Antisense oligonucleotides targeting downstream of the transcripts 3' terminus

RNase H recruiting antisense oligonucleotides targeting sequences downstream of the 3' terminus address the limitations of existing technologies by effectively reducing gene expression through targeted cleavage of nascent transcripts, enhancing gene silencing efficacy.

WO2026132147A1PCT designated stage Publication Date: 2026-06-25F HOFFMANN LA ROCHE & CO AG +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
F HOFFMANN LA ROCHE & CO AG
Filing Date
2025-12-18
Publication Date
2026-06-25

AI Technical Summary

Technical Problem

Existing antisense oligonucleotides targeting mRNA or pre-mRNA sequences near the 3' terminus are limited in effectively reducing gene expression, as they do not account for the continuous RNA synthesis downstream of the polyadenylation site during transcription termination.

Method used

Designing RNase H recruiting antisense oligonucleotides that are reverse complementary to nucleotide sequences located downstream of the transcripts' 3' terminus, targeting a pre-RNA molecule before polyadenylation-site induced cleavage, to modulate gene expression.

Benefits of technology

Effectively reduces gene expression by recruiting RNase H to cleave nascent transcripts, providing a novel mechanism for targeted gene silencing beyond traditional methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000021_0001
    Figure IMGF000021_0001
  • Figure IMGF000022_0001
    Figure IMGF000022_0001
  • Figure IMGF000011_0001_TABLE
    Figure IMGF000011_0001_TABLE
Patent Text Reader

Abstract

The present invention describes that a pre-mRNA molecule, which temporarily exists before polyadenylation-site induced cleavage occurs, can be targeted by RNase H recruiting antisense oligonucleotides downstream of a transcripts 3' terminus to reduce expression levels of target genes from which the RNA polymerization originates.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Docket No. P39006

[0002] ANTISENSE OLIGONUCLEOTIDES TARGETING DOWNSTREAM OF THE TRANSCRIPTS 3’ TERMINUS

[0003] CROSS-REFERENCE TO RELATED APPLICATIONS

[0004] SEQUENCE LISTING

[0005] The sequence listing submitted with this application is hereby incorporated by reference. In the event of a discrepancy between the sequence listing and the specification or figures, the information disclosed in the specification (including the figures) shall be deemed to be correct.

[0006] BACKGROUND

[0007] RNase H recruiting antisense oligonucleotides (ASOs) have been described to be able to reduce gene expression levels when they are reverse complementary to mRNA or pre-mRNA sequence of the targeted genes (Lai F, Damle SS, Ling KK, Rigo F. Directed RNase H Cleavage of Nascent Transcripts Causes Transcription Termination. Mol Cell. 2020 Mar 5;77(5): 1032-1043. e4; Lee JS, Mendell JT. Antisense-Mediated Transcript Knockdown Triggers Premature Transcription Termination. Mol Cell. 2020 Mar 5;77(5): 1044-1054. e3). Here, we are describing a novel possibility of reducing gene expression levels by designing RNase H recruiting antisense oligonucleotides that are reverse complementary to a nucleotide sequence located downstream of a transcripts 3’ terminus. This is consistent with a gene expression model in which RNA from a given gene locus is continuously synthesized downstream of the transcript’s polyadenylation site until the transcription process is terminated (Eaton JD, Francis L, Davidson L, West S. A unified allosteric / torpedo mechanism for transcriptional termination on human protein -coding genes. Genes Dev. 2020 Jan 1;34(1 -2): 132-145).

[0008] OBJECTIVE OF THE INVENTION

[0009] The present inventors found that a pre-RNA molecule, which temporarily exists before polyadenylation-site induced cleavage occurs, can be targeted by RNase H recruiting antisense oligonucleotides downstream of a transcripts 3' terminus to reduce expression levels of target genes from which the RNA polymerization originates. Docket No. P39006

[0010] BRIEF SUMMARY

[0011] Provided herein is an antisense oligonucleotide of 10 to 30 nucleotides in length, wherein the antisense oligonucleotide is capable of modulating the expression of a target gene, wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity, such as 100% complementarity, to a target sequence located downstream of a cleavage and polyadenylation site.

[0012] In one aspect, modulating the expression of a target gene is reducing the expression of the target gene.

[0013] In one aspect, modulating the expression of a target gene is inhibiting the expression of the target gene.

[0014] In one aspect, the cleavage and polyadenylation site is located on a pre-mRNA, wherein the pre-mRNA is a transcript of the target gene.

[0015] In one aspect, the cleavage and polyadenylation site is located within the transcription unit of the target gene.

[0016] In one aspect, the target sequence is located between about 1 nucleotide and about 2000 nucleotides, between about 1 nucleotide and about 1000 nucleotides, between about 1 nucleotide and about 500 nucleotides, between about 1 nucleotide and about 400 nucleotides, between about 1 nucleotide and about 300 nucleotides, between about 1 nucleotide and about 200 nucleotides, between about 1 nucleotide and about 100 nucleotides, between about 1 nucleotide and about 50 nucleotides downstream of the cleavage and polyadenylation site.

[0017] In another aspect, the target sequence is located between about 50 nucleotide and about 2000 nucleotides, between about 50 nucleotide and about 1000 nucleotides, between about 50 nucleotide and about 500 nucleotides, between about 50 nucleotide and about 400 nucleotides, between about 50 nucleotide and about 300 nucleotides, between about 50 nucleotide and about 200 nucleotides, between about 50 nucleotide and about 100 nucleotides downstream of the cleavage and polyadenylation site.

[0018] In one aspect, the contiguous nucleotide sequence comprises at least one mismatch as compared to the target site sequence. Docket No. P39006

[0019] In one aspect, the mismatch is located at the terminal position of the antisense oligonucleotide-mRNA duplex.

[0020] In one aspect, one or more nucleoside in the contiguous nucleotide sequence is a 2’ sugar modified nucleoside.

[0021] In one aspect, one or more 2’ sugar modified nucleoside is independently selected from the group consisting of 2’-O-alkyl-RNA, 2’-O-methyl-RNA, 2’-O-ethyl-RNA, 2’-alkoxy-RNA, 2’ -O-m ethoxy ethyl-RNA, 2’-amino-DNA, 2’-fluoro-DNA, arabino nucleic acid (ANA), 2 ’-fluoro- ANA and LNA nucleosides.

[0022] In one aspect, one or more of the modified nucleoside is a LNA nucleoside.

[0023] In one aspect, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphorothioate internucleoside linkages.

[0024] In one aspect, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphorodithioate internucleoside linkages.

[0025] In one aspect, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphodiester internucleoside linkages.

[0026] In one aspect, all the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

[0027] In one aspect, the antisense oligonucleotide is capable of recruiting RNase H, such as RNaseHl.

[0028] In one aspect, the antisense oligonucleotide is a gapmer.

[0029] In one aspect, the gapmer has the formula 5’-F-G-F’-3’.

[0030] In one aspect, region G consists of 6 - 16 DNA nucleosides.

[0031] In one aspect, provided is a conjugate comprising the antisense oligonucleotide as described herein above, and at least one conjugate moiety covalently attached to said antisense oligonucleotide.

[0032] In one aspect, provided is a pharmaceutically acceptable salt of the antisense oligonucleotide as described herein above, or the conjugate as described herein above. Docket No. P39006

[0033] In one aspect, provided is a pharmaceutical composition comprising the antisense oligonucleotide as described herein above, the conjugate as described herein above, or the pharmaceutically acceptable salt as described herein above, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0034] In one aspect, provided is an in vivo or in vitro method for modulating the expression of a target gene in a target cell which is expressing the target gene, said method comprising administering an antisense oligonucleotide as described herein above, or the conjugate as described herein above, or the pharmaceutical composition as described herein above in an effective amount to said cell.

[0035] In one aspect, provided is the antisense oligonucleotide as described herein above, or the conjugate as described herein above, or the pharmaceutical composition as described herein above for use in medicine.

[0036] BRIEF SUMMARY OF FIGURES

[0037] Figure 1 shows coverage plot generated by Integrative Genomics Viewer (IGV, version 2.13.1), using BAM files from RNA-Seq experiment described in Example 1 (data pooled from all PBS-treated wells, no ASO treatment data used). The view is approximately centered around the most downstream annotated cleavage and polyadenylation site of CHMP1A gene (Ensembl version 99). Note that CHMP1A gene is annotated on a negative strand, and in the provided display the cleavage and polyadenylation site corresponds to the left terminus of the black bar labeled ‘CHMP1 A’. The bottom section of the figure displays 1-mismatch off-target site of CP04358 gapmer. The figure confirms that the 3’ end of the CHMP1A transcript is correctly annotated, and that the 1-mismatch off-target binding site is positioned outside of the mature mRNA sequence.

