kininogen (HMWK) is cleaved by plasma kallikrein (pKal), which is the activated form of the protein prekallikrein. Prekallikrein is encoded by KLKB1 and is also called the KLKB1 protein. The KLKB1 protein is produced in the liver and secreted into the plasma, which can be activated by factor XIIa. When KLKB1 is activated, pKal can increase bradykinin levels. Excess bradykinin in the blood causes fluid leakage through the blood vessel walls into body tissues. Excessive fluid accumulation in body tissues leads to the swelling seen in HAE patients.
[0005] Several drugs targeting the kallikrein-kinin pathway have been developed, including C1 esterase inhibitors (Berinert®, Cinryze®), recombinant C1-INH replacement therapy (rhC1INH, conestat alfa (Rhucin®, Ruconest®), and bradykinin receptor antagonists (Icatibant, Firazyr®)). Approaches using kallikrein or prekallikrein (KLKB1) inhibitors have also been developed (ecalantide, Kalbitor®, lanadermab, Takhzyro®). [Overview of the project] [Problems that the invention aims to solve]
[0006] The present invention provides a composition and method for using the CRISPR / Cas system to knock out the KLKB1 gene, thereby reducing the production of prekallikrein (KLKB1), reducing kallikrein, and reducing bradykinin production in subjects with HAE. [Means for solving the problem]
[0007] Accordingly, the following embodiments are provided. In some embodiments, the present invention provides compositions and methods for substantially reducing or knocking out the expression of the KLKB1 gene, thereby substantially reducing or eliminating bradykinin production, using a guide RNA together with an RNA guide DNA binder such as a CRISPR / Cas system. Substantially reducing or eliminating bradykinin production by modifying the KLKB1 gene may constitute a long-term or permanent treatment.
[0008] The following embodiments are provided herein.
[0009] Embodiment A1 is a guide RNA, a. A guide sequence containing at least 95%, 90%, or 85% identicalness to the sequence selected from sequence numbers 15, 8, and 41. b. A guide sequence containing at least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from sequence numbers 15, 8, and 41, or c. A guide RNA containing a guide sequence selected from SEQ ID NOs: 15, 8, and 41.
[0010] Embodiment A2 is the guide RNA of Embodiment A1, further comprising the nucleotide sequence of Sequence ID No. 202.
[0011] Embodiment A3 is the guide RNA of Embodiment A1, wherein the guide RNA further comprises a nucleotide sequence selected from SEQ ID NOs: 170, 171, 172, and 173, and the sequence of SEQ ID NOs: 170, 171, 172, or 173 is the 3' of the guide sequence.
[0012] Embodiment A4 is one of the guide RNAs from Embodiments A1 to A3, wherein the guide RNA further includes a 3' tail.
[0013] Embodiment A5 is a guide RNA from any one of Embodiments A1 to A4, wherein the guide RNA includes at least one modification.
[0014] Embodiment A6 is the guide RNA of Embodiment A5, wherein the modification includes a 5' terminal modification.
[0015] Embodiment A7 is a guide RNA of Embodiment A5 or A6, wherein the modification includes a 3' terminal modification.
[0016] Embodiment A8 is a guide RNA from any one of Embodiments A1 to A7, wherein the guide RNA includes modifications in the hairpin region.
[0017] Embodiment A9 is a guide RNA from any one of Embodiments A1 to A8, wherein the modification includes a 2'-O-methyl (2'-O-Me) modified nucleotide.
[0018] Embodiment A10 is a guide RNA from any one of Embodiments A1 to A9, wherein the modification includes internucleotide phosphorothioate (PS) binding.
[0019] Embodiment A11 is a guide RNA from any one of Embodiments A1 to A10, wherein the modification includes a 2'-fluor(2'F) modified nucleotide.
[0020] Embodiment A12 is a guide RNA from either Embodiment A1 or any one of A3-A11, further comprising the nucleotide sequence of Sequence ID No. 171.
[0021] Embodiment A13 is the guide RNA of Embodiment A12, modified according to the nucleotide sequence pattern of SEQ ID NO: 405.
[0022] Embodiment A14 is a guide RNA of any one of Embodiments A1 or A3 - A11, further comprising the nucleotide sequence of SEQ ID NO: 173.
[0023] Embodiment A15 is the guide RNA of Embodiment A14, modified according to the pattern of SEQ ID NOs: 248 - 255 or 450.
[0024] Embodiment A16 is a guide RNA of any one of Embodiments A12 - A15, wherein the guide sequence is SEQ ID NO: 15.
[0025] Embodiment A17 is a guide RNA of any one of Embodiments A12 - A15, wherein the guide sequence is SEQ ID NO: 8.
[0026] Embodiment A18 is a guide RNA of any one of Embodiments A12 - A15, wherein the guide sequence is SEQ ID NO: 41.
[0027] Embodiment A19 is a guide RNA of any one of Embodiments A1 or A4 - A11, wherein the guide RNA is modified according to the pattern of SEQ ID NO: 300, and N is collectively the guide sequence of Embodiment A1.
[0028] Embodiment A20 is the guide RNA of Embodiment A16, wherein each N in SEQ ID NO: 300 is any natural or non - natural nucleotide.
[0029] Embodiment A21 has a guide sequence of SEQ ID NO: 1, and the guide RNA is mG*mG*mA*UUGCGUAUGGGACACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (Sequence ID 603)The guide RNA of Embodiment A19 is modified according to the formula, where "mA", "mC", "mU", or "mG" indicates a nucleotide modified with 2'-O-Me, * indicates a phosphorothioate bond, and N is a native nucleotide.
[0030] Embodiment A22 has a guide sequence, sequence number 8, and guide RNA, mU*mA*mC*CCGGGAGUUGACUUUGGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmGmGmCmU*mU*mU*mU (Sequence ID 604) The guide RNA of Embodiment A19 is modified according to the formula, where "mA", "mC", "mU", or "mG" indicates a nucleotide modified with 2'-O-Me, * indicates a phosphorothioate bond, and N is a native nucleotide.
[0031] Embodiment A23 has a guide sequence, SEQ ID NO: 41, and a guide RNA, mU*mU*mU*ACUCCCAGAAGACUGUA GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCamAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU*mU (Sequence ID 605) The guide RNA of Embodiment A19 is modified according to the formula, where "mA", "mC", "mU", or "mG" indicates a nucleotide modified with 2'-O-Me, * indicates a phosphorothioate bond, and N is a native nucleotide.
[0032] Embodiment A24 is a composition comprising one of the guide RNAs from Embodiments A1 to A23.
[0033] Embodiment A25 is the composition of Embodiment A24, further comprising an RNA guide DNA binder or a nucleic acid encoding an RNA guide DNA binder.
[0034] Embodiment A26 is the composition of Embodiment A25, wherein the nucleic acid encoding the RNA guide DNA binder comprises mRNA containing an open reading frame (ORF) encoding the RNA guide DNA binder.
[0035] Embodiment A27 is the composition of Embodiment A25 or A26, wherein the RNA guide DNA binding agent is Cas9.
[0036] Embodiment A28 is the composition of Embodiment A27, wherein Cas9 is S.pyogenes Cas9.
[0037] Embodiment A29 is one of the compositions from Embodiments A26 to A28, wherein ORF is a modified ORF.
[0038] Embodiment A30 is one of the compositions from Embodiments A24 to A29, further comprising a pharmaceutical excipient.
[0039] Embodiment A31 is one of the compositions from Embodiments A24 to A30, wherein the guide RNA is associated with lipid nanoparticles (LNPs).
[0040] Embodiment A32 is the composition of Embodiment A31, wherein the LNP contains a cationic lipid.
[0041] Embodiment A33 is the composition of Embodiment A32, wherein the cationic lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate.
[0042] Embodiment A34 is one of the compositions from Embodiments A31 to A33, wherein the LNP is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-dienoate (also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate), DSPC, cholesterol, and PEG2k-DMG.
[0043] Embodiment A35 is a pharmaceutical composition comprising one guide RNA from Embodiments A1 to A23 or one composition from Embodiments A24 to A34.
[0044] Embodiment A36 is a pharmaceutical composition comprising any one guide RNA from Embodiments A1 to A23 or any one composition from Embodiments A24 to A34, or a use thereof, for inducing double-strand or single-strand breaks in the KLKB1 gene within a cell, or for reducing the expression of KLKB1 within a cell.
[0045] Embodiment A37 is the pharmaceutical composition of Embodiment A36, or its use, for reducing the expression of the KLKB1 gene in cells or subjects.
[0046] Embodiment A38 is a pharmaceutical composition comprising any one guide RNA from Embodiments A1 to A23 or any one composition from Embodiments A24 to A34, or a use thereof, for treating a subject having hereditary angioedema (HAE).
[0047] Embodiment A39 is the pharmaceutical composition of Embodiment A38, or its use thereof, which includes reducing the frequency and / or severity of HAE attacks.
[0048] Embodiment A40 is a pharmaceutical composition comprising any one guide RNA from Embodiments A1 to A23 or any one composition from Embodiments A24 to A34, or a use thereof, for treating or preventing HAE-related angioedema, bradykinin production and accumulation, bradykinin-induced swelling, airway angioedema occlusion, or suffocation.
[0049] Embodiment A41 is a pharmaceutical composition or use thereof comprising any one guide RNA from Embodiments A1 to A23 or any one composition from Embodiments A24 to A34 for reducing total plasma kallikrein activity or reducing prekallikrein and / or kallikrein levels in a subject.
[0050] Embodiment A42 is the pharmaceutical composition of Embodiment A41, or its use thereof, in which the total plasma kallikrein activity is reduced by more than 60%.
[0051] Embodiment A43 is a method, or a method for inducing double-strand or single-strand breaks in the KLKB1 gene within a cell, or reducing the expression of KLKB1 within a cell, comprising contacting a cell with a guide RNA from any one of Embodiments A1 to A23 or a composition from any one of Embodiments A24 to A34.
[0052] Embodiment A44 is the method of Embodiment A43, wherein the cells are within the scope of the subject.
[0053] Embodiment A45 is a method for treating a subject having hereditary angioedema (HAE), comprising administering one guide RNA from any one of Embodiments A1 to A23 or one composition from any one of Embodiments A24 to A34, thereby treating the subject.
[0054] Embodiment A46 is the method of Embodiment A45, wherein treating the subject involves reducing the frequency and / or severity of HAE attacks.
[0055] Embodiment A47 is a method for treating or preventing HAE-related angioedema, bradykinin production and accumulation, bradykinin-induced swelling, airway angioedema-induced obstruction, or suffocation, comprising administering one guide RNA from any one of Embodiments A1 to A23 or one composition from any one of Embodiments A24 to A34 to a subject, thereby treating or preventing HAE-related angioedema, bradykinin production and accumulation, bradykinin-induced swelling, airway angioedema-induced obstruction, or suffocation in the subject.
[0056] Embodiment A48 is a method for reducing total plasma kallikrein activity in a subject, comprising administering one guide RNA from Embodiments A1 to A23 or one composition from Embodiments A24 to A34, thereby reducing total plasma kallikrein activity in the subject.
[0057] Embodiment A49 is the method of Embodiment A48, wherein the total plasma kallikrein activity is reduced by more than 60% in the subject.
[0058] Embodiment A50 is the use of one guide RNA from Embodiments A1 to A23 or one composition from Embodiments A24 to A34 in the preparation of a pharmaceutical product for carrying out one of the methods from Embodiments A43 to A49.
[0059] Additional embodiments are provided herein.
[0060] Embodiment 1 is a method for inducing double-strand breaks (DSBs) or single-strand breaks (SSBs) within the KLKB1 gene, comprising delivering a composition to a cell, wherein the composition a. Guide RNA, i. A guide sequence selected from sequence numbers 1 to 149, or ii. At least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from sequence numbers 1 to 149, or iii. A guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from sequence numbers 1 to 149, or iv. A guide sequence containing any one of sequence numbers 1, 7, 8, 15, 26, 27, 28, 41, 42, 46, 51, 52, 53, 56, 69, or 71, or v. A guide sequence containing any one of sequence numbers 8, 15, 41, 51, or 69, or vi. A sequence containing 15 consecutive nucleotides ± 10 nucleotides at the genomic coordinates listed in Table 1, or At least 17, 18, 19, or 20 consecutive nucleotides from the sequence starting from vii.(vi), or A guide RNA containing a guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from viii.(vi), and optionally, b. A method comprising an RNA guide DNA binder, or a nucleic acid encoding an RNA guide DNA binder.
[0061] Embodiment 2 is a method for reducing the expression of the KLKB1 gene, comprising delivering a composition to cells, wherein the composition a. Guide RNA, i. A guide sequence selected from sequence numbers 1 to 149, or ii. At least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from sequence numbers 1 to 149, or iii. A guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from sequence numbers 1 to 149, or iv. A guide sequence containing any one of sequence numbers 1, 7, 8, 15, 26, 27, 28, 41, 42, 46, 51, 52, 53, 56, 69, or 71, or v. A guide sequence containing any one of sequence numbers 8, 15, 41, 51, or 69, or vi. A sequence containing 15 consecutive nucleotides ± 10 nucleotides at the genomic coordinates listed in Table 1, or At least 17, 18, 19, or 20 consecutive nucleotides from the sequence starting from vii.(vi), or A guide RNA containing a guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from viii.(vi), and optionally, b. A method comprising an RNA guide DNA binder, or a nucleic acid encoding an RNA guide DNA binder.
[0062] Embodiment 3 is a method for treating or preventing hereditary angioedema (HAE), comprising administering a composition to a subject in need thereof, wherein the composition is a. Guide RNA, i. A guide sequence selected from sequence numbers 1 to 149, or ii. At least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from sequence numbers 1 to 149, or iii. A guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from sequence numbers 1 to 149, or iv. A guide sequence containing any one of sequence numbers 1, 7, 8, 15, 26, 27, 28, 41, 42, 46, 51, 52, 53, 56, 69, or 71, or v. A guide sequence containing any one of sequence numbers 8, 15, 41, 51, or 69, or vi. A sequence containing 15 consecutive nucleotides ± 10 nucleotides at the genomic coordinates listed in Table 1, or At least 17, 18, 19, or 20 consecutive nucleotides from the sequence starting from vii.(vi), or A guide RNA containing a guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from viii.(vi), and optionally, b. A method comprising an RNA guide DNA binder, or a nucleic acid encoding an RNA guide DNA binder, thereby treating or preventing HAE.
[0063] Embodiment 4 is a method for treating or preventing angioedema caused by or associated with HAE, comprising administering a composition to a subject in need thereof, wherein the composition a. Guide RNA, i. A guide sequence selected from sequence numbers 1 to 149, or ii. At least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from sequence numbers 1 to 149, or iii. A guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from sequence numbers 1 to 149, or iv. A guide sequence containing one of sequence numbers 1, 7, 8, 15, 26, 27, 28, 41, 42, 46, 51, 52, 53, 56, 69, or 71, or v. A guide sequence containing any one of sequence numbers 8, 15, 41, 51, or 69, or vi. A sequence containing 15 consecutive nucleotides ± 10 nucleotides at the genomic coordinates listed in Table 1, or At least 17, 18, 19, or 20 consecutive nucleotides from the sequence starting from vii.(vi), or A guide RNA containing a guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from viii.(vi), and optionally, b. A method comprising an RNA guide DNA binder, or a nucleic acid encoding an RNA guide DNA binder, for treating or preventing angioedema caused by HAE or angioedema associated with HAE.
[0064] Embodiment 5 is a method for treating or preventing one of bradykinin production and accumulation, bradykinin-induced swelling, airway angioedema obstruction, or suffocation, comprising administering a composition to a subject in need thereof, wherein the composition is a. Guide RNA, i. A guide sequence selected from sequence numbers 1 to 149, or ii. At least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from sequence numbers 1 to 149, or iii. A guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from sequence numbers 1 to 149, or iv. A guide sequence containing any one of sequence numbers 1, 7, 8, 15, 26, 27, 28, 41, 42, 46, 51, 52, 53, 56, 69, or 71, or v. A guide sequence containing any one of sequence numbers 8, 15, 41, 51, or 69, or vi. A sequence containing 15 consecutive nucleotides ± 10 nucleotides at the genomic coordinates listed in Table 1, or At least 17, 18, 19, or 20 consecutive nucleotides from the sequence starting from vii.(vi), or A guide RNA containing a guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from viii.(vi), and optionally, b. A method comprising an RNA guide DNA binder, or a nucleic acid encoding an RNA guide DNA binder, for treating or preventing any one of the following: bradykinin production and accumulation, bradykinin-induced swelling, airway angioedema, or suffocation.
[0065] Embodiment 6 is a method for reducing the frequency and / or severity of HAE attacks, comprising administering a composition to a subject in need thereof, wherein the composition is a. Guide RNA, i. A guide sequence selected from sequence numbers 1 to 149, or ii. At least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from sequence numbers 1 to 149, or iii. A guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from sequence numbers 1 to 149, or iv. A guide sequence containing any one of sequence numbers 1, 7, 8, 15, 26, 27, 28, 41, 42, 46, 51, 52, 53, 56, 69, or 71, or v. A guide sequence containing any one of sequence numbers 8, 15, 41, 51, or 69, or vi. A sequence containing 15 consecutive nucleotides ± 10 nucleotides at the genomic coordinates listed in Table 1, or At least 17, 18, 19, or 20 consecutive nucleotides from the sequence starting from vii.(vi), or A guide RNA containing a guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from viii.(vi), and optionally, b. A method comprising an RNA guide DNA binder, or a nucleic acid encoding an RNA guide DNA binder, thereby reducing the frequency and / or severity of HAE seizures.
[0066] Embodiment 7 is a method for reducing the frequency and / or severity of angioedema attacks in a subject, or for achieving remission of angioedema attacks, comprising administering a composition to a subject in need thereof, wherein the composition is a. Guide RNA, i. A guide sequence selected from sequence numbers 1 to 149, or ii. At least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from sequence numbers 1 to 149, or iii. A guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from sequence numbers 1 to 149, or iv. A guide sequence containing any one of sequence numbers 1, 7, 8, 15, 26, 27, 28, 41, 42, 46, 51, 52, 53, 56, 69, or 71, or v. A guide sequence containing any one of sequence numbers 8, 15, 41, 51, or 69, or vi. A sequence containing 15 consecutive nucleotides ± 10 nucleotides at the genomic coordinates listed in Table 1, or At least 17, 18, 19, or 20 consecutive nucleotides from the sequence starting from vii.(vi), or A guide RNA containing a guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from viii.(vi), and optionally, b. A method comprising an RNA guide DNA binder or a nucleic acid encoding an RNA guide DNA binder, thereby reducing the frequency and / or severity of angioedema attacks in a subject or achieving remission of angioedema attacks.
[0067] Embodiment 8 is a method for reducing total plasma kallikrein activity, comprising administering a composition to a subject requiring it, wherein the composition a. Guide RNA, i. A guide sequence selected from sequence numbers 1 to 149, or ii. At least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from sequence numbers 1 to 149, or iii. A guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from sequence numbers 1 to 149, or iv. A guide sequence containing any one of sequence numbers 1, 7, 8, 15, 26, 27, 28, 41, 42, 46, 51, 52, 53, 56, 69, or 71, or v. A guide sequence containing any one of sequence numbers 8, 15, 41, 51, or 69, or vi. A sequence containing 15 consecutive nucleotides ± 10 nucleotides at the genomic coordinates listed in Table 1, or At least 17, 18, 19, or 20 consecutive nucleotides from the sequence starting from vii.(vi), or A guide RNA containing a guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from viii.(vi), and optionally, b. A method comprising an RNA guide DNA binder, or a nucleic acid encoding an RNA guide DNA binder, thereby achieving remission of an angioedema attack and reducing total plasma kallikrein activity in a subject.
[0068] Embodiment 9 is the method of Embodiment 8, further comprising an activation step for converting prekallikrein to its active form, pKal.
[0069] Embodiment 10 is the method of Embodiment 8, wherein the total plasma kallikrein activity is reduced by more than 60%, more than 85%, or more than 60-80%.
[0070] Embodiment 11 is a method for lowering total plasma kallikrein levels, comprising administering a composition to a subject in need thereof, wherein the composition is a. Guide RNA, i. A guide sequence selected from sequence numbers 1 to 149, or ii. At least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from sequence numbers 1 to 149, or iii. A guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from sequence numbers 1 to 149, or iv. A guide sequence containing any one of sequence numbers 1, 7, 8, 15, 26, 27, 28, 41, 42, 46, 51, 52, 53, 56, 69, or 71, or v. A guide sequence containing any one of sequence numbers 8, 15, 41, 51, or 69, or vi. A sequence containing 15 consecutive nucleotides ± 10 nucleotides at the genomic coordinates listed in Table 1, or At least 17, 18, 19, or 20 consecutive nucleotides from the sequence starting from vii.(vi), or A guide RNA containing a guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from viii.(vi), and optionally, b. A method comprising an RNA guide DNA binder, or a nucleic acid encoding an RNA guide DNA binder, thereby measuring the total plasma kallikrein level.
[0071] Embodiment 12 is a method for reducing prekallikrein and / or kallikrein levels, comprising administering a composition to a subject in need thereof, wherein the composition a. Guide RNA, i. A guide sequence selected from sequence numbers 1 to 149, or ii. At least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from sequence numbers 1 to 149, or iii. A guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from sequence numbers 1 to 149, or iv. A guide sequence containing any one of sequence numbers 1, 7, 8, 15, 26, 27, 28, 41, 42, 46, 51, 52, 53, 56, 69, or 71, or v. A guide sequence containing any one of sequence numbers 8, 15, 41, 51, or 69, or vi. A sequence containing 15 consecutive nucleotides ± 10 nucleotides at the genomic coordinates listed in Table 1, or At least 17, 18, 19, or 20 consecutive nucleotides from the sequence starting from vii.(vi), or A guide RNA containing a guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from viii.(vi), and optionally, b. A method comprising an RNA guide DNA binder, or a nucleic acid encoding an RNA guide DNA binder, thereby reducing prekallikrein and / or kallikrein.
[0072] Embodiment 13 is one of the methods from the prior embodiments, wherein there is a dose-dependent increase in the edit rate.
[0073] Embodiment 14 is the method of Embodiment 13, wherein there is a dose-dependent decrease in total plasma kallikrein levels.
[0074] Embodiment 15 is the method of Embodiment 13 or 14, wherein there is a dose-dependent decrease in plasma kallikrein activity.
[0075] Embodiment 16 is one of the methods from the prior embodiments, wherein the effect lasts for at least 1 month, 2 months, 4 months, 6 months, 1 year, 2 years, 5 years, 10 years, or longer after administration.
[0076] Embodiment 17 is one of the methods from the prior embodiments, wherein the effect lasts for at least 6 months.
[0077] Embodiment 18 is one of the methods from the prior embodiments, wherein the effect lasts for at least one year.
[0078] Embodiment 19 is the method of Embodiment 6 for reducing the frequency of HAE attacks.
[0079] Embodiment 20 is the method of Embodiment 19, which reduces the frequency by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 60-80%, or at least 40-90%.
[0080] Embodiment 21 is the method of Embodiment 20, which reduces the frequency by at least 60-80%.
[0081] Embodiment 22 is the method of Embodiment 20, which reduces the frequency by at least 40-90%.
[0082] Embodiment 23 is one of the methods from the prior embodiments, wherein the effect lasts for at least 1 month, 2 months, 4 months, 6 months, 1 year, 2 years, 5 years, 10 years, or longer after administration.
[0083] Embodiment 24 is one of the methods from the prior embodiments, wherein the effect lasts for at least 6 months after administration.
[0084] Embodiment 25 is one of the methods from the prior embodiments, wherein the effect lasts for at least one year after administration.
[0085] Embodiment 26 is one of the methods from the prior embodiments, the effect of which is compared to the ground level.
[0086] Embodiment 27 is one of the methods from the prior embodiments, wherein the effect is compared to the baseline level of the target.
[0087] Embodiment 28 is one of the methods from the preceding embodiments, wherein an RNA guide DNA binder or a nucleic acid encoding the RNA guide DNA binder is administered.
[0088] Embodiment 29 is a composition, a. Guide RNA, i. A guide sequence selected from sequence numbers 1 to 149, or ii. At least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from sequence numbers 1 to 149, or iii. A guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from sequence numbers 1 to 149, or iv. A guide sequence containing any one of sequence numbers 1, 7, 8, 15, 26, 27, 28, 41, 42, 46, 51, 52, 53, 56, 69, or 71, or v. A guide sequence containing any one of sequence numbers 8, 15, 41, 51, or 69, or vi. A sequence containing 15 consecutive nucleotides ± 10 nucleotides at the genomic coordinates listed in Table 1, or At least 17, 18, 19, or 20 consecutive nucleotides from the sequence starting from vii.(vi), or A guide RNA containing a guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from viii.(vi), and optionally, b. A composition comprising an RNA guide DNA binder, or a nucleic acid encoding an RNA guide DNA binder.
[0089] Embodiment 30 is a composition comprising a short single guide RNA (short sgRNA), a. Guide array, i. A guide sequence selected from sequence numbers 1 to 149, or ii. At least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from sequence numbers 1 to 149, or iii. A guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from sequence numbers 1 to 149, or iv. A guide sequence containing any one of sequence numbers 1, 7, 8, 15, 26, 27, 28, 41, 42, 46, 51, 52, 53, 56, 69, or 71, or v. A guide sequence containing any one of sequence numbers 8, 15, 41, 51, or 69, or vi. A sequence containing 15 consecutive nucleotides ± 10 nucleotides at the genomic coordinates listed in Table 1, or At least 17, 18, 19, or 20 consecutive nucleotides from the sequence starting from vii.(vi), or A guide sequence that includes a guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from viii.(vi), b. A composition comprising a conserved portion of an sgRNA including a hairpin region, wherein the hairpin region has at least 5 to 10 nucleotides deleted, and optionally, the short sgRNA includes one or more of the 5' terminal modifications and 3' terminal modifications.
[0090] Embodiment 31. The composition of Embodiment 29, comprising the sequence of Sequence ID No. 202.
[0091] Embodiment 32 is a composition of Embodiment 29 or Embodiment 30, which includes a 5'-terminus modification.
[0092] Embodiment 33 is one of the compositions from Embodiments 29 to 32, wherein the short sgRNA includes a 3' terminal modification.
[0093] Embodiment 34 is one of the compositions from Embodiments 29 to 33, wherein the short sgRNA includes 5'-terminal modifications and 3'-terminal modifications.
[0094] Embodiment 35 is one of any one of Embodiments 29 to 34, wherein the short sgRNA further comprises a 3' tail.
[0095] Embodiment 36 is the composition of Embodiment 35, wherein the 3' tail contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides.
[0096] Embodiment 37 is the composition of Embodiment 35, wherein the 3' tail contains about 1-2, 1-3, 1-4, 1-5, 1-7, 1-10, at least 1-2, at least 1-3, at least 1-4, at least 1-5, at least 1-7, or at least 1-10 nucleotides.
[0097] Embodiment 38 is one of the compositions from Embodiments 29 to 37, in which the short sgRNA does not contain a 3' tail.
[0098] Embodiment 39 is one of the compositions from Embodiments 29 to 38, which includes a modification within the hairpin region.
[0099] Embodiment 40 is one of the compositions from Embodiments 29 to 39, comprising a 3'-terminus modification and a modification within the hairpin region.
[0100] Embodiment 41 is one of the compositions from Embodiments 29 to 40, comprising a 3'-end modification, a modification within the hairpin region, and a 5'-end modification.
[0101] Embodiment 42 is one of the compositions from Embodiments 29 to 41, comprising a 5'-end modification and a modification within the hairpin region.
[0102] Embodiment 43 is one of the compositions from Embodiments 29 to 42, wherein the hairpin region is missing at least five consecutive nucleotides.
[0103] Embodiment 44 has at least 5 to 10 deleted nucleotides, a. Inside hairpin 1, b. Within the "N" between hairpin 1 and hairpin 1 and hairpin 2, c. In the two nucleotides located at hairpin 1 and immediately 3' to the side of hairpin 1, d. Including at least a portion of hairpin 1, e. Inside hairpin 2, f. Including at least a portion of hairpin 2, g. Inside hairpin 1 and hairpin 2, h. Includes at least a portion of hairpin 1, and includes "N" between hairpin 1 and hairpin 2, i. Includes at least a portion of hairpin 2, and includes "N" between hairpin 1 and hairpin 2, j. Includes at least a portion of hairpin 1, includes "N" between hairpin 1 and hairpin 2, and includes at least a portion of hairpin 2, k. Located within hairpin 1 or hairpin 2, optionally containing "N" between hairpin 1 and hairpin 2. l. Continuous, m. Continuous, including the "N" between hairpin 1 and hairpin 2. n. Continuous and extending to at least part of hairpin 1 and part of hairpin 2, o. Continuous, extending to at least a portion of hairpin 1 and "N" between hairpin 1 and hairpin 2, p. is continuous and extends to at least a portion of hairpin 1 and two nucleotides immediately 3' on the side of hairpin 1. q. Consists of 5 to 10 nucleotides, r. Consists of 6 to 10 nucleotides, s. Consists of 5 to 10 consecutive nucleotides, t. Consists of 6 to 10 consecutive nucleotides, or u. A composition consisting of nucleotides 54-58 of sequence number 400, one of any of embodiments 29-43.
[0104] Embodiment 45 is one of the compositions from Embodiments 29 to 44, comprising a conserved portion of an sgRNA including a nexus region, wherein the nexus region is missing at least one nucleotide.
[0105] Embodiment 46 is an embodiment in which a nucleotide is deleted within the nexus region. a. At least 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides within the nexus region, b. At least 1-2 nucleotides, 1-3 nucleotides, 1-4 nucleotides, 1-5 nucleotides, 1-6 nucleotides, 1-10 nucleotides, or 1-15 nucleotides within the nexus region, and c. The composition of Embodiment 45, comprising one or more of the nucleotides within the nexus region.