[0038] Figure 2 shows coverage plot generated by Integrative Genomics Viewer (IGV, version 2.13.1), using BAM files prepared from publicly available RNA-Seq data, as described in Example 2. The view is approximately centered around annotated (RefSeq CFB transcript annotation NM_001710.6) cleavage and polyadenylation site of CFB gene. Note that CFB gene is annotated on a positive strand, and in the provided display the cleavage and polyadenylation site corresponds to the right terminus of the black bar labeled CFB. The figure confirms that the 3’ end of the CFB transcript is correctly annotated. Docket No. P39006

[0039] DETAILED DESCRIPTION

[0040] DEFINITIONS

[0041] Oligonucleotide

[0042] The term “oligonucleotide” as used herein is defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification and isolation. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. The oligonucleotide of the invention is man-made, and is chemically synthesized, and is typically purified or isolated. The oligonucleotide of the invention may comprise one or more modified nucleosides such as 2’ sugar modified nucleosides. The oligonucleotide of the invention may comprise one or more modified internucleoside linkages, such as one or more phosphorothioate internucleoside linkages.

[0043] Antisense oligonucleotides

[0044] The term “antisense oligonucleotide” or “ASO” as used herein is defined as oligonucleotides capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid. Antisense oligonucleotides are not essentially double stranded and are therefore not siRNAs or shRNAs. Preferably, the antisense oligonucleotides of the present invention are single stranded. It is understood that single stranded oligonucleotides of the present invention can form hairpins or intermolecular duplex structures (duplex between two molecules of the same oligonucleotide), as long as the degree of intra or inter self-complementarity is less than 50% across of the full length of the oligonucleotide.

[0045] In some embodiments, the single stranded antisense oligonucleotide of the invention may not contain RNA nucleosides.

[0046] Advantageously, the antisense oligonucleotide of the invention comprises one or more modified nucleosides or nucleotides, such as 2’ sugar modified nucleosides. Furthermore, it is advantageous that the nucleosides which are not modified are DNA nucleosides. Docket No. P39006

[0047] Contiguous Nucleotide Sequence

[0048] The term “contiguous nucleotide sequence” refers to the region of the oligonucleotide which is complementary to the target nucleic acid. The term is used interchangeably herein with the term “contiguous nucleobase sequence” and the term “oligonucleotide motif sequence”. In some embodiments all the nucleosides of the oligonucleotide constitute the contiguous nucleotide sequence. In some embodiments the oligonucleotide comprises the contiguous nucleotide sequence, such as aF-G-F’ gapmer region, and may optionally comprise further nucleotide(s), for example a nucleotide linker region which may be used to attach a functional group (e.g. a conjugate group) to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. In some embodiments, the nucleobase sequence of the antisense oligonucleotide is the contiguous nucleotide sequence.

[0049] Nucleotides and nucleosides

[0050] Nucleotides and nucleosides are the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention include both naturally occurring and non-naturally occurring nucleotides and nucleosides. In nature, nucleotides, such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which is absent in nucleosides). Nucleosides and nucleotides may also interchangeably be referred to as “units” or “monomers”.

[0051] Modified nucleoside

[0052] The term “modified nucleoside” or “nucleoside modification” as used herein refers to nucleosides modified as compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications of the sugar moiety or the (nucleo)base moiety. Advantageously, one or more of the modified nucleosides of the antisense oligonucleotide of the invention comprise a modified sugar moiety. The term modified nucleoside may also be used herein interchangeably with the term “nucleoside analogue” or modified “units” or modified “monomers”. Nucleosides with an unmodified DNA or RNA sugar moiety are termed DNA or RNA nucleosides herein. Nucleosides with modifications in the base region of the DNA or RNA nucleoside are still generally termed DNA or RNA if they allow Watson Crick base pairing.

[0053] Modified internucleoside linkage Docket No. P39006

[0054] The term “modified internucleoside linkage” is defined as generally understood by the skilled person as linkages other than phosphodiester (PO) linkages, that covalently couples two nucleosides together. The oligonucleotides of the invention may therefore comprise one or more modified internucleoside linkages such as a one or more phosphorothioate internucleoside linkages, or one or more phoshporodithioate internucleoside linkages.

[0055] In some embodiments at least 50% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate, such as at least 60%, such as at least 70%, such as at least 75%, such as at least 80% or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate.

[0056] In some advantageous embodiments, all the internucleoside linkages of the contiguous nucleotide sequence of the oligonucleotide are phosphorothioate, or all the internucleoside linkages of the oligonucleotide are phosphorothioate linkages.

[0057] It is recognized that, as disclosed in EP 2742 135, antisense oligonucleotides may comprise other internucleoside linkages (other than phosphodiester, phosphorothioate and phosphorodithioate), for example alkyl phosphonate / methyl phosphonate internucleoside, which according to EP 2742 135 may for example be tolerated in an otherwise DNA phosphorothioate the gap region.

[0058] Nucleobase

[0059] The term nucleobase includes the purine (e.g. adenine and guanine) and pyrimidine (e.g. uracil, thymine and cytosine) moiety present in nucleosides and nucleotides which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention the term nucleobase also encompasses modified nucleobases which may differ from naturally occurring nucleobases, but are functional during nucleic acid hybridization. In this context “nucleobase” refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine and hypoxanthine, as well as non -naturally occurring variants. Such variants are for example described in Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1. Docket No. P39006

[0060] In some embodiments the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as a nucleobased selected from isocytosine, pseudoisocytosine, 5 -methyl cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2 ’thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine and 2-chloro-6-aminopurine.

[0061] The nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g. A, T, G, C or U, wherein each letter may optionally include modified nucleobases of equivalent function. For example, in the exemplified oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5 -methyl cytosine. Optionally, for LNA gapmers, 5-methyl cytosine LNA nucleosides may be used.

[0062] Modified oligonucleotide

[0063] The term modified oligonucleotide describes an oligonucleotide comprising one or more sugar-modified nucleosides and / or modified internucleoside linkages. The term chimeric” oligonucleotide is a term that has been used in the literature to describe oligonucleotides comprising sugar modified nucleosides and DNA nucleosides. The antisense oligonucleotide of the invention is advantageously a chimeric oligonucleotide.

[0064] Complementarity

[0065] The term “complementarity” describes the capacity for Watson-Crick base-pairing of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A) - thymine (T) / uracil (U). It will be understood that oligonucleotides may comprise nucleosides with modified nucleobases, for example 5-methyl cytosine is often used in place of cytosine, and as such the term complementarity encompasses Watson Crick base-paring between non-modified and modified nucleobases (see for example Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).

[0066] The term “% complementary” as used herein, refers to the proportion of nucleotides (in percent) of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which across the contiguous nucleotide sequence, are complementary to a reference sequence (e.g. a target sequence or sequence motif). The percentage of complementarity is thus calculated by counting the number of aligned nucleobases that are complementary (from Watson Crick base pair) between the two sequences (when aligned Docket No. P39006

[0067] with the target sequence 5 ’-3’ and the oligonucleotide sequence from 3 ’-5’), dividing that number by the total number of nucleotides in the oligonucleotide and multiplying by 100. In such a comparison a nucleobase / nucleotide which does not align (form a base pair) is termed a mismatch. Insertions and deletions are not allowed in the calculation of % complementarity of a contiguous nucleotide sequence. It will be understood that in determining complementarity, chemical modifications of the nucleobases are disregarded as long as the functional capacity of the nucleobase to form Watson Crick base pairing is retained (e.g. 5 ’-methyl cytosine is considered identical to a cytosine for the purpose of calculating % identity).

[0068] The term “fully complementary”, refers to 100% complementarity.

[0069] Identity

[0070] The term “identity” as used herein, refers to the proportion of nucleotides (expressed in percent) of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which across the contiguous nucleotide sequence, are identical to a reference sequence (e.g. a sequence motif). The percentage of identity is thus calculated by counting the number of aligned nucleobases that are identical (a Match) between two sequences (in the contiguous nucleotide sequence of the compound of the invention and in the reference sequence), dividing that number by the total number of nucleotides in the oligonucleotide and multiplying by 100. Therefore, Percentage of Identity = (Matches x 100) / Length of aligned region (e.g. the contiguous nucleotide sequence). Insertions and deletions are not allowed in the calculation the percentage of identity of a contiguous nucleotide sequence. It will be understood that in determining identity, chemical modifications of the nucleobases are disregarded as long as the functional capacity of the nucleobase to form Watson Crick base pairing is retained (e.g. 5 -methyl cytosine is considered identical to a cytosine for the purpose of calculating % identity).

[0071] Hybridization

[0072] The term “hybridizing” or “hybridizes” as used herein is to be understood as two nucleic acid strands (e.g. an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands thereby forming a duplex. The affinity of the binding between two nucleic acid strands is the strength of the hybridization. It is often described in terms of the melting temperature (Tm) defined as the temperature at which half of the oligonucleotides are duplexed with the target nucleic acid. At physiological conditions Tmis not strictly proportional to the affinity (Mergny and Lacroix,

[0073] 2003, Oligonucleotides 13:515-537). The standard state Gibbs free energy AG° is a more accurate representation of binding affinity and is related to the dissociation constant (Ka) of the reaction by AG°=-RTln(Ka), where R is the gas constant and T is the absolute temperature. Therefore, a very low AG° of the reaction between an oligonucleotide and the target nucleic acid reflects a strong hybridization between the oligonucleotide and target nucleic acid. AG° is the energy associated with a reaction where aqueous concentrations are IM, the pH is 7, and the temperature is 37°C. The hybridization of oligonucleotides to a target nucleic acid is a spontaneous reaction and for spontaneous reactions AG° is less than zero. AG° can be measured experimentally, for example, by use of the isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discov Today. The skilled person will know that commercial equipment is available for AG° measurements. AG° can also be estimated numerically by using the nearest neighbor model as described by SantaLucia, 1998, Proc Natl Acad Sci USA. 95: 1460-1465 using appropriately derived thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al.,

[0074] 2004, Biochemistry 43:5388-5405. In order to have the possibility of modulating its intended nucleic acid target by hybridization, oligonucleotides of the present invention hybridize to a target nucleic acid with estimated AG° values below -10 kcal for oligonucleotides that are 10-30 nucleotides in length. In some embodiments the degree or strength of hybridization is measured by the standard state Gibbs free energy AG°. The oligonucleotides may hybridize to a target nucleic acid with estimated AG° values below the range of -10 kcal, such as below -15 kcal, such as below -20 kcal and such as below -25 kcal for oligonucleotides that are 8-30 nucleotides in length. In some embodiments the oligonucleotides hybridize to a target nucleic acid with an estimated AG° value of -10 to -60 kcal, such as -12 to -40, such as from -15 to -30 kcal or- 16 to -27 kcal such as -18 to -25 kcal.

[0075] Exemplary target genes with reference to the Examples

[0076] The term “target sequence” as used herein refers to a sequence of nucleotides present in the target nucleic acid which comprises the nucleobase sequence which is complementary to the oligonucleotide of the invention. In some embodiments, the target sequence consists of a region on the target nucleic acid with a nucleobase sequence that is complementary to the contiguous nucleotide sequence of the oligonucleotide of the invention. This region of the target nucleic acid may interchangeably be referred to as the target nucleotide sequence, Docket No. P39006

[0077] target sequence or target region. In some embodiments the target sequence is longer than the complementary sequence of a single oligonucleotide, and may, for example represent a preferred region of the target nucleic acid which may be targeted by several oligonucleotides of the invention.

[0078] CHMP1A

[0079] According to one aspect of the present invention, the target nucleic acid is a nucleic acid which encodes mammalian CHMP1A and may for example be a gene, a RNA, a mRNA, and pre-mRNA, a mature mRNA or a cDNA sequence. The target may therefore be referred to as an CHMP1A target nucleic acid. For in vitro and in vivo use, a preferred target nucleic acid is the pre-mRNA or mRNA encoding CHMP1 A. If employing the oligonucleotide of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.

[0080] A preferred target gene is the human CHMP1A, for example the human CHMP1A pre-mRNA (see genetic coordinates provided in Table 1, and as illustrated herein as SEQ ID NO: 190, or the human CHMP1A mature mRNA as illustrated herein as SEQ ID NO: 191.

[0081] Table 1: Genome and assembly information for human CHMP1A target gene

[0082] Species Chr. Strand Genomic Assembly NCBI reference coordinates sequence * Start End Accession number for mRNA

[0083] Human chr16 Rev 896444 896577 Genome Reference NM_002768.5

[0084] 35 08 Consortium Human

[0085] GRCh38.pl4

[0086] (GCA_000001405.2

[0087] 9)

[0088]

[0089] Fwd = forward strand. Rev = reverse strand. The genome coordinates provide the pre-mRNA sequence (genomic sequence). The NCBI reference provides the mRNA sequence (cDNA sequence). Docket No. P39006

[0090] *The National Center for Biotechnology Information reference sequence database is a comprehensive, integrated, non-redundant, well -annotated set of reference sequences including genomic, transcript, and protein. It is hosted at www.ncbi.nlm.nih.gov / refse

[0091] In some embodiments the target nucleic acid is a transcript variant of SEQ ID NO: 190 - i.e. a transcript which is transcribed from the CHMP1A gene encoded from the human chromosomal locus (coordinates are identified in Table 1).

[0092] The oligonucleotide of the invention may for example target an exon region of a human CHMP1A pre-mRNA or mRNA, or may for example target an intron region in a human CHMP1A pre-mRNA (see e.g. Table 2, illustrating exon and intron regions of SEQ ID NO: 190). In some embodiments, the oligonucleotide of the invention targets an intron / exon boundary of a human CHMP1A pre-mRNA.

[0093] Table 2: human CHMP1A Exons and Introns of SEQ ID NO: 190

[0094] Exemplary exonic regions in the Exemplary intronic regions in the human CHMP1A pre-mRNA (SEQ ID human CHMP1A pre-mRNA (SEQ ID NO:

[0095] NO: 190) 190)

[0096] ID start end ID start end

[0097] el 1 127 il 128 3785

[0098] e2 3786 3805 i2 3806 6062

[0099] e3 6063 6140 i3 6141 8211

[0100] e4 8212 8358 i4 8359 10377

[0101] e5 10378 10506 i5 10507 10994

[0102] e6 10995 11182 i6 11183 11621

[0103] e7 11622 13274

[0104]

[0105] Docket No. P39006

[0106] The oligonucleotide of the invention comprises a contiguous nucleotide sequence which is complementary to and hybridizes to the target nucleic acid, such as a target sequence described herein.

[0107] The target sequence to which the oligonucleotide is complementary to generally comprises a contiguous nucleobases sequence of at least 10 nucleotides. The contiguous nucleotide sequence is between 10 to 30 nucleotides in length, such as 12 to 30, such as 14 to 20, such as 15 to 18 contiguous nucleotides in length, such as 15, 16, 17 contiguous nucleotides in length.

[0108] The contiguous sequence of nucleobases of the oligonucleotide of the invention is typically complementary to the CHMP1A target nucleic acid, such as SEQ ID NO: 190 as measured across the length of the oligonucleotide, optionally with the exception of a mismatches, and optionally excluding nucleotide based linker regions which may link the oligonucleotide to an optional functional group such as a conjugate, or other non- complementary terminal nucleotides (e.g. region D’ or D”). The target nucleic acid may for example be a messenger RNA, such as a mature mRNA or a pre-mRNA, which

[0109] encodes CHMP1A.

[0110] CFB

[0111] According to one aspect of the present invention, the target nucleic acid is a nucleic acid which encodes mammalian CFB and may for example be a gene, a RNA, a mRNA, and pre-mRNA, a mature mRNA or a cDNA sequence. The target may therefore be referred to as an CFB target nucleic acid. For in vitro and in vivo use, a preferred target nucleic acid is the pre-mRNA or mRNA encoding CFB. If employing the oligonucleotide of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.

[0112] A preferred target gene is the human CFB, for example the Human CFB pre-mRNA (see genetic coordinates provided in Table 3, and as illustrated herein as SEQ ID NO: 192, or the human CFB mature mRNA as illustrated herein as SEQ ID NO: 193.

[0113] Table 3: Genome and assembly information for human CFB target gene

[0114] Species Chr. Strand Genomic Assembly NCBI reference coordinates sequence

[0115]

[0116] Docket No. P39006

[0117] Start End *

[0118] Accession number for mRNA

[0119] Human chr6 Fwd 319460 319520 Genome Reference NM_001710.6

[0120] 95 84 Consortium Human

[0121] GRCh38.pl4

[0122] (GCA_000001405.2

[0123] 9)

[0124]

[0125] Fwd = forward strand. Rev = reverse strand. The genome coordinates provide the pre-mRNA sequence (genomic sequence). The NCBI reference provides the mRNA sequence (cDNA sequence).