[0106] Embodiment 47 is a composition comprising modified single guide RNA (sgRNA), a. Guide array, i. A guide sequence selected from sequence numbers 1 to 149, or ii. At least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from sequence numbers 1 to 149, or iii. A guide sequence that is at least 95%, 90%, or 85% identical to the sequence selected from sequence numbers 1 to 149, or iv. A guide sequence containing any one of sequence numbers 1, 7, 8, 15, 26, 27, 28, 41, 42, 46, 51, 52, 53, 56, 69, or 71, or v. A guide sequence containing any one of sequence numbers 8, 15, 41, 51, or 69, or vi. A sequence containing 15 consecutive nucleotides ± 10 nucleotides at the genomic coordinates listed in Table 1, or At least 17, 18, 19, or 20 consecutive nucleotides from the sequence starting from vii.(vi), or viii.(vi) includes a guide sequence which is at least 95%, 90%, or 85% identical to the sequence selected from viii. moreover b. Below 1. YA modification in one or more guide region YA sites, 2. YA modification in one or more conserved region YA sites, 3. YA modification in one or more guide region YA sites and one or more preserved region YA sites. 4.i) YA modification in two or more guide region YA sites, ii) YA modification in one or more of the preserved region YA sites 2, 3, 4, and 10, and iii) YA modification in one or more of the preserved YA sites 1 and 8, or 5.i) YA modifications in one or more guide region YA sites, wherein the guide region YA site has a YA modification at the 8th nucleotide from the 5' end of the 5' end, or thereafter. ii) YA modification in one or more of the preserved region YA sites 2, 3, 4, and 10, and optionally, iii) YA modification in one or more of the preserved YA sites 1 and 8, or 6.i) YA modifications in one or more guide region YA sites, wherein the guide region YA site is located within 13 nucleotides of the 3' terminal nucleotide of the guide region, ii) YA modification in one or more of the preserved region YA sites 2, 3, 4, and 10, and iii) YA modification in one or more of the preserved YA sites 1 and 8, or 7.i) 5'-terminal modifications and 3'-terminal modifications, ii) YA modification in one or more of the preserved region YA sites 2, 3, 4, and 10, and iii) YA modification in one or more of the preserved YA sites 1 and 8, or 8.i) YA modification in the guide region YA site, wherein the modification of the guide region YA site includes a modification that does not include at least one nucleotide located at 5' of the guide region YA site. ii) YA modification in one or more of the preserved region YA sites 2, 3, 4, and 10, and iii) YA modification in one or more of the preserved YA sites 1 and 8, or 9.i) YA modification in one or more of the YA sites 2, 3, 4, and 10 of the preserved region, and ii) YA modification in YA sites 1 and 8 of the preserved region, or 10.i) YA modifications in one or more guide region YA sites, wherein the YA site has a YA modification at the 8th nucleotide at the 5' end, or thereafter. ii) YA modification in one or more of the preserved region YA sites 2, 3, 4, and 10, and iii) Modification in one or more of H1-1 and H2-1, or 11.i) YA modification in one or more of the YA sites 2, 3, 4, and 10 in the conserved region, ii) YA modification in one or more of the YA sites 1, 5, 6, 7, 8, and 9 in the conserved region, and iii) modification in one or more of H1-1 and H2-1, or 12.i) Modifications such as YA modifications, at the 6th nucleotide from the 5' end, or one or more nucleotides located thereafter. ii) YA modification at one or more guide sequence YA sites, iii) Modifications in one or more of B3, B4, and B5 such that B6 does not contain a 2'-OMe modification or contains a modification other than a 2'-OMe modification, iv) Modifications in LS10 such that LS10 includes modifications other than 2'-fluoro, and / or v) Includes one or more modifiers selected from the modifiers in N2, N3, N4, N5, N6, N7, N10, or N11, below i. YA modification in one or more guide region YA sites, ii. YA modification in one or more conserved region YA sites, iii. YA modification in one or more guide region YA sites and one or more preserved region YA sites, iv. At least one of nucleotides 8-11, 13, 14, 17, or 18 from the 5' end of the 5' terminal does not contain a 2'-fluoro modification. v. At least one of nucleotides 6-10 from the 5' end of the 5' terminal does not contain a phosphorothioate linkage. vi. At least one of B2, B3, B4, or B5 does not contain a 2'-OMe modification. vii. At least one of LS1, LS8, or LS10 does not contain a 2'-OMe modification. viii. At least one of N2, N3, N4, N5, N6, N7, N10, N11, N16, or N17 does not contain a 2'-OMe modification. ix.H1-1 includes modifications, x.H2-1 includes modifications, or xi. A composition in which at least one of H1-2, H1-3, H1-4, H1-5, H1-6, H1-7, H1-8, H1-9, H1-10, H2-1, H2-2, H2-3, H2-4, H2-5, H2-6, H2-7, H2-8, H2-9, H2-10, H2-11, H2-12, H2-13, H2-14, or H2-15 does not contain phosphorothioate linkages, and at least one of these is true.
[0107] Embodiment 48 is the composition of Embodiment 47, including Sequence ID No. 450.
[0108] Embodiment 49 is one of the compositions from Embodiments 29 to 48 for use in inducing double-strand breaks (DSBs) or single-strand breaks in the KLKB1 gene in cells or subjects.
[0109] Embodiment 50 is one of the compositions from Embodiments 29 to 48 for use in reducing the expression of the KLKB1 gene in cells or subjects.
[0110] Embodiment 51 is one of the compositions from Embodiments 29 to 48 for use in treating or preventing HAE in a subject.
[0111] Embodiment 52 is one of the compositions from Embodiments 29 to 48 for use in reducing serum and / or plasma bradykinin concentrations in a subject.
[0112] Embodiment 53 is one of the compositions from Embodiments 29 to 48 for use in reducing bradykinin-mediated vasodilation concentration in a subject.
[0113] Embodiment 54 is one of any one of Embodiments 29 to 48 for use in treating or preventing bradykinin production and accumulation, bradykinin-mediated vasodilation, swelling, or angioedema, airway obstruction, or suffocation.
[0114] Embodiment 55 is one of the compositions from Embodiments 29 to 48 for use in treating or preventing angioedema caused by or associated with HAE.
[0115] Embodiment 56 is one of the compositions from Embodiments 29 to 48 for use in reducing the frequency of angioedema attacks.
[0116] Embodiment 57 is one of the compositions from Embodiments 29 to 48 for use in reducing the severity of an angioedema attack.
[0117] Embodiment 58 is one of the compositions from Embodiments 29 to 48 for use in reducing the frequency and / or severity of seizures.
[0118] Embodiment 59 is one of the compositions from Embodiments 29 to 48 for use in achieving remission of an angioedema attack.
[0119] Embodiment 60 is one of the compositions from Embodiments 29 to 48 for use in reducing the frequency and / or severity of HAE attacks.
[0120] Embodiment 61 is the composition of Embodiment 60 for use in reducing the frequency of HAE attacks.
[0121] Embodiment 62 is the composition of Embodiment 61, which reduces the frequency by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 60-80%, or at least 40-90%.
[0122] Embodiment 63 is the method of Embodiment 61, which reduces the frequency by at least 60-80%.
[0123] Embodiment 64 is the method of Embodiment 61, which reduces the frequency by at least 40-90%.
[0124] Embodiment 65 is the composition of Embodiment 60 for use in reducing total plasma kallikrein activity.
[0125] Embodiment 66 is the composition of Embodiment 60 for use in lowering total plasma kallikrein levels.
[0126] Embodiment 67 is the composition of Embodiment 60 for use in reducing prekallikrein and / or kallikrein levels.
[0127] Embodiment 68 is any one of the compositions from Embodiments 65 to 67, wherein there is a dose-dependent increase in the edit rate.
[0128] Embodiment 69 is one of the compositions from Embodiments 65 to 68, wherein there is a dose-dependent decrease in total plasma kallikrein levels.
[0129] Embodiment 70 is one of the compositions from Embodiments 65 to 69, in which there is a dose-dependent decrease in plasma kallikrein activity.
[0130] Embodiment 71 is one of any one of Embodiments 29 to 70, wherein the effect lasts for at least 1 month, 2 months, 4 months, 6 months, 1 year, 2 years, 5 years, 10 years, or longer after administration.
[0131] Embodiment 72 is one of any one of Embodiments 29 to 71, wherein the effect lasts for at least 6 months.
[0132] Embodiment 73 is one of any one of Embodiments 29 to 72, wherein the effect lasts for at least one year.
[0133] Embodiment 74 further a. Induction of double-strand breaks (DSBs) within the KLKB1 gene in cells or subjects. b. Decreasing the expression of the KLKB1 gene in cells or subjects. c. To treat or prevent HAE in the target population. d. To reduce serum and / or plasma bradykinin concentrations in the subjects. e. To reduce bradykinin production. f. To reduce bradykinin-mediated vasodilation. g. To treat or prevent bradykinin-mediated swelling and angioedema, and / or h. Any one of Embodiments 1 to 28, comprising treating or preventing airway obstruction or suffocation caused by swelling.
[0134] Embodiment 75 is a composition for use of any one of the preceding embodiments, a method, or a composition for use that reduces KLKB1 mRNA production.
[0135] Embodiment 76 is a composition for use of any one of the preceding embodiments, a method, a composition, or a composition for use that reduces prekallikrein protein levels in plasma and serum.
[0136] Embodiment 77 is a method, composition, or composition for use of any one of the preceding embodiments for which the composition reduces total kallikrein (prekallikrein and pKal) protein levels in plasma and serum.
[0137] Embodiment 78 is a method, composition, or composition for use of any one of the preceding embodiments, wherein the composition reduces the proportion of circulating truncated HMWK (cHMWK) compared to total HMWK in citrate serum or citrate plasma.
[0138] Embodiment 79 is a method, composition, or composition for use of any one of the preceding embodiments, wherein the composition reduces the proportion of cHMWK in citrated plasma to less than 30% of total HMWK.
[0139] Embodiment 80 is a method, composition, or composition for use of any one of the preceding embodiments, wherein the composition reduces spontaneous pKal activity in serum or plasma.
[0140] Embodiment 81 is a composition for use of any one of the preceding embodiments, a method, or a composition for use that reduces kallikrein activity.
[0141] Embodiment 82 is a method, composition, or composition for use of any one of the preceding embodiments, wherein the kallikrein activity comprises total kallikrein activity, prekallikrein activity, and / or pKal activity.
[0142] Embodiment 83 is a method, composition, or composition for use of any one of the preceding embodiments, wherein the composition reduces the pKal activity of the subject by at least about 40% before use of the method or composition.
[0143] Embodiment 84 is a method, composition, or composition for use of any one of the preceding embodiments, wherein the composition reduces the pKal activity of the subject by at least about 50% before use of the method or composition.
[0144] Embodiment 85 is a method, composition, or composition for use of any one of the preceding embodiments, wherein the composition reduces the pKal activity of the subject by at least about 60% before use of the method or composition.
[0145] Embodiment 86 is a method, composition, or composition for use of any one of the preceding embodiments, wherein the composition reduces the pKal activity of the subject to less than about 40% of the basal level.
[0146] Embodiment 87 is a method, composition, or composition for use of any one of the preceding embodiments, wherein the composition reduces the pKal activity of the subject to about 40-50% of the basal level.
[0147] Embodiment 88 is a method, composition, or composition for use of any one of the preceding embodiments, wherein the composition reduces the target pKal activity to 20-40% or 20-50% of the basal level.
[0148] Embodiment 89 is a composition for use of any one of the preceding embodiments, a method, or a composition for use that increases serum and / or plasma bradykinin levels.
[0149] Embodiment 90 is a composition for use of any one of the preceding embodiments, a method, or a composition for use that causes editing of the KLKB1 gene.
[0150] Embodiment 91 is a method, composition, or composition for use of Embodiment 90, in which editing is calculated as the percentage of the set being edited (edit rate).
[0151] Embodiment 92 is a method, composition, or composition for use of Embodiment 91, wherein the edit ratio is 30-99% of the aggregate.
[0152] Embodiment 93 is a method, composition, or composition for use of Embodiment 91, wherein the edit ratio is 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-99% of the aggregate.
[0153] Embodiment 94 is a composition for use of any one of the preceding embodiments, a method, a composition, or a composition for use that reduces serum and / or plasma bradykinin concentration.
[0154] Embodiment 95 is a method, composition, or composition for use of any one of the preceding embodiments, wherein the composition reduces serum and / or plasma bradykinin concentration, and the reduction in serum and / or plasma bradykinin concentration causes a reduction in swelling in organ tissues, including the limbs, face, GI ducts, or airways.
[0155] Embodiment 96 has a guide array, a. Sequence IDs 1-149, or b. Sequence numbers 1, 7, 8, 15, 26, 27, 28, 41, 42, 46, 51, 52, 53, 56, 69, 71, or c. Any one of sequence numbers 8, 15, 41, 51, or 69, or d. A sequence containing 15 consecutive nucleotides ± 10 nucleotides at the genomic coordinates listed in Table 1, or e.(d) at least 17, 18, 19, or 20 consecutive nucleotides from the sequence, or A method, composition, or composition for use from any one of the prior embodiments, selected from guide sequences that are at least 95%, 90%, or 85% identical to the sequence selected from f.(d).
[0156] Embodiment 97 describes a composition in which a. Sequence numbers 1, 7, 8, 15, 26, 27, 28, 41, 42, 46, 51, 52, 53, 56, 69, 71, or b. Any one of sequence numbers 8, 15, 41, 51, or 69, or c. A sequence containing 15 consecutive nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 1, or d. At least 17, 18, 19, or 20 consecutive nucleotides from the sequence in (c), or A method, composition, or composition for use according to any one of the prior embodiments, comprising an sgRNA containing a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from e.(c).
[0157] Embodiment 98 is one of the methods, compositions, or compositions for use from the prior embodiments, wherein the target sequence is located in exon 1, exon 3, exon 4, exon 5, exon 6, or exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, or exon 15 of the human KLKB1 gene.
[0158] Embodiment 99 is the method, composition for use, or composition of Embodiment 98, wherein the target sequence is located in exon 1 of the human KLKB1 gene.
[0159] Embodiment 100 is the method, composition for use, or composition of Embodiment 98, wherein the target sequence is located in exon 3 of the human KLKB1 gene.
[0160] Embodiment 101 is the method, composition for use, or composition of Embodiment 98, wherein the target sequence is located in exon 4 of the human KLKB1 gene.
[0161] Embodiment 102 is the method, composition for use, or composition of Embodiment 98, wherein the target sequence is located in exon 5 of the human KLKB1 gene.
[0162] Embodiment 103 is the method, composition for use, or composition of Embodiment 98, wherein the target sequence is located in exon 6 of the human KLKB1 gene.
[0163] Embodiment 104 is the method, composition for use, or composition of Embodiment 98, wherein the target sequence is located in exon 8 of the human KLKB1 gene.
[0164] Embodiment 105 is the method, composition for use, or composition of Embodiment 98, wherein the target sequence is located in exon 9 of the human KLKB1 gene.
[0165] Embodiment 106 is the method, composition for use, or composition of Embodiment 98, wherein the target sequence is located in exon 10 of the human KLKB1 gene.
[0166] Embodiment 107 is the method, composition for use, or composition of Embodiment 98, wherein the target sequence is located in exon 11 of the human KLKB1 gene.
[0167] Embodiment 108 is the method, composition for use, or composition of Embodiment 98, wherein the target sequence is located in exon 12 of the human KLKB1 gene.
[0168] Embodiment 109 is the method, composition for use, or composition of Embodiment 98, wherein the target sequence is located in exon 13 of the human KLKB1 gene.
[0169] Embodiment 110 is the method, composition for use, or composition of Embodiment 98, wherein the target sequence is located in exon 14 of the human KLKB1 gene.
[0170] Embodiment 111 is the method, composition for use, or composition of Embodiment 98, wherein the target sequence is located in exon 15 of the human KLKB1 gene.
[0171] Embodiment 112 is a method, composition for use, or composition from any one of the prior embodiments, wherein the guide sequence is complementary to the target sequence in the positive strand of KLKB1.
[0172] Embodiment 113 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the guide sequence is complementary to the target sequence in the minus strand of KLKB1.
[0173] Embodiment 114 is a method, composition for use, or composition from any one of the prior embodiments, wherein the first guide sequence is complementary to a first target sequence in the positive strand of the KLKB1 gene, and the composition further comprises a second guide sequence complementary to a second target sequence in the negative strand of the KLKB1 gene.
[0174] Embodiment 115 is a method, composition for use, or composition of any one of the preceding embodiments, wherein the guide RNA comprises a guide sequence selected from any one of SEQ ID NOs: 1 to 149, and further comprises the nucleotide sequence of SEQ ID NO: 170, wherein the nucleotide of SEQ ID NO: 170 is located after the guide sequence at its 3' end.
[0175] Embodiment 116 is a method, composition for use, or composition of any one of the preceding embodiments, wherein the guide RNA comprises a guide sequence selected from any one of SEQ ID NOs: 1 to 149, and further comprises a nucleotide sequence of any one of SEQ ID NOs: 171, SEQ ID NOs: 172, SEQ ID NOs: 173, or SEQ ID NOs: 400 to 450, and one of the nucleotides of SEQ ID NOs: 171, SEQ ID NOs: 172, SEQ ID NOs: 173, or a conserved portion of the sgRNA from Table 4, which is located after the guide sequence at its 3' end.
[0176] Embodiment 117 is a method, composition for use, or composition from any one of the prior embodiments, wherein the guide RNA is a single guide RNA (sgRNA).
[0177] Embodiment 118 is the method, composition for use, or composition of Embodiment 117, wherein the sgRNA comprises a guide sequence containing one of sequence numbers 8, 15, 41, 51, or 69.
[0178] Embodiment 119 is a method, composition for use, or composition from any of the preceding embodiments, wherein the guide RNA is modified according to the pattern of SEQ ID NO: 300, and N is collectively one of the guide sequences (SEQ ID NOs: 1 to 149) in Table 1.
[0179] Embodiment 120 is a method, composition for use, or composition of Embodiment 119, wherein each N in SEQ ID NO: 300 is any natural or non-natural nucleotide, and N forms a guide sequence, and the guide sequence targets Cas9 to the KLKB1 gene.
[0180] Example 121 is a method, composition for use, or composition of any one of the preceding embodiments, wherein the sgRNA comprises one of the guide sequences of SEQ ID NOs: 1 to 149, one of the nucleotides of SEQ ID NOs: 171, 172, 173, or one of the conserved portion of the sgRNA from Table 4, and the nucleotide of SEQ ID NOs: 171, 172, 173, or one of the conserved portion of the sgRNA from Table 4 is located after the guide sequence at its 3' end.
[0181] Embodiment 122 is a method, composition for use, or composition from any one of the prior embodiments, wherein the sgRNA comprises a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1 to 149.
[0182] Embodiment 123 is the method, composition for use, or composition of Embodiment 122, wherein the sgRNA comprises a sequence selected from SEQ ID NOs: 8, 15, 41, 51, and 69.
[0183] Embodiment 124 is a method, composition for use, or composition from any one of the prior embodiments, wherein the guide RNA comprises at least one modification.
[0184] Embodiment 125 is the method, composition for use, or composition of Embodiment 124, wherein at least one modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide.
[0185] Embodiment 126 is a method, composition for use, or composition from any one of Embodiments 124 to 125, comprising internucleotide phosphorothioate (PS) bonding.
[0186] Embodiment 127 is a method, composition for use, or composition from any one of Embodiments 124 to 126, comprising a 2'-fluoro(2'-F) modified nucleotide.
[0187] Embodiment 128 is a method, composition for use, or composition according to any one of Embodiments 124 to 127, comprising modification of one or more of the first five nucleotides at the 5' end of a guide RNA.
[0188] Embodiment 129 is a method, composition for use, or composition according to any one of Embodiments 124 to 128, comprising modification of one or more of the last five nucleotides at the 3' end of a guide RNA.
[0189] Embodiment 130 is a method, composition for use, or composition from any one of Embodiments 124 to 129, comprising a PS bond between the first four nucleotides of a guide RNA.
[0190] Embodiment 131 is a method, composition for use, or composition from any one of Embodiments 124 to 130, comprising a PS bond between the last four nucleotides of the guide RNA.
[0191] Embodiment 132 is a method, composition for use, or composition from any one of Embodiments 124 to 131, comprising 2'-O-Me modified nucleotides in the first three nucleotides at the 5' end of the guide RNA.
[0192] Embodiment 133 is any one of Embodiments 124 to 132, a composition for use, or a composition, wherein the last three nucleotides at the 3' end of the guide RNA are 2'-O-Me modified nucleotides.
[0193] Embodiment 134 is a method, composition for use, or composition from any one of Embodiments 124 to 133, wherein the guide RNA comprises the modified nucleotide of SEQ ID NO: 300.
[0194] Embodiment 135 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition further comprises a pharmaceutically acceptable excipient.
[0195] Embodiment 136 is a method, composition for use, or composition from any one of the prior embodiments, wherein the guide RNA is associated with lipid nanoparticles (LNPs).
[0196] Embodiment 137 is the method, composition for use, or composition of Embodiment 136, wherein the LNP comprises a cationic lipid.
[0197] Embodiment 138 is a method, composition for use, or composition of Embodiment 137, wherein the cationic lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate.
[0198] Embodiment 139 is a method, composition for use, or composition from any one of Embodiments 136 to 138, wherein the LNP comprises a neutral lipid.
[0199] Embodiment 140 is the method, composition for use, or composition of Embodiment 139, wherein the neutral lipid is DSPC.
[0200] Embodiment 141 is a method, composition for use, or composition from any one of Embodiments 136 to 140, wherein the LNP comprises a helper lipid.
[0201] Embodiment 142 is the method, composition for use, or composition of Embodiment 141, wherein the helper lipid is cholesterol.
[0202] Embodiment 143 is a method, composition for use, or composition from any one of Embodiments 136 to 142, wherein the LNP comprises a stealth lipid.
[0203] Embodiment 144 is the method, composition for use, or composition of Embodiment 143, wherein the stealth lipid is PEG2k-DMG.
[0204] Embodiment 145 is a method, composition for use, or composition from any one of the prior embodiments, further comprising an RNA guide DNA binder.
[0205] Embodiment 146 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition further comprises mRNA encoding an RNA guide DNA binder.
[0206] Embodiment 147 is a method, composition for use, or composition of Embodiment 145 or 146, wherein the RNA guide DNA binding agent is Cas9.
[0207] Embodiment 148 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition is a pharmaceutical formulation and further comprises a pharmaceutically acceptable carrier.
[0208] Embodiment 149 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprises an array selected from SEQ ID NOs: 1 to 149, and is SEQ ID NO: 1.
[0209] Embodiment 150 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 2.
[0210] Embodiment 151 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 3.
[0211] Embodiment 152 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 4.
[0212] Embodiment 153 is a method, composition for use, or composition from any one of Embodiments 1 to 89, wherein the sequence selected from Sequence IDs 1 to 149 is Sequence ID 5.
[0213] Embodiment 154 is a method, composition for use, or composition from any one of Embodiments 1 to 89, wherein the sequence selected from Sequence IDs 1 to 149 is Sequence ID 6.
[0214] Embodiment 155 is a method, composition for use, or composition from any one of Embodiments 1 to 89, wherein the sequence selected from Sequence IDs 1 to 149 is Sequence ID 7.
[0215] Embodiment 156 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprises an array selected from SEQ ID NOs: 1 to 149 and is SEQ ID NO: 8.
[0216] Embodiment 157 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 9.
[0217] Embodiment 158 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 10.
[0218] Embodiment 159 is a composition comprising a sequence selected from SEQ ID NOs: 1 to 149, and is the composition, or a method or composition for use, of any one of the preceding embodiments, where the sequence is SEQ ID NO: 11.
[0219] Embodiment 160 is a composition comprising a sequence selected from SEQ ID NOs: 1 to 149, and is the composition, or a method or composition for use, of any one of the preceding embodiments, where the sequence is SEQ ID NO: 12.
[0220] Embodiment 161 is a composition comprising a sequence selected from SEQ ID NOs: 1 to 149, and is the composition, or a method or composition for use, of any one of the preceding embodiments, where the sequence is SEQ ID NO: 13.
[0221] Embodiment 162 is a composition comprising a sequence selected from SEQ ID NOs: 1 to 149, and is the composition, or a method or composition for use, of any one of the preceding embodiments, where the sequence is SEQ ID NO: 14.
[0222] Embodiment 163 is a composition comprising a sequence selected from SEQ ID NOs: 1 to 149, and is the composition, or a method or composition for use, of any one of the preceding embodiments, where the sequence is SEQ ID NO: 15.
[0223] Embodiment 164 is a composition comprising a sequence selected from SEQ ID NOs: 1 to 149, and is the composition, or a method or composition for use, of any one of the preceding embodiments, where the sequence is SEQ ID NO: 16.
[0224] Embodiment 165 is a composition comprising a sequence selected from SEQ ID NOs: ! to 149, and is the composition, or a method or composition for use, of any one of the preceding embodiments, where the sequence is SEQ ID NO: 17.
[0225] Embodiment 166 is a composition comprising a sequence selected from SEQ ID NOs: 1 to 149, and is the composition, or a method or composition for use, of any one of the preceding embodiments, where the sequence is SEQ ID NO: 18.
[0226] Embodiment 167 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 19.
[0227] Embodiment 168 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 20.
[0228] Embodiment 169 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 21.
[0229] Embodiment 170 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 22.
[0230] Embodiment 171 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 23.
[0231] Embodiment 172 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 24.
[0232] Embodiment 173 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 25.
[0233] Embodiment 174 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 26.
[0234] Embodiment 175 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 27.
[0235] Embodiment 176 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 28.
[0236] Embodiment 177 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 29.
[0237] Embodiment 178 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 30.
[0238] Embodiment 179 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 31.
[0239] Embodiment 180 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 32.
[0240] Embodiment 181 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 33.
[0241] Embodiment 182 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 34.
[0242] Embodiment 183 is a method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 35.
[0243] Embodiment 184 is a method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 36.
[0244] Embodiment 185 is a method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 37.
[0245] Embodiment 186 is a method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 38.
[0246] Embodiment 187 is a method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 39.
[0247] <( Embodiment 188 is a method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 40.
[0248] Embodiment 189 is a method, composition for use, or composition of any one of the preceding embodiments, wherein the composition comprising a sequence selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 41.
[0249] Embodiment 190 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 42.
[0250] Embodiment 191 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 43.
[0251] Embodiment 192 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 44.
[0252] Embodiment 193 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 45.
[0253] Embodiment 194 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 46.
[0254] Embodiment 195 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 47.
[0255] Embodiment 196 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 48.
[0256] Embodiment 197 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 49.
[0257] Embodiment 198 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 50.
[0258] Embodiment 199 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 51.
[0259] Embodiment 200 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 52.
[0260] Embodiment 201 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 53.
[0261] Embodiment 202 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 54.
[0262] Embodiment 203 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 55.
[0263] Embodiment 204 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 56.
[0264] Embodiment 205 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 57.
[0265] Embodiment 206 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 58.
[0266] Embodiment 207 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 59.
[0267] Embodiment 208 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 60.
[0268] Embodiment 209 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 61.
[0269] Embodiment 210 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 62.
[0270] Embodiment 211 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 63.
[0271] Embodiment 212 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 64.
[0272] Embodiment 213 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 65.
[0273] Embodiment 214 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 66.
[0274] Embodiment 215 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 67.
[0275] Embodiment 216 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 68.
[0276] Embodiment 217 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 69.
[0277] Embodiment 218 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 70.
[0278] Embodiment 219 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 71.
[0279] Embodiment 220 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 72.
[0280] Embodiment 221 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 73.
[0281] Embodiment 222 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 74.
[0282] Embodiment 223 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 75.
[0283] Embodiment 224 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 76.
[0284] Embodiment 225 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 77.
[0285] Embodiment 226 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 78.
[0286] Embodiment 227 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 79.
[0287] Embodiment 228 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 80.
[0288] Embodiment 229 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 81.
[0289] Embodiment 230 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 82.
[0290] Embodiment 231 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 83.
[0291] Embodiment 232 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 84.
[0292] Embodiment 233 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 85.
[0293] Embodiment 234 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 86.
[0294] Embodiment 235 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 87.
[0295] Embodiment 236 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 88.
[0296] Embodiment 237 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 89.
[0297] Embodiment 238 is one of the methods, compositions for use, or compositions from any one of Embodiments 1 to 89, wherein the sequence selected from Sequence IDs 1 to 149 is Sequence ID 90.
[0298] Embodiment 239 is one of the methods, compositions for use, or compositions from any one of Embodiments 1 to 89, wherein the sequence selected from sequence numbers 1 to 149 is sequence number 91.
[0299] Embodiment 240 is one of the methods, compositions for use, or compositions from Embodiments 1 to 89, wherein the sequence selected from Sequence IDs 1 to 149 is Sequence ID 92.
[0300] Embodiment 241 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 93.
[0301] Embodiment 242 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 94.
[0302] Embodiment 243 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 95.
[0303] Embodiment 244 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 96.
[0304] Embodiment 245 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 97.
[0305] Embodiment 246 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 98.
[0306] Embodiment 247 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 99.
[0307] Embodiment 248 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 100.
[0308] Embodiment 249 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 101.
[0309] Embodiment 250 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 102.
[0310] Embodiment 251 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 103.
[0311] Embodiment 252 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 104.
[0312] Embodiment 253 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 105.
[0313] Embodiment 254 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 106.
[0314] Embodiment 255 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 107.
[0315] Embodiment 256 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 108.
[0316] Embodiment 257 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 109.
[0317] Embodiment 258 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 110.
[0318] Embodiment 259 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 111.
[0319] Embodiment 260 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 112.
[0320] Embodiment 261 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 113.
[0321] Embodiment 262 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 114.
[0322] Embodiment 263 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 115.
[0323] Embodiment 264 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 116.
[0324] Embodiment 265 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 117.
[0325] Embodiment 266 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 118.
[0326] Embodiment 267 is a method, composition for use, or composition of any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 119.
[0327] Embodiment 268 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 120.
[0328] Embodiment 269 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 121.
[0329] Embodiment 270 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 122.
[0330] Embodiment 271 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 123.
[0331] Embodiment 272 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 124.
[0332] Embodiment 273 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 125.
[0333] Embodiment 274 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 126.
[0334] Embodiment 275 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 127.
[0335] Embodiment 276 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 128.
[0336] Embodiment 277 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 129.
[0337] Embodiment 278 is a method, composition for use, or composition of any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 130.
[0338] Embodiment 279 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 131.
[0339] Embodiment 280 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 132.
[0340] Embodiment 281 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 133.
[0341] Embodiment 282 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 134.
[0342] Embodiment 283 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 135.
[0343] Embodiment 284 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 136.
[0344] Embodiment 285 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 137.
[0345] Embodiment 286 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 138.
[0346] Embodiment 287 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 139.
[0347] Embodiment 288 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 140.
[0348] Embodiment 289 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 141.
[0349] Embodiment 290 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 142.
[0350] Embodiment 291 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 143.
[0351] Embodiment 292 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 144.
[0352] Embodiment 293 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs. 1 to 149 is SEQ ID NO. 145.
[0353] Embodiment 294 is a method, composition for use, or composition from any one of the preceding embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 146.
[0354] Embodiment 295 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 147.
[0355] Embodiment 296 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 148.
[0356] Embodiment 297 is a method, composition for use, or composition from any one of the prior embodiments, wherein the composition comprising an array selected from SEQ ID NOs: 1 to 149 is SEQ ID NO: 149.
[0357] Embodiment 298 is a method, composition for use, or composition from any one of the prior embodiments, in which the guide array is selected from SEQ ID NOs: 310 to 386.
[0358] Embodiment 299 is any one of the preceding embodiments, a method, composition for use, or composition, wherein the guide array is selected from SEQ ID NOs: 310-311, 313-326, 329-337, 339-342, 344-346, 348, 350, 352-356, 361, 362, 364, 365, 366, 367, 369-374, 376-380, and 382-386.
[0359] Embodiment 300 is a method, composition for use, or composition from any one of the prior embodiments, wherein the guide array is selected from SEQ ID NOs. 310 to 386, and is SEQ ID NO. 310.
[0360] Embodiment 301 is a method, composition for use, or composition from any of the preceding embodiments, comprising an sgRNA having one guide sequence from any of SEQ ID NOs: 1 to 149 and one of the conserved portions of sgRNA in Table 4, optionally having the modification pattern of SEQ ID NO: 450 or one of the modification patterns in Table 4, and optionally the sgRNA having 5'-terminal modifications and 3'-terminal modifications.
[0361] Embodiment 302 is a composition for use of any one of Embodiments 1 to 301, where the composition is administered as a single dose.
[0362] Embodiment 303 is a composition for use of any one of Embodiments 1 to 301, which is administered once.