[0126] *The National Center for Biotechnology Information reference sequence database is a comprehensive, integrated, non-redundant, well -annotated set of reference sequences including genomic, transcript, and protein. It is hosted at www.ncbi.nlm.nih.gov / refse

[0127] In some embodiments the target nucleic acid is a transcript variant of SEQ ID NO:

[0128] 192 - i.e. a transcript which is transcribed from the CFB gene encoded from the human chromosomal locus (coordinates are identified in table 1).

[0129] The oligonucleotide of the invention may for example target an exon region of a Human CFB pre-mRNA or mRNA, or may for example target an intron region in a Human CFB pre-mRNA (see e.g. Table 4, illustrating exon and intron regions of SEQ ID NO:

[0130] 192). In some embodiments, the oligonucleotide of the invention targets an intron / exon boundary of a human CFB pre-mRNA.

[0131] Table 4: human CFB Exons and Introns of SEQ ID NO: 192

[0132] Exemplary exonic regions in the human Exemplary intronic regions in the CFB prem-RNA (SEQ ID NO: 192) human CFB prem-RNA (SEQ ID NO:

[0133] 192)

[0134] ID start end ID start end

[0135]

[0136] Docket No. P39006

[0137] el 1 191 il 192 278

[0138] e2 279 512 i2 513 912

[0139] e3 913 1098 i3 1099 1253

[0140] e4 1254 1427 i4 1428 1647

[0141] e5 1648 1749 i5 1750 1850

[0142] e6 1851 1987 i6 1988 2279

[0143] e7 2280 2418 i7 2419 2735

[0144] e8 2736 2867 i8 2868 3148

[0145] e9 3149 3250 i9 3251 3325

[0146] elO 3326 3463 ilO 3464 3955

[0147] ell 3956 4053 ill 4054 4191

[0148] el2 4192 4309 il2 4310 4524

[0149] el3 4525 4678 il3 4679 4773

[0150] el4 4774 4850 il4 4851 5049

[0151] el5 5050 5150 il5 5151 5246

[0152] el6 5247 5379 il6 5380 5460

[0153] el7 5461 5510 il7 5511 5780

[0154] el8 5781 5990

[0155]

[0156] Docket No. P39006

[0157] The oligonucleotide of the invention comprises a contiguous nucleotide sequence which is complementary to and hybridizes to the target nucleic acid, such as a target sequence described herein.

[0158] The target sequence to which the oligonucleotide is complementary to generally comprises a contiguous nucleobases sequence of at least 10 nucleotides. The contiguous nucleotide sequence is between 10 to 30 nucleotides in length, such as 12 to 30, such as 14 to 20, such as 15 to 18 contiguous nucleotides in length, such as 15, 16, 17 contiguous nucleotides in length.

[0159] The contiguous sequence of nucleobases of the oligonucleotide of the invention is typically complementary to the CFB target nucleic acid, such as SEQ ID NO: 192 as measured across the length of the oligonucleotide, optionally with the exception of a mismatches, and optionally excluding nucleotide based linker regions which may link the oligonucleotide to an optional functional group such as a conjugate, or other non-complementary terminal nucleotides (e.g. region D’ or D”). The target nucleic acid may for example be a messenger RNA, such as a mature mRNA or a pre-mRNA, which

[0160] encodes CFB.

[0161] Cleavage and polyadenylation site

[0162] The term “cleavage and polyadenylation site” refers to a sequence that terminates transcription of a transcriptional unit and ensures that the nucleic acid sequence encoding a polypeptide is transcribed and translated properly. The cleavage and polyadenylation site is recognised by the RNA cleavage complex resulting in cleavage of the pre-RNA and polyadenylation catalyzed by polyadenylate polymerase.

[0163] Examples of naturally-occurring eukaryotic cleavage and polyadenylation site include rabbit beta-globin poly(A) signal, a signal sequence that has been characterized in the literature as strong (Gil and Proudfoot, Cell 49: 399-406 (1987); Gil and Proudfoot, Nature 312: 473-474 (1984)). One of its key features is the structure of its downstream element, which contains both UG- and U-rich domains. Other cleavage and polyadenylation site include synthetic poly A, HSV Thymidine kinase poly A, (see Cole, C. N. and T. P. Stacy, Mol. Cell. Biol. 5:2104-2113 (1985)); Human alpha globin poly A SV40 poly A (See Schek, N, Cooke, C, and J. C. Alwine, Mol. Cell Biol. 12:5386-5393 (1992)); human beta globin poly A (See Gil, A., and N. J. Proudfoot, Cell 49:399-406 (1987)); polyomavirus poly A (See Batt, D. B and G. G. Carmichael Mol. Cell. Biol. 15:4783-4790 (1995); Bovine Docket No. P39006

[0164] growth hormone poly A, (Gimmi, E. R., Reff, M. E., and I. C. Deckman, Nucleic Acid Res. (1989)).

[0165] Additional cleavage and polyadenylation site can be identified or constructed using methods that are known in the art and also described below. A minimal cleavage and polyadenylation site is composed of AAUAAA and a second recognition sequence, generally a G / U rich sequence, found about 30 nucleotides downstream. As used herein, the sequences are presented as DNA, rather than RNA, to facilitate preparation of suitable DNAs for incorporation into expression vectors. When presented as DNA, the cleavage and polyadenylation site is composed of AATAAA, with, for example, a G / T rich region downstream. Both sequences must be present to form an efficient cleavage and polyadenylation site. The purpose of these sites is to recruit specific RNA binding proteins to the RNA. The AAUAAA binds cleavage polyadenylation specificity factor (CPSF;

[0166] Murthy K. G., and Manley J. L. (1995), Genes Dev 9:2672-2683), and second site, frequently a G / U sequence, binds to Cleavage stimulatory factor (CstF; Takagaki Y. and Manley J. L. (1997) Mol Cell Biol 17:3907-3914). CstF is composed of several proteins, but the protein responsible for RNA binding is CstF-64, a member of the ribonucleoprotein domain family of proteins (Takagaki et al. (1992) Proc Natl Acad Sci USA 89:1403-1407).

[0167] It is estimated that more than 70% of mammalian protein-coding genes are able to utilize more than one cleavage and polyadenylation site (Zhang, Z., Bae, B., Cuddleston, W. H., & Miura, P. (2023). Coordination of alternative splicing and alternative polyad enylati on revealed by targeted long read sequencing. Nature communications, 14(1), 5506. https: / / doi.org / 10.1038 / s41467-023-41207-8), which is also reflected in public gene annotations, such as Ensembl. To experimentally determine which cleavage and polyadenylation site gene of interest utilises in a given biological system, one can perform a 3' RACE (Rapid amplification of cDNA ends) experiment as outlined in a published protocol: Scotto-Lavino E, Du G, Frohman MA. 3' end cDNA amplification using classic RACE. Nat Protoc. 2006;l(6):2742-2745. doi:10.1038 / nprot.2006.481. Alternatively, it can be determined using a commercial kit and following its instructions, e.g. "3' RACE System for Rapid Amplification of cDNA Ends" from Thermo Fisher Scientific (Catalog number 18373019). Alternatively, it can be determined using deep sequencing protocol, such as 3' READS (Hoque, M., Ji, Z., Zheng, D., Luo, W., Li, W., You, B., Park, J. Y., Yehia, G., & Tian, B. (2013). Analysis of alternative cleavage and polyadenylation by 3' region extraction and deep sequencing. Nature methods, 10(2), 133-139.

[0168] https: / / doi.org / 10.1038 / nmeth.2288) Docket No. P39006

[0169] Without being bound to theory, it is appreciated that cleavage and polyadenylation site sequences belong to 3’ regulatory elements which are DNA sequences located in the 3’ untranslated region (UTR) of mRNA transcripts, downstream of the coding region. Other 3’ regulatory elements comprise AU-rich elements (AREs) and microRNA (miRNA) binding sites. 3’ regulatory elements are not translated into protein but play an important role in regulating gene expression, such as influencing the stability, localization, and translation of mRNA transcripts, and ultimately affect the expression (level) of protein -coding genes.

[0170] Target Cell

[0171] The term a “target cell” as used herein refers to a cell which is expressing the target nucleic acid. In some embodiments the target cell may be in vivo or in vitro. In some embodiments the target cell is a mammalian cell such as a rodent cell, such as a mouse cell or a rat cell, or a primate cell such as a monkey cell or a human cell.

[0172] Typically, the target cell expresses the CHMP1A mRNA, such as the CHMP1A pre-mRNA or CHMP1 A mature mRNA. For experimental evaluation a target cell may be used which expresses a nucleic acid which comprises a target sequence.

[0173] The poly A tail of CHMP1 A mRNA is typically disregarded for antisense oligonucleotide targeting.

[0174] The oligonucleotide of the invention is typically capable of inhibiting the expression of the CHMP1 A target nucleic acid in a cell which is expressing the CHMP1 A target nucleic acid (a target cell), for example either in vivo or in vitro.

[0175] Naturally occurring variant

[0176] The term “naturally occurring variant” refers to variants of CHMP1A gene or transcripts which originate from the same genetic loci as the target nucleic acid, but may differ for example, by virtue of degeneracy of the genetic code causing a multiplicity of codons encoding the same amino acid, or due to alternative splicing of pre-mRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms (SNPs), and allelic variants. Based on the presence of the sufficient complementary sequence to the oligonucleotide, the oligonucleotide of the invention may therefore target the target nucleic acid and naturally occurring variants thereof. Docket No. P39006

[0177] In some embodiments, the naturally occurring variants have at least 95% such as at least 98% or at least 99% homology to a mammalian CHMP1 A target nucleic acid, such as a target nucleic acid selected from the group consisting of SEQ ID NO: 1. In some embodiments the naturally occurring variants have at least 99% homology to the human CHMP1A target nucleic acid of SEQ ID NO: 1.

[0178] Inhibition of expression

[0179] The term “inhibition of expression” as used herein is to be understood as an overall term for an oligonucleotide’s ability to inhibit the amount or the activity of CHMP1 A in a target cell. Inhibition of activity may be determined by measuring the level of CHMP1A pre-mRNA or CHMP1 A mRNA, or by measuring the level of CHMP1 A or CHMP1 A activity in a cell. Inhibition of expression may therefore be determined in vitro or in vivo.

[0180] Typically, inhibition of expression is determined by comparing the inhibition of activity due to the administration of an effective amount of the antisense oligonucleotide to the target cell and comparing that level to a reference level obtained from a target cell without administration of the antisense oligonucleotide (control experiment), or a known reference level (e.g. the level of expression prior to administration of the effective amount of the antisense oligonucleotide, or a predetermine or otherwise known expression level).

[0181] For example a control experiment may be an animal or person, or a target cell treated with a saline composition or a reference oligonucleotide (often a scrambled control).

[0182] The term inhibition or inhibit may also be referred as down -regulate, reduce, suppress, lessen, lower, the expression of CHMP1A.

[0183] The inhibition of expression may occur e.g. by degradation of pre-mRNA (e.g. using RNase H recruiting oligonucleotides, such as gapmers).

[0184] High affinity modified nucleosides

[0185] A high affinity modified nucleoside is a modified nucleotide which, when incorporated into the oligonucleotide enhances the affinity of the oligonucleotide for its complementary target, for example as measured by the melting temperature (Tm). A high affinity modified nucleoside of the present invention preferably result in an increase in melting temperature between +0.5 to +12°C, more preferably between +1.5 to +10°C and most preferably between+3 to +8°C per modified nucleoside. Numerous high affinity Docket No. P39006

[0186] modified nucleosides are known in the art and include for example, many 2’ substituted nucleosides as well as locked nucleic acids (LNA) (see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213).

[0187] Sugar modifications

[0188] The oligomer of the invention may comprise one or more nucleosides which have a modified sugar moiety, i.e. a modification of the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA.

[0189] Numerous nucleosides with modification of the ribose sugar moiety have been made, primarily with the aim of improving certain properties of oligonucleotides, such as affinity and / or nuclease resistance.

[0190] Such modifications include those where the ribose ring structure is modified, e.g. by replacement with a hexose ring (HNA), or a bicyclic ring, which typically have a biradicle bridge between the C2 and C4 carbons on the ribose ring (LNA), or an unlinked ribose ring which typically lacks a bond between the C2 and C3 carbons (e.g. UNA). Other sugar modified nucleosides include, for example, bicyclohexose nucleic acids (WO2011 / 017521) or tricyclic nucleic acids (WO2013 / 154798). Modified nucleosides also include nucleosides where the sugar moiety is replaced with a non-sugar moiety, for example in the case of peptide nucleic acids (PNA), or morpholino nucleic acids.

[0191] Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen, or the 2’ -OH group naturally found in DNA and RNA nucleosides. Substituents may, for example be introduced at the 2’, 3’, 4’ or 5’ positions.

[0192] 2’ sugar modified nucleosides

[0193] A 2’ sugar modified nucleoside is a nucleoside which has a substituent other than H or -OH at the 2’ position (2’ substituted nucleoside) or comprises a 2’ linked biradical capable of forming a bridge between the 2’ carbon and a second carbon in the ribose ring, such as LNA (2’ - 4’ biradical bridged) nucleosides.

[0194] Indeed, much focus has been spent on developing 2’ sugar substituted nucleosides, and numerous 2’ substituted nucleosides have been found to have beneficial properties when Docket No. P39006

[0195] incorporated into oligonucleotides. For example, the 2’ modified sugar may provide enhanced binding affinity and / or increased nuclease resistance to the oligonucleotide.

[0196] Examples of 2’ substituted modified nucleosides are 2’-0-alkyl-RNA, 2’-0-methyl-RNA, 2’-O-ethyl-RNA (cEt), 2’ -alkoxy -RNA, 2’-O-methoxyethyl-RNA (MOE), 2’-amino-DNA, 2’-Fluoro-RNA, and 2’-F-ANA nucleoside. For further examples, please see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are illustrations of some 2’ substituted modified nucleosides.

[0197] o OCH3

[0198] 2'-O-Me

[0199]

[0200] 2'-D-MOE 2'-O" AHyl L '- -Hl*. n

[0201] In relation to the present invention 2’ substituted sugar modified nucleosides does not include 2’ bridged nucleosides like LNA.

[0202] Locked Nucleic Acid Nucleosides (LNA nucleoside)

[0203] A “LNA nucleoside” is a 2’- modified nucleoside which comprises a biradical linking the C2’ and C4’ of the ribose sugar ring of said nucleoside (also referred to as a “2’ -4’ bridge”), which restricts or locks the conformation of the ribose ring. These nucleosides are also termed bridged nucleic acid or bicyclic nucleic acid (BNA) in the literature. The locking of the conformation of the ribose is associated with an enhanced affinity of hybridization (duplex stabilization) when the LNA is incorporated into an oligonucleotide for a complementary RNA or DNA molecule. This can be routinely determined by measuring the melting temperature of the oligonucleotide / complement duplex. Docket No. P39006

[0204] Non limiting, exemplary LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO 2008 / 150729, Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76, Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81, and Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238, and Wan and Seth, J.

[0205] Medical Chemistry 2016, 59, 9645-9667.

[0206] Further non limiting, exemplary LNA nucleosides are disclosed in Scheme 1.

[0207] Scheme 1:

[0208] α-L-oxy LNA

[0209] Mim«hylp-D-wyLNA 5’ methyl p-&«y IN* S'methyLe'dimethyl p-O-cay UN*

[0210]

[0211] Carbocyclic(vinyl) β-D- LNA Carbocyclic(vinyl) α-L- LNA 6' methyl thio β-D LNA Substituted β-D amino LNA Docket No. P39006

[0212] Particular LNA nucleosides are beta-D-oxy-LNA, 6’-methyl-beta-D-oxy LNA such as (S)-6’-methyl-beta-D-oxy-LNA (ScET) and ENA.

[0213] A particularly advantageous LNA is beta-D-oxy-LNA.

[0214] RNase H Activity and Recruitment

[0215] The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when in a duplex with a complementary RNA molecule. WOOl / 23613 provides in vitro methods for determining RNase H activity, which may be used to determine the ability to recruit RNase H. Typically an oligonucleotide is deemed capable of recruiting RNase H if it, when provided with a complementary target nucleic acid sequence, has an initial rate, as measured in pmol / l / min, of at least 5%, such as at least 10% or more than 20% of the of the initial rate determined when using a oligonucleotide having the same base sequence as the modified oligonucleotide being tested, but containing only DNA monomers with phosphorothioate linkages between all monomers in the oligonucleotide, and using the methodology provided by Example 91 - 95 of WOOl / 23613 (hereby incorporated by reference). For use in determining RNase H activity, recombinant human RNase Hl is available from Creative Biomart® (Recombinant Human RNase Hl fused with His tag expressed in E. coli).