[0363] Embodiment 304 is a single dose or a one-time administration. a. Induce double-strand breaks (DSBs) within the KLKB1 gene in cells or subjects, and / or b. Reduce the expression of the KLKB1 gene in cells or subjects, and / or c. To treat or prevent HAE in the subject, and / or d. To treat or prevent angioedema caused by or associated with HAE in the subject, and / or e. Reduce serum and / or plasma bradykinin concentrations in the subjects. f. Reduces bradykinin-mediated vasodilation, g. To treat or prevent bradykinin-mediated swelling and angioedema, and / or h. A method, composition, or composition for use of any one of Embodiments 302 or 303 for treating or preventing airway obstruction or suffocation caused by swelling.
[0364] Embodiment 305 is a method or composition of Embodiment 304 in which a single dose or administration achieves one or more of a) to h) over 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks.
[0365] Embodiment 306 is a method or composition of Embodiment 304 in which a single dose or administration achieves a sustained effect.
[0366] Embodiment 307 is a method, composition, or composition for use of any one of Embodiments 1 to 306, further comprising achieving a sustained effect.
[0367] Embodiment 308 is a method, composition, or composition for use of Embodiment 307, wherein the sustained effect lasts for at least one month, at least three months, at least six months, at least one year, or at least five years.
[0368] Embodiment 309 is one of the methods, compositions, or compositions for use from Embodiments 1 to 308, wherein administration of the composition results in a treatment-related reduction in kallikrein activity, total plasma kallikrein levels, prekallikrein and / or kallikrein levels, or bradykinin in serum and / or plasma.
[0369] Embodiment 310 is one of the methods, compositions, or compositions for use from Embodiments 1 to 309, wherein administration of the composition results in serum and / or plasma bradykinin levels within a therapeutic range.
[0370] Embodiment 311 is a method, composition, or composition for use from any one of the preceding embodiments, wherein administration of the composition results in serum and / or plasma bradykinin levels within 100, 120, or 150% of the normal range.
[0371] Embodiment 312 is the use of any of the embodiments of the preceding compositions for the preparation of a pharmacopoeia for the treatment of a human subject having HAE.
[0372] Embodiment 313 is the use of any of the embodiments of the preceding compositions for the preparation of a medicament for treating or preventing bradykinin production and accumulation, bradykinin-induced swelling, airway angioedema occlusion, or suffocation.
[0373] Embodiment 314 is the use of any of the embodiments of the preceding compositions for the preparation of a medicament for treating or preventing angioedema caused by or associated with HAE.
[0374] Embodiment 315 is the use of any of the embodiments of the preceding compositions for the preparation of a pharmacopoeia for reducing the frequency of angioedema attacks.
[0375] Embodiment 316 is the use of any of the earlier embodiments of a composition for the preparation of a pharmacopoeia for reducing the severity of an angioedema attack.
[0376] Embodiment 317 is the use of any of the embodiments of the preceding compositions for the preparation of a pharmacopoeia for reducing the frequency and / or severity of HAE attacks.
[0377] Embodiment 318 is the use of any of the earlier embodiments of a composition for the preparation of a pharmacopoeia for achieving remission of an angioedema attack.
[0378] Embodiment 319 is the use of any of the compositions of the preceding embodiments for the preparation of a medicament to achieve sustained remission, for example, that is maintained for at least one month, two months, four months, six months, one year, two years, five years, ten years, or longer. [Brief explanation of the drawing]
[0379] [Figure 1A] The edit rates (indel frequencies) detected at various sites within the KLKB1 gene locus using guide RNA are shown in primary human hepatocytes (PHH) (Figures 1A-1B) and primary cynomolgus monkey hepatocytes (PCH) (Figures 1C-1D). [Figure 1B] (As stated above.) [Figure 1C] (As stated above.) [Figure 1D] (As stated above.) [Figure 2A] The editing rates (indel frequencies) of KLKB1 sgRNA in PHH (Figures 2A-2B) and PCH (Figures 2C-2D) are shown. [Figure 2B] (As stated above.) [Figure 2C] (As stated above.) [Figure 2D] (As stated above.) [Figure 3A] The editing rate (indel frequency) (Figure 3A), secreted KLKB1 protein levels (Figure 3B), and correlation plots (Figure 3C) after transfection of PHH with KLKB1-targeting guide RNA are shown for three different PHH lots (HU8300, HU8284, and HU8296). [Figure 3B] (As stated above.) [Figure 3C] (As stated above.) [Figure 3D] (As stated above.) [Figure 3E] (As stated above.) [Figure 4A] Figures 4A-4B show the editing rate of the KLKB1 guide in primary human hepatocytes (PHH), and Figures 4C-4D show the editing rate of the KLKB1 guide in primary cynomolgus monkey hepatocytes (PCH). [Figure 4B] (As stated above.) [Figure 4C] (As stated above.) [Figure 4D] (As stated above.) [Figure 5A] The edit rate and dose-response data for secreted kallikrein for specific guide sequences in PHH (Figures 5A-5D) and PCH (Figures 5E-5H), as well as correlation plots of edit rate and secreted proteins in PHH and PCH (Figures 5I-5J), are shown. [Figure 5B] (As stated above.) [Figure 5C] (As stated above.) [Figure 5D] (As stated above.) [Figure 5E] (As stated above.) [Figure 5F] (As stated above.) [Figure 5G] (As stated above.) [Figure 5H] (As stated above.) [Figure 5I] (As stated above.) [Figure 5J] (As stated above.) [Figure 6A] This provides dose-response curve data for indel frequencies for specific guide sequences in PHH (Figures 6A-6B) and PCH (Figures 6C-6D). [Figure 6B] (As stated above.) [Figure 6C] (As stated above.) [Figure 6D] (As stated above.) [Figure 7A] Dose-response curve data for indel frequencies (Figures 7A and 7B) and KLKB1 secretion (Figures 7C and 7D) for specific guide sequences in PHH (Figures 7A and 7C) and PCH (Figures 7B and 7D), as well as Western blot analysis (Figure 7E) for measuring secreted proteins, are shown. [Figure 7B] (As stated above.) [Figure 7C] (As stated above.) [Figure 7D] (As stated above.) [Figure 7E] (As stated above.) [Figure 8A] This shows the KLKB1 editing percentage of various modified sgRNAs in vivo in Hu KLKB1 mice. [Figure 8B] The KLKB1 protein levels in Hu KLKB1 mice (Example 6) are shown, measured using ELISA and electrochemiluminescence-based arrays, respectively. [Figure 8C] (As described above (same as the explanation in Figure 8B).) [Figure 8D] This shows the multiplicative change in KLKB1 mRNA levels for each sequence in Hu KLKB1 mice. [Figure 9A] Figure 9A shows the level of correlation between liver editing rate and KLKB1 protein rate, serum KLKB1 protein (prekallikrein and kallikrein) (Figure 9B), TSS rate in treated mice (Figure 9C), and KLKB1 protein rate (Figure 9D). [Figure 9B] (As stated above.) [Figure 9C] (As stated above.) [Figure 9D] (As stated above.) [Figure 10] This shows the KLKB1 gene editing, the knockdown rate of KLKB1 mRNA, and the dose-dependent levels of plasma kallikrein in the Hu KLKB1 mouse model. [Figure 11A] This shows the levels of KLKB1 gene editing and plasma kallikrein in a dose-response assay after treatment with the indicated dose of sgRNA in a Hu KLKB1 mouse model. [Figure 11B]In a dose-response vascular permeability assay in the Hu KLKB1 mouse model, the absorbance levels at 600 nm light for detecting Evans Blue (EB) dye are shown in response to treatment with a permeabilizer after treatment with the indicated dose of sgRNA. [Figure 12A] In cynomolgus monkeys, single-dose administration of CRISPR / Cas9 components at 1.5 mg / kg, 3 mg / kg, or 6 mg / kg along with G013901 resulted in in vivo dose-dependent decreases in circulating total kallikrein activity (Figure 12A) and protein levels (Figure 12B), respectively. [Figure 12B] (As stated above.) [Figure 13A] In cynomolgus monkeys, the in vivo reductions in circulating total kallikrein activity (Figure 13A) and protein levels (Figure 13B) are shown after single-dose administration of the CRISPR / Cas9 component at the dosage indicated for G012267. [Figure 13B] (As stated above.) [Figure 14] Ten conserved YA regions in an exemplary sgRNA sequence (SEQ ID NO: 201) are labeled 1 to 10. The numbers 25, 45, 50, 56, 64, 67, and 83 indicate the pyrimidine positions of YA regions 1, 5, 6, 7, 8, 9, and 10 in the sgRNA having a guide region denoted as (N)x, where x is, for example, 20, optionally. [Figure 15] An exemplary sgRNA (SEQ ID NO: 401, not all modifications shown) in a possible secondary structure is shown, with labels indicating the individual nucleotides of the conserved region of the sgRNA, including the lower stem, bulge, upper stem, nexus (whose nucleotides can be designated N1-N18 in the 5'-3' direction, respectively), and hairpin 1 and hairpin 2 regions. Nucleotides between hairpin 1 and hairpin 2 are labeled with n. A guide region may be present on the sgRNA and is shown in this figure as "(N)x" before the conserved region of the sgRNA. [Modes for carrying out the invention]
[0380] Herein, specific embodiments of the present invention will be described in detail, and examples of embodiments of the present invention are illustrated in the accompanying drawings. The present invention will be described in conjunction with the illustrated embodiments, but it will be understood that they are not intended to limit the present invention to those embodiments. On the contrary, the present invention is intended to cover all substitutes, modifications, and equivalents that may be included in the present invention by the embodiments defined and included in the accompanying claims.
[0381] Before describing this instruction in detail, it should be understood that this disclosure is not limited to any particular composition or process step and is therefore subject to change. Note that, as used herein and in the appended claims, the singular forms “a,” “an,” and “the” include multiple references unless the context otherwise explicitly indicates otherwise. For example, a reference to “a conjugate” includes multiple conjugates, and a reference to “a cell” includes multiple cells, and so on.
[0382] Numerical ranges include the numbers that define that range. Measured and measurable values are understood to be approximate, taking into account significant digits and errors associated with measurement. Furthermore, the use of “comprise,” “comprises,” “comprising,” “contain,” “contains,” “containing,” “include,” “includes,” and “including” is not intended to be limiting. The above general explanation and the following detailed explanation are both illustrative and for illustrative purposes only, and should be understood not to limit the teachings.
[0383] Unless otherwise specified herein, embodiments herein that list various components “comprising” are also assumed to “consist of” or “essentially consist of” those listed components. Embodiments herein that list various components “comprising” are also assumed to “comprising” or “essentially consist of” those listed components. Embodiments herein that list various components “essentially consist of” are also assumed to “consist of” or “comprising” those listed components (this interchangeability does not apply to the use of these terms in the claims).
[0384] The term "or" is used in a comprehensive sense, i.e., equivalent to "and / or," unless the context explicitly indicates otherwise.
[0385] The chapter headings used herein are for structural purposes only and should not be construed as limiting the subject matter in any way. In the event of any conflict between any material incorporated by reference and any term or other express content herein as defined herein, this specification shall prevail. While this instruction is described in conjunction with various embodiments, it is not intended to limit this instruction to such embodiments. Conversely, this instruction includes various alternatives, modifications, and equivalents as will be understood by those skilled in the art.
[0386] I. Definition Unless otherwise specified, the following terms and phrases used herein are intended to have the meanings set forth below.
[0387] "Polynucleotide" and "nucleic acid" are used herein to refer to multimeric compounds comprising nucleosides or nucleoside analogs (including conventional RNA, DNA, mixed RNA-DNA, and polymers which are analogs thereof) having nitrogen-based heterocyclic bases or base analogs linked together along a backbone. The nucleic acid "backbone" may consist of various linkages, including one or more of the following: sugar phosphodiester linkages, peptide-nucleic acid linkages ("peptide nucleic acid" or PNA, PCT No. 95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. The sugar portion of the nucleic acid may be ribose, deoxyribose, or analogous compounds having substitutions, e.g., 2'-methoxy or 2'-halide substitutions. Nitrogen-based bases include conventional bases (A, G, C, T, U), their analogues (e.g., modified uridines such as 5-methoxyuridine, pseudouridine, or N1-methylpseudridine), inosine, purines, or pyrimidine derivatives (e.g., N1-methylpseudridine). 4 -methyldeoxyguanosine, deaza- or aza-purine, deaza- or aza-pyrimidine, pyrimidine bases substituted at position 5 or 6 (e.g., 5-methylcytosine), purine bases substituted at position 2, 6, or 8, 2-amino-6-methylaminopurine, O 6 -methylguanine, 4-thiopyrimidine, 4-aminopyrimidine, 4-dimethylhydrazinepyrimidine, and O 4 -Alkylpyrimidines (U.S. Patent No. 5,378,825 and PCT No. 93 / 13121) may also be used. For general considerations, see The Biochemistry of the Nucleic Acids 5-36, edited by Adams et al., 11 th(See ed., 1992). Nucleic acids may contain one or more “debased” residues in the polymer backbone that do not contain nitrogenous bases (U.S. Patent No. 5,585,481). Nucleic acids may contain only conventional RNA or DNA sugars, bases, and ligatures, or they may contain both conventional components and substitutions (e.g., conventional bases with 2'-methoxy ligatures, or polymers containing both conventional bases and one or more base analogs). Nucleic acids may contain “locked nucleic acids” (LNAs), analogs that have a bicyclic furanose unit locked in an RNA-mimicking sugar structure and contain one or more LNA nucleotide monomers that enhance hybridization affinity to complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). RNA and DNA have different sugar moieties and may differ in the presence of uracil or its analogues in RNA and thymine or its analogues in DNA.
[0388] "Guide RNA," "gRNA," and simply "guide" are used interchangeably herein to refer to a guide that directs an RNA guide DNA binder to target DNA, and may be either crRNA (also known as CRISPR RNA) or a combination of crRNA and trRNA (also known as tracrRNA). crRNA and trRNA may associate as a single-stranded RNA molecule (single guide RNA, sgRNA) or as two separate RNA molecules (dual guide RNA, dgRNA). "Guide RNA" or "gRNA" refers to each type. trRNA may be a naturally occurring sequence or a trRNA sequence that is modified or diverse compared to a naturally occurring sequence.
[0389] As used herein, “guide sequence” refers to a sequence within a guide RNA that is complementary to the target sequence and functions to direct the guide RNA toward the target sequence for binding or modification (e.g., cleavage) by an RNA guide DNA binder. The “guide sequence” may also be referred to as the “targeting sequence” or “spacer sequence.” The guide sequence may be 20 base pairs long, for example, in the case of Streptococcus pyogenes (i.e., Spy Cas9) and associated Cas9 homologs / orthologues. Shorter or longer sequences, such as 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides long, can also be used as guides. For example, in some embodiments, the guide sequence comprises at least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 1–149. In some embodiments, the target sequence is located, for example, within a gene or on a chromosome and is, for example, complementary to the guide sequence. In some embodiments, the degree of complementarity or identity between the guide sequence and its corresponding target sequence may be about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. For example, in some embodiments, the guide sequence includes a sequence having about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with at least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 1 to 149. In some embodiments, the guide sequence and target sequence may be 100% complementary or identical. In other embodiments, the guide sequence and target sequence may contain at least one mismatch. For example, the guide sequence and target sequence may contain 1, 2, 3, or 4 mismatches, and the full length of the target sequence may be at least 17, 18, 19, 20, or more base pairs. In some embodiments, the guide sequence and target sequence may contain 1 to 4 mismatches, and the guide sequence may contain at least 17, 18, 19, 20, or more nucleotides.In some embodiments, the guide sequence and target sequence may contain 1, 2, 3, or 4 mismatches, and the guide sequence may contain 20 nucleotides.
[0390] Since the nucleic acid substrate of an RNA guide DNA binder is a double-stranded nucleic acid, the target sequence of the RNA guide DNA binder includes both the positive and negative strands of genomic DNA (i.e., the given sequence and its reverse complement). Therefore, when a guide sequence is said to be "complementary to the target sequence," it should be understood that it can direct the guide RNA to bind to the reverse complement of the target sequence. Thus, in some embodiments, when a guide sequence binds to the reverse complement of the target sequence, the guide sequence is identical to a specific nucleotide of the target sequence (e.g., a target sequence without PAM), except for the substitution of U to T in the guide sequence.
[0391] As used herein, “RNA-guided DNA binder” means a polypeptide or polypeptide complex having RNA and DNA-binding activity, or a DNA-binding subunit of such a complex, where the DNA-binding activity is sequence-specific and dependent on the RNA sequence. Exemplary RNA-guided DNA binders include Cas cleavase / nickase and its inactivated form ("dCas DNA binder"). “Cas nuclease,” also referred to as “Cas protein” as used herein, encompasses Cas cleavase, Cas nickase, and dCas DNA binders. Cas cleavase / nickase and dCas DNA binders include the Csm or Cmr complex of the type III CRISPR system, Cas10, Csm1, or its Cmr2 subunit, the Cascade complex of the type I CRISPR system, its Cas3 subunit, and class 2 Cas nucleases. As used herein, “class 2 Cas nuclease” is a single-stranded polypeptide having RNA-guided DNA-binding activity. Class 2 Cas nucleases further include class 2 Cas cribase / nickases (e.g., H840A, D10A, or N863A variants) that possess RNA-induced DNA cleavage or nickase activity, and class 2d Cas DNA conjugates in which cribase / nickase activity is inactivated. Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variant) proteins, as well as their modifications. The Cpf1 protein (Zetsche et al., Cell, 163:1-13 (2015)) is homologous to Cas9 and contains a RuvC-like nuclease domain. Zetsche's Cpf1 sequences are incorporated entirely by reference. For example, refer to Zetsche's tables S1 and S3.For example, see Makarova et al., Nat Rev Microbiol, 13(11):722-36 (2015) and Shmakov et al., Molecular Cell, 60:385-397 (2015).
[0392] As used herein, “ribonucleoprotein” (RNP) or “RNP complex” refers to a guide RNA comprising an RNA guide DNA binder, such as a Cas nuclease, such as Cas cribase, Cas nickas, or a dCas DNA binder (e.g., Cas9). In some embodiments, the guide RNA guides the RNA guide DNA binder, such as Cas9, to a target sequence, the guide RNA hybridizes with the target sequence, and the agent binds to the target sequence, in which case the agent is a cribase or nickas, and can cleave or nicking after binding.
[0393] As used herein, if the alignment of the first sequence with respect to the second sequence shows that at least X% of the positions of the second sequence are matched by the first sequence, then the first sequence is considered to "contain a sequence having at least X% identity" with respect to the second sequence. For example, the sequence AAGA contains a sequence having 100% identity with respect to the sequence AAG because the alignment gives 100% identity in that there is a match at all three positions of the second sequence. Differences between RNA and DNA (generally, the exchange of thymidine for uridine, or vice versa), and the presence of nucleoside analogs such as modified uridine, do not contribute to differences in identity or complementarity between polynucleotides, as long as the relevant nucleotides (thymidine, uridine, or modified uridine, etc.) have the same complement (e.g., adenosine for all of thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as complements). Therefore, for example, the sequence 5'-AXG, where X is any modified uridine, e.g., pseudouridine, N1-methylpseudridine, or 5-methoxyuridine, is considered 100% identical to AUG, in that both are perfectly complementary to the same sequence (5'-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well known in the art. Those skilled in the art will understand what algorithm and parameter settings are appropriate for a given pair of sequences to be aligned. Generally, for sequences of similar length and expected identity of more than 50% for amino acids or more than 75% for nucleotides, the Needleman-Wunsch algorithm using the default settings of the Needleman-Wunsch algorithm interface provided by EBI on the www.ebi.ac.uk web server is generally appropriate.
[0394] "mRNA" is used herein to refer to a polynucleotide comprising an open reading frame that can be translated into a polypeptide (i.e., can function as a substrate for translation by ribosomes and aminoacylated tRNA). mRNA may contain a phosphate sugar backbone (e.g., a 2'-methoxyribose residue) comprising a ribose residue or an analogue thereof. In some embodiments, the sugars of the mRNA phosphate sugar backbone are essentially ribose residues, 2'-methoxyribose residues, or combinations thereof.
[0395] Guide sequences useful for the guide RNA compositions and methods described herein are shown in Table 1 or Table 2, and throughout this application.
[0396] As used herein, “indel” refers to an insertion / deletion mutation consisting of multiple nucleotides that are either inserted into or deleted at a double-strand break (DSB) site within a target nucleic acid.
[0397] As used herein, “knockdown” refers to a reduction in the expression of a particular gene product (e.g., a protein, mRNA, or both). Protein knockdown can be measured by detecting the total cellular mass of the protein from a sample such as a tissue, fluid, or cell assembly of interest. This can also be measured by measuring a protein substitute, marker, or activity. Methods for measuring mRNA knockdown are known and involve sequencing of mRNA isolated from a sample of interest. In some embodiments, “knockdown” may refer to some loss of expression of a particular gene product, e.g., a reduction in the amount of mRNA transcribed, or a reduction in the amount of protein expressed by a cell assembly (including in vivo assemblies such as those found in tissues).
[0398] As used herein, “knockout” refers to the loss of expression from a particular gene in a cell, or the loss of a particular protein in a cell. Knockout can be measured by detecting the total cellular amount of protein in a cell, tissue, or cell aggregate. In some embodiments, the methods of the present invention “knock out” KLKB1 in one or more samples, e.g., serum, plasma, tissue, or cells (e.g., in a cell aggregate including an in vivo aggregate such as one found in a tissue). In some embodiments, knockout is the complete loss of expression of the KLKB1 protein in a cell, rather than the formation of a mutant KLKB1 protein produced by, for example, an indel. As used herein, “KLKB1” generally refers to prekallikrein, the gene product of the KLKB1 gene. Prekallikrein is treated with plasma kallikrein (pKal), and antibodies can detect pKal, prekallikrein, or both. The human wild-type KLKB1 sequence is available at NCBI Gene ID:3818, Ensembl:ENSG00000164344. "PKK," "PPK," "KLK3," and "PKKD" are synonymous genes. The human KLKB1 transcript is available at Ensembl:ENST00000264690, and the wild-type KLKB1 sequence of cynomolgus monkeys is available at Ensembl:ENSMFAT00000002355.
[0399] Hereditary angioedema (HAE) is an inflammatory disorder characterized by recurrent events of severe swelling (angioedema) resulting from inactivating mutations in the SERPING1 gene, which encodes the C1 esterase inhibitor protein (C1-INH). C1-INH blocks the activity of certain proteins that promote inflammation (e.g., in the kinin system). Deficiency in C1-INH levels leads to unchecked factor XII (FXII) and high levels of kallikrein activation (pKal, treated from the KLKB1 protein (prekallikrein)). Kallikrein cleaves high molecular weight kininogen (HMWK) to release bradykinin, a peptide that affects vascular permeability. Excess bradykinin in the blood causes fluid leakage through the walls of blood vessels into body tissues, resulting in swelling in individuals with HAE. Therefore, in some embodiments, methods are provided for reducing KLKB1 activity, which, when reduced, decreases bradykinin production and reduces swelling episodes. The effectiveness of KLKB1 knockout may be evaluated by measuring the protein levels of prekallikrein / kallikrein, HMWK and its cleavage products, as well as surrogate labeling substrates for HMWK.
[0400] As used herein, “target sequence” refers to a nucleic acid sequence within a target gene that is complementary to the gRNA guide sequence. The interaction between the target sequence and the guide sequence directs the RNA guide DNA binder to bind to the target sequence and potentially form a nick (depending on the drug's activity) or cleave it.
[0401] As used herein, “YA site” refers to the 5'-pyrimidine-adenine-3' dinucleotide. “Conserved region YA site” is located within the conserved region of sgRNA. “Guide region YA site” is located within the guide region of sgRNA. Unmodified YA sites in sgRNA may be susceptible to cleavage by RNase-A-like endonucleases, such as RNase A. In some embodiments, sgRNA contains approximately 10 YA sites within its conserved region. In some embodiments, sgRNA contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 YA sites within its conserved region. An exemplary conserved region YA site is shown in Figure 14 (SEQ ID NO: 201) in relation to the sgRNA structure (Figure 15). Since the guide region can be any sequence containing any number of YA sites, an exemplary guide region YA site is not shown in Figure 14. In some embodiments, the sgRNA contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the YA sites shown in Figure 14. In some embodiments, the sgRNA contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 YA sites at the following positions or subsets thereof: LS5-LS6, US3-US4, US9-US10, US12-B3, LS7-LS8, LS12-N1, N6-N7, N14-N15, N17-N18, and H2-2~H2-3. In some embodiments, the YA sites include modifications, meaning that at least one nucleotide of the YA site is modified. In some embodiments, the pyrimidine of the YA site (also referred to as the pyrimidine site) includes modifications (including modifications that alter the internucleoside linkage immediately 3' of the sugar of the pyrimidine). In some embodiments, the adenine at the YA site (also referred to as the adenine position) includes modifications (including modifications that alter the internucleoside linkage immediately 3' of the sugar of adenine). In some embodiments, the pyrimidine and adenine positions at the YA site include modifications.
[0402] As used herein, “treatment” means any application of administration or treatment for a disease or disorder in a subject, including inhibiting the disease, halting its progression, alleviating one or more symptoms of the disease, curing the disease, or preventing the recurrence of one or more symptoms of the disease. For example, treatment of HAE may include alleviating the symptoms of HAE.
[0403] The term "treatment-related decline in KLKB1 activity" can mean a decrease of more than approximately 60% of plasma KLKB1 activity compared to baseline. See Banerji et al., N Engl J Med, 2017, 376:717-728 and Ferrone et al., Nucleic Acid Therapeutics, 2019, 82-917. KLKB1 activity is often measured as total kallikrein activity, where prekallikrein is converted to kallikrein in the sample, and total kallikrein activity is measured for that sample. In some cases, the range of KLKB1 activity decline can mean a decrease of approximately 60–80% of plasma KLKB1 activity compared to baseline. To calculate the decline of the analyte in a subject, the baseline can be obtained by collecting a pre-treatment sample from the subject. In some cases, the sample is a serum sample. In certain embodiments, a reduction in targeted KLKB1 activity is a decrease of approximately 60% of total kallikrein (prekallikrein and plasma kallikrein) activity compared to baseline. For example, achieving a therapeutic range of KLKB1 activity may mean reducing total kallikrein by more than approximately 60% from baseline. In some embodiments, a “normal kallikrein level” or “normal kallikrein range” is reduced. In some embodiments, a treatment-related reduction in kallikrein activity is achieved at levels of approximately 0-60%, 0-50%, 0-40%, 0-30%, 0-25%, 0-20%, 0-15%, 0-10% of a default value for the subject, or 10-60%, 10-50%, 10-40%, 10-30%, 10-20%, or 20-60%, 20-50%, 20-40%, or 20-30% of a normal kallikrein activity level. KLKB1 activity can be measured by assays known in the art, including the assays described herein.
[0404] The term “targeted KLKB1 protein reduction,” as used herein, means a target level of pKal compared to baseline. KLKB1 protein levels can be measured by assays known in the art, such as ELISA or Western blot assays, as described herein. Total KLKB1 protein can be measured using antibodies that detect both prekallikrein and kallikrein, and / or after converting prekallikrein in the sample to kallikrein. In some cases, the sample is a serum sample. In certain embodiments, targeted KLKB1 protein reduction is a reduction of approximately 60% of total kallikrein (prekallikrein and plasma kallikrein) compared to baseline. In some embodiments, the treatment-related reduction in total kallikrein protein achieves levels of approximately 0-60%, 0-50%, 0-40%, 0-30%, 0-25%, 0-20%, 0-15%, 0-10% of the default value for the subject, or 10-60%, 10-50%, 10-40%, 10-30%, 10-20%, or 20-60%, 20-50%, 20-40%, or 20-30% of the normal total kallikrein protein level.
[0405] A circulating plasma cHMWK level of less than approximately 30% of total HMWK was associated with a reduction in HAE attacks in patients treated with lanadermab (see Banerji, et al, 2017). In the same study, healthy controls had a plasma cHMWK level of approximately 8.3% of total HMWK. In another study, Suffritti et al. found mean cHMWK plasma levels of approximately 34.8% in normal controls, approximately 41.4% in HAE patients in remission, and approximately 58.1% in HAE patients experiencing attacks (Suffritti, et al. Clin Exp Allergy 2014;44:1503-14). Therapeutic treatment can target a circulating plasma cHMWK ratio of less than approximately 60% of total HMWK. In some embodiments, the ratio of cHMWK to HMWK is less than or greater than approximately 10%, 15%, 20%, 25%, 30%, 35%, 40%, and 50%.
[0406] The terms "about" or "approximately" refer to the allowable error for a particular value as determined by those skilled in the art, which in part depends on how the value is measured or determined.
[0407] II. Composition A. Compositions containing guide RNA (gRNA) For example, compositions useful for inducing site-directed binding that causes double-strand breaks (DSBs), single-strand breaks, and / or nucleic acid modifications within the KLKB1 gene are provided herein, using guide RNA having an RNA-guided DNA binding agent (e.g., a CRISPR / Cas system). The compositions may be administered to subjects having or suspected of having HAE. The compositions may be administered to subjects having increased serum and / or plasma bradykinin concentrations, such as by a decrease in prekallikrein protein levels in plasma or serum, a decrease in total kallikrein (prekallikrein and pKal) protein levels in plasma or serum, a decrease in the proportion of circulating cleaved HMWK (cHMWK), or a decrease in the proportion of cHMWK in citrated plasma. The compositions may be administered to subjects having increased serum and / or plasma prekallikrein and / or kallikrein concentrations. The compositions may be administered to subjects having increased serum and / or plasma total kallikrein concentrations. The compositions may be administered to subjects having increased serum and / or plasma kallikrein activity. Guide sequences targeting the KLKB1 gene are shown in Table 1 as sequence numbers 1 to 149.
[0408] Each guide sequence shown in Table 1 as Sequence IDs 1 to 149 may further contain additional nucleotides for forming crRNA, for example, having the following exemplary nucleotide sequence following the guide sequence at its 3' end: 5' to 3' orientation, GUUUUAGAGCUAUGCUGUUUUG (Sequence ID 167). In the case of sgRNA, the above guide sequence may further contain additional nucleotides for forming sgRNA, for example, having the following exemplary nucleotide sequence following the 3' end of the guide sequence: 5' to 3' orientation, GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Sequence ID 171) or GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (Sequence ID 172, which is Sequence ID 171 without the four terminal Us). In some embodiments, the four terminal Us of sequence number 171 are absent. In some embodiments, only one, two, or three of the four terminal Us of sequence number 171 are present.
[0409] In some embodiments, the sgRNA comprises one of the guide sequences of SEQ ID NOs: 1-149 and additional nucleotides to form a crRNA, for example, having the following exemplary nucleotide sequence at its 3' end, following the guide sequence: 5' to 3' orientation, GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 170) or GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGCACCGAGUCGGUGC (SEQ ID NO: 173). SEQ ID NO: 173 lacks eight nucleotides, referring to the following wild-type guide RNA conserved sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 172).
[0410] In some embodiments, a short single guide RNA (short sgRNA of KLKB1) is provided, comprising the guide sequence described herein and a “conserved portion of sgRNA” including a hairpin region, wherein the hairpin region lacks at least 5 to 10 nucleotides or 6 to 10 nucleotides. In certain embodiments, the hairpin region of the short single guide RNA of KLKB1 lacks 5 to 10 nucleotides with reference to the conserved portion of sgRNA (e.g., nucleotides H1-1 to H2-15 in Table 3B and Figure 15). In certain embodiments, the hairpin 1 region of the short single guide RNA of KLKB1 lacks 5 to 10 nucleotides with reference to the conserved portion of sgRNA (e.g., nucleotides H1-1 to H1-12 in Table 3B and Figure 15). See, for example, WO2019 / 237069, whose contents are incorporated herein by reference in their entirety, for example, in claims 1 to 15.