[0216] Gapmer

[0217] The antisense oligonucleotide of the invention, or contiguous nucleotide sequence thereof, may be a gapmer, also termed gapmer oligonucleotide or gapmer designs. The antisense gapmers are commonly used to inhibit a target nucleic acid via RNase H mediated degradation. A gapmer oligonucleotide comprises at least three distinct structural regions a 5 ’-flank, a gap and a 3 ’-flank, F-G-F’ in the ‘5 -> 3’ orientation. The “gap” region (G) comprises a stretch of contiguous DNA nucleotides which enable the oligonucleotide to recruit RNase H. The gap region is flanked by a 5’ flanking region (F) comprising one or more sugar modified nucleosides, advantageously high affinity sugar modified nucleosides, and by a 3’ flanking region (F’) comprising one or more sugar modified nucleosides, advantageously high affinity sugar modified nucleosides. The one or more sugar modified nucleosides in region F and F’ enhance the affinity of the oligonucleotide for the target nucleic acid (i.e. are affinity enhancing sugar modified nucleosides). In some embodiments, the one or more sugar modified nucleosides in region F and F’ are 2’ sugar modified Docket No. P39006

[0218] nucleosides, such as high affinity 2’ sugar modifications, such as independently selected from LN A and 2’ -MOE.

[0219] In a gapmer design, the 5’ and 3’ most nucleosides of the gap region are DNA nucleosides, and are positioned adjacent to a sugar modified nucleoside of the 5’ (F) or 3’ (F’) region respectively. The flanks may further be defined by having at least one sugar modified nucleoside at the end most distant from the gap region, i.e. at the 5’ end of the 5’ flank and at the 3’ end of the 3’ flank.

[0220] Regions F-G-F’ form a contiguous nucleotide sequence. Antisense oligonucleotides of the invention, or the contiguous nucleotide sequence thereof, may comprise a gapmer region of formula F-G-F’.

[0221] The overall length of the gapmer design F-G-F’ may be, for example 12 to 32 nucleosides, such as 13 to 24, such as 14 to 22 nucleosides, Such as from 14 to 17, such as 16 tol8 nucleosides.

[0222] By way of example, the gapmer oligonucleotide of the present invention can be represented by the following formulae:

[0223] Fi-s-Gs-ie-F’i-s, such as

[0224] Fl-8-G7-16-F’2-8

[0225] with the proviso that the overall length of the gapmer regions F-G-F’ is at least 12, such as at least 14 nucleotides in length.

[0226] In an aspect of the invention the antisense oligonucleotide or contiguous nucleotide sequence thereof consists of or comprises a gapmer of formula 5’-F-G-F’-3’, where region F and F’ independently comprise or consist of 1- 8 nucleosides, of which 1-4 are 2’ sugar modified and defines the 5’ and 3’ end of the F and F’ region, and G is a region between 6 and 16 nucleosides which are capable of recruiting RNaseH.

[0227] Regions F, G and F’ are further defined below and can be incorporated into the F -G-F’ formula.

[0228] LNA Gapmer Docket No. P39006

[0229] An LNA gapmer is a gapmer wherein either one or both of region F and F’ comprises or consists of LNA nucleosides. A beta-D-oxy gapmer is a gapmer wherein either one or both of region F and F’ comprises or consists of beta-D-oxy LNA nucleosides.

[0230] In some embodiments the LNA gapmer is of formula: [LNA]1–5-[region G] -[LNA]1-5, wherein region G is or comprises a region of contiguous DNA nucleosides which are capable of recruiting RNaseH.

[0231] cET Gapmer

[0232] A cEt gapmer is a gapmer wherein either one or both of region F and F’ comprises or consists of constrained ethyl (cEt) nucleosides. In some embodiments the bridge within the cEt may connect the 4'-carbon and the 2'-carbon of the ribosyl ring. In some embodiments the modified sugar moiety may be a constrained ethyl nucleic acid (cEt).

[0233] In some embodiments the cEt gapmer is of formula: [cEt]1-5-[region G] -[cEt]1-5, wherein region G is or comprises a region of contiguous DNA nucleosides which are capable of recruiting RNaseH.

[0234] Conjugate moiety

[0235] In some embodiments, the antisense oligonucleotide is covalently attached to a conjugate moiety. In some embodiments, the antisense oligonucleotide is covalently attached to at least one conjugate moiety.

[0236] The term “conjugate moiety” as used herein refers to a non-nucleotide moiety which is covalently attached to the antisense oligonucleotide (i.e. the ribonucleic acid) of the compound of the invention. The term “conjugate moiety” as used herein refers to the part of the compound of the invention which is not the antisense oligonucleotide. The noun “conjugate” may be used to refer to a compound of the invention comprising a conjugate moiety and an antisense oligonucleotide.

[0237] A “compound of the invention” may thus be an isolated antisense oligonucleotide (i.e. an antisense oligonucleotide with no further moieties attached, also referred to as “naked antisense oligonucleotide” or “naked ASO”) or an antisense oligonucleotide with conjugate moiety attached.

[0238] The term “conjugate moiety” encompasses the carbon-chain moiety and linker, including any linker nucleotides, as described elsewhere herein. Docket No. P39006

[0239] Thus, the term “covalently attached” encompasses direct attachment and indirect attachment. The terms “attached”, “positioned”, “linked” and “conjugated” are interchangeable in reference to the antisense oligonucleotide and the conjugate moiety.

[0240] Attachment of a conjugate moiety to an antisense oligonucleotide of the invention is termed “conjugation” herein. Conjugation of an antisense oligonucleotide of the invention to one or more conjugate moi eties may improve the pharmacology of the compound, e.g. by affecting the activity, cellular distribution, cellular uptake or stability of the compound. In some embodiments the conjugate moiety may modify or enhance the pharmacokinetic properties of the compound by improving cellular distribution, bioavailability, metabolism, excretion, permeability, and / or cellular uptake. In particular the conjugate moiety may target the compound to a specific organ, tissue or cell type and thereby enhance the effectiveness of the compound in that organ, tissue or cell type. At the same time the conjugate moiety may serve to reduce activity of the compound in non-target cell types, tissues or organs, e.g. off target activity or activity in non-target cell types, tissues or organs.

[0241] Nucleic acid conjugates and their synthesis has also been reported in comprehensive reviews by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, S. T. Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103.

[0242] In some embodiments, the antisense oligonucleotide is covalently attached to one or more conjugate moiety. In some embodiments, the antisense oligonucleotide is covalently attached to two or more conjugate moi eties, such as two, three, four or five conjugate moieties.

[0243] Attachment

[0244] In some embodiments, the conjugate moiety is covalently attached to the 3 ’-end of the antisense oligonucleotide. In other words, in some embodiments, the conjugate moiety is attached via a covalent bond linking the 3’ carbon of the 3 ’-most nucleotide of the antisense oligonucleotide to an atom of the conjugate moiety.

[0245] In some embodiments, the conjugate moiety is covalently attached to the 3’ end of the antisense oligonucleotide via a 3’ phosphorous-containing group. The phosphorous-containing group may not be considered part of the conjugate moiety. Docket No. P39006

[0246] In some embodiments, the 3’ phosphorous-containing group is a phosphorothioate group. In other words, in some embodiments, the conjugate moiety is attached via a phosphorothioate bond linking the 3’ carbon of the 3 ’-most nucleotide of the antisense oligonucleotide to an atom of the conjugate moiety.

[0247] In some embodiments, the conjugate moiety is covalently attached to the 5’ -end of the antisense oligonucleotide. In other words, in some embodiments, the conjugate moiety is attached via a covalent bond linking the 5’ carbon of the 5 ’-most nucleotide of the antisense oligonucleotide to an atom of the conjugate moiety.

[0248] In some embodiments, the conjugate moiety is covalently attached to the 5’ end of the antisense oligonucleotide via a 5’ phosphorous-containing group. The phosphorous-containing group may not be considered part of the conjugate moiety. The phosphorous-containing group may be considered part of the antisense oligonucleotide.

[0249] In some embodiments, the 5’ phosphorous-containing group is a phosphate group. In other words, in some embodiments, the conjugate moiety is attached via a phosphodiester bond linking the 5’ carbon of the 5 ’-most nucleotide of the antisense oligonucleotide to an atom of the conjugate moiety.