[0411] An example of a conserved sgRNA is shown in Table 3A (see also Figure 15), illustrating the conserved region of S. pyogenes Cas9 ("spyCas9" or "spCas9") sgRNA. The first row shows the nucleotide numbering, the second row shows the sequence (e.g., SEQ ID NO: 500), and the third row shows the domain. Briner AE et al., Molecular Cell 56:333-339 (2014) describes the functional domains of sgRNA referred to herein as "domains," including the "spacer" domain responsible for targeting, the "lower stem," "bulge," "upper stem" (which may include a tetraloop), the "nexus," and the "hairpin 1" and "hairpin 2" domains. See Briner et al., page 334, Figure 1A.
[0412] Table 3B provides a schematic diagram of the sgRNA domains used herein. In Table 3B, "n" between regions represents, for example, a variable number of nucleotides, such as 0-1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more. In some embodiments, n is equal to 0. In some embodiments, n is equal to 1.
[0413] In some embodiments, the KLKB1 sgRNA is derived from S. pyogenes Cas9 ("spyCas9") or a spyCas9 equivalent. In some embodiments, the sgRNA is not derived from S. pyogenes ("non-spyCas9"). In some embodiments, it consists of 5 to 10 nucleotides or 6 to 10 nucleotides in sequence.
[0414] In some embodiments, the short sgRNA of KLKB1 is a deletion of at least nucleotides 54–58 (AAAAA) of the conserved region of S. pyogenes Cas9 ("spyCas9") sgRNA, as shown in Table 3A. In some embodiments, the short sgRNA of KLKB1 is a non-spyCas9 sgRNA that is a deletion of at least the nucleotides corresponding to nucleotides 54–58 (AAAAA) of the conserved region of spyCas9, as determined, for example, by pairwise or structural alignment. In some embodiments, the non-spyCas9 sgRNA is a Staphylococcus aureus Cas9 ("saCas9") sgRNA.
[0415] In some embodiments, the short sgRNA of KLKB1 is missing at least nucleotides 54-61 (AAAAAGUG) of the conserved portion of the spyCas9 sgRNA. In some embodiments, the short sgRNA of KLKB1 is missing at least nucleotides 53-60 (GAAAAAGU) of the conserved portion of the spyCas9 sgRNA. In some embodiments, the short sgRNA of KLKB1 is missing 4, 5, 6, 7, or 8 nucleotides from nucleotides 53-60 (GAAAAAGU) or nucleotides 54-61 (AAAAAGUG) of the conserved portion of the spyCas9 sgRNA, or the corresponding nucleotides of the conserved portion of the non-spyCas9 sgRNA as determined, for example, by pairwise or structural alignment. [Table 1] [Table 2] [Table 3] [Table 4] [Table 5] [Table 6] [Table 7] [Table 8] [Table 9]
[0416] The guide RNA identified above as "G0XXXXX" is an sgRNA containing the identified 20-nucleotide target sequence from Table 1 or Table 2 within the guide structure of Sequence ID No. 300. In some embodiments, the sgRNA comprises one of the guide RNAs from Table 1 or 2 and one of the nucleotides from Sequence ID No. 300, and optionally, the sgRNA comprises one of the modification patterns described in Table 4. In some embodiments, the sgRNA comprises one of the guide RNAs from Table 1 or 2 and one of the conserved portions of the sgRNA from Table 4, and optionally, has one of the modification patterns described in Table 4. [Table 10] [Table 11]
[0417] In some embodiments, the present invention provides a composition comprising one or more guide RNAs (gRNAs) containing a guide sequence that directs an RNA guide DNA binder, which may be a nuclease (e.g., a Cas nuclease such as Cas9), to a target DNA sequence in KLKB1. The gRNA may comprise a crRNA containing the guide sequences shown in Table 1. The gRNA may comprise a crRNA containing 17, 18, 19, or 20 consecutive nucleotides of the guide sequences shown in Table 1. In some embodiments, the gRNA comprises a crRNA containing a sequence having approximately 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with at least 17, 18, 19, or 20 consecutive nucleotides of the guide sequences shown in Table 1. In some embodiments, the gRNA includes a crRNA containing a sequence having approximately 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity with respect to the guide sequences shown in Table 1. The gRNA may further contain a trRNA. In embodiments of each composition and method described herein, the crRNA and trRNA may be associated as a single RNA (sgRNA) or on separate RNAs (dgRNA). In the context of sgRNA, the components of crRNA and trRNA may be covalently linked, for example, by phosphodiester bonds or other covalent bonds.
[0418] In each embodiment of the compositions, uses, and methods described herein, the guide RNA may comprise two RNA molecules as a “dual guide RNA” or “dgRNA.” The dgRNA comprises, for example, a first RNA molecule comprising a crRNA containing a guide sequence shown in Table 1, and a second RNA molecule comprising a trRNA. The first and second RNA molecules do not have to be covalently bonded, but may form an RNA double helix by base pairing between portions of the crRNA and trRNA.
[0419] In each embodiment of the compositions, uses, and methods described herein, the guide RNA may comprise a single RNA molecule as a “single guide RNA” or “sgRNA”. The sgRNA may comprise a crRNA (or a portion thereof) containing a guide sequence shown in Table 1, covalently bonded to the trRNA. The sgRNA may comprise 17, 18, 19, or 20 consecutive nucleotides of the guide sequence shown in Table 1. In some embodiments, the crRNA and trRNA are covalently bonded via a linker. In some embodiments, the sgRNA forms a stem-loop structure by base pairing between the crRNA and portions of the trRNA. In some embodiments, the crRNA and trRNA are covalently bonded via one or more bonds other than phosphodiester bonds.
[0420] In some embodiments, the trRNA may comprise all or part of a naturally occurring CRISPR / Cas system-derived trRNA sequence. In some embodiments, the trRNA may comprise a truncated or modified wild-type trRNA. The length of the trRNA depends on the CRISPR / Cas system used. In some embodiments, the trRNA may comprise or consist of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, or more than 100 nucleotides. In some embodiments, the trRNA may comprise certain secondary structures, such as one or more hairpin or stem-loop structures, or one or more bulge structures.
[0421] In some embodiments, compositions are provided that include one or more guide RNAs, each containing one of the guide sequences from SEQ ID NOs: 1 to 149. In some embodiments, compositions are provided that include one or more guide RNAs, each containing one of the guide sequences from SEQ ID NOs: 1 to 149 and any conserved portion of the sgRNAs shown in Table 4, optionally having any of the modification patterns of the sgRNAs shown in Table 4, and optionally having 5'-terminal modifications and 3'-terminal modifications (if not already shown in the constructs in Table 4). In some embodiments, compositions are provided that include one or more guide RNAs, each containing one of the guide sequences from SEQ ID NOs: 1 to 149, with the nucleotides of SEQ ID NOs: 170, 171, 172, or 173 following the guide sequence at its 3' end. In some embodiments, one or more guide RNAs, each containing one of the guide sequences from SEQ ID NOs: 1 to 149, with the nucleotides of SEQ ID NOs: 170, 171, 172, or 173 at its 3' end, are modified according to the pattern of SEQ ID NOs: 300.
[0422] In some embodiments, a composition is provided comprising one or more guide RNAs, each containing a guide sequence from among sequence numbers 1 to 149. In one embodiment, the present invention provides a composition comprising one or more gRNAs, each containing a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids from sequence numbers 1 to 149.
[0423] In other embodiments, a composition is provided comprising at least one, for example, at least two gRNAs, each containing a guide sequence selected from any two or more of the guide sequences of SEQ ID NOs: 1 to 149. In some embodiments, the composition comprises at least two gRNAs, each containing a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids of SEQ ID NOs: 1 to 149.
[0424] The guide RNA composition of the present invention is designed to recognize (e.g., hybridize to) a target sequence within the KLKB1 gene. For example, the KLKB1 target sequence can be recognized and cleaved by a provided Cas cleavage containing the guide RNA. In some embodiments, an RNA guide DNA binder, e.g., Cas cleavase, may direct the guide RNA to the target sequence of the KLKB1 gene, the guide sequence of the guide RNA hybridizes with the target sequence, and the RNA guide DNA binder, e.g., Cas cleavase, cleaves the target sequence.
[0425] In some embodiments, the selection of one or more guide RNAs is determined based on target sequences within the KLKB1 gene. In some embodiments, a composition comprising one or more guide sequences includes guide sequences complementary to the corresponding genomic regions shown in Table 1 below, according to coordinates from the human reference genome hg38. Guide sequences in further embodiments may be complementary to sequences near genomic coordinates listed in any of the tables provided herein. For example, guide sequences in further embodiments may be complementary to sequences comprising 15 consecutive nucleotides ± 10 nucleotides at genomic coordinates listed in any of the tables disclosed herein.
[0426] Without being constrained by any particular theory, mutations in specific regions of a gene (e.g., frameshift mutations resulting from indels as a result of nuclease-mediated double-slash breaks) may be less tolerant than mutations in other regions of the gene, and therefore the location of the DSB is a critical factor in the amount or type of protein knockdown that may result. In some embodiments, gRNAs that are complementary to or have complementarity with a target sequence within KLKB1 are used to direct an RNA guide DNA binder to a specific location within the KLKB1 gene. In some embodiments, the gRNAs are designed to have a guide sequence that is complementary to or has complementarity with a target sequence within exon 1, exon 3, exon 4, exon 5, exon 6, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, or exon 15 of KLKB1.
[0427] In some embodiments, the guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to the target sequence present in the human KLKB1 gene. In some embodiments, the target sequence may be complementary to the guide sequence of the guide RNA. In some embodiments, the degree of complementarity or identity between the guide sequence of the guide RNA and its corresponding target sequence may be at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the target sequence and the guide sequence of the gRNA may be 100% complementary or identical. In other embodiments, the target sequence and the guide sequence of the gRNA may contain at least one mismatch. For example, the target sequence and the guide sequence of the gRNA may contain 1, 2, 3, or 4 mismatches, where the total length of the guide sequence is approximately 20. In some embodiments, the target sequence and the gRNA guide sequence may contain 1 to 4 mismatches, where the guide sequence consists of 20 nucleotides.
[0428] In some embodiments, the compositions or formulations disclosed herein include mRNA comprising an RNA guide DNA conjugate, for example, an open reading frame (ORF) encoding a Cas nuclease as described herein. In some embodiments, mRNA comprising an RNA guide DNA conjugate, for example, an ORF encoding a Cas nuclease, is provided, used, or administered.
[0429] B. Modified gRNA and mRNA In some embodiments, the gRNA is chemically modified. A gRNA containing one or more modified nucleosides or nucleotides is referred to as “modified” gRNA or “chemically modified” gRNA to describe the presence of one or more non-natural and / or naturally occurring components or structures used in place of or in addition to standard A, G, C, and U residues. In some embodiments, the modified gRNA is synthesized using non-standard nucleosides or nucleotides and is referred to herein as “modified.” Modified nucleosides or nucleotides may include one or more of the following: (i) modifications in the phosphodiester skeleton bond, e.g., one or both of the uncrosslinked phosphate oxygens and / or the replacement of one or more crosslinked phosphate oxygens (exemplary skeleton modifications); (ii) modifications of components of ribose sugars, e.g., the 2' hydroxyl of ribose sugars, e.g., replacement (exemplary sugar modifications); (iii) large-scale replacement of the phosphate moiety by a "dephosphorylated" linker (exemplary skeleton modifications); (iv) modifications or replacements of naturally occurring nucleic acid bases, including those by non-standard nucleic acid bases (exemplary base modifications); (v) replacement or modification of the ribose phosphate skeleton (exemplary skeleton modifications); (vi) modifications of the 3' or 5' end of an oligonucleotide, e.g., removal, modification or replacement of the terminal phosphate group, or conjugation of a part, cap, or linker (such 3' or 5' cap modifications may include sugar and / or skeleton modifications); and (vii) modifications or replacements of sugars (exemplary sugar modifications).
[0430] By combining the chemical modifications listed above, modified gRNA and / or mRNA can be provided that contain nucleosides and nucleotides (collectively, "residues") that may have two, three, four, or more modifications. For example, modified residues may have modified sugars and modified nucleic acid bases. In some embodiments, each base of the gRNA is modified, for example, all bases have a modified phosphate group such as a phosphorothioate. In certain embodiments, all or substantially all of the phosphate groups of the gRNA molecule are replaced by phosphorothioate groups. In some embodiments, the modified gRNA contains at least one modified residue at or near the 5' end of the RNA. In some embodiments, the modified gRNA contains at least one modified residue at or near the 3' end of the RNA.
[0431] In some embodiments, the gRNA contains one, two, three, or more modified residues. In some embodiments, at least 5% of the positions within the modified gRNA (e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%) are modified nucleosides or nucleotides.
[0432] Unmodified nucleic acids may be susceptible to degradation by, for example, intracellular nucleases or those found in serum. For example, nucleases can hydrolyze phosphodiester bonds in nucleic acids. Therefore, in one embodiment, the gRNAs described herein may contain one or more modified nucleosides or nucleotides to introduce stability against, for example, intracellular or serum-derived nucleases. In some embodiments, the modified gRNA molecules described herein may exhibit a reduced innate immune response when introduced into cell aggregates both in vivo and ex vivo. The term “innate immune response” includes cellular responses to exogenous nucleic acids, including single-stranded nucleic acids, including induction of cytokine (particularly interferon) expression and release and cell death.
[0433] In some embodiments of skeletal modification, the phosphate group of a modified residue may be modified by replacing one or more oxygen atoms with different substituents. Furthermore, modified residues, such as those present in modified nucleic acids, may involve extensive replacement of an unmodified phosphate moiety with a modified phosphate group, as described herein. In some embodiments, skeletal modification of the phosphate backbone may involve modifications that result in either an uncharged linker or a charged linker with an asymmetric charge distribution.
[0434] Examples of modified phosphate groups include phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotryesters. The phosphate atom in an unmodified phosphate group is achiral. However, substitution of one of the non-bridged oxygen atoms with one of the atoms or groups of atoms described above can make the phosphate atom chiral. The stereophosphorus atom may have either an "R" configuration (Rp as herein) or an "S" configuration (Sp as herein). The skeleton can also be modified by substitution of the bridged oxygen (i.e., the oxygen linking the phosphate to the nucleoside) with nitrogen (bridged phosphoramidate), sulfur (bridged phosphorothioate), and carbon (bridged methylenephosphonate). The substitution may occur in either or both of the bridged oxygens.
[0435] In some skeletal modifications, the phosphate group can be replaced by a non-phosphorus-containing linking group. In some embodiments, the charged phosphate group can be replaced by a neutral moiety. Examples of moieties that can replace the phosphate group include, but are not limited to, methylphosphonic acid, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, and methyleneoxymethylimino.
[0436] Scaffolds can also be constructed that mimic nucleic acids in which the phosphate linker and ribose sugar are replaced by nuclease-resistant nucleosides or nucleotide substitutes. Such modifications may include both a skeletal and sugar modifications. In some embodiments, nucleic acid bases may be anchored by the substitute skeletal structure. Examples may, non-limitingly, include morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleic acid base substitutes.
[0437] Modified nucleosides and modified nucleotides may include one or more modifications to a sugar group, i.e., sugar modifications. For example, the 2'-hydroxyl group (OH) may be modified, for example, by being replaced by many different "oxy" or "deoxy" substituents. In some embodiments, modifications to the 2'-hydroxyl group can enhance the stability of the nucleic acid because it is no longer possible for the hydroxyl to be further deprotonated to form a 2'-alkoxide ion.
[0438] Examples of 2'-hydroxyl group modifications include alkoxy or aryloxy (OR, where "R" can be alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), polyethylene glycol (PEG), and O(CH2CH2O). n CH2CH2OR, where R is, for example, H or optionally substituted alkyl, and n can be an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20). In some embodiments, the 2'-hydroxyl group modification may be 2'-O-Me. In some embodiments, the 2'-hydroxyl group modification may be a 2'-fluoro modification in which the 2'-hydroxyl group is replaced with fluorine. In some embodiments, the 2'-hydroxyl group modification may be such that the 2'-hydroxyl is, for example, a C1-6 alkylene or C 1-6The materials may also contain "locked" nucleic acids (LNAs) that can be linked to the 4' carbon of the same ribose sugar via heteroalkylene crosslinks, exemplary crosslinks of which include methylene, propylene, ether, or amino crosslinks, O-amino (wherein amino can be, for example, NH2, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino), and aminoalkoxys, O(CH2) n -amino (wherein amino can be, for example, NH2, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino). In some embodiments, the 2' hydroxyl group modification may include "unlocked" nucleic acids (UNA) in which the ribose ring lacks a C2'-C3' bond. In some embodiments, the 2' hydroxyl group modification may include a methoxyethyl group (MOE), (OCH2CH2OCH3, e.g., a PEG derivative).
[0439] The "deoxy" 2' modification can be hydrogen (i.e., deoxyribose sugar, e.g., the overhang of a partial dsRNA), halo (e.g., bromo, chloro, fluoro, or iodine), amino (where amino can be e.g., NH2, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid), or NH(CH2CH2NH) n CH2CH2-amino (wherein amino is, for example, as described herein), -NHC(O)R (wherein R can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), cyano, mercapto, alkyl-thio-alkyl, thioalkoxy, and alkyl, cycloalkyl, aryl, alkenyl and alkynyl, which may optionally be substituted with aminos, for example, as described herein.
[0440] Sugar modification may involve sugar groups containing one or more carbon atoms and having a stereochemical configuration opposite to that of the corresponding carbon atoms in ribose. Therefore, modified nucleic acids may include nucleotides containing, for example, arabinose as the sugar. Modified nucleic acids may also include debasic sugars. These debasic sugars may also be further modified in one or more of their constituent sugar atoms. Modified nucleic acids may also include one or more L-type sugars, such as L-nucleosides.
[0441] The modified nucleosides and modified nucleotides described herein, which can be incorporated into modified nucleic acids, may include modified bases, also called nucleic acid bases. Examples of nucleic acid bases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleic acid bases can be modified or completely replaced to result in modified residues that can be incorporated into modified nucleic acids. The nucleic acid bases of nucleotides can be independently selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleic acid bases may include, for example, naturally occurring bases and synthetic derivatives of bases.
[0442] In embodiments using dual guide RNA, each of the crRNA and tracrRNA may include modifications. Such modifications may be present at one or both ends of the crRNA and / or tracrRNA. In embodiments including sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, and / or the internal nucleoside may be modified, and / or the entire sgRNA may be chemically modified. Certain embodiments include 5' end modifications. Certain embodiments include 3' end modifications.
[0443] In some embodiments, the guide RNA disclosed herein includes one of the modification patterns disclosed in WO2018 / 107028 and / or WO2019 / 237069, the contents of which are incorporated herein by reference in their entirety. For example, the guide RNA disclosed herein may include the short guide structures described in claims 1 to 15 and / or the modification patterns described in claims 16 to 462 of WO2019 / 237069. In some embodiments, the guide RNA disclosed herein includes one of the structure / modification patterns disclosed in WO2015 / 200555, the contents of which are incorporated herein by reference in their entirety. In some embodiments, the guide RNA disclosed herein includes one of the structure / modification patterns disclosed in WO2017 / 136794, the contents of which are incorporated herein by reference in their entirety.
[0444] C.YA Qualification Modifications at the YA site (also referred to herein as YA modifications) may be modifications of nucleoside linkages, such as modifications of bases (pyrimidine or adenine) by chemical modification, substitution, or other means, and / or modifications of sugars (e.g., modifications at the 2-position, such as 2'-O-alkyl, 2'-F, 2'-moe, 2'-F arabinose, 2'-H (deoxyribose), etc.). In some embodiments, a “YA modification” is any modification that alters the structure of a dinucleotide motif to reduce RNA endonuclease activity, for example, by preventing recognition or cleavage of the YA site by RNase and / or by stabilizing the RNA structure (e.g., secondary structure) which reduces RNase access to the cleavage site. See Peacock et al., J Org Chem. 76:7295-7300 (2011), Behlke, Oligonucleotides 18:305-320 (2008), Ku et al., Adv. Drug Delivery Reviews 104:16-28 (2016), and Ghidini et al., Chem. Commun., 2013, 49, 9036. Peacock et al., Behlke, Ku, and Ghidini provide exemplary modifications suitable as YA modifications. Modifications known to those skilled in the art for reducing endonucleotide degradation are included. Exemplary 2'-ribose modifications affecting the 2'-hydroxyl group involved in RNase cleavage are 2'-H and 2'-O-alkyl (including 2'-O-Me). Modifications such as bicyclic ribose analogs UNA of residues at the YA site, and intermodal nucleoside linkages, can be YA modifications. Exemplary base modifications that can stabilize the RNA structure are pseudouridine and 5-methylcytosine. In some embodiments, at least one nucleotide of the YA site is modified. In some embodiments, the pyrimidine of the YA site (also referred to as the "pyrimidine site") includes modifications (including modifications that alter the internucleoside linkage immediately 3' of the sugar of the pyrimidine, modifications of the pyrimidine base, and modifications of the ribose, for example, at its 2' position).In some embodiments, the adenine at the YA site (also referred to as the "adenine position") includes modifications (including modifications altering the internucleoside linkage immediately 3' of the pyrimidine sugar, modifications of the pyrimidine base, and modifications of ribose, for example, at its 2' position). In some embodiments, the pyrimidine and adenine at the YA site include modifications. In some embodiments, the YA modification reduces RNA endonuclease activity.
[0445] In some embodiments, the short sgRNA includes modifications at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more YA sites. In some embodiments, the pyrimidine at the YA site includes modifications (including modifications altering the nucleoside linkage immediately 3' of the sugar of the pyrimidine). In some embodiments, the adenine at the YA site includes modifications (including modifications altering the nucleoside linkage immediately 3' of the sugar of the adenine). In some embodiments, the pyrimidine and adenine at the YA site include modifications such as modifications of sugars, bases, or nucleoside linkages. The YA modification may be any type of modification described herein. In some embodiments, the YA modification includes one or more of phosphorothioate, 2'-OMe, or 2'-fluoro. In some embodiments, the YA modification includes pyrimidine modifications including one or more of phosphorothioate, 2'-OMe, or 2'-fluoro. In some embodiments, the YA modification comprises a bicyclic ribose analog (e.g., LNA, BNA, or ENA) within an RNA double-stranded region containing one or more YA sites. In some embodiments, the YA modification comprises a bicyclic ribose analog (e.g., LNA, BNA, or ENA) within an RNA double-stranded region containing a YA site, and the YA modification is distal to the YA site.
[0446] In some embodiments, the sgRNA includes YA site modifications in the guide region. In some embodiments, the guide region includes one, two, three, four, five or more YA sites ("guide region YA sites") which may include YA modifications. In some embodiments, one or more YA sites located from the 5' end to the 5, 6, 7, 8, 9, or 10 end of the 5' end ("5 end", etc., refers to position 5 relative to the 3' end of the guide region, i.e., the furthest 3' nucleotide in the guide region) include YA modifications. In some embodiments, two or more YA sites located from the 5' end to the 5, 6, 7, 8, 9, or 10 end of the 5' end include YA modifications. In some embodiments, three or more YA sites located from the 5' end to the 5, 6, 7, 8, 9, or 10 end of the 5' end include YA modifications. In some embodiments, four or more YA sites located from the 5' end to the 5, 6, 7, 8, 9, or 10 end of the 5' end include YA modifications. In some embodiments, five or more YA sites located from the 5' end to the 5, 6, 7, 8, 9, or 10 end of the 5' end contain YA modifications. The modification guide region YA sites contain YA modifications.
[0447] In some embodiments, the modified guide region YA site is located within the 17th, 16th, 15th, 14th, 13th, 12th, 11th, 10th, or 9th nucleotide of the 3' terminal nucleotide of the guide region. For example, if the modified guide region YA site is located within the 10th nucleotide of the 3' terminal nucleotide of the guide region, and the guide region is 20 nucleotides long, the modified nucleotide of the modified guide region YA site is located at any of the positions 11th to 20th. In some embodiments, the YA modification is located within the 20th, 19th, 18th, 17th, 16th, 15th, 14th, 13th, 12th, 11th, 10th, 9th, 8th, 7th, 6th, 5th, 4th, 3rd, 2nd, or 1st nucleotide of the YA site, starting from the 3' terminal nucleotide of the guide region. In some embodiments, the YA modification is located at 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide from the 3' terminal nucleotide of the guide region.
[0448] In some embodiments, the modification guide region YA site is nucleotide 4, 5, 6, 7, 8, 9, 10, or 11th from the 5' end of the 5' terminal, or thereafter.
[0449] In some embodiments, the modification guide region YA site is other than the 5' end modification. For example, the sgRNA may include the 5' end modification described herein and may further include the modification guide region YA site. Alternatively, the sgRNA may include an unmodified 5' end and the modification guide region YA site. Alternatively, the sgRNA may include a modified 5' end and an unmodified guide region YA site.
[0450] In some embodiments, the modified guide region YA site includes modifications that do not include at least one nucleotide located 5' of the guide region YA site. For example, if nucleotides 1-3 contain phosphorothioates, nucleotide 4 contains only the 2'-OMe modification, and nucleotide 5 is a pyrimidine at the YA site and contains a phosphorothioate, then the modified guide region YA site includes modifications (phosphorothioate) that do not include at least one nucleotide located 5' of the guide region YA site (nucleotide 4). In another example, if nucleotides 1-3 contain phosphorothioates, and nucleotide 4 is a pyrimidine at the YA site and contains 2'-OMe, then the modified guide region YA site includes modifications (2'-OMe) that do not include at least one nucleotide (any of nucleotides 1-3) located 5' of the guide region YA site. This condition is also always met if the unmodified nucleotide is located 5' of the modified guide region YA site.
[0451] In some embodiments, the modified guide region YA includes modifications described for the YA region above.
[0452] Additional embodiments of guide region YA site modification are shown in the summary above. Any embodiments described elsewhere in this disclosure may be combined with any of the prior embodiments to the extent feasible.
[0453] In some embodiments, the sgRNA includes modifications to the conserved YA region. Conserved YA regions 1-10 are shown in Figure 14. In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 conserved YA regions include modifications.
[0454] In some embodiments, the storage region YA sites 1, 8, or 1 and 8 include YA modifications. In some embodiments, the storage region YA sites 1, 2, 3, 4, and 10 include YA modifications. In some embodiments, YA sites 2, 3, 4, 8, and 10 include YA modifications. In some embodiments, the storage region YA sites 1, 2, 3, and 10 include YA modifications. In some embodiments, YA sites 2, 3, 8, and 10 include YA modifications. In some embodiments, YA sites 1, 2, 3, 4, 8, and 10 include YA modifications. In some embodiments, 1, 2, 3, 4, 5, 6, 7, or 8 additional storage region YA sites include YA modifications.
[0455] In some embodiments, 1, 2, 3, or 4 of the preserved region YA sites 2, 3, 4, and 10 include YA modifications. In some embodiments, 1, 2, 3, 4, 5, 6, 7, or 8 additional preserved region YA sites include YA modifications.
[0456] In some embodiments, the modified preservation region YA includes the modifications described for the YA region.
[0457] Further embodiments of the modification of the YA site in the preserved region are shown in the summary above. Any embodiments described elsewhere in this disclosure may be combined with any of the prior embodiments to the extent feasible.
[0458] In some embodiments, an sgRNA is provided that comprises one guide sequence from sequence numbers 1 to 149 and any conserved portion of the sgRNA shown in Table 4, optionally having any modification pattern of the sgRNA shown in Table 4, and optionally including a 5'-terminal modification and a 3'-terminal modification (if not already shown in the constructs in Table 4).
[0459] In some embodiments, the sgRNA comprises one of the modification patterns shown in Table 4 below, where N is any natural or non-natural nucleotide, and the entirety of N comprises the KLKB1 guide sequence described herein in Table 1. Table 4 does not show the guide sequence portion of the sgRNA. The modification remains as shown in Table 4 despite the substitution of N for the guide nucleotide; that is, the guide nucleotide replaces "N", but the nucleotide is modified as shown in Table 4. [Table 12] JPEG0007883437000013.jpg222155JPEG0007883437000014.jpg229154JPEG00078834370 00015.jpg235154JPEG0007883437000016.jpg235153JPEG0007883437000017.jpg229153 JPEG0007883437000018.jpg237154JPEG0007883437000019.jpg236153JPEG00078834370 00020.jpg237153JPEG0007883437000021.jpg236154JPEG0007883437000022.jpg210154
[0460] In some embodiments, the modified sgRNA comprises the following sequence mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 300), where "N" may be any natural or non-natural nucleotide, and the entirety of N comprises the KLKB1 guide sequence listed in Table 1. For example, SEQ ID NO: 300 is included herein, where N is replaced with one of the guide sequences (SEQ ID NOs: 1 to 149) disclosed herein in Table 1. Furthermore, this specification also includes guide RNAs obtained by combining any of the guide sequences (SEQ ID NOs. 1-149) in Table 1 with a conserved portion of sgRNA, such as the sequences in Table 4.
[0461] Any of the modifications described below may be present in the gRNAs and mRNAs described herein.
[0462] The terms "mA," "mC," "mU," or "mG" may be used to represent nucleotides modified with 2'-O-Me.
[0463] The 2'-O-methyl modification can be described as follows: [ka]
[0464] Another chemical modification that has been shown to affect nucleotide sugar rings is halogen substitution. For example, 2'-fluoro(2'-F) substitutions on nucleotide sugar rings can increase oligonucleotide binding affinity and nuclease stability.
[0465] In this application, the terms “fA,” “fC,” “fU,” or “fG” may be used to represent a nucleotide substituted with 2'-F.
[0466] The 2'-F substitution can be described as follows: [ka]
[0467] A phosphorothioate (PS) linkage or bond refers to a phosphodiester linkage, such as a bond between nucleotide bases in which a sulfur atom replaces one uncrosslinked phosphate oxygen atom. When oligonucleotides are produced using phosphorothioates, the modified oligonucleotide may also be called an S-oligo.
[0468] The symbol "*" may be used to indicate PS modification. In this application, the terms A*, C*, U*, or G* may be used to indicate a nucleotide that is attached to an adjacent (e.g., 3') nucleotide by a PS bond.
[0469] In this application, the terms "mA*", "mC*", "mU*", or "mG*" may be used to indicate a nucleotide that is substituted with 2'-O-Me and linked to the next (e.g., 3') nucleotide by a PS bond.
[0470] The following diagram shows the substitution of S- atoms to non-crosslinked phosphate oxygen, resulting in a PS bond instead of a phosphodiester bond. [ka]
[0471] Debasic nucleotides are those that lack a nitrogenous base. The following diagram illustrates oligonucleotides that have a debasic (also known as depurine) site lacking a base. [ka]
[0472] An inverted base refers to a base that has a linkage that is the reverse of the usual 5'-to-3' linkage (i.e., either a 5'-to-5' linkage or a 3'-to-3' linkage). For example, [ka]
[0473] Debasic nucleotides can be linked to inverted ligatures. For example, a debasic nucleotide may be linked to a terminal 5' nucleotide via a 5'-to-5' bond, or it may be linked to a terminal 3' nucleotide via a 3'-to-3' bond. An inverted debasic nucleotide at either the terminal 5' or 3' nucleotide may also be referred to as an inverted debasic terminal cap.