[0250] Herein the terms “5 ’-end” and “3 ’-end” refer to the direction of the nucleic acid strand and have their generally recognised meaning in the art.

[0251] In some embodiments, the conjugate moiety is attached near the 3’ end of the antisense oligonucleotide. In some embodiments, the conjugate moiety is attached near the 5’ end of the antisense oligonucleotide. Within the context of the invention, a conjugate moiety which is described as being attached “near the 3’ end” of a nucleic acid strand is attached within one, two or three nucleotides of the 3’ end of the nucleic acid strand.

[0252] Similarly, a conjugate moiety which is described as being attached “near the 5’ end” of a nucleic acid strand is attached within one, two or three nucleotides of the 5’ end of the nucleic acid strand.

[0253] In some embodiments, the conjugate moiety is not positioned at an end terminal position of the antisense oligonucleotide (i.e. the conjugate moiety is not positioned at the 5’ end or the 3’ end of antisense oligonucleotide). For example, the conjugate moiety may be attached to a position in the middle or centre region of the contiguous nucleotide sequence. Herein the terms “middle” and “centre” are intended to indicate that the conjugate Docket No. P39006

[0254] moiety is not located at either end of the antisense oligonucleotide, and not that the conjugate moiety is position equidistant from each end.

[0255] In some embodiments, the conjugate moiety is positioned at any position of the contiguous nucleotide sequence. In some embodiments, the conjugate moiety is positioned at any position on the antisense oligonucleotide.

[0256] In some embodiments, the conjugate moiety is selected from the group consisting of carbohydrates, cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins (e.g. bacterial toxins), vitamins, viral proteins (e.g. capsids) and combinations thereof.

[0257] MOE Gapmers

[0258] A MOE gapmers is a gapmer wherein regions F and F’ consist of MOE nucleosides. In some embodiments the MOE gapmer is of design [MOE]1-8-[Region G]5-16-[MOE]1-8, such as [MOE]2-7-[Region G]6-14-[MOE]2-7, such as [MOE]3-6-[Region G]8-12-[MOE]3-6, wherein region G is as defined in the Gapmer definition. MOE gapmers with a 5-10-5 design (MOE-DNA-MOE) have been widely used in the art.

[0259] Mixed Wing Gapmer

[0260] A mixed wing gapmer is an LNA gapmer wherein one or both of region F and F’ comprise a 2’ substituted nucleoside, such as a 2’ substituted nucleoside independently selected from the group consisting of 2’-O-alkyl-RNA units, 2’-O-methyl-RNA, 2’-O-ethyl-RNA (cEt), 2’-amino-DNA units, 2’-fluoro-DNA units, 2’ -alkoxy -RNA, MOE units, arabino nucleic acid (ANA) units and 2’-fluoro-ANA units, such as a MOE nucleoside. In some embodiments wherein at least one of region F and F’, or both region F and F’ comprise at least one LNA nucleoside, the remaining nucleosides of region F and F’ are independently selected from the group consisting of MOE and LNA. In some embodiments wherein at least one of region F and F’, or both region F and F’ comprise at least two LNA nucleosides, the remaining nucleosides of region F and F’ are independently selected from the group consisting of MOE and LNA. In some mixed wing embodiments, one or both of region F and F’ may further comprise one or more DNA nucleosides.

[0261] Alternating Flank Gapmers Docket No. P39006

[0262] Flanking regions may comprise both LNA and DNA nucleoside and are referred to as "alternating flanks" as they comprise an alternating motif of LNA-DNA-LNA nucleosides. Gapmers comprising such alternating flanks are referred to as "alternating flank gapmers". " Alternative flank gapmers" are thus LNA gapmer oligonucleotides where at least one of the flanks (F or F’) comprises DNA in addition to the LNA nucleoside(s). In some embodiments at least one of region F or F’, or both region F and F’, comprise both LNA nucleosides and DNA nucleosides. In such embodiments, the flanking region F or F’, or both F and F’ comprise at least three nucleosides, wherein the 5’ and 3’ most nucleosides of the F and / or F’ region are LNA nucleosides.

[0263] Region D’ or D” in an oligonucleotide

[0264] The oligonucleotide of the invention may in some embodiments comprise or consist of the contiguous nucleotide sequence of the oligonucleotide which is complementary to the target nucleic acid, such as a gapmer region F-G-F’, and further 5’ and / or 3’ nucleosides. The further 5’ and / or 3’ nucleosides may or may not be fully complementary to the target nucleic acid. Such further 5’ and / or 3’ nucleosides may be referred to as region D’ and D” herein.

[0265] The addition of region D’ or D” may be used for the purpose of joining the contiguous nucleotide sequence, such as the gapmer, to a conjugate moiety or another functional group. When used for joining the contiguous nucleotide sequence with a conjugate moiety is can serve as a biocleavable linker. Alternatively, it may be used to provide exonucleoase protection or for ease of synthesis or manufacture.

[0266] Region D’ and D” can be attached to the 5’ end of region F or the 3’ end of region F’, respectively to generate designs of the following formulas D’ -F-G-F’, F-G-F’-D” or

[0267] D’-F-G-F’-D”. In this instance the F-G-F’ is the gapmer portion of the oligonucleotide and region D’ or D” constitute a separate part of the oligonucleotide.

[0268] Region D’ or D” may independently comprise or consist of 1, 2, 3, 4 or 5 additional nucleotides, which may be complementary or non-complementary to the target nucleic acid. The nucleotide adjacent to the F or F’ region is not a sugar -modified nucleotide, such as a DNA or RNA or base modified versions of these. The D’ or D’ region may serve as a nuclease susceptible biocleavable linker (see definition of linkers). In some embodiments the additional 5’ and / or 3’ end nucleotides are linked with phosphodiester linkages, and are DNA or RNA. Nucleotide based biocleavable linkers suitable for use as region D’ or D” are Docket No. P39006

[0269] disclosed in WO2014 / 076195, which include by way of example a phosphodiester linked DNA dinucleotide. The use of biocleavable linkers in poly -oligonucleotide constructs is disclosed in WO2015 / 113922, where they are used to link multiple antisense constructs (e.g. gapmer regions) within a single oligonucleotide.

[0270] In one embodiment the oligonucleotide of the invention comprises a region D’ and / or D” in addition to the contiguous nucleotide sequence which constitutes the gapmer.

[0271] In some embodiments, the oligonucleotide of the present invention can be represented by the following formulae:

[0272] F-G-F’; in particular F1-8-G5-16-F'1-8

[0273] D’-F-G-F’, in particular D’ I-3-FI-8-G5-16-F’2-8

[0274] F-G-F’-D”, in particular Fi-8-G5-i6-F’2-8-D” 1-3

[0275] D’-F-G-F’-D”, in particular D’1-3- Fi-8-G5-i6-F’2-8-D”i-3

[0276] In some embodiments the internucleoside linkage positioned between region D’ and region F is a phosphodiester linkage. In some embodiments the internucleoside linkage positioned between region F’ and region D” is a phosphodiester linkage.

[0277] Conjugate

[0278] The term conjugate as used herein refers to an oligonucleotide which is covalently linked to a non-nucleotide moiety (conjugate moiety or region C or third region). The conjugate moiety may be covalently linked to the antisense oligonucleotide, optionally via a linker group, such as region D’ or D”.

[0279] Oligonucleotide conjugates and their synthesis has also been reported in comprehensive reviews by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, S. T. Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103.

[0280] Is some embodiments the conjugate is [CONJUGATE], E.g. for GalNAc

[0281] In some embodiments, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of carbohydrates (e.g. GalNAc), cell surface receptor ligands, drug Docket No. P39006

[0282] substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins (e.g. bacterial toxins), vitamins, viral proteins (e.g. capsids) or combinations thereof.

[0283] Exemplary conjugate moieties include those capable of binding to the asialoglycoprotein receptor (ASGPR). In particular tri -valent N-acetylgalactosamine conjugate moieties are suitable for binding to the ASGPR, see for example WO 2014 / 076196, WO 2014 / 207232 and WO 2014 / 179620. Such conjugates serve to enhance uptake of the oligonucleotide to the liver.

[0284] In some embodiments, the conjugate is an antibody or an antibody fragment which has a specific affinity for a transferrin receptor, for example as disclosed in WO 2012 / 143379 herby incorporated by reference. In some embodiments the non-nucleotide moiety is an antibody or antibody fragment, such as an antibody or antibody fragment that facilitates delivery across the blood-brain-barrier, in particular an antibody or antibody fragment targeting the transferrin receptor.

[0285] Linkers

[0286] A linkage or linker is a connection between two atoms that links one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds. Conjugate moieties can be attached to the oligonucleotide directly or through a linking moiety (e.g. linker or tether). Linkers serve to covalently connect a third region, e.g. a conjugate moiety (Region C), to a first region, e.g. an oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A).

[0287] In some embodiments of the invention the conjugate or oligonucleotide conjugate of the invention may optionally, comprise a linker region (second region or region B and / or region Y) which is positioned between the oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A or first region) and the conjugate moiety (region C or third region).

[0288] Region B refers to biocleavable linkers comprising or consisting of a physiologically labile bond that is cleavable under conditions normally encountered or analogous to those encountered within a mammalian body. Conditions under which physiologically labile linkers undergo chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidative or reductive conditions or agents, and salt concentration found in or analogous to those encountered in mammalian cells. Mammalian intracellular conditions also include the presence of enzymatic activity normally present in a mammalian Docket No. P39006

[0289] cell such as from proteolytic enzymes or hydrolytic enzymes or nucleases. In one embodiment the biocleavable linker is susceptible to SI nuclease cleavage. In some embodiments the nuclease susceptible linker comprises between 1 and 5 nucleosides, such as DNA nucleoside(s) comprising at least two consecutive phosphodiester linkages,.

[0290] Phosphodiester containing biocleavable linkers are described in more detail in WO 2014 / 076195.

[0291] Region Y refers to linkers that are not necessarily biocleavable but primarily serve to covalently connect a conjugate moiety (region C or third region), to an oligonucleotide (region A or first region). The region Y linkers may comprise a chain structure or an oligomer of repeating units such as ethylene glycol, amino acid units or amino alkyl groups The oligonucleotide conjugates of the present invention can be constructed of the following regional elements A-C, A-B-C, A-B-Y-C, A-Y-B-C or A-Y-C. In some embodiments the linker (region Y) is an amino alkyl, such as a C2 - C36 amino alkyl group, including, for example C6 to C12 amino alkyl groups. In some embodiments the linker (region Y) is a C6 amino alkyl group.

[0292] Treatment

[0293] The term “treatment” as used herein refers to both treatment of an existing disease (e.g. a disease or disorder as herein referred to), or prevention of a disease, i.e. prophylaxis. It will therefore be recognized that treatment as referred to herein may, in some embodiments, be prophylactic.

[0294] DETAILED DESCRIPTION OF THE INVENTION

[0295] The oligonucleotide of the invention is an antisense oligonucleotide which targets a sequence located 3' (downstream) of a cleavage and polyadenylation site on a pre-mRNA molecule.

[0296] In some embodiments the antisense oligonucleotide of the invention is capable of modulating the expression of a target gene by inhibiting or down -regulating it. Preferably, such modulation produces an inhibition of expression of at least 20% compared to the uninhibited expression level of the target, more preferably at least 30%, at least 40%, at least 50% inhibition compared to the uninhibited expression level of the target. Suitably, the Examples provide assays which may be used to measure target RNA or protein inhibition. The target modulation is triggered by the hybridization between a contiguous nucleotide sequence of the oligonucleotide and the target nucleic acid. In some Docket No. P39006

[0297] embodiments the oligonucleotide of the invention comprises mismatches between the oligonucleotide and the target nucleic acid. Despite mismatches hybridization to the target nucleic acid may still be sufficient to show a desired modulation of target gene expression. Reduced binding affinity resulting from mismatches may advantageously be compensated by increased number of nucleotides in the oligonucleotide and / or an increased number of modified nucleosides capable of increasing the binding affinity to the target, such as 2’ sugar modified nucleosides, including LNA, present within the oligonucleotide sequence.

[0298] An aspect of the present invention relates to an antisense oligonucleotide of 10 to 30 nucleotides in length, wherein the oligonucleotide is capable of modulating the expression of a target gene, wherein the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity, such as 100% complementarity, to a target sequence located downstream of a cleavage and polyadenylation site.

[0299] In some embodiments, the antisense oligonucleotide comprises a contiguous sequence of 10 to 30 nucleotides in length, which is at least 90% complementary, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or 100% complementary with a region of the target nucleic acid or a target sequence.

[0300] It is advantageous if the antisense oligonucleotide of the invention, or contiguous nucleotide sequence thereof is fully complementary (100% complementary) to a region located downstream of a cleavage and polyadenylation site of the target nucleic acid, or in some embodiments may comprise one or two mismatches between the oligonucleotide and the target nucleic acid.

[0301] In some embodiments the antisense oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementary, such as fully (or 100%) complementary, to a region located downstream of a cleavage and polyadenylation site.

[0302] In some embodiments the sequence of nucleobases of the antisense oligonucleotide sequence is 100% complementary to a region located downstream of a cleavage and polyadenylation site.

[0303] In some embodiments, the antisense oligonucleotide of the invention or contiguous nucleotide sequence thereof, comprises or consists of 10 to 30 nucleotides in length, such as Docket No. P39006

[0304] from 12 to 25, such as 11 to 22, such as from 12 to 20, such as from 14 to 18 or 14 to 16 contiguous nucleotides in length.

[0305] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 22 or less nucleotides, such as 20 or less nucleotides, such as 18 or less nucleotides, such as 14, 15, 16 or 17 nucleotides. It is to be understood that any range given herein includes the range endpoints. Accordingly, if an oligonucleotide is said to include from 10 to 30 nucleotides, both 10 and 30 nucleotides are included.

[0306] In some embodiments, the contiguous nucleotide sequence comprises or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleotides in length.

[0307] In advantageous embodiments, the antisense oligonucleotide comprises one or more sugar modified nucleosides, such as one or more 2’ sugar modified nucleosides, such as one or more 2’ sugar modified nucleoside independently selected from the group consisting of 2’-O-alkyl-RNA, 2’-O-methyl-RNA, 2’-O-ethyl-RNA (cEt), 2’-alkoxy-RNA, 2’-O-methoxyethyl-RNA, 2’-amino-DNA, 2’-fluoro-DNA, arabino nucleic acid (ANA), 2’-fluoro-ANA and LNA nucleosides. It is advantageous if one or more of the modified nucleoside(s) is a locked nucleic acid (LNA).

[0308] In some embodiments the contiguous nucleotide sequence comprises LNA nucleosides.

[0309] In some embodiments the contiguous nucleotide sequence comprises LNA nucleosides and DNA nucleosides.

[0310] In some embodiments the contiguous nucleotide sequence comprises 2’-O-methoxyethyl (2’MOE) nucleosides.

[0311] In some embodiments the contiguous nucleotide sequence comprises 2’-O-methoxy ethyl (2’MOE) nucleosides and DNA nucleosides.

[0312] Advantageously, the 3’ most nucleoside of the antisense oligonucleotide, or contiguous nucleotide sequence thereof is a 2’ sugar modified nucleoside.

[0313] Advantageously, the oligonucleotide comprises at least one modified internucleoside linkage, such as phosphorothioate or phosphorodithioate. Docket No. P39006

[0314] In some embodiments at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphorothioate internucleoside linkages.

[0315] In some embodiments at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphorodithioate internucleoside linkages.

[0316] In some embodiments at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphodiester internucleoside linkages.

[0317] In some embodiments all the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

[0318] In some embodiments at least 75% the internucleoside linkages within the antisense oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate internucleoside linkages.

[0319] In some embodiments all the internucleoside linkages within the antisense oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate internucleoside linkages.

[0320] In an advantageous embodiment of the invention the oligonucleotide of the invention is capable of recruiting RNase H, such as RNAasHl. In some embodiments the antisense oligonucleotide of the invention, or the contiguous nucleotide sequence thereof is a gapmer.

[0321] In some embodiments the antisense oligonucleotide, or contiguous nucleotide sequence thereof, consists or comprises a gapmer of formula 5’-F-G-F’-3’.

[0322] In some embodiments region G consists of 6 - 16 DNA nucleosides.

[0323] In some embodiments region F and F’ each comprise at least one LNA nucleoside.

[0324] PHARMACEUTICALLY ACCEPTABLE SALTS

[0325] In a further aspect the invention provides a pharmaceutically acceptable salt of the antisense oligonucleotide or a conjugate thereof, such as a pharmaceutically acceptable sodium salt, ammonium salt or potassium salt.

[0326] METHOD OF MANUFACTURE Docket No. P