[0474] In some embodiments, one or more of the first three, four, or five nucleotides at the 5' end and one or more of the last three, four, or five nucleotides at the 3' end are modified. In some embodiments, the modification is 2'-O-Me, 2'-F, inverted debasalized nucleotide, PS bond, or other nucleotide modifications well known in the art to increase stability and / or performance.
[0475] In some embodiments, the first four nucleotides at the 5' end and the last four nucleotides at the 3' end are linked using phosphorothioate (PS) bonds.
[0476] In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end include 2'-O-methyl (2'-O-Me) modified nucleotides. In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end include 2'-fluoro (2'-F) modified nucleotides. In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end include inverted debasalized nucleotides.
[0477] In some embodiments, the guide RNA comprises a modified sgRNA. In some embodiments, the guide RNA comprises any conserved portion of the sgRNA shown in Table 4, optionally having any modification pattern of the sgRNA shown in Table 4, and optionally having a 5'-terminal modification and a 3'-terminal modification (if not already shown in the constructs in Table 4). In some embodiments, the sgRNA comprises any modification pattern of the sgRNA shown in Table 4, where N is any native or non-native nucleotide, and the entirety of N comprises a guide sequence (e.g., as shown in Table 1) that directs the nuclease to a target sequence within KLKB1.
[0478] In some embodiments, the guide RNA comprises an sgRNA containing one of the guide sequences from SEQ ID NOs: 1 to 149 and any conserved portion of the sgRNA shown in Table 4, optionally having any modification pattern of the sgRNA shown in Table 4, and optionally including 5'-terminal modifications and 3'-terminal modifications (if not already shown in the constructs in Table 4). In some embodiments, the guide RNA comprises an sgRNA containing one of the guide sequences from SEQ ID NOs: 1 to 149 and the nucleotide of SEQ ID NOs: 170, 171, 172, or 173, wherein the nucleotide of SEQ ID NOs: 170, 171, 172, or 173 is on the 3' end of the guide sequence, and the sgRNA may be modified as shown in Table 4 or SEQ ID NOs: 300.
[0479] As described above, in some embodiments, the compositions or formulations disclosed herein include mRNA comprising an RNA guide DNA conjugate, for example, an open reading frame (ORF) encoding a Cas nuclease as described herein. In some embodiments, mRNA comprising an RNA guide DNA conjugate, for example, an ORF encoding a Cas nuclease, is provided, used, or administered. In some embodiments, the ORF encoding an RNA guide DNA nuclease is referred to as a “modified RNA guide DNA conjugate ORF” or simply “modified ORF,” used as an abbreviation to indicate that the ORF is modified.
[0480] In some embodiments, the modified ORF may contain modified uridine at at least one, more, or all uridine positions. In some embodiments, the modified uridine is uridine modified at position 5 with, for example, halogen, methyl, or ethyl. In some embodiments, the modified uridine is pseudouridine modified at position 1 with, for example, halogen, methyl, or ethyl. The modified uridine may be, for example, pseudouridine, N1-methyl-psoidouridine, 5-methoxyuridine, 5-iodouridine, or a combination thereof. In some embodiments, the modified uridine is 5-methoxyuridine. In some embodiments, the modified uridine is 5-iodouridine. In some embodiments, the modified uridine is pseudouridine. In some embodiments, the modified uridine is N1-methyl-psoidouridine. In some embodiments, the modified uridine is a combination of pseudouridine and N1-methyl-psoidouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of N1-methylpsoiduridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and N1-methylpsoiduridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-iodouridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and 5-methoxyuridine.
[0481] In some embodiments, the mRNA disclosed herein includes a 5' cap, e.g., Cap0, Cap1, or Cap2. The 5' cap is generally a 7-methylguanine ribonucleotide (which may be further modified, e.g., with respect to ARCA, as discussed below) linked via a 5'-triphosphate to the 5' position of the first nucleotide of the 5'-3' chain of mRNA (i.e., the nucleotide proximal to the first cap). In Cap0, the ribose of both the first and second cap-proximal nucleotides of mRNA contains 2'-hydroxyl. In Cap1, the ribose of the first and second transcription nucleotides of mRNA contains 2'-methoxy and 2'-hydroxyl, respectively. In Cap2, the ribose of both the first and second cap-proximal nucleotides of mRNA contains 2'-methoxy. See, for example, Katibah et al. (2014) Proc Natl Acad Sci USA 111(33):12025-30 and Abbas et al. (2017) Proc Natl Acad Sci USA 114(11):E2106-E2115. Most endogenous high-level eukaryotic mRNAs, including mammalian mRNA such as human mRNA, contain either Cap1 or Cap2. Cap0, and other cap structures different from Cap1 and Cap2, may be immunogenic in mammals such as humans because they are recognized as "non-self" by components of the innate immune system such as IFIT-1 and IFIT-5, and can cause elevated cytokine levels, including type I interferons. Components of the innate immune system such as IFIT-1 and IFIT-5 may also compete with eIF4E for mRNA binding to caps other than Cap1 or Cap2, potentially inhibiting mRNA translation.
[0482] Caps can be included cotranscribed. For example, ARCA (anti-reverse cap analog, Thermo Fisher Scientific catalog number AM8045) is a cap analog containing 7-methylguanine 3'-methoxy-5'-triphosphate linked to the 5' position of a guanine ribonucleotide and can be incorporated into the transcript in vitro at the initiation. ARCA results in a Cap0 cap where the 2' position of the nucleotide proximal to the first cap is hydroxyl. See, for example, Stepinski et al., (2001) “Synthesis and properties of mRNAs containing the novel 'anti-reverse' cap analogs 7-methyl(3'-O-methyl)GpppG and 7-methyl(3'deoxy)GpppG,” RNA 7:1486-1495. The structure of ARCA is shown below. [ka]
[0483] The Cap1 structure can be co-transferred using CleanCap®AG (m7G(5')ppp(5')(2'OMeA)pG, TriLink Biotechnologies catalog number N-7113) or CleanCap®GG (m7G(5')ppp(5')(2'OMeG)pG, TriLink Biotechnologies catalog number N-7133). 3'-O-methylated forms of CleanCap®AG and CleanCap®GG are also available from TriLink Biotechnologies as catalog numbers N-7413 and N-7433, respectively. The structure of CleanCap®AG is shown below. [ka]
[0484] Alternatively, the cap can be added to the RNA after transcription. For example, the Vaccinia capping enzyme is commercially available (New England Biolabs catalog number M2080S) and has RNA triphothphatase and guanylyltransferase activity given by its D1 subunit and guanine methyltransferase activity given by its D12 subunit. Therefore, 7-methylguanine can be added to RNA to give Cap0 in the presence of S-adenosylmethionine and GTP. See, for example, Guo, P. and Moss, B. (1990) Proc. Natl. Acad. Sci. USA 87, 4023-4027 and Mao, X. and Shuman, S. (1994) J. Biol. Chem. 269, 24472-24479.
[0485] In some embodiments, the mRNA further comprises a polyadenylated (poly-A) tail. In some embodiments, the poly-A tail contains at least 20, 30, 40, 50, 60, 70, 80, 90, or 100 adenines, and optionally up to 300 adenines. In some embodiments, the poly-A tail contains 95, 96, 97, 98, 99, or 100 adenine nucleotides.
[0486] D. Ribonucleoprotein complex In some embodiments, the disclosure provides compositions comprising one or more gRNAs containing one or more guide sequences from Table 1 or 2, and an RNA guide DNA binder, e.g., a nuclease, e.g., a Cas nuclease, e.g., Cas9. In some embodiments, the RNA guide DNA binder has cribase activity, which may also be referred to as double-stranded endonuclease activity. In some embodiments, the RNA guide DNA binder comprises a Cas nuclease. Examples of Cas9 nucleases include those from the type II CRISPR systems of S. pyogenes, S. aureus, and other prokaryotes (see, for example, the list in the following paragraph), as well as modified (e.g., operational or mutant) forms thereof. See, for example, US2016 / 0312198A1 and US2016 / 0312199A1. Other examples of Cas nucleases include the Csm or Cmr complex of the type III CRISPR system, or Cas10, Csm1, or its Cmr2 subunit, and the cascade complex of the type I CRISPR system, or its Cas3 subunit. In some embodiments, the Cas nuclease may originate from the type IIA, type IIB, or type IIC system. For a discussion of various CRISPR systems and Cas nucleases, see, for example, Makarova et al., NAT.REV.MICROBIOL.9:467-477(2011), Makarova et al., NAT.REV.MICROBIOL,13:722-36(2015), and Shmakov et al., MOLECULAR CELL,60:385-397(2015).
[0487] Non-limiting exemplary species from which Cas nucleases can be derived include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella succinogenes, Sutterella wadsworthensis, Gammaproteobacterium, Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, Fibrobacter succinogene, Rhodospirillum rubrum, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Lactobacillus buchneri, Treponema denticola, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp.、Crocosphaera watsonii、Cyanothece sp.、Microcystis aeruginosa、Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohlobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Streptococcus pasteurianus, Neisseria cinerea, Campylobacter lari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, Acidaminococcus sp., Lachnospiraceae bacterium ND2006, and Acaryochloris marina are included.
[0488] In some embodiments, the Cas nuclease is the Cas9 nuclease derived from Streptococcus pyogenes. In some embodiments, the Cas nuclease is the Cas9 nuclease derived from Streptococcus thermophilus. In some embodiments, the Cas nuclease is the Cas9 nuclease derived from Neisseria meningitidis. In some embodiments, the Cas nuclease is the Cas9 nuclease derived from Staphylococcus aureus. In some embodiments, the Cas nuclease is the Cpf1 nuclease derived from Francisella novicida. In some embodiments, the Cas nuclease is the Cpf1 nuclease derived from Acidaminococcus sp. In some embodiments, the Cas nuclease is the Cpf1 nuclease derived from Lachnospiraceae bacterium ND2006. In further embodiments, the Cas nuclease is a Cpf1 nuclease derived from Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium, Parcubacteria bacterium, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prevotella disiens, or Porphyromonas macacae. In specific embodiments, the Cas nuclease is a Cpf1 nuclease derived from Acidaminococcus or Lachnospiraceae.
[0489] In some embodiments, the gRNA included with the RNA guide DNA binder is called a ribonucleoprotein complex (RNP). In some embodiments, the RNA guide DNA binder is a Cas nuclease. In some embodiments, the gRNA included with the Cas nuclease is called a Cas RNP. In some embodiments, the RNP contains type I, type II, or type III components. In some embodiments, the Cas nuclease is a Cas9 protein derived from the type II CRISPR / Cas system. In some embodiments, the gRNA included with Cas9 is called a Cas9 RNP.
[0490] Wild-type Cas9 has two nuclease domains, RuvC and HNH. The RuvC domain cleaves the non-target DNA strand, and the HNH domain cleaves the target DNA strand. In some embodiments, the Cas9 protein contains one or more RuvC domains and / or one or more HNH domains. In some embodiments, the Cas9 protein is wild-type Cas9. In each embodiment of the composition, use, and method, Cas induces double-strand breaks in target DNA.
[0491] In some embodiments, a chimeric Cas nuclease is used, in which one domain or region of a protein is replaced by a part of a different protein. In some embodiments, the Cas nuclease domain may be replaced by a domain derived from a different nuclease, such as Fok1. In some embodiments, the Cas nuclease may be a modified nuclease.
[0492] In other embodiments, the Cas nuclease may be derived from the type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a component of the type I CRISPR / Cas system cascade complex. In some embodiments, the Cas nuclease may be the Cas3 protein. In some embodiments, the Cas nuclease may be derived from the type III CRISPR / Cas system. In some embodiments, the Cas nuclease may have RNA cleavage activity.
[0493] In some embodiments, the RNA guide DNA binder has single-strand nickase activity, i.e., it can cleave one DNA strand to produce a single-strand break (also known as a "nick"). In some embodiments, the RNA guide DNA binder includes Cas nickase. Nickase is an enzyme that produces a nick in dsDNA, i.e., it cleaves one strand of the DNA double helix but not the other. In some embodiments, Cas nickase is a form of Cas nuclease (e.g., the Cas nuclease discussed above) in which the endonucleotide degradation active site is inactivated, for example, by one or more modifications (e.g., point mutations) in the catalytic domain. For a discussion of Cas nickase and exemplary catalytic domain modifications, see, for example, U.S. Patent No. 8,889,356. In some embodiments, Cas nickase, such as Cas9 nickase, has an inactivated RuvC or HNH domain.
[0494] In some embodiments, the RNA guide DNA binding agent is modified to contain only one functional nuclease domain. For example, the drug protein may be modified to have one of its nuclease domains mutated or completely or partially deleted in order to reduce its nucleic acid cleavage activity. In some embodiments, a nickase having a reduced-activity RuvC domain is used. In some embodiments, a nickase having an inactive RuvC domain is used. In some embodiments, a nickase having a reduced-activity HNH domain is used. In some embodiments, a nickase having an inactive HNH domain is used.
[0495] In some embodiments, conserved amino acids within the Cas protein nuclease domain are substituted to reduce or modify nuclease activity. In some embodiments, the Cas nuclease may contain amino acid substitutions within the RuvC or RuvC-like nuclease domain. An example of an amino acid substitution in the RuvC or RuvC-like nuclease domain is D10A (based on the S. pyogenes Cas9 protein). See, for example, Zetsche et al. (2015) Cell Oct 22:163(3):759-771. In some embodiments, the Cas nuclease may contain amino acid substitutions within the HNH or HNH-like nuclease domain. Example of amino acid substitutions in the HNH or HNH-like nuclease domain is E762A, H840A, N863A, H983A, and D986A (based on the S. pyogenes Cas9 protein). See, for example, Zetsche et al. (2015). Further exemplary amino acid substitutions include D917A, E1006A, and D1255A (based on the Francisella novicida U112 Cpf1 (FnCpf1) sequence (UniProtKB-A0Q7Q2 (CPF1_FRATN))).
[0496] In some embodiments, the mRNA encoding the nickase is provided in combination with a pair of guide RNAs complementary to the sense and antisense strands of the target sequence, respectively. In this embodiment, the guide RNAs direct the nickase to the target sequence and introduce a double-segment break (DSB) by generating a nick on the opposite strand of the target sequence (i.e., double nicking). In some embodiments, the use of double nicking can improve specificity and reduce off-target effects. In some embodiments, the nickase is used with two distinct guide RNAs that target the opposite strand of the DNA to produce a double nick within the target DNA. In some embodiments, the nickase is used with two distinct guide RNAs selected to be located very close together to produce a double nick within the target DNA.
[0497] In some embodiments, the RNA-guided DNA conjugate lacks cleavase and nickase activity. In some embodiments, the RNA-guided DNA conjugate comprises a dCas DNA-binding polypeptide. The dCas polypeptide possesses DNA-binding activity while essentially lacking catalytic (cleavase / nickase) activity. In some embodiments, the dCas polypeptide is a dCas9 polypeptide. In some embodiments, the RNA-guided DNA conjugate lacking cleavase and nickase activity, or the dCas DNA-binding polypeptide, is a form of a Cas nuclease (e.g., the Cas nucleases discussed above) whose endonucleotide degradation active site has been inactivated, for example, by one or more modifications (e.g., point mutations) within its catalytic domain. See, for example, US2014 / 0186958A1 and US2015 / 0166980A1.
[0498] In some embodiments, the RNA guide DNA binder comprises one or more heterogeneous functional domains (for example, a fusion polypeptide or containing a fusion polypeptide).
[0499] In some embodiments, heterogeneous functional domains can facilitate the transport of RNA guide DNA conjugates to the cell nucleus. For example, heterogeneous functional domains can be nuclear localization signals (NLS). In some embodiments, RNA guide DNA conjugates can be fused with 1 to 10 NLS. In some embodiments, RNA guide DNA conjugates can be fused with 1 to 5 NLS. In some embodiments, RNA guide DNA conjugates can be fused with 1 NLS. When 1 NLS is used, the NLS can be ligated at the N-terminus or C-terminus of the RNA guide DNA conjugate sequence. It can also be inserted into the RNA guide DNA conjugate sequence. In other embodiments, RNA guide DNA conjugates can be fused with more than 1 NLS. In some embodiments, RNA guide DNA conjugates can be fused with 2, 3, 4, or 5 NLS. In some embodiments, RNA guide DNA conjugates can be fused with 2 NLS. In certain circumstances, the 2 NLS may be the same (e.g., 2 SV40 NLS) or different. In some embodiments, the RNA guide DNA binder is fused to a sequence of two SV40 NLS linked at the carboxyl terminus. In some embodiments, the RNA guide DNA binder may be fused to two NLS, one linked to the N-terminus and the other to the C-terminus. In some embodiments, the RNA guide DNA binder may be fused to three NLS. In some embodiments, the RNA guide DNA binder may be fused without any NLS. In some embodiments, the NLS may be a single subsequence such as SV40 NLS, PKKKRKV (SEQ ID NO: 600), or PKKKRRV (SEQ ID NO: 601). In some embodiments, the NLS may be a bisubsequence such as nucleoplasmin NLS, KRPAATKKAGQAKKKK (SEQ ID NO: 602). In certain embodiments, a single PKKKRKV (SEQ ID NO: 600) NLS may be linked at the C-terminus of the RNA guide DNA binder. One or more linkers are optionally included in the fusion site.
[0500] In some embodiments, the heterofunctional domain can modify the intracellular half-life of the RNA guide DNA binder. In some embodiments, the half-life of the RNA guide DNA binder can be increased. In some embodiments, the half-life of the RNA guide DNA binder can be decreased. In some embodiments, the heterofunctional domain can increase the stability of the RNA guide DNA binder. In some embodiments, the heterofunctional domain can decrease the stability of the RNA guide DNA binder. In some embodiments, the heterofunctional domain can function as a signal peptide for proteolysis. In some embodiments, proteolysis can be mediated by proteolytic enzymes such as proteasomes, lysosomal proteases, or calpein proteases. In some embodiments, the heterofunctional domain may include a PEST sequence. In some embodiments, the RNA guide DNA binder can be modified by the addition of ubiquitin or polyubiquitin chains. In some embodiments, ubiquitin may be a ubiquitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifiers (SUMOs), ubiquitin-cross-reactive proteins (UCRP, also known as interferon-stimulated gene-15 (ISG15)), ubiquitin-associated modifier-1 (URM1), developmentally downregulated protein-8 (NEDD8, also called Rub1 in S. cerevisiae) expressed by neural progenitor cells, human leukocyte antigen F-related (FAT10), autophagy-8 (ATG8) and -12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-fixed UBL (MUB), ubiquitin folding modifier-1 (UFM1), and ubiquitin-like protein-5 (UBL5).
[0501] In some embodiments, the heterologous functional domain may be a marker domain. Non-limiting examples of marker domains include fluorescent proteins, purification tags, epitope tags, and reporter gene sequences. In some embodiments, the marker domain may be a fluorescent protein. Non-limiting examples of suitable fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, sfGFP, EGFP, Emerald, Azami Green, Monomeric Azami). Green (e.g., CopGFP, AceGFP, ZsGreen1), yellow fluorescent proteins (e.g., YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellow1), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g., ECFP, Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRaspberry, mStrawberry, Jred), and orange fluorescent proteins (mOrange, mKO, Kusabira-Orange, Monomeric) Examples include Kusabira-Orange, mTangerine, tdTomato, or any other suitable fluorescent protein. In other embodiments, the marker domain may be a purification tag and / or an epitope tag.Non-exclusive exemplary tags include glutathione-S-transferase (GST), chitin-binding protein (CBP), maltose-binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis, 8xHis, biotin carboxyl carrier protein (BCCP), poly-His, and calmodulin. Non-exclusive exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), β-galactosidase, β-glucuronidase, luciferase, or fluorescent proteins.
[0502] In additional embodiments, the heterogeneous functional domain may target the RNA guide DNA binder to a specific organelle, cell type, tissue, or organ. In some embodiments, the heterogeneous functional domain may target the RNA guide DNA binder to mitochondria.
[0503] In further embodiments, the heterofunctional domain may be an effector domain. When an RNA guide DNA binder is directed to its target sequence, for example, when a Cas nuclease is directed to a target sequence by gRNA, the effector domain may modify or influence the target sequence. In some embodiments, the effector domain may be selected from a nucleic acid binding domain, a nuclease domain (e.g., a non-Cas nuclease domain), an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repression domain. In some embodiments, the heterofunctional domain is a nuclease, for example, a FokI nuclease. See, for example, U.S. Patent No. 9,023,649. In some embodiments, the heterofunctional domain is a transcriptional activator or a transcriptional repressor. See, for example, Qi et al., “Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression”, Cell 152:1173-83 (2013), Perez-Pinera et al., “RNA-guided gene activation by CRISPR-Cas9-based transcription factors”, Nat. Methods 10:973-6 (2013), Mali et al., “CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering”, Nat. Biotechnol. 31:833-8 (2013), and Gilbert et al., “CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes”, Cell 154:442-51 (2013). Thus, RNA-guided DNA binders are essentially transcription factors that can be directed to bind to a desired target sequence using guide RNA.
[0504] Determination of E.gRNA efficacy In some embodiments, the effectiveness of the gRNA is determined when it is delivered or when it is expressed together with other components that form the RNP. In some embodiments, the gRNA is expressed together with an RNA guide DNA binder, e.g., a Cas protein, e.g., Cas9. In some embodiments, the gRNA is delivered to or expressed in a cell line that already stably expresses an RNA guide DNA nuclease, e.g., a Cas nuclease or nickase, e.g., a Cas9 nuclease or nickase. In some embodiments, the gRNA is delivered to cells as part of the RNP. In some embodiments, the gRNA is delivered to cells together with mRNA encoding an RNA guide DNA nuclease, e.g., a Cas nuclease or nickase, e.g., a Cas9 nuclease or nickase.
[0505] Where described herein, the use of RNA-guided DNA nucleases and guide RNAs disclosed herein may cause site-directed binding that results in double-strand breaks (DSBs), single-strand breaks, and / or nucleic acid modifications in DNA, which may result in errors in the form of insertion / deletion (indel) mutations during repair by cellular mechanisms. Many mutations resulting from indels alter the reading frame or introduce immature stop codons, and thus produce non-functional proteins.
[0506] In some embodiments, the efficacy of a particular gRNA is determined based on an in vitro model. In some embodiments, the in vitro model is HEK293 cells that stably express Cas9 (HEK293_Cas9). In some embodiments, the in vitro model is HUH7 human liver cancer cells. In some embodiments, the in vitro model is HepG2 cells. In some embodiments, the in vitro model is primary human hepatocytes. In some embodiments, the in vitro model is primary cynomolgus monkey hepatocytes. Regarding the use of primary human hepatocytes, commercially available primary human hepatocytes can be used to provide greater consistency between experiments. In some embodiments, the number of off-target sites where deletions or insertions occur in the in vitro model (e.g., in primary human hepatocytes) is determined, for example, by analyzing genomic DNA derived from primary human hepatocytes transfected with Cas9 mRNA and guide RNA in vitro. In some embodiments, such a determination involves analyzing genomic DNA derived from primary human hepatocytes transfected with Cas9 mRNA, guide RNA, and donor oligonucleotides in vitro. Exemplary steps for making such a decision are provided in the following working examples.
[0507] In some embodiments, the effectiveness of a particular gRNA is determined across multiple in vitro cell models for the gRNA selection process. In some embodiments, cell line comparison of data with the selected gRNA is performed. In some embodiments, cross-screening is performed in multiple cell models. In some embodiments, the effectiveness of a particular gRNA is determined in PHH or PCH for the gRNA selection process.
[0508] In some embodiments, the efficacy of a particular gRNA is determined based on an in vivo model. In some embodiments, the in vivo model is a rodent model. In some embodiments, the rodent model is a mouse expressing the KLKB1 gene. In some embodiments, the rodent model is a mouse expressing the human KLKB1 gene. In some embodiments, the in vivo model is a non-human primate, such as a cynomolgus monkey.
[0509] In some embodiments, the effectiveness of the guide RNA is measured by the KLKB1 editing rate. The indel percentage can be calculated from NGS sequencing. In some embodiments, the KLKB1 editing rate is compared to the editing rate required to achieve knockdown of prekallikrein and / or kallikrein proteins, for example, from cell culture or cell lysates in in vitro models, or from plasma containing circulating levels in in vivo models.
[0510] In some embodiments, the effectiveness of the guide RNA is measured by the number and / or frequency of indels at off-target sequences within the genome of the target cell type. In some embodiments, an effective guide RNA is provided that generates indels at off-target sites at a very low frequency (e.g., less than 5%) compared to the frequency of indel formation in cell aggregates and / or at target sites. Accordingly, the disclosure provides a guide RNA that does not exhibit off-target indel formation in the target cell type (e.g., hepatocytes such as PHH) or has an off-target indel formation frequency of less than 5% compared to the frequency of indel formation in cell aggregates and / or at target sites. In some embodiments, the disclosure provides a guide RNA that does not exhibit any off-target indel formation in the target cell type (e.g., hepatocytes). In some embodiments, a guide RNA is provided that generates indels at fewer than 5 off-target sites, for example, when evaluated by one or more methods described herein. In some embodiments, a guide RNA is provided that generates indels at fewer than 4, 3, 2, or 1 or fewer off-target sites, for example, when evaluated by one or more methods described herein. In some embodiments, off-target sites do not occur within protein-coding regions of the target cell (e.g., hepatocyte) genome.
[0511] In some embodiments, linear amplification is used to detect gene editing events such as insertion / deletion ("indel") mutations, translocations, and homology-induced repair (HDR) events in target DNA. For example, linear amplification using unique sequence-tagging primers and isolation of the tagged amplification product may be used (referred herein to as the "UnIT" or "Unique Identifier Tagmentation" method).
[0512] In some embodiments, the effectiveness of the guide RNA is determined by measuring the levels of KLKB1, pKal, total KLKB1 (prekallikrein + pKal), KLKB1 activity, HMWK, HMWK activity, and / or bradykinin in a sample such as a body fluid, e.g., serum, plasma, or blood.
[0513] In some embodiments, the effectiveness of the guide RNA is determined by measuring KLKB1 mRNA levels. A decrease in KLKB1 mRNA levels indicates an effective guide RNA.
[0514] In some embodiments, the effectiveness of the guide RNA is determined by measuring the level of bradykinin in a sample such as serum, plasma, or other bodily fluids like blood.
[0515] In some embodiments, the effectiveness of the guide RNA is determined by measuring the levels of bradykinin and / or its degradation products in the sample. In some embodiments, the effectiveness of the guide RNA is determined by measuring the levels of bradykinin and / or its degradation products in serum or plasma. A decrease in the levels of bradykinin and / or its degradation products in serum or plasma indicates an effective guide RNA.
[0516] One method for detecting bradykinin in circulating blood is provided in Ferreira, et al., Br.J. Pharmac. Chemother. (1967), 29, 367-377. Bradykinin can also be measured using enzyme-linked immunosorbent assay (ELISA) assays with cell culture medium or serum or plasma. (See, for example, Abcam Cat. No. ab136936, Markit-M Bradykinin (Gentaur).) In some embodiments, the level of bradykinin is measured in the same in vitro or in vivo system or model used to measure editing. In some embodiments, the level of bradykinin is measured in cells, e.g., primary human hepatocytes. In some embodiments, the level of bradykinin is measured in a fluid such as serum or plasma. In some embodiments, the circulating level of bradykinin is measured.
[0517] In some embodiments, the effectiveness of the guide RNA is determined by measuring the level of total kallikrein (prekallikrein and plasma kallikrein (pKal)) in the sample. In some embodiments, the effectiveness of the guide RNA is determined by measuring the level of total kallikrein in the sample, such as serum, plasma, or body fluids such as blood. In some embodiments, the effectiveness of the guide RNA is determined by measuring the level of total kallikrein in serum or plasma. A decrease in the level of total kallikrein in serum or plasma indicates an effective guide RNA. In some embodiments, serum and / or plasma total kallikrein decreases to less than 40% of the basal level. In some embodiments, the level of total kallikrein is measured using an enzyme-linked immunosorbent assay (ELISA) assay with cell culture medium or serum or plasma. In some embodiments, the level of total kallikrein is measured in the same in vitro or in vivo system or model used to measure editing. In some embodiments, the level of total kallikrein is measured in cells, e.g., primary human hepatocytes. In some embodiments, the level of total kallikrein is measured in PHH and PCH cells.
[0518] In some embodiments, the effectiveness of the guide RNA is determined by measuring the levels of prekallikrein and / or kallikrein in a sample such as serum, plasma, or body fluid such as blood. In some embodiments, the effectiveness of the guide RNA is determined by measuring the levels of prekallikrein and / or kallikrein in serum or plasma. A decrease in the levels of prekallikrein and / or kallikrein in serum or plasma indicates an effective guide RNA. In some embodiments, the levels of prekallikrein and / or kallikrein are measured using an enzyme-linked immunosorbent assay (ELISA) assay with cell culture medium or serum or plasma. In some embodiments, the levels of prekallikrein and / or kallikrein are measured in an in vitro or in vivo system or model used to measure editing. In some embodiments, the levels of prekallikrein and / or kallikrein are measured in cells, e.g., primary human hepatocytes, in plasma, or in cell culture medium. In some embodiments, the levels of prekallikrein and / or kallikrein are measured from a plasma sample. In some embodiments, the levels of prekallikrein and / or kallikrein are measured from a serum sample. Prekallikrein and / or pKal protein levels are optionally measured by ELISA after an activation step to convert prekallikrein to its active form, pKal.
[0519] In some embodiments, the effectiveness of the guide RNA is determined by measuring the level of prekallikrein in the sample. In some embodiments, the effectiveness of the guide RNA is determined by measuring the level of prekallikrein in the sample, such as serum, plasma, or body fluids such as blood. In some embodiments, the effectiveness of the guide RNA is determined by measuring the level of prekallikrein in serum or plasma. A decrease in the level of prekallikrein in serum or plasma indicates an effective guide RNA. In some embodiments, serum and / or plasma prekallikrein decreases by at least 60%, 70%, 80%, 85%, 90%, 95%, or more. In some embodiments, total kallikrein, prekallikrein, and / or kallikrein in serum and / or plasma decreases by about 60–80%, 60–90%, 60–95%, 60–100%, 85–95%, or 85–100%. In some embodiments, the level of prekallikrein is measured using an enzyme-linked immunosorbent assay (ELISA) assay with cell culture medium or serum or plasma. In some embodiments, the level of prekallikrein is measured in an in vitro or in vivo system or model used to measure editing. In some embodiments, the level of prekallikrein is measured in cells, e.g., primary human hepatocytes, in plasma, or in cell culture medium. In some embodiments, the level of prekallikrein is measured from a plasma sample. In some embodiments, the level of prekallikrein is measured from a serum sample.
[0520] In some embodiments, the effectiveness of the guide RNA is determined by measuring the level of pKal in a sample. In some embodiments, the effectiveness of the guide RNA is determined by measuring the level of pKal in serum or plasma. A decrease in the level of pKal in serum or plasma indicates an effective guide RNA. In some embodiments, the level of pKal decreases by at least 60%, 70%, 80%, 85%, 90%, 95%, or more. In some embodiments, serum and / or plasma pKal decreases by approximately 60–80%, 60–90%, 60–95%, 60–100%, 85–95%, or 85–100%. In some embodiments, the level of pKal is measured using an enzyme-linked immunosorbent assay (ELISA) assay with cell culture medium or serum or plasma. In some embodiments, the level of pKal is measured in an in vitro or in vivo system or model used to measure editing. In some embodiments, the level of pKal is measured in cells, e.g., primary human hepatocytes, in plasma, or in cell culture medium. In some embodiments, the pKal level is measured from a plasma sample. In some embodiments, the pKal level is measured from a serum sample.
[0521] In some embodiments, the effectiveness of the guide RNA is determined by measuring the levels of circulating cleaved HMWK (cHMWK) and total HMWK in citrated serum or citrated plasma. A decrease in the ratio of cleaved HMWK to total HMWK indicates an effective guide RNA. In some embodiments, the ratio of cleaved HMWK to total HMWK can target a ratio of circulating plasma cHMWK to total HMWK of less than approximately 60%. In some embodiments, the ratio of cHMWK to HMWK is less than or greater than approximately 10%, 15%, 20%, 25%, 30%, 35%, 40%, or 50%. In some embodiments, the level of prekallikrein is measured using a Western blotting assay with cell culture medium or serum or plasma. In some embodiments, cHMWK and total HMWK levels are measured in an in vitro or in vivo system or model used to measure editing. In some embodiments, cHMWK and total HMWK levels are measured in cells, e.g., primary human hepatocytes, in plasma, or in cell culture medium. In some embodiments, cHMWK and total HMWK levels are measured from plasma samples. In some embodiments, cHMWK and total HMWK levels are measured from serum samples.
[0522] In some embodiments, the effectiveness of the guide RNA is determined by measuring the pKal activity in the sample. A decrease in pKal activity indicates an effective guide RNA. In some embodiments, the effectiveness of the guide RNA is determined by measuring the pKal activity in serum or plasma.
[0523] In some embodiments, pKal activity is measured as the ability of a citrate serum or citrate plasma sample to convert HMWK to cHMWK (see Banerji et al, N Engl J Med 2017;376:717-28). A decrease in the final ratio of cHMWK to total HMWK indicates a decrease in pKal activity. Levels of cHMWK and full-length HMWK can be measured by Western blotting. In other embodiments, pKal activity is measured as the ability of a citrate serum or citrate plasma sample to enzymatically cleave HMWK-like peptide substrates, in which case a decrease in substrate cleavage indicates a decrease in pKal activity.
[0524] In some embodiments, pKal activity decreases by at least 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, or more. In some embodiments, pKal activity decreases by about 60–80%, 60–90%, 60–95%, 60–100%, 85–95%, or 85–100%. In some embodiments, pKal activity decreases to less than about 40% of the baseline level. In some embodiments, pKal activity decreases to about 40–50% of the baseline level. In some embodiments, pKal activity decreases to 20–40% or 20–50% of the baseline level. In some embodiments, the level of pKal activity is measured in an in vitro or in vivo system or model used to measure editing. In some embodiments, the level of pKal activity is measured in cells, e.g., primary human hepatocytes, in plasma, or in cell culture medium. In some embodiments, the level of pKal activity is measured from a plasma sample. In some embodiments, the level of pKal is measured from a serum sample.
[0525] III. Treatment method The gRNAs and related methods and compositions disclosed herein are useful for treating and preventing HAE and for preventing the symptoms of HAE. In some embodiments, the gRNAs and related methods and compositions are useful for reducing the frequency of HAE attacks. In some embodiments, the gRNAs and related methods and compositions are useful for preventing HAE attacks. In some embodiments, the gRNAs disclosed herein are useful for treating or preventing bradykinin production and accumulation, bradykinin-induced swelling, airway angioedema occlusion, or suffocation. In some embodiments, the gRNAs disclosed herein are useful for treating or preventing angioedema and attacks caused by HAE. In some embodiments, the gRNAs disclosed herein are useful for reducing the frequency of angioedema attacks, such as HAE attacks. In some embodiments, the gRNAs disclosed herein are useful for reducing the severity of angioedema attacks. In some embodiments, the gRNAs disclosed herein are useful for reducing the frequency and / or severity of angioedema attacks, such as HAE attacks. In some embodiments, the gRNAs disclosed herein are useful for achieving remission of angioedema attacks, such as HAE attacks. In some embodiments, the gRNAs disclosed herein are useful for achieving sustained remission, which is maintained for, for example, at least one month, two months, four months, six months, one year, two years, five years, ten years, or longer.
[0526] The gRNAs and related methods and compositions disclosed herein are useful for reducing KLKB1 mRNA production. In one embodiment, the effectiveness of treatment / prevention can be evaluated by measuring KLKB1 mRNA levels, where an increase in KLKB1 mRNA levels indicates effectiveness.
[0527] The gRNAs and related methods and compositions disclosed herein are useful for reducing prekallikrein protein levels in plasma and serum. Thus, in one aspect, the therapeutic / preventive efficacy can be evaluated by measuring prekallikrein protein levels or total kallikrein protein levels, and a decrease in prekallikrein and / or kallikrein proteins indicates efficacy. In some embodiments, the therapeutic / preventive efficacy can be evaluated by measuring prekallikrein protein in a sample such as serum or plasma, and a decrease in prekallikrein indicates efficacy. For example, plasma or serum prekallikrein can be measured by ELISA as described by Ferrone JD, Bhattacharjee G, Revenko AS, et al. IONIS-PKK Rx a Novel Antisense Inhibitor of Prekallikrein and Bradykinin Production. Nucleic Acid Ther. 2019;29(2):82-91. Similarly, kallikrein can be measured by ELISA as described herein, and administration of the gRNAs disclosed herein can reduce kallikrein protein levels in plasma or serum.
[0528] The gRNAs and related methods and compositions disclosed herein are useful for reducing total kallikrein (prekallikrein and pKal) protein levels in plasma and serum. Therefore, in one embodiment, the effectiveness of treatment / prevention can be evaluated by measuring total kallikrein (prekallikrein and pKal) protein levels, where a decrease in total kallikrein protein indicates effectiveness. Total kallikrein, prekallikrein, and / or kallikrein may be measured before or after activation for the release of plasma kallikrein. In some embodiments, the effectiveness of treatment / prevention can be evaluated by measuring prekallikrein and / or pKal protein in a sample such as serum or plasma, where a decrease in prekallikrein protein indicates effectiveness. In some embodiments, the effectiveness of treatment / prevention can be evaluated by measuring pKal protein in a sample such as serum or plasma, where a decrease in pKal protein indicates effectiveness. For example, the levels of prekallikrein and pKal protein can be measured by ELISA, for example, by using a prekallikrein and kallikrein human ELISA kit (Abcam, Eugene, OR). Prekallikrein and / or pKal protein levels are optionally measured by ELISA after an activation step to convert prekallikrein to its active form, pKal.
[0529] The gRNAs and related methods and compositions disclosed herein are useful for reducing the proportion of circulating cleaved HMWK (cHMWK) compared to total HMWK in citrated serum or citrated plasma. Therefore, in one embodiment, the effectiveness of treatment / prevention can be evaluated by measuring total HMWK and cHMWK protein levels, where a reduction in the proportion of cleaved HMWK indicates effectiveness. In some embodiments, the effectiveness of treatment / prevention can be evaluated by measuring total HMWK and cHMWK protein levels in a sample such as serum or plasma, where a reduction in the proportion of cHMWK indicates effectiveness. For example, the proportion of cHMWK compared to total HMWK in a citrated serum or citrated plasma sample can be measured by Western blotting as described in Suffritti C, Zanichelli A, Maggioni L, Bonanni E, Cugno M, Cicardi M. High molecular weight kininogen cleavage correlates with disease status in bradykinin-mediated angioedema resulting from hereditary C1 inhibitor deficiency. Clin Exp Allergy 2014;44:1503-14, and Banerji A, Busse P, Shennak M, et al. Inhibiting plasma kallikrein for hereditary angioedema prophylaxis. N Engl J Med 2017;376:717-28.
[0530] Circulating plasma cHMWK levels of less than approximately 30% of total HMWK were associated with a reduction in HAE attacks in patients treated with lanadermab (see Banerji, et al, 2017). In the same study, healthy controls had plasma cHMWK levels of approximately 8.3% of total HMWK. In another study, Suffritti et al. found mean cHMWK plasma levels of approximately 34.8% in normal controls, approximately 41.4% in HAE patients in remission, and approximately 58.1% in HAE patients experiencing attacks (Suffritti, et al. Clin Exp Allergy 2014;44:1503-14). Therefore, in some embodiments, the gRNAs and related methods and compositions disclosed herein are useful for reducing circulating cHMWK levels so that subjects exhibit a reduction in the number of HAE attacks. In some embodiments, the gRNAs and related methods and compositions disclosed herein are useful for reducing the proportion of target cHMWK in citrate plasma to less than 30%. In some embodiments, the gRNAs and related methods and compositions disclosed herein are useful for reducing the proportion of target cHMWK in citrate plasma to less than 30%, 20%, and / or 10%. In some embodiments, the gRNAs and related methods and compositions disclosed herein are useful for reducing the proportion of target cHMWK in citrate plasma to approximately the proportion of a healthy control.
[0531] The gRNAs and related methods and compositions disclosed herein may be useful in reducing spontaneous pKal activity in serum or plasma. Therefore, in one embodiment, the effectiveness of treatment / prevention can be evaluated by measuring spontaneous pKal activity, where a decrease in spontaneous pKal activity indicates effectiveness. In some embodiments, the effectiveness of treatment / prevention can be evaluated by measuring spontaneous pKal activity in a sample such as serum or plasma, where a decrease in spontaneous pKal activity indicates effectiveness. In certain embodiments, the gRNAs and related methods and compositions disclosed herein are useful in reducing basal levels of circulating pKal and circulating pKal activity.
[0532] The gRNAs and related methods and compositions disclosed herein may be useful in reducing inducible pKal activity in serum or plasma. Therefore, in one embodiment, the effectiveness of treatment / prevention can be evaluated by measuring inducible pKal activity, where a decrease in inducible pKal activity indicates effectiveness. In some embodiments, the effectiveness of treatment / prevention can be evaluated by measuring inducible pKal activity in a sample such as serum or plasma, where a decrease in inducible pKal activity indicates effectiveness. In some examples, pKal activity can be induced by exposing the sample to FXIIa (see Banerji et al, N Engl J Med 2017;376:717-28). In some examples, pKal activity can be induced by incubation of the sample with dextran sulfate (see Ferrone, et al. Nucleic Acid Ther. 2019;29(2):82-91). In some cases, pKal activity can be induced by adding ellagic acid to the sample (Aygoren-Pursun, et al. J Allergy Clin Immunol 2016;138:934-936).
[0533] In some cases, pKal activity is measured as the ability of a citrate serum or citrate plasma sample to convert HMWK to cHMWK (see Banerji et al, N Engl J Med 2017;376:717-28), where a decrease in the final ratio of cHMWK to total HMWK indicates a decrease in pKal activity. The ratio of cHMWK to full-length HMWK can be measured by Western blotting, for example, as described in Suffritti, et al. Clin Exp Allergy 2014;44:1503-14. In other cases, pKal activity is measured as the ability of a citrate serum or citrate plasma sample to enzymatically cleave HMWK-like peptide substrates, where a decrease in substrate cleavage indicates a decrease in pKal activity. In one example, the substrate peptide may be the chromogenic substrate HD-Pro-Phe-Arg-p-nitroanilide peptide (Bachem, Cat.L-2120), and cleavage can be measured as a change at A405 (see Defendi et al, PLoS One 2013;8:e70140). In another example, the substrate peptide may be the fluorescence-generating substrate H-Pro-Phe-Arg-AMC (Sigma, catalog number P9273), and cleavage can be measured as fluorescence changes at excitation and emission wavelengths of 360 nm and 480 nm, respectively (see Banerji, et al., N Engl J Med 2017;376:717-28).
[0534] In one study, a greater than 40% reduction in induced pKal activity was associated with a reduction in HAE attacks (Banerji, et al., N Engl J Med 2017;376:717-28). A reduction of at least 50% in induced pKal activity was associated with a reduction in HAE attacks with BCX7353 treatment (Aygoren-Pursun, et al., N Engl J Med 2018;379:352-362). A 60% reduction in induced pKal activity was associated with a reduction in attacks with lanadermab treatment (Banerji, et al., N Engl J Med 2017;376:717-28). Therefore, in some embodiments, administration of the gRNAs and compositions disclosed herein is useful in reducing kallikrein activity (e.g., total kallikrein, prekallikrein, and / or pKal activity) so that subjects exhibit fewer HAE seizures.
[0535] In some embodiments, administration of the gRNAs and compositions disclosed herein reduces the pKal activity of the target to less than about 40% of the basal level. In some embodiments, administration of the gRNAs and compositions disclosed herein reduces the pKal activity of the target to less than about 40-50% of the basal level. In some embodiments, administration of the gRNAs and compositions disclosed herein reduces the pKal activity of the target to 20-40% or less than 20-50% of the basal level.
[0536] In some embodiments, one or more of the gRNAs, compositions, or pharmaceutical preparations described herein are for use in preparing a medicament for treating or preventing a disease or disorder in a subject. In some embodiments, treatment and / or prevention is achieved by a single dose of the medicament / composition, e.g., a single treatment. In some embodiments, the disease or disorder is HAE.
[0537] In some embodiments, the present invention includes a method for treating or preventing a disease or disorder in a subject, comprising administering one or more of the gRNAs, compositions, or pharmaceutical formulations described herein. In some embodiments, the disease or disorder is HAE. In some embodiments, the gRNAs, compositions, or pharmaceutical formulations described herein are administered, for example, as a single dose. In some embodiments, the single dose achieves sustained treatment and / or prevention. In some embodiments, the method achieves sustained treatment and / or prevention. Sustained treatment and / or prevention, as used herein, includes treatment and / or prevention lasting at least i) 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks, ii) 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 18, 24, 30, or 36 months, or iii) 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 years. In some embodiments, a single dose of the gRNA, composition, or pharmaceutical formulation described herein is sufficient to treat and / or prevent any of the indications described herein over the lifespan of the subject.
[0538] In some embodiments, the present invention includes a method or use for modifying target DNA (e.g., creating double-strand breaks), which involves administering or delivering one or more of the gRNAs, compositions, or pharmaceutical formulations described herein. In some embodiments, the target DNA is the KLKB1 gene. In some embodiments, the target DNA is located within an exon of the KLKB1 gene. In some embodiments, the target DNA is located within exons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 of the KLKB1 gene.
[0539] In some embodiments, the present invention includes a method or use for modulating a target gene, comprising administering or delivering one or more of the gRNAs, compositions, or pharmaceutical formulations described herein. In some embodiments, the modification is editing of the KLKB1 target gene. In some embodiments, the modification is alteration of the expression of the protein encoded by the KLKB1 target gene.
[0540] In some embodiments, the method or use results in gene editing. In some embodiments, the method or use results in a double-strand break within the target KLKB1 gene. In some embodiments, the method or use results in the formation of an indel mutation during non-homologous end joining of a DSB. In some embodiments, the method or use results in a nucleotide insertion or deletion in the target KLKB1 gene. In some embodiments, a nucleotide insertion or deletion in the target KLKB1 gene results in a frameshift mutation or immature stop codon resulting in a non-functional protein. In some embodiments, a nucleotide insertion or deletion in the target KLKB1 gene results in knockdown or removal of target gene expression.
[0541] In some embodiments, the method or use results in KLKB1 gene regulation. In some embodiments, KLKB1 gene regulation is a reduction in gene expression. In some embodiments, the method or use results in cell aggregation or a decrease in the expression of the protein encoded by the target gene in vivo.
[0542] In some embodiments, a method is provided for inducing double-strand breaks (DSBs) in the KLKB1 gene, comprising administering a composition comprising a guide RNA containing one or more guide sequences from SEQ ID NOs: 1 to 149. In some embodiments, a gRNA containing one or more guide sequences from SEQ ID NOs: 1 to 149 is administered to induce DSBs in the KLKB1 gene. The guide RNA may be administered together with an RNA guide DNA nuclease, e.g., a Cas nuclease (e.g., Cas9) or mRNA, or a vector encoding an RNA guide DNA nuclease, e.g., a Cas nuclease (e.g., Cas9).
[0543] In some embodiments, a method is provided for modifying the KLKB1 gene, comprising administering a composition comprising a guide RNA containing one or more of the guide sequences of SEQ ID NOs: 1 to 149. In some embodiments, a gRNA containing one or more of the guide sequences of SEQ ID NOs: 1 to 149 is administered to modify the KLKB1 gene. The guide RNA may be administered together with an RNA guide DNA nuclease, such as a Cas nuclease (e.g., Cas9) or mRNA, or a vector encoding an RNA guide DNA nuclease, such as a Cas nuclease (e.g., Cas9).
[0544] In some embodiments, a method is provided for treating or preventing hereditary angioedema (HAE), comprising administering a composition comprising a guide RNA comprising one or more guide sequences of SEQ ID NOs: 1 to 149. In some embodiments, a gRNA comprising one or more guide sequences of SEQ ID NOs: 1 to 149 is administered to treat or prevent HAE. The guide RNA may be administered together with an RNA guide DNA nuclease, e.g., a Cas nuclease (e.g., Cas9) or mRNA, or a vector encoding an RNA guide DNA nuclease, e.g., a Cas nuclease (e.g., Cas9).
[0545] In some embodiments, methods are provided for reducing or eliminating bradykinin production and accumulation, comprising administering a guide RNA containing one or more guide sequences of SEQ ID NOs: 1 to 149. The guide RNA may be administered with an RNA guide DNA nuclease, e.g., a Cas nuclease (e.g., Cas9) or mRNA, or with a vector encoding an RNA guide DNA nuclease, e.g., a Cas nuclease (e.g., Cas9).
[0546] In some embodiments, a method is provided for treating or preventing bradykinin-induced swelling, comprising administering a guide RNA comprising one or more guide sequences of Sequence ID No. 1 to 149. The guide RNA may be administered together with an RNA guide DNA nuclease, e.g., a Cas nuclease (e.g., Cas9) or mRNA, or a vector encoding an RNA guide DNA nuclease, e.g., a Cas nuclease (e.g., Cas9).
[0547] In some embodiments, a method is provided for treating or preventing bradykinin-induced swelling, comprising administering a guide RNA comprising one or more guide sequences of Sequence ID No. 1 to 149. The guide RNA may be administered together with an RNA guide DNA nuclease, e.g., a Cas nuclease (e.g., Cas9) or mRNA, or a vector encoding an RNA guide DNA nuclease, e.g., a Cas nuclease (e.g., Cas9).
[0548] In some embodiments, a method is provided for treating or preventing airway obstruction and / or asphyxiation, comprising administering a guide RNA comprising one or more guide sequences of SEQ ID NOs: 1 to 149. The guide RNA may be administered together with an RNA guide DNA nuclease, e.g., a Cas nuclease (e.g., Cas9) or mRNA, or a vector encoding an RNA guide DNA nuclease, e.g., a Cas nuclease (e.g., Cas9).
[0549] In some embodiments, gRNAs containing one or more guide sequences from SEQ ID NOs: 1 to 149 are administered to reduce bradykinin levels in plasma, serum, or blood. The gRNAs may be administered together with RNA guide DNA nucleases, such as Cas nucleases (e.g., Cas9) or mRNA, or with a vector encoding an RNA guide DNA nuclease, such as Cas nucleases (e.g., Cas9).
[0550] In some embodiments, a gRNA containing one or more guide sequences from SEQ ID NOs: 1 to 149 is administered to reduce bradykinin in serum or plasma. The gRNA may be administered with an RNA guide DNA nuclease, such as a Cas nuclease (e.g., Cas9) or mRNA, or with a vector encoding an RNA guide DNA nuclease, such as a Cas nuclease (e.g., Cas9).
[0551] In some embodiments, a gRNA containing the guide sequence from Table 1 together with an RNA guide DNA nuclease, such as Cas nuclease, induces a double-segment break (DSB), and the non-homologous end join (NHEJ) during repair results in a mutation within the KLKB1 gene. In some embodiments, the NHEJ causes a nucleotide deletion or insertion, inducing a frameshift or nonsense mutation in the KLKB1 gene.
[0552] In some embodiments, administration of the guide RNA of the present invention (e.g., in the compositions provided herein) reduces the levels of total kallikrein, prekallikrein, and / or kallikrein (e.g., serum or plasma levels) in a subject, and thus prevents bradykinin overproduction and accumulation. In some embodiments, administration of the guide RNA of the present invention (e.g., in the compositions provided herein) reduces the levels of kallikrein activity (e.g., serum or plasma levels) in a subject, and thus prevents bradykinin overproduction and accumulation.
[0553] In some embodiments, the methods provided in the present invention induce fewer episodes, including fluid leakage into tissue through vascular cells. In some embodiments, the methods provided in the present invention reduce the frequency of episodes that increase swelling in organ tissue. In some embodiments, administration of the guide RNA of the present invention (e.g., in the compositions provided herein) reduces the frequency or severity of angioedema episodes.
[0554] In some embodiments, the subject is a mammal. In some embodiments, the subject is a primate, such as a human.
[0555] In some embodiments, the use of guide RNA (e.g., in the compositions provided herein) containing one or more guide sequences from Table 1 or Table 2 is provided for the preparation of pharmaceuticals for treating human subjects having HAE.
[0556] In some embodiments, the guide RNA, composition, and formulation are administered intravenously. In some embodiments, the guide RNA, composition, and formulation are administered by infusion. In some embodiments, the guide RNA, composition, and formulation are administered via hepatic circulation.
[0557] In some embodiments, a single dose of the guide RNA composition provided herein is sufficient to knock down protein expression. In other embodiments, more than one dose of the guide RNA composition provided herein may be beneficial in maximizing the therapeutic effect.
[0558] In some embodiments, the treatment slows or stops the progression of HAE disease.
[0559] In some embodiments, the treatment slows or stops the progression of angioedema. In some embodiments, the treatment improves, stabilizes, or slows the progression of HAE symptoms.
[0560] Delivery of A.gRNA composition Lipid nanoparticles (LNPs) are a well-known means for the delivery of nucleotides and protein cargoes and may be used for the delivery of guide RNA, compositions, or pharmaceutical formulations disclosed herein. In some embodiments, LNPs deliver nucleic acids, proteins, or nucleic acids together with proteins.
[0561] In some embodiments, the present invention includes a method of targeting and delivering any one of the gRNAs disclosed herein, the gRNA associating with an LNP. In some embodiments, the gRNA / LNP also associates with Cas9 or a Cas9-encoding mRNA.
[0562] In some embodiments, the present invention comprises a composition comprising one of the disclosed gRNAs and LNPs. In some embodiments, the composition further comprises Cas9 or a Cas9-encoding mRNA.
[0563] In some embodiments, the LNP comprises a cationic lipid. In some embodiments, the LNP comprises (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-dienoate, or another ionizable liquid. See, for example, Lipids in WO / 2017 / 173054 and the references listed therein. In some embodiments, LNPs include a molar ratio (N:P) of cationic lipid amine to RNA phosphate of approximately 4.5, 5.0, 5.5, 6.0, or 6.5. In some embodiments, the terms cationic and ionizable are interchangeable in the context of LNP lipids; for example, an ionizable lipid is cationic depending on the pH.
[0564] In some embodiments, the LNPs that associate with gRNAs disclosed herein are intended for use in the preparation of pharmaceuticals for the treatment of diseases or disorders.
[0565] Electroporation is a well-known means for cargo delivery, and any electroporation methodology may be used for the delivery of any one of the gRNAs disclosed herein. In some embodiments, electroporation may be used to deliver any one of the gRNAs disclosed herein and Cas9 or the mRNA encoding Cas9.
[0566] In some embodiments, the present invention includes a method for delivering any one of the gRNAs disclosed herein to a cell ex vivo, wherein the gRNA may or may not associate with an LNP. In some embodiments, the gRNA / LNP or gRNA may also associate with Cas9 or a Cas9-encoding mRNA.
[0567] In some embodiments, the guide RNA compositions described herein are administered alone or encoded in one or more vectors, formulated into lipid nanoparticles, or via lipid nanoparticles. See, for example, WO / 2017 / 173054 and WO2019 / 067992, whose contents are incorporated herein by reference in their entirety.
[0568] In certain embodiments, the present invention comprises a DNA or RNA vector encoding one of the guide RNAs comprising one or more of the guide sequences described herein. In some embodiments, in addition to the guide RNA sequence, the vector further comprises a nucleic acid that does not encode the guide RNA. Non-guide RNA nucleic acids include, but are not limited to, promoters, enhancers, regulatory sequences, and nucleic acids encoding RNA guide DNA nucleases (which may be nucleases such as Cas9). In some embodiments, the vector comprises one or more nucleotide sequences encoding crRNA, trRNA, or crRNA and trRNA. In some embodiments, the vector comprises one or more nucleotide sequences encoding sgRNA and mRNA encoding an RNA guide DNA nuclease, where the RNA guide DNA nuclease may be a Cas nuclease, e.g., Cas9 or Cpf1. In some embodiments, the vector comprises one or more nucleotide sequences encoding crRNA, trRNA and mRNA encoding an RNA guide DNA nuclease, where the RNA guide DNA nuclease may be a Cas protein, e.g., Cas9. In one embodiment, Cas9 is derived from Streptococcus pyogenes (i.e., Spy Cas9). In some embodiments, the nucleotide sequence encoding crRNA, trRNA, or crRNA and trRNA (which may also be sgRNA) contains or consists of guide sequences adjacent to all or part of naturally occurring CRISPR / Cas system-derived repetitive sequences. The nucleic acid containing or consisting of crRNA, trRNA, or crRNA and trRNA may further contain a vector sequence, where the vector sequence contains or consists of nucleic acid sequences not found in nature with crRNA, trRNA, or crRNA and trRNA.
[0569] This description and exemplary embodiments should not be construed as limitations. Unless otherwise indicated, all figures used herein and in the appended claims to represent quantities, percentages, or proportions, and other numerical values, should be understood in all cases to be modified by the term “approximately,” which is still less modified. Therefore, unless otherwise indicated, the numerical parameters shown in the following specification and appended claims are approximations that may vary depending on the desired properties to be obtained. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the claims, each numerical parameter should be interpreted by applying ordinary rounding techniques, taking into account the number of significant figures reported.
[0570] It should be noted that, as used herein and in the appended claims, the use of the singular forms “a,” “an,” and “the,” and any singular form of any word, includes multiple referents unless explicitly and clearly limited to one. The term “include” and its grammatical variations as used herein are intended to be non-limiting so as not to exclude other similar items that may be substituted for or added to the listed items. [Examples]
[0571] The following embodiments are provided to illustrate specific disclosed embodiments and should not be construed as limiting the scope of this disclosure in any way.
[0572] Example 1: Materials and Method 1.1 In vitro transcription of nuclease mRNA ("IVT") Capped polyadenylated Streptococcus pyogenes ("Spy") Cas9 mRNA containing N1-methylpsoid-U was generated by in vitro transcription using a linear plasmid DNA template and T7 RNA polymerase. Plasmid DNA containing the T7 promoter and sequences for transcription to produce mRNA including the mRNA described herein (see SEQ ID NOs. 501-516 in Table 5 below for Cas9 ORFs) was linearized by incubation at 37°C, and digestion with XbaI was completed under the following conditions: 200 ng / μL plasmid, 2 U / μL XbaI (NEB), and 1x reaction buffer. XbaI was inactivated by heating the reaction mixture at 65°C for 20 minutes. The linear plasmid was purified from enzymes and buffer salts using a silica maxi-spin column (Epoch Life Sciences), and linearization was confirmed by analysis on an agarose gel. The IVT reaction to generate Cas9 mRNA was incubated at 37°C for 4 hours under the following conditions. 50 ng / μL linearized plasmid; 2 mM each of GTP, ATP, CTP, and N1-methyl pseudo-UTP (Trilink); 10 mM ARCA (Trilink); 5 U / μL T7 RNA polymerase (NEB); 1 U / μL mouse RNase inhibitor (NEB); 0.004 U / μL inorganic E. coli pyrophosphatase (NEB); and 1x reaction buffer. After 4 hours of incubation, TURBO DNase (ThermoFisher) was added to a final concentration of 0.01 U / μL, and the reaction mixture was incubated for a further 30 minutes to remove the DNA template. Cas9 mRNA was purified from enzymes and nucleotides using the MegaClear Transcription Clean-up Kit according to the manufacturer's protocol (ThermoFisher). Alternatively, Cas9 mRNA was purified by LiCl precipitation, followed in some cases by tangential flow filtration for further purification.The transcript concentration was determined by measuring the light absorbance at 260 nm (Nanodrop), and the transcript was analyzed by capillary electrophoresis using a Bioanlayzer (Agilent).
[0573] [Table 13] [Table 14] [Table 15] [Table 16] [Table 17] [Table 18] [Table 19] [Table 20] [Table 21] [Table 22] [Table 23] [Table 24] [Table 25] [Table 26] [Table 27] [Table 28] [Table 29] [Table 30] [Table 31] [Table 32] [Table 33] [Table 34] [Table 35] [Table 36] [Table 37]
[0574] 1.2 Human KLKB1 guide design and cynomolgus monkey homology guide design Guide RNAs were designed for human KLKB1 (ENSG00000164344), targeting the protein-coding regions within exons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15. Guide RNAs were also designed for cynomolgus monkey KLKB1 (ENSMFAT00000002355), targeting the protein-coding regions within exons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15. The guide RNAs and their corresponding target genomic coordinates are provided above (Table 1).
[0575] 1.2. Cas9 (mRNA / protein) and guide RNA delivery in vitro 1.2.1. Cell preparation and in vitro delivery Primary human hepatocytes (PHH) (Gibco, lots Hu8296, Hu8300, and Hu8284, Hu8296, HU8290, and HU8317) and primary cynomolgus monkey hepatocytes (PCH) (Gibco, lots Cy367, Cy400, and 10281011) were thawed, resuspended in hepatocyte thawing medium containing a supplement (Gibco, catalog number CM7500), and then centrifuged. The supernatant was discarded, and the pelleted cells were resuspended in hepatocyte plating medium containing dexamethasone (William's E Medium (Invitrogen, catalog number A1217601) + cocktail supplement, FBS content, and plating supplement (Gibco, catalog number CM3000)). The cells were counted and plated onto 96-well plates coated with Bio-coat collagen I (ThermoFisher, catalog number 877272) at densities of 30,000-35,000 cells / well for PHH and 40,000-45,000 cells / well for PCH. The plated cells were incubated in a tissue culture incubator at 37°C and a 5% CO2 atmosphere for 4-6 hours to allow adhesion. After incubation, cell monolayer formation was confirmed, and the cells were plated in hepatocyte maintenance medium (William's E Medium with maintenance supplement (Gibco, catalog number CM4000)) or Cellartis Power Primary HEP. It was washed once with Medium (Takada, catalog number Y20020).
[0576] Guide RNAs targeting KLKB1 were delivered to cells, for example, using a liposome system containing the Cas9 protein, or using an LNP formulation containing Cas9 mRNA and guide RNA, as further described below.
[0577] 1.2.2. RNP Transfection Ribonucleoprotein (RNP) complexes were shuttled to the cell membrane using RNP transfection along with a liposome system (Lipofectamine RNAiMAX (ThermoFisher, catalog number 13778150) and CRISPR reagents (guide RNA, Cas9 protein).
[0578] For the dual-guide (dgRNA) test, individual crRNAs and trRNAs were pre-annealed by mixing them with equal volumes of reagent, incubating at 95°C for 2 minutes, and cooling to room temperature. The gRNA, consisting of the pre-annealed crRNAs and trRNAs, was added to Spy Cas9 protein in reaction buffer (OptiMem) to form an RNP complex, and the formed RNP complex was incubated at room temperature for 10 minutes. The RNP complex was diluted with OptiMem to prepare a 1 μm stock solution of the RNP complex. A transfection mixture containing Lipofectamine RNAiMAX and OptiMem was prepared and incubated for at least 5 minutes. The transfection mixture was added to the RNP complex and incubated at room temperature for 10 minutes, after which the transfection agent (transfection mixture and RNP complex) was added to the cells. Cells were transfected with an RNP complex containing Spy Cas9 protein (10 nM), individual guide / tracer RNAs (10 nM), and Lipofectamine RNAiMAX (1.0 μL / well) and OptiMem.
[0579] 1.2.3. RNP Electroporation RNP electroporation was used to shuttle ribonucleoprotein (RNP) complexes to the cell membrane using a cell electroporation system (Lonza 4D Nucleofector® kit 816B0346) and CRISPR reagents, gRNA, and Cas9 protein.
[0580] For the dgRNA-based tests, individual crRNAs and trRNAs were pre-annealed by mixing them with equal volumes of reagents, incubating at 95°C for 2 minutes, and then cooling to room temperature.
[0581] For the sgRNA-based test, a 50 μM stock solution of sgRNA was prepared by incubating an equal volume of 100 μM sgRNA in water at 95°C for 2 minutes, followed by cooling on ice for 5 minutes. The sgRNA was added to Spy Cas9 protein in reaction buffer (20 mM Hepes, 100 mM KCl, 1 mM MgCl2, 10% glycerol, 1 mM DTT, pH 7.5) to form an RNP complex, which was incubated at room temperature for 10 minutes. Cells were electroporated (Amaxa® 96-well Shuttle® catalog number AAM-1001S) with an RNP complex containing Spy Cas9 protein (2 μM), gRNA (4 μM), and Lonza P3 buffer (catalog no. V4SP-3960). After electroporation, hepatocyte plating medium (Will's E, catalog number A12176-01) was added to the cell plate, and the medium containing the cells was transferred to a collagen-coated plate (Corning 354407). After 4-6 hours, the medium was replaced with maintenance medium (William's E (Gibco, catalog number A12176-01, lot 2039733)) and maintenance supplement (Gibco, catalog number A12176-01, lot 2039733) for overnight incubation at 37°C.
[0582] 1.2.4. Preparation of LNP preparations containing sgRNA and Cas9 mRNA Generally, the components of lipid nanoparticles were dissolved in 100% ethanol in various molar ratios. RNA cargo (e.g., Cas9 mRNA and sgRNA) was dissolved in 25 mM citrate and 100 mM NaCl (pH 5.0) to obtain an RNA cargo concentration of approximately 0.45 mg / mL. The LNP used in Examples 2-10 is an ionizable liquid ((9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate), also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(di The formulation contained ethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-dienoate, cholesterol, DSPC, and PEG2k-DMG in a molar ratio of 50:38:9:3, respectively. LNPs were formulated with a (N:P) molar ratio of approximately 6 lipid amines to RNA phosphate and a weight ratio of 1:2 gRNA to mRNA. The LNPs used in Examples 2-10 contained Cas9 mRNA and sgRNA.
[0583] LNPs were prepared using cross-flow technology by impinging jet mixing of lipids in ethanol with 2 volumes of RNA solution and 1 volume of water. The lipids in ethanol were mixed with 2 volumes of RNA solution via a mixing cross. A fourth stream of water was mixed with the outlet stream of the cross through a tee in the line (see Figure 2 of WO2016 / 010840). The LNPs were kept at room temperature for 1 hour and then further diluted with water (approximately 1:1 v / v). The diluted LNPs were concentrated using tangential flow filtration in a flat sheet cartridge (Sartorius, 100kD MWCO), and then the buffer was replaced with 50 mM Tris, 45 mM NaCl, 5% (w / v) sucrose, pH 7.5 (TSS) using a PD-10 desalting column (GE). The resulting mixture was then filtered using a 0.2 μm sterile filter. The final LNPs were characterized to determine encapsulation efficiency, polydispersity index, and average particle size. The final LNPs were stored at 4°C or -80°C until further use.
[0584] 1.2.5. sgRNA and Cas9 mRNA lipofection Lipofection of Cas9 mRNA and gRNA was performed using a pre-mixed lipid formulation. The lipofection reagent contained 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate, a liquid ionizable substance, cholesterol, DSPC, and PEG2k-DMG in a molar ratio of 50:38:9:3. The mixture was then reconstituted with 100% ethanol, and then an RNA cargo (e.g., Cas9) was added at a lipid amine to RNA phosphate (N:P) molar ratio of approximately 6.0. The mRNA and gRNA were mixed. Guide RNA was chemically synthesized by a commercial vendor or using standard in vitro synthesis techniques with modified nucleotides. Cas9 ORFs in Table 5 were generated by IVT as described in WO2019 / 067910 (see, e.g., paragraph
[0354] ), by using a 2-hour IVT reaction time and purifying the mRNA by LiCl precipitation followed by tangential flow filtration. Lipofection was performed using 3% cynomolgus monkey serum in a 1:1 gRNA-to-mRNA weight ratio.
[0585] 1.2.6. LNP Transfection Modified sgRNA targeting human KLKB1 was formulated in LNP as described in Example 1. Primary human hepatocytes were plated as described in Example 1. Cells were incubated at 37°C and 5% CO2 for 48 hours before treatment with LNP. LNP was incubated at 37°C for 10 minutes in a medium containing 3% fetal bovine serum (FBS). After incubation, the medium was aspirated from the cells and a mixture of medium containing 3% FBS and LNP was added to the hepatocytes. A portion of the cells were collected 72–96 hours after transfection and processed for NGS sequencing as described in Example 1.
[0586] 1.3. Isolation of Genomic DNA Transfected PHH and PCH were collected 48 or 72 hours after transfection. gDNA was extracted from each well of a 96-well plate using 50 μL / well of BuccalAmp DNA Extraction solution (Epicentre, catalog no. QE09050) or Zymo's Quick RNA / DNA Extraction Kit (catalog no. R2130) according to the manufacturer's protocol. All DNA samples were subjected to PCR and subsequent NGS analysis as described herein.
[0587] 1.4. Analysis of Next-Generation Sequencing ("NGS") and On-Target Cutting Efficiency To quantitatively determine the editing efficiency at target sites in the genome, next-generation sequencing was used to identify the presence of insertions and deletions introduced by gene editing. PCR primers were designed around target sites within the gene of interest (e.g., KLKB1), and the target genomic region was amplified. Primer sequencing was performed according to in-situ standards.
[0588] Additional PCR was performed according to the manufacturer's protocol (Illumina) to impart the necessary chemical properties for sequencing. The amplicons were sequenced using an Illumina MiSeq instrument. After excluding reads with low quality scores, the reads were aligned with a human (e.g., hg38) reference genome. The resulting read-containing files were mapped to a reference genome (BAM file), reads overlapping with the target region of interest were selected, and the number of wild-type reads was calculated relative to the number of reads containing insertions or deletions ("indels").
[0589] The edit ratio (e.g., "edit efficiency" or "edit rate") is defined as the total number of sequence reads containing insertions or deletions ("indels") relative to the total number of sequence reads containing the wild type.
[0590] Using biochemical methods (see, e.g., Cameron et al., Nature Methods. 6, 600-606; 2017), we discovered potential off-target genomic sites cleaved by Cas9 targeting KLKB1. Purified genomic DNA (gDNA) from cells was digested with Cas9 and sgRNA-assembled ribonucleoprotein (RNP) to induce DNA cleavage at on-target sites and potential off-target sites homologous to sgRNA spacer sequences. After gDNA digestion, the ends of the free gDNA fragments were ligated with an adapter to facilitate enrichment of the edited fragments and construction of an NGS library. The NGS library was sequenced, and the genomic coordinates of the free DNA ends were determined by analyzing the reads through bioinformatics analysis. The locations in the human genome with read accumulations were then annotated as potential off-target sites.
[0591] Known off-target detection assays, such as the biochemical assays used above, typically "cast a wide net" of potential off-target sites, which can be recovered by design and validated in other contexts, e.g., in the primary cells of interest. For example, this biochemical assay typically overrepresents the number of potential off-target sites because it utilizes purified high molecular weight genomic DNA that does not contain the cellular environment and is dependent on the dose of Cas9 RNP used. Therefore, potential off-target sites identified by these assays were validated using targeted sequencing of the identified potential off-target sites.
[0592] One approach to targeted sequencing involves introducing Cas9 and the sgRNA of interest (e.g., an sgRNA with a potential off-target site for evaluation) into PHH or PCH cells. The cells are then lysed, and amplicons for NGS analysis are generated using primers adjacent to the potential off-target site. While the identification of indels at specific levels can be used to validate potential off-target sites, the absence of indels found at potential off-target sites may result in false positives in the utilized off-target assay.
[0593] Guides exhibiting targeted indel activity were tested for potential off-target genomic cleavage sites in this assay. Repair structures were manually examined at loci with statistically relevant indel rates at off-target cleavage sites to validate the repair structures.
[0594] 1.5 Transcript analysis by quantitative PCR Quantitative PCR was performed to evaluate KLKB1 transcript levels. Qiagen RNeasy Mini Kit (Qiagen, catalog number 74106) was used to isolate mRNA. The RNeasy Mini Kit procedure was completed according to the manufacturer's protocol.
[0595] RNA was quantified using Nanodrop 8000 (ThermoFisher Scientific, catalog number ND-8000-GL). The RNA quantification procedure was completed according to the manufacturer's protocol. RNA samples were stored at -20°C before use.
[0596] PCR reaction products were prepared using the Taqman RNA-to-Ct 1-Step Kit (Thermo Fisher Scientific, catalog number 4392938). The reaction setup was completed according to the manufacturer's protocol. Alternatively, samples for qPCR were prepared using the Cells-to-CT 1-Step TaqMan Kit (Thermo Fisher Scientific, catalog number A25603). The following quantitative PCR probes targeting human or cynomolgus monkey KLKB1 were used in the PCR reaction: Thermo Fisher Scientific, catalog number 4351372, transcript UniGene ID Hs01111828_m1; Thermo Fisher Scientific, catalog number 4331182, transcript UniGene ID Hs00168478_m1; internal control PPIB (Thermo Fisher Scientific, catalog number 4351372, transcript UniGene ID Hs00168719_m1; Thermo Fisher Scientific, catalog number 4331182, transcript UniGene ID Mf02802985_m1); internal control GAPDH (Thermo Fisher Scientific, catalog number 4351372, transcript UniGene ID Hs02786624_g1); and internal control 18S (Thermo Fisher Scientific, catalog number 4319413E). Real-time PCR reactions and transcript quantification were performed using the StepOnePlus Real-Time PCR System (Thermo Fisher Scientific, catalog number 4376600) according to the manufacturer's protocol.
[0597] Double-delta Ct analysis of KLKB1 mRNA was provided using Ct values determined from the StepOnePlus Real-Time PCR System. Double-delta Ct values were calculated by comparing the Ct values for the internal control within each sample with those for KLKB1. The fold change in expression was determined based on the double-delta Ct values for each sequence.
[0598] 1.6. Protein analysis of tissue culture media by ELISA PHH or PCH was transfected as described above. The medium was changed on the cells every two days, starting on day 3 after transfection and plating (96-well plate). 7–10 days after transfection, the medium was removed from the cells and then replaced with 100 μL of William's E medium or Cellartis Power Primary HEP Medium (Takada, catalog number Y20020). After 24–48 hours, the medium was collected and stored at -20°C. Total secreted KLKB1 protein levels were determined using a prekallikrein ELISA kit (Abcam, catalog number ab202405) to detect prekallikrein and kallikrein (also called total kallikrein). Kit reagents and standards were prepared according to the manufacturer's protocol. Before running the ELISA, the frozen medium was thawed at room temperature, centrifuged at 1000 rpm for 1 minute to pelletize the fragments, and then placed on ice. For the ELISA, 10–40 μL of culture medium was diluted with Sample Diluent NS assay diluent until the total volume reached 50 μL. The ELISA procedure was completed according to the manufacturer's protocol. The plates were read using a SpectraMax M5 plate reader. Total kallikrein levels were calculated using SoftMax Pro software version 6.4.2 with 4-parameter logistic curve fitting of a standard curve. The decrease in total secretory prekallikrein protein in cells treated with the KLKB1 reagent was determined by comparing wells treated with the control reagent or untreated samples.
[0599] 1.6.1 Protein analysis of serum by ELISA Serum prekallikrein levels were measured in humanized mice using the following procedure. Six to seven days after administration, the animals were euthanized by puncture and bloodletting under isoflorane anesthesia. Blood was collected in a serum separator and allowed to coagulate at room temperature for 2 hours, then the serum was separated by spinning down at 9000g for 10 minutes. Samples were stored at -20°C until analysis.
[0600] Prekallikrein protein levels were determined using a human prekallikrein ELISA kit (Abcam, catalog number ab202405) that detects prekallikrein and kallikrein (also known as total kallikrein). Briefly, serum was added to an ELISA plate after serial dilution with the kit sample diluent to a final dilution of 1:500-1 or 1:1000-1. The assay was performed according to the manufacturer's protocol. The plates were read using a Clariostar plate reader (BMG Labtech). Serum kallikrein levels were calculated using Mars software with 4-parameter logistic curve fitting from a standard curve. The decrease in total secreted prekallikrein protein in cells treated with the KLKB1 reagent was determined by comparing wells treated with the control reagent or untreated samples.
[0601] 1.6.2. Protein analysis by Western blotting PHH was treated with LNPs formulated with selected guide RNAs from Table 1, as further described below. The LNPs were incubated at 37°C for 10 minutes in Cellartis Power Primary HEP Medium (Takada, catalog number Y20020) containing 3% FBS or cynomolgus monkey serum. After incubation, the LNPs were added to human hepatocytes. The culture medium was changed on the cells every two days, starting on day 3 post-transfection. Ten to fourteen days after transfection, the cells plated in 96-well plates were lysed with 50 μL / well of RIPA buffer (Boston Bio Products, catalog no. BP-115) and a freshly added protease inhibitor mixture consisting of a complete protease inhibitor cocktail (Sigma, catalog no. 11697498001), 1 mM DTT, and 250 U / ml benzonase (EMD Millipore, catalog no. 71206-3) per 30,000–45,000 cells. The cells were kept on ice for 30 minutes, during which time NaCl (1 M final concentration) was added. The cell lysates were thoroughly mixed and kept on ice for 30 minutes. Whole cell extracts ("WCE") were transferred to PCR plates and centrifuged to form pellet debris. The protein content of the lysates was evaluated using the Bradford assay (Bio-Rad, catalog no. 500-0001). The Bradford assay procedure was completed according to the manufacturer's protocol. The extract was stored at -20°C before use.
[0602] Western blotting was performed to assess KLKB1 protein levels. Lysates were mixed with Laemmli buffer (Boston BioProducts, catalog no. BP-111R) and denatured at 95°C for 10 minutes. Western blotting was performed using a NuPage system on a 4–12% Bis-Tris gel (Thermo Fisher Scientific, catalog no. NP0323BOX) and then transferred in a wet state to a 0.45 μm nitrocellulose membrane (Bio-Rad, catalog no. 1620115), according to the manufacturer's protocol. After transfer, the membrane was thoroughly rinsed with water and stained with Ponceau S solution (Boston Bio Products, catalog no. ST-180) to confirm complete and uniform transfer. The blots were blocked at room temperature on a lab locker for 30 minutes using 5% powdered milk in TBS. The blots were rinsed in TBST and probed with rabbit α-kallikrein monoclonal antibody (Abcam, catalog no. ab124938) at a ratio of 1:1000 in TBST. For blots containing in vitro cell lysates, GAPDH was used as a loading control (Novus, catalog no. NB600502) at a ratio of 1:2500 in TBST and incubated simultaneously with the KLKB1 primary antibody. After incubation, the blots were rinsed three times in TBST for 5 minutes each. The blots were visualized and analyzed using a densitometer with a Licor Odyssey system.
[0603] 1.6.3. Electrochemiluminescence-based detection of plasma kallikrein levels Plasma kallikrein levels in samples were measured by immunoassay using a MesoScale Discovery (MSD) electrochemiluminescence detection platform. 96-well MSD standard plates (catalog number L15XA) were coated overnight at 4°C with 25 or 40 μL of mouse monoclonal capture antibody for kallikrein (LS-Bio, LS-C38308) at a concentration of 1 μg / mL in PBS. The following day, the wells were washed and then blocked with 150 μL of 3% Blocker-A (MSD, catalog number R93AA), and incubated at room temperature for 1 hour on a shaker set to 700 rpm. After washing, samples for determining kallikrein concentration were added to the wells along with internally prepared human kallikrein standards of known concentrations, and incubated at room temperature for 2 hours on a shaker set to 700 rpm. Both samples and standards were diluted with 1% Blocker-A (optionally containing 0.05% Tween20).
[0604] After washing, 25 μL of detection antibody solution was added (in 1% blocker-A containing 0.05% Tween20, LSBio no. C185168 at 1 ug / mL and MSD no. R32AG at 500 ug / mL) and incubated at room temperature for 1 hour. The plate was washed and 150 μL of MSD gold read buffer (MesoScale Discovery, catalog no. R92TG) was added to each well. The plate was read using QuickPlex SQ 120 (MesoScale Discovery). The plate was washed three times with PBS containing 0.05% Tween20 between different steps.
[0605] 1.7. Fluorescence analysis of plasma kallikrein activity Total plasma kallikrein activity levels in samples such as non-human primate (NHP) samples were measured using the Fluorometric SensoLyte Rh110 Plasma Kallikrein Activity Assay Kit (Anaspec catalog number AS-72255). Chloroform pretreatment was performed by mixing an equal volume of cold chloroform with K2EDTA NHP plasma in a 96-well plate to inhibit C1-inhibitor activity. The plate was then centrifuged at 4°C and 16,000 × g for 5 minutes, and 10 μL of treated plasma was carefully collected from the top layer. In a 96-well black microplate, 10 μL of pretreated plasma was mixed with 30 μL of assay buffer, 10 μL of plasma prekallikrein activator, and 50 μL of substrate, all of which were provided in the kit and prepared according to the kit protocol. Fluorescence measurements were immediately started with excitation / emission = 490 nm / 520 nm, and readouts were taken every 5 minutes for 1 hour using a SpectraMax M5 plate reader. The baseline percentage was calculated by comparing the slope of the linear portion of the dynamic fluorescence readout of a given post-treatment plasma sample with the slope of the pre-treatment plasma sample from the same animal.
[0606] 1.7.1 Electrochemiluminescence-based detection of plasma kallikrein levels in non-human primates Plasma kallikrein levels in non-human primates (NHPs) were measured by immunoassay using a MesoScale Discovery (MSD) electrochemiluminescence detection platform. A 96-well MSD standard plate (catalog number L15XA) was coated overnight at 4°C with 40 μL of mouse monoclonal capture antibody for kallikrein (LS-Bio, LS-C38308) at a concentration of 1 μg / mL in PBS. The following day, the wells were washed and then blocked with 150 μL of 3% Blocker-A (MSD, catalog number R93AA), and incubated at room temperature for 1 hour on a shaker set to 700 rpm. After washing, NHP samples for determining kallikrein concentration were added to the wells along with NHP kallikrein standards of known concentrations prepared internally, and incubated at room temperature for 2 hours on a shaker set to 700 rpm. Both the samples and standards were diluted with 1% Blocker-A containing 0.05% Tween20.
[0607] After washing, 25 μL of detection antibody solution was added and incubated at room temperature for 1 hour. The plate was washed and 150 μL of MSD gold read buffer (MesoScale Discovery, catalog no. R92TG) was added to each well. The plate was read using QuickPlex SQ 120 (MesoScale Discovery). The plate was washed three times with PBS containing 0.05% Tween 20 between different steps.
[0608] 1.8 Vascular Permeability Assay The Evans Blue vascular permeability assay is an established model of edema and vascular leakage that can be used as a model in the testing of HAE (see, e.g., Bhattacharjee et al., 2013). This assay is based on the injection of Evans Blue, an albumin-binding dye, into test animals, typically mice. Under physiological conditions, the endothelium is impermeable to albumin, so albumin-bound Evans Blue remains confined within the blood vessels. In pathological conditions that promote increased vascular permeability, extravasation of Evans Blue can be readily observed qualitatively, for example, by the presence of blue in the ears, feet, and noses of mice after intravenous injection, or quantitatively by measuring the dye incorporated into tissues, e.g., the intestines.
[0609] Using huKLKB1 mice, a model for vascular permeability was developed to evaluate the potential of KLKB1 editing to mitigate the effects of excessive bradykinin production (Bhattacharjee et al., 2013). Modified KLKB1 and Cas9 mRNA targeting sgRNA were administered in dose-response order at total RNA doses of 0.03 mg / kg, 0.1 mg / kg, and 0.3 mg / kg. Additional groups were treated with 0.3 mg / kg of untargeted LNP controls and TSS vehicle controls. Thirteen days after administration, vascular permeability was induced using 2.5 mg / kg intraperitoneal injection of the angiotensin-converting enzyme (ACE) inhibitor captopril. Fifteen minutes later, a mixture of Evans blue dye (30 mg / kg) and dextran sulfate (0.3 mg / kg) was administered by intravenous tail injection. Fifteen minutes after this injection, the animals were euthanized, and extravascular leakage of the dye into the colon was assessed by optical density (OD) at 600 nm absorbance via a Clariostar plate reader (BMG LabTech). Liver and serum were collected, and huKLKB1 gene editing and kallikrein protein were quantified, respectively.
[0610] Example 2: Screening and in vitro guide characterization 2.1. Screening of dual guide RNAs (dgRNAs) targeting human KLKB1 Guides targeting human KLKB1 were prepared as dual guide RNAs and evaluated by transfection into primary human hepatocytes (PHH) and primary cynomolgus monkey hepatocytes (PCH) as described in Example 1. The cells were lysed for 48 hours post-treatment for NGS analysis as described in Example 1. The guides shown in Table 6 were tested. [Table 38] JPEG0007883437000056.jpg235156JPEG0007883437000057.jpg148154
[0611] Editing of dgRNA was determined in two separate sets of PHH and PCH populations. Guide sequence screening data are listed in Table 6 above. Table 7A and Figures 1A-1B show the editing rates of KLKB1-targeting guides co-transfected with Spy Cas9 protein in primary human hepatocytes (PHH) (N=2), and Table 7B and Figures 1C-1D show the editing rates for primary cynomolgus monkey hepatocytes (PCH) (N=2).
[0612] The best-performing guide RNA and corresponding edited data from Set 2 are marked with an asterisk (*) in Tables 7A and 7B. When compared, this set was determined to be highly correlated (Spearman R = 0.985). [Table 39] JPEG0007883437000059.jpg234155JPEG0007883437000060.jpg168156 [Table 40] JPEG0007883437000062.jpg42154
[0613] 2.1.1 Cross-screening and editing of sgRNAs in PHH and PCH Selected guide sequences targeting KLKB1 were prepared as sgRNAs and further evaluated in PHH and PCH. PHH and PCH (Gibco, lot Hu8298) were prepared and transfected with RNP as described in Example 1. Cells were lysed for 48 and 72 hours post-treatment for NGS analysis, respectively, as described in Example 1. Table 8A and Figures 2A-2B show the editing rates in PHH, and Table 8B and Figures 2C-2D show the editing rates in PCH.
[0614] [Table 41] JPEG0007883437000064.jpg239147JPEG0007883437000065.jpg233147JPEG0007883437000066.jpg83147 [Table 42] JPEG0007883437000068.jpg185149
[0615] 2.2 Screening, editing, and protein knockdown of sgRNAs in primary human hepatocytes (PHH) Three PHH lots (Hu8296, Hu8300, and Hu8284) were individually plated as described in Example 1 and incubated at 37°C and 5% CO2 for 24 hours prior to lipofection. A mixture of 6.88 μL of 10 μM sgRNA guide and 4.5 μL of 500 ng / μl Cas9 mRNA was prepared in 11.4 μL of water. The lipofection reagent described in Example 1 was thawed to room temperature. The guide / Cas9 mRNA mixture was sequentially added with 4.8 μL of 50 mM sodium citrate / 200 mM NaCl (pH 5), 4.8 μL of lipofection reagent, and 54 μL of molecular-grade water to prepare a total volume of 75 μL per sample. The lipofection samples were pre-incubated at 37°C for 10 minutes with William's E or Cellartis Power Primary HEP Medium (Takada, catalog number Y20020), which contains 3% FBS or cynomolgus monkey serum, before being added to the cells. The cells were transfected with 10 μL of prepared lipofection sample containing 300 ng of Cas9 mRNA and 302 ng of guide sgRNA.
[0616] The cells were lysed 72 hours after transfection for NGS analysis and carried out as described in Example 1.
[0617] For cells used for secreted protein analysis by ELISA or intracellular protein analysis by Western blotting, the culture medium was aspirated 72 hours after transfection and replaced with Cellartis Power Primary HEP Medium (Takada, catalog number Y20020). The medium was aspirated and replaced every two days. For samples used to determine the decrease in secreted proteins, the medium was aspirated from the wells and replaced with fresh medium incubated for 24–48 hours before harvesting. The medium was collected, transferred to a 96-well PCR plate, and stored at -20°C before use in the assay.
[0618] Table 8C and Figures 3A–3B show the edit rates and secreted KLKB1 protein levels based on transfection of three PHH lots. Twenty guides were compared in pairs of PHH lots and were determined to be highly correlated (Spearman R>0.8), as shown in Figures 3C–3E. [Table 43] JPEG0007883437000070.jpg163156
[0619] 2.3. Screening of sgRNA in PHH Primary human hepatocytes (PHH) were transfected with Cas9 mRNA and sgRNA as described in Example 1. The cells were lysed 72 hours after transfection, and NGS analysis was performed as described in Example 1.
[0620] The editing rates were determined for sgRNAs containing the guide sequences shown in Table 1 for two primer sets. The average editing rates for each guide in the two datasets are shown in Table 9A and Figures 4A-4B. [Table 44] JPEG0007883437000072.jpg235156JPEG0007883437000073.jpg123157
[0621] 2.3.1 Screening of sgRNA in PCH Primary cynomolgus monkey hepatocytes (PCH) were transfected with Cas9 mRNA and sgRNA as described in Example 1, by increasing the amount of lipofection sample prepared to assay dose-response effects. Cells were lysed 72 seconds after transfection, and NGS analysis was performed as described in Example 1. Edit rates were determined for sgRNAs containing the guide sequences in Table 1, using two primer sets for amplification and indel detection. The mean edit rates for each guide in the two datasets are shown in Table 9B and Figures 4C–4D.
[0622] The selected guide RNAs and corresponding edited data from sets 1 and 2 are marked with an asterisk (*) in Table 9B. When compared, the datasets were determined to be highly correlated (Spearman R = 0.987). [Table 45] JPEG0007883437000075.jpg234149JPEG0007883437000076.jpg147150
[0623] Example 3: Dose-response assay 3.1 Cross-screening of PCH and PHH sgRNAs in a 4-point dose-response assay Modified sgRNAs targeting human KLKB1 and sgRNA sequences matched with cynomolgus monkeys were tested in dose-response assays in PHH and PCH using 16 guides from the PHH guided screening described in Example 2.2. Lipofection samples containing Cas9 mRNA and sgRNA were prepared as described in Example 2.2. Primary human and cynomolgus monkey hepatocytes were plated as described in Example 1. Both cell lines were incubated at 37°C and 5% CO2 for 48 hours before treatment with lipofection samples. Lipofection samples were incubated in Cellartis Power Primary HEP Medium (Takada, catalog no. Y20020) containing 3% FBS for 10 minutes at 37°C.
[0624] Following incubation, lipofection samples were added to human or cynomolgus monkey hepatocytes in a four-point dose-response assay. PHH was dissolved 120 hours after transfection, PCH was dissolved 168 hours after transfection, and gDNA was subjected to quantitative PCR for NGS analysis as described in Example 1.
[0625] The indel frequencies of sgRNA at concentrations of 0.4 nM, 3.3 nM, 30 nM, and 90 nM in PHH cells are shown in Table 10 and Figures 5A-5B. The secreted KLKB1 protein levels of sgRNA determined by ELISA are shown in Table 10 and Figures 5C-5D. [Table 46] JPEG0007883437000078.jpg228152
[0626] The indel frequencies of sgRNA at concentrations of 0.4 nM, 10 nM, 30 nM, and 90 nM in PCH cells are shown in Table 11 and Figures 5E to 5F. The secreted KLKB1 protein levels of sgRNA, as determined by ELISA, are shown in Table 11 and Figures 5G to 5H. [Table 47] JPEG0007883437000080.jpg222147
[0627] Indel frequency and secreted KLKB1 protein levels were shown to be inversely correlated in both PHH and PCH, as shown in Figures 5I–5J.
[0628] 3.2 Cross-screening of sgRNAs for PHH and PCH in a 7-point dose-response assay In dose-response assays, lipid nanoparticle (LNP) formulations of sgRNA targeting the human KLKB1 sgRNA sequence were tested in PHH and PCH.
[0629] The LNPs were formulated as described in Example 1. The final LNPs were characterized according to the analytical methods described above to determine the encapsulation efficiency, polydispersity index, and average particle size.
[0630] Primary human and cynomolgus monkey hepatocytes were plated as described in Example 1. Both cell lines were incubated at 37°C and 5% CO2 for 24 hours before treatment with LNP. LNP was incubated in a medium containing 3% FBS at 37°C for 10 minutes. After incubation, LNP was added to human or cynomolgus monkey hepatocytes in a 7-point 3x dose-response curve. Cells were lysed 72 hours after transfection, and gDNA was subjected to quantitative PCR for NGS analysis as described in Example 1.
[0631] Table 12 shows the indel frequencies of sgRNA at concentrations of 0.04 nM, 0.13 nM, 0.40 nM, 1.19 nM, 3.58 nM, 10.75 nM, and 32.25 nM. The dose-response curves for PHH are shown in Figures 6A-6B, and for PCH in Figures 6C-6D. [Table 48] JPEG0007883437000082.jpg234153JPEG0007883437000083.jpg235156JPEG0007883437000084.jpg149155
[0632] 3.3 Cross-screening of PCH and PHH read sgRNAs in a 7-point dose-response assay In dose-response assays, modified sgRNA lipid nanoparticle (LNP) formulations were tested in PHH and PCH.
[0633] This test used the LNP described in Example 3.2.
[0634] After incubation, LNPs were added to human or cynomolgus monkey hepatocytes in a 7-point 3x dose-response curve. Cells were lysed 72 hours after transfection, and gDNA was subjected to quantitative PCR for NGS analysis as described in Example 1. For KLKB1 protein analysis, cells were lysed 8 days after transfection, and whole cell extracts were subjected to Western blotting analysis as described in Example 1.
[0635] Table 13 shows the sgRNA indel frequencies for PHH and PCH at concentrations of 0.04 nM, 0.13 nM, 0.40 nM, 1.19 nM, 3.58 nM, 10.75 nM, and 32.25 nM, and the dose-response curve data are shown in Figures 7A and 7B. The secreted KLKB1 protein levels of sgRNA determined by ELISA are shown in Table 13 and Figure 7C for PHH and in Figure 7D for PCH. [Table 49]
[0636] For KLKB1 protein analysis, PHH was transfected with the human KLKB1 guide G012267, dissolved 8 days post-transfection, and whole cell extracts were subjected to Western blotting analysis as described in Example 1. Human KLKB1 protein levels across 7 dose-response curves were compared to untreated controls, normalized to GAPDH, and are shown in Figure 7E.
[0637] Example 4 - Off-target analysis of the KLKB1 guide Potential off-target genomic sites cleaved by Cas9 targeting KLKB1 were determined using the biochemical methods described in Example 1. Guides selected based on the results of the above experiments were tested for potential off-target genomic cleavage sites. Sixteen KLKB1 targeting guides were evaluated for off-target genomic cleavage of genomic DNA from HEK293 cells at a concentration of 16 nM (ATCC, catalog number CRL-1573). KLKB1 guide G012267 and a control guide with a known off-target profile were included in the experiment (G000644 targeting EMX1, with 281 off-target sites detected; G00045 targeting VEGFA, with 6602 off-target sites detected). Frock et al., 2015, Tsai et al., 2015) evaluated off-target genomic cleavage of pooled human PBMC-derived genomic DNA at a concentration of 64 nM. Table 14A shows the number of potential off-target sites detected in biochemical assays using genomic DNA derived from HEK293 cells. Table 14B shows the number of potential off-target sites detected in biochemical assays using genomic DNA derived from PBMCs. The rate of off-target sites detected by the assays performed herein is shown in comparison to the number of off-target sites described in the literature for the EMX1 guide and the VEGFA guide. [Table 50]
[0638] Example 5. Target sequencing to verify potential off-target sites The KLKB1 guides were selected based on the above experiments for further evaluation. Target indel activity for potential off-targets associated with these guides was evaluated using the targeted off-target approach described in Example 1. Off-target sites tested in this experiment were identified via the biochemical assay experiment described in Example 4 or the in silico prediction described in Example 1.
[0639] In this experiment, three sgRNAs targeting human KLKB1 were evaluated. PHH cells were cultured and transfected with LNPs containing Cas9 mRNA and the sgRNA of interest (e.g., sgRNAs with potential off-target sites for evaluation) as described in Example 1. Genomic DNA was isolated from PHH cells and subjected to NGS and targeted off-target analysis as described in Example 1.
[0640] Table 15A shows the number of potential off-target sites evaluated by assay, and the number of those sites, off-target sites successfully characterized by assay, and sites subsequently verified by manual examination. [Table 51]
[0641] Example 6. In vivo editing of the humanized KLKB1 gene locus in a Hu KLKB1 mouse model. In this study, we used humanized mice expressing the human KLKB1 protein (Hu KLKB1 mouse model). The Hu KLKB1 mouse model contains a humanized KLKB1 locus in which the region from the start codon to the stop codon of mouse KLKB1 is replaced with the corresponding human genome sequence. The animals were weighed and administered in a volume specific to their individual body weight. There were a total of five groups (N=4, consisting of 2 male and 2 female mice).
[0642] LNPs containing modified sgRNAs (G12260, G12267, G12293, G12303, and G12321) and Cas9 mRNA were administered via the lateral tail vein at a dose of 0.3 mg / kg based on total RNA cargo in a volume of 10 ml per kilogram of body weight. The final LNPs were characterized to determine encapsulation efficiency, polydispersity index, and average particle size according to the analytical method described in Example 1. Mice were euthanized 11 days after LNP administration, and liver tissue was collected for DNA extraction. The tissue was lysed using a Zymo Research Bashing Bead Lysis Rack, and DNA was extracted using a Zymo Research DNA Extraction Kit according to the manufacturer's protocol. The extracted DNA was subjected to PCR submitted for sequencing.
[0643] Blood was collected in a serum separatory tube, allowed to coagulate at room temperature for 2 hours, and then centrifuged. Equal portions of serum were subjected to ELISA, and the results were diluted in a 96-well plate.
[0644] Edits observed in treated mice are shown in Figure 8A and Table 16A. [Table 52]
[0645] Serum human KLKB1 protein levels were measured before and after administration using an ELISA assay as described in Example 1. The results are shown in Table 16B and Figure 8B. [Table 53]
[0646] Serum human KLKB1 protein levels from samples were measured using an electrochemiluminescence-based array (MSD) as described in Example 1 and compared to baseline levels. The results are shown in Table 17 and Figure 8C. [Table 54]
[0647] The KLKB1 mRNA levels for each sequence were measured by quantitative PCR as described in Example 1, Table 18, and Figure 8D. Protein reduction was confirmed by Western blot analysis as described in Example 1. [Table 55]
[0648] Example 7. In vivo editing activity of human KLKB1 guide in Hu KLKB1 mouse model In this study, humanized KLKB1 mice described in Example 6 were used and prepared using the same protocol. A total of five groups were present (N=5, with 2 male and 3 female mice, or vice versa). LNPs containing modified sgRNA and mRNA encoding Cas9 protein were administered via the lateral tail vein at a dose of 0.3 mg / kg and characterized as described in Example 6.
[0649] The mice were euthanized 13 days after LNP administration. Liver tissue and blood were processed as described in Example 6 for sequencing and ELISA analysis.
[0650] Table 19 and Figures 9A-9D show the correlation between KLKB1 editing, serum prekallikrein protein (detected using an ELISA that detects both prekallikrein and kallikrein) (ug / ml), the level of prekallikrein protein as a percentage of the KLKB1 protein level in the control TSS of treated mice, and the liver editing rate to the prekallikrein protein rate, respectively. The G012323 and G012253 guides were tested, but editing could not be detected due to malfunctions in the NGS method. [Table 56] JPEG0007883437000093.jpg131147
[0651] Example 8. In vivo dose response of KLKB1 gene editing in a Hu KLKB1 mouse model In this study, humanized mice described in Example 6 were used and prepared using the same protocol. A total of five groups were present (N=5, with 2 male and 3 female mice, or vice versa). LNPs containing mRNA encoding the G12267 and Cas9 proteins were administered at doses of 0.3, 0.1, 0.03, and 0.01 mg per kg of body weight, and the mice were characterized as described in Example 6.
[0652] On day 13 after LNP administration, the mice were euthanized. Liver tissue was processed for DNA sequencing as described in Example 6. Blood was processed as described in Example 6, and secreted human prekallikrein was measured via ELISA to detect prekallikrein and kallikrein (also called total kallikrein) as described in Example 1.
[0653] For RNA analysis, liver tissue was lysed using a Zymo Research Bashing Bead Lysis Rack, and RNA was extracted using a Qiagen RNeasy Mini Kit (Qiagen, catalog number 74106) according to the manufacturer's protocol. RNA was quantified using a Nanodrop 8000 (ThermoFisher Scientific, catalog number ND-8000-GL). RNA samples were stored at -20°C before use.
[0654] PCR reactions were prepared using the SuperScript III Platinum One-Step qRT-PCR Kit (Invitrogen, catalog number 11732-088). This reaction utilized a quantitative PCR probe targeting Hu KLKB1 and an internal control Ms PPIB. The quantitative PCR assay was performed according to the manufacturer's specifications, scaled to the appropriate reaction volume, and using the Hu KLKB1 and Ms PPIB probes specified above. Real-time PCR reactions and transcript quantification were performed using the StepOnePlus Real-Time PCR System (Thermo Fisher Scientific, catalog number 4376600), following the manufacturer's protocol.
[0655] Hu KLKB1 mRNA was quantified using a standard curve starting with 20 ng / uL of pooled mRNA from the vehicle control group and ending with five further 3-fold dilutions at 0.06 ng / uL. Ct values were determined using the StepOnePlus Real-Time PCR System. Decrease in total secreted human prekallikrein protein in cells treated with the KLKB1 reagent was determined by ELISA as described in Example 1.
[0656] Table 20 and Figure 10 show the editing rate, serum prekallikrein levels as a percentage of TSS vehicle-controlled treated mice, and mRNA transcript levels as a percentage of TSS vehicle-controlled treated mice. [Table 57]
[0657] Example 9. Vascular leakage test Tests were conducted to evaluate KLKB1 gene editing, total kallikrein protein expression, and vascular leakage in humanized mice. Humanized mice as described in Example 1 were used in these tests. Six groups were formed (N=5, with 2 males and 3 females per group). The animals were weighed and administered in a volume specific to their individual body weight.
[0658] LNPs containing modified KLKB1 and Cas9 mRNA targeting sgRNA (G12267) were administered via the lateral tail vein at a volume of 10 ml per kilogram of body weight, based on total RNA cargo, at doses of 0.03 mg / kg, 0.1 mg / kg, or 0.3 mg / kg, or in a vehicle control (TSS).
[0659] One day prior to the vascular leakage test, blood was collected and processed as described in Example 6, and secreted human prekallikrein was measured via ELISA to detect prekallikrein and kallikrein (also called total kallikrein) as described in Example 1.
[0660] A vascular leakage assay was performed as described in Example 1. Liver tissue was collected at autopsy, DNA was extracted as described in Example 6, and KLKB1 editing was measured. Colon tissue was collected and processed as described in Example 1 for quantification of the dye in the vascular leakage model.
[0661] The results for editing rate, serum hu KLKB1 protein levels, and vascular leakage are shown in Table 21 and Figures 11A-11B. [Table 58]
[0662] Separate studies were conducted using similar methods to assess endurance over 9 months, including editing rate, serum prekallikrein levels, and vascular leakage. Mice were administered modified KLKB1 targeting sgRNA (G12267) and Cas9 mRNA or non-targeted sgRNA via the lateral tail vein at a volume of 10 ml per kilogram of body weight, based on total RNA cargo, at 0.1 mg / kg or 0.3 mg / kg. Dose-response endurance was observed in that increased editing, decreased protein levels, and decreased vascular leakage levels were maintained throughout the length of the study.
[0663] Example 10. In vivo study of KLKB1 gene editing in non-human primates (NHPs). In this example, we conducted studies to evaluate KLKB1 gene editing, total kalkrein protein expression, and total kalkrein activity levels in cynomolgus monkeys after administration of CRISPR / Cas9 lipid nanoparticles (LNPs) along with mRNA for the Cas9 protein and various guides for the KLKB1 gene. A cohort of n=3 cynomolgus monkeys was treated. The study was conducted using LNP formulations according to Example 1. Each LNP formulation contained polyadenylated Cas9 mRNA (including SEQ ID NO: 516) and gRNA (G013901, a cynomolgus monkey-specific KLKB1 guide RNA) with an mRNA:gRNA weight ratio of 2:1. Animals were administered doses of 1.5, 3, or 6 mg per kg based on total RNA cargo. Indel formation (editing rate) was measured by NGS. Total kalkrein activity and serum kalkrein protein levels were measured as described in Example 1.
[0664] This study demonstrated that knockout of KLKB1, a part of the biological pathway that triggers bradykinin release, by G013901 resulted in a robust response beyond target activity, achieving a therapeutically meaningful effect on HAE seizure rates, with a maximum reduction of 90% or more in kallikrein activity in the NHP group (60% reduction in kallikrein activity, Banerji, 2017). This study showed a dose-dependent correlation between increased editing rate, decreased plasma kallikrein levels, and decreased kallikrein activity. This response persisted for one year in the NHP group. Circulating kallikrein protein and activity levels are provided in Tables 22 and 23, and Figures 12A–12B. [Table 59] [Table 60]
[0665] Testing of selected NHP serum samples found no effect on coagulation pathway biomarkers associated with KLKB1 knockout in NHP at weeks 10 or 15 (based on measurements of prothrombin, APTT, and fibrinogen (all at week 10) and factor XII (at week 15)) when comparing the TSS buffer control group with the treatment group.
[0666] The NHP test was repeated to evaluate KLKB1 total kallikrein protein expression and total kallikrein activity levels in cynomolgus monkeys using guide G012267, which contains a guide sequence fully complementary to human KLKB1. The guide sequence of G012267 has a one-nucleotide difference compared to G013901, which has a guide sequence fully complementary to cynomolgus monkey KLKB1. The experimental protocol and LNP formulation in this test were essentially the same as those described in the above experiment, except that the animals (n=3) were administered only 3 mg per kg based on total RNA cargo. Total kallikrein activity and serum kallikrein protein levels were measured using the method described in Example 1.
[0667] This study demonstrated that knockdown of KLKB1 using G012267 resulted in up to a 65% reduction in kallikrein activity in the NHP group. This response persisted for up to 9 months in the NHP group. Circulating kallikrein protein and activity levels are provided in Tables 24 and 25, and Figures 13A–13B. [Table 61] [Table 62] The inventions described in the original claims of this application are listed below. [Invention 1] It is a guide RNA, a. A guide sequence containing at least 95%, 90%, or 85% identicalness to the sequence selected from sequence numbers 15, 8, and 41. b. A guide sequence containing at least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from sequence numbers 15, 8, and 41, or c. Includes a guide sequence selected from sequence numbers 15, 8, and 41. The aforementioned guide RNA. [Invention 2] The guide RNA according to Invention 1, further comprising the nucleotide sequence of Sequence ID No. 202. [Invention 3] The guide RNA according to Invention 1, wherein the guide RNA further comprises a nucleotide sequence selected from SEQ ID NOs: 170, 171, 172, and 173, and the sequence of SEQ ID NOs: 170, 171, 172, or 173 is the 3' of the guide sequence. [Invention 4] The guide RNA according to any one of Inventions 1 to 3, wherein the guide RNA further comprises a 3' tail. [Invention 5] The guide RNA according to any one of Inventions 1 to 4, wherein the guide RNA includes at least one modification. [Invention 6] The guide RNA according to Invention 5, wherein the modification includes a 5' terminal modification. [Invention 7] The guide RNA according to invention 5 or 6, wherein the modification includes a 3' terminal modification. [Invention 8] The guide RNA according to any one of Inventions 1 to 7, wherein the guide RNA includes modifications in the hairpin region. [Invention 9] The guide RNA according to any one of Inventions 1 to 8, wherein the modification includes a 2'-O-methyl (2'-O-Me) modified nucleotide. [Invention 10] The guide RNA according to any one of Inventions 1 to 9, wherein the modification includes internucleotide phosphorothioate (PS) bonding. [Invention 11] The guide RNA according to any one of Inventions 1 to 10, wherein the modification includes a 2'-fluor(2'F) modified nucleotide. [Invention 12] A guide RNA according to any one of Invention 1 or 3-11, further comprising the nucleotide sequence of Sequence ID No. 171. [Invention 13] A guide RNA according to Invention 12, modified according to the nucleotide sequence pattern of Sequence ID No. 405. [Invention 14] A guide RNA according to any one of Invention 1 or 3-11, further comprising the nucleotide sequence of Sequence ID No. 173. [Invention 15] Guide RNA according to Invention 14, modified according to the pattern of Sequence IDs 248-255 or 450. [Invention 16] The guide RNA according to any one of inventions 12 to 15, wherein the guide sequence is sequence number 15. [Invention 17] The guide RNA according to any one of inventions 12 to 15, wherein the guide sequence is sequence number 8. [Invention 18] The guide RNA according to any one of inventions 12 to 15, wherein the guide sequence is sequence number 41. [Invention 19] The guide RNA according to Invention 1 or any one of Inventions 4 to 11, wherein the guide RNA is modified according to the pattern of Sequence ID No. 300, and N is collectively the guide sequence described in Invention 1. [Invention 20] The guide RNA according to Invention 19, wherein each N in SEQ ID NO: 300 is any natural or non-natural nucleotide. [Invention 21] The guide RNA according to Invention 19, wherein the guide sequence is Sequence ID No. 15, and the guide RNA is modified according to mG*mG*mA*UUGCGUAUGGGACACAAGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmGmCmU*mU*mU*mU, where "mA", "mC", "mU", or "mG" represents a nucleotide modified with 2'-O-Me, * represents a phosphorothioate bond, and N is a natural nucleotide. [Invention 22] The guide RNA according to Invention 19, wherein the guide sequence is Sequence ID No. 8, and the guide RNA is modified according to mU*mA*mC*CCGGGAGUUGACUUUGGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU, where "mA", "mC", "mU", or "mG" represent a nucleotide modified with 2'-O-Me, * represents a phosphorothioate bond, and N is a natural nucleotide. [Invention 23] The guide RNA according to Invention 19, wherein the guide sequence is Sequence ID No. 41, and the guide RNA is modified according to mU*mA*mU*UAUCAAAUCACAUUACCGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU, where "mA", "mC", "mU", or "mG" represents a nucleotide modified with 2'-O-Me, * represents a phosphorothioate bond, and N is a natural nucleotide. [Invention 24] A composition comprising the guide RNA described in any one of Inventions 1 to 23. [Invention 25] The composition according to Invention 24, further comprising an RNA guide DNA binder or a nucleic acid encoding an RNA guide DNA binder. [Invention 26] The composition according to Invention 25, wherein the nucleic acid encoding the RNA guide DNA binder comprises mRNA containing an open reading frame (ORF) encoding the RNA guide DNA binder. [Discussion 27] The composition according to invention 25 or 26, wherein the RNA guide DNA binding agent is Cas9. [Invention 28] The composition according to Invention 27, wherein the Cas9 is S. pyogenes Cas9. [Invention 29] The composition according to any one of inventions 26 to 28, wherein the ORF is a modified ORF. [Invention 30] A composition according to any one of inventions 24 to 29, further comprising a pharmaceutical excipient. [Invention 31] The composition according to any one of inventions 24 to 30, wherein the guide RNA is associated with lipid nanoparticles (LNPs). [Invention 32] The composition according to Invention 31, wherein the LNP contains a cationic lipid. [Invention 33] The composition according to Invention 32, wherein the cationic lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate. [Invention 34] The composition according to any one of Inventions 31 to 33, wherein the LNP comprises (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-dienoate (also called 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate), DSPC, cholesterol, and PEG2k-DMG. [Invention 35] A pharmaceutical composition comprising a guide RNA described in any one of Inventions 1 to 23 or a composition described in any one of Inventions 24 to 34. [Invention 36] A pharmaceutical composition comprising a guide RNA according to any one of Inventions 1 to 23, or a composition according to any one of Inventions 24 to 34, for inducing double-strand or single-strand breaks in the KLKB1 gene within a cell, or for reducing the expression of KLKB1 within a cell, or for use thereof. [Invention 37] A pharmaceutical composition according to invention 36, or use thereof, for reducing the expression of the KLKB1 gene in cells or subjects. [Invention 38] A pharmaceutical composition comprising a guide RNA according to any one of Inventions 1 to 23, or a composition according to any one of Inventions 24 to 34, or use thereof, for the treatment of a subject having hereditary angioedema (HAE). [Invention 39] A pharmaceutical composition according to Invention 38, or use thereof, comprising reducing the frequency and / or severity of HAE attacks. [Invention 40] A pharmaceutical composition comprising a guide RNA according to any one of Inventions 1 to 23, or a composition according to any one of Inventions 24 to 34, or use thereof, for treating or preventing HAE-related angioedema, bradykinin production and accumulation, bradykinin-induced swelling, airway angioedema-induced obstruction, or suffocation. [Invention 41] A pharmaceutical composition comprising a guide RNA according to any one of Inventions 1 to 23, or a composition according to any one of Inventions 24 to 34, or use thereof, for reducing total plasma kallikrein activity or reducing prekallikrein and / or kallikrein levels in a subject. [Invention 42] The pharmaceutical composition according to Invention 41, or its use, wherein the total plasma kallikrein activity is reduced by more than 60%. [Invention 43] A method for inducing double-strand or single-strand breaks in the KLKB1 gene within a cell, or for reducing the expression of KLKB1 within a cell, comprising contacting a cell with a guide RNA described in any one of Inventions 1 to 23, or a composition described in any one of Inventions 24 to 34. [Invention 44] The method according to Invention 43, wherein the cells are within the scope of the subject. [Invention 45] A method for treating a subject having hereditary angioedema (HAE), comprising administering a guide RNA according to any ...
Claims
1. A guide RNA that targets the KLKB1 gene and includes a guide sequence comprising at least 17 consecutive nucleotides of the sequence GGAUUGCGUAUGGGACACAA (SEQ ID NO: 15).
2. The guide RNA according to claim 1, wherein the guide sequence includes the sequence GGAUUGCGUAUGGGACACAA (Sequence ID 15).
3. The guide RNA according to claim 1 or 2, wherein the guide RNA is a single guide RNA (sgRNA) comprising (1) the guide sequence and (2) the sequence of sequence number 171, 170, 172, or 173 in order from 5' to 3'.
4. The guide RNA according to any one of claims 1 to 3, wherein the guide RNA further comprises a 3' tail.
5. The guide RNA according to any one of claims 1 to 4, wherein at least one nucleotide of the guide RNA comprises a modification of a sugar group or a phosphate group.
6. The guide RNA according to claim 5, wherein the modification comprises at least one of (1) a 5'-terminal modification, (2) a 3'-terminal modification, and (3) a modification in the hairpin region.
7. The guide RNA according to claim 5 or 6, wherein the modification comprises at least one of (1) a 2'-O-methyl (2'-O-Me) modified nucleotide, (2) an internucleotide phosphorothioate (PS) bond, and (3) a 2'-fluor (2'F) modified nucleotide.
8. The guide RNA is arranged in the order of 5' to 3' as (1) the guide sequence and (2) GUUUUAGCUAGAAAUAGCAAGUUAAAAAAAGCUAGUCCGUUAUCAACUUGAAAAAAGUGGCACCGAGUUCGGUGCU The guide RNA according to any one of claims 1 to 7, which is a single guide RNA (sgRNA) containing the sequence UUU (sequence number 171).
9. The guide RNA according to claim 8, wherein the sequence of sequence number 171 is modified according to the pattern GUUUUAGAmGmCmUmAmGmAmAmUmAmGmCAAGUUAAAAAUAAGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmGmUmGmCmU*mU*mU*mU (sequence number 405) (wherein "mA", "mC", "mU", and "mG" each represent a 2'-O-methyl (2'-O-Me) modified nucleotide, and "*" represents a phosphorothioate (PS) bond).
10. The guide RNA according to any one of claims 1 to 7, wherein the guide RNA is a single guide RNA (sgRNA) comprising, in order from 5' to 3', (1) the guide sequence and (2) the sequence GUUUUAGCUAGAAAUAGCAAGUUAAAAUAAGCUAGUCCGUUAUCAACUUGGCACCGAGUUCGGGUGC (Sequence ID 173).
11. The guide RNA according to claim 10, wherein the sequence of SEQ ID NO: 173 is modified according to the pattern GUUUUAGACCUAGAAGAAGUUAAAAAGCAAGUCCUAGUCCGUUAUCAACUUGGCACCGAGUUCGG*mU*mG*mC (SEQ ID NO: 248), or GUUUUAGAMGmCmUmAmGmAmAmAmAmAmGmCAAGUAAAAAGCUAGUCCGUUAUCAACUUGGCACCGAGUUCGG*mU*mG*mC (SEQ ID NO: 450) (wherein "mA", "mC", "mU", and "mG" each represent a 2'-O-methyl (2'-O-Me) modified nucleotide, and "*" represents a phosphorothioate (PS) bond).
12. The guide RNA according to claim 6, wherein the 5' terminal modification comprises a phosphorothioate (PS) bond between the first four nucleotides of the guide sequence and / or a 2'-O-methyl (2'-O-Me) modified nucleotide at the first three nucleotides of the guide sequence.
13. The guide RNA according to claim 6, wherein the guide RNA comprises the sequence of sequence number 171, and the 3' terminal modification is *mU*mU*mU*mU (where "mU" represents 2'-O-methyl(2'-O-Me)uridine, and "*" represents a phosphorothioate (PS) bond).
14. The guide RNA according to claim 6, wherein the modification in the hairpin region includes a 2'-O-methyl modified nucleotide.
15. The guide RNA according to any one of claims 1 to 14, wherein the guide sequence consists of the sequence of sequence number 15.
16. The guide RNA according to claim 1, wherein the guide RNA consists of the sequence of sequence number 15 and the sequence of sequence number 171 in the order from 5' to 3'.
17. The guide RNA according to claim 1, wherein the guide RNA comprises the sequence of SEQ ID NO: 15 (GGAUUGCGUAUGGGACACAA) in the order from 5' to 3' and the sequence of SEQ ID NO: 405 (GUUUUAGAmGmCmUmAmGmAmAmUmAmGmCAAGUUAAAAUAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmCmAmCmCmGmAmGmUmGmCmU*mU*mU*mU (wherein "mA", "mC", "mU", and "mG" each represent a 2'-O-methyl (2'-O-Me) modified nucleotide, and "*" represents a phosphorothioate (PS) bond)).
18. A guide RNA comprising the nucleotide sequence of SEQ ID NO: 603 (mG*mG*mA*UUGCGUAUGGGACACAAGUUUUAGAmGmCmUmAmAmAmAmUmAmGmCAAGUUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmCmAmCmCmGmAmGmUmGmCmU*mU*mU*mU (wherein "mA", "mC", "mU", and "mG" each represent a 2'-O-methyl (2'-O-Me) modified nucleotide, and "*" represents a phosphorothioate (PS) bond)).
19. A pharmaceutical composition comprising the guide RNA described in any one of claims 1 to 18.
20. The pharmaceutical composition according to claim 19, further comprising an RNA guide DNA binder.
21. The pharmaceutical composition according to claim 19, further comprising a nucleic acid encoding an RNA guide DNA binder.
22. The pharmaceutical composition according to claim 21, wherein the nucleic acid comprises mRNA containing a sequence encoding an RNA guide DNA binder.
23. The pharmaceutical composition according to any one of claims 20 to 22, wherein the RNA guide DNA binding agent is a Cas9 nuclease.
24. The pharmaceutical composition according to claim 23, wherein the Cas9 nuclease is Streptococcus pyogenes (S. pyogenes) Cas9 (SpyCas9).
25. The pharmaceutical composition according to claim 22, wherein the mRNA comprises one of the sequences of sequence numbers 501 to 516 (wherein each thymidine in sequences 501 and 506 to 515 is replaced with uridine or modified uridine).
26. The pharmaceutical composition according to claim 25, wherein the mRNA comprises the sequence of SEQ ID NO: 511 (where each thymidine in the sequence of SEQ ID NO: 511 is replaced with uridine or modified uridine).
27. The pharmaceutical composition according to claim 25, wherein the mRNA comprises the sequence of sequence number 516.
28. The pharmaceutical composition according to any one of claims 25 to 27, wherein the mRNA encoding the RNA guide DNA binder comprises modified uridine at one, more, or all of the uridine positions in the mRNA.
29. The pharmaceutical composition according to claim 28, wherein the modified uridine is N1-methylpseudridine.
30. (a) A guide RNA comprising the sequence mG*mG*mA*UUGCGUAUGGGAACACAAGUUUUAGAmGmCmUmAmGmAmAmAmAmGmCAAGUUUAAAAUGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmGmGmCmU*mU*mU*mU (SEQ ID NO: 603) (wherein "mA", "mC", "mU", and "mG" each represent a 2'-O-methyl (2'-O-Me) modified nucleotide, and "*" represents a phosphorothioate (PS) bond), (b) Messenger RNA (mRNA) comprising a sequence encoding Streptococcus pyogenes (S. pyogenes) Cas9 (SpyCas9), wherein the mRNA comprises the RNA sequence of Sequence ID No. 516, and the RNA sequence comprises N1-methylpsoidouridine at all uridine positions in Sequence ID No. 516, and A pharmaceutical composition containing [the specified substance].
31. The pharmaceutical composition according to any one of claims 19 to 30, wherein the pharmaceutical composition further comprises lipid nanoparticles (LNPs).
32. The pharmaceutical composition according to claim 31, wherein the LNP comprises an ionizable lipid.
33. The pharmaceutical composition according to claim 32, wherein the ionizable lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-dienoate.
34. The pharmaceutical composition according to any one of claims 31 to 33, wherein the LNP further comprises a helper lipid and a stealth lipid.
35. The pharmaceutical composition according to claim 34, wherein the LNP further comprises a neutral lipid.
36. The pharmaceutical composition according to claim 35, wherein the neutral lipid is DSPC.
37. The pharmaceutical composition according to any one of claims 34 to 36, wherein the helper lipid is cholesterol.
38. The pharmaceutical composition according to any one of claims 34 to 37, wherein the stealth lipid is PEG2k-DMG.
39. A pharmaceutical composition according to any one of claims 19 to 38, for use in inducing double-strand or single-strand breaks in the KLKB1 gene within a cell, and / or reducing the expression of KLKB1 within a cell.
40. The pharmaceutical composition according to claim 39, for use in reducing the expression of the KLKB1 gene in cells or subjects.
41. A pharmaceutical composition according to any one of claims 19 to 38, for use in treating a subject having hereditary angioedema (HAE).
42. The pharmaceutical composition according to claim 41, wherein the treatment comprises reducing the frequency and / or severity of HAE attacks.
43. A pharmaceutical composition according to any one of claims 19 to 38, for use in treating and / or preventing at least one of HAE-related angioedema, bradykinin production and / or accumulation, bradykinin-induced swelling, airway angioedema-induced obstruction, and suffocation.
44. A pharmaceutical composition according to any one of claims 19 to 38, for use in a subject to reduce total plasma kallikrein activity and / or reduce prekallikrein and / or kallikrein levels.
45. The pharmaceutical composition according to claim 44, wherein the total plasma kallikrein activity is reduced by more than 60%.
46. A guide RNA according to any one of claims 1 to 18 or a pharmaceutical composition according to any one of claims 19 to 38 for use in a method for inducing double-strand or single-strand breaks in the KLKB1 gene within a cell and / or reducing the expression of KLKB1 within a cell, wherein the method comprises contacting a cell with the guide RNA according to any one of claims 1 to 18 or the pharmaceutical composition according to any one of claims 19 to 38.
47. The guide RNA or pharmaceutical composition according to claim 46, wherein the cells are within the target range.
48. A guide RNA according to any one of claims 1 to 18 or a pharmaceutical composition according to any one of claims 19 to 38 for use in a method of treating a subject having hereditary angioedema (HAE), wherein the method comprises administering the guide RNA according to any one of claims 1 to 18 or the pharmaceutical composition according to any one of claims 19 to 38 to the subject, thereby treating the subject.
49. The guide RNA or pharmaceutical composition according to claim 48, wherein treating the subject reduces the frequency and / or severity of HAE seizures.
50. A guide RNA according to any one of claims 1 to 18 or a pharmaceutical composition according to any one of claims 19 to 38 for use in a method of treating and / or preventing at least one of HAE-related angioedema, bradykinin production and / or accumulation, bradykinin-induced swelling, angioedema-induced obstruction of the airway, and suffocation, wherein the method comprises administering the guide RNA according to any one of claims 1 to 18 or the pharmaceutical composition according to any one of claims 19 to 38 to a subject, thereby treating and / or preventing at least one of HAE-related angioedema, bradykinin production and / or accumulation, bradykinin-induced swelling, angioedema-induced obstruction of the airway, and suffocation in the subject.
51. A guide RNA according to any one of claims 1 to 18 or a pharmaceutical composition according to any one of claims 19 to 38 for use in a method for reducing total plasma kallikrein activity in a subject, wherein the method comprises administering the guide RNA according to any one of claims 1 to 18 or the pharmaceutical composition according to any one of claims 19 to 38 to the subject, thereby reducing total plasma kallikrein activity in the subject.
52. The guide RNA or pharmaceutical composition according to claim 51, wherein the total plasma kallikrein activity is reduced by more than 60% in the subject.
53. Use of a guide RNA according to any one of claims 1 to 18, or a pharmaceutical composition according to any one of claims 19 to 38, in the preparation of a pharmaceutical for carrying out a method using a guide RNA or pharmaceutical composition according to any one of claims 46 to 52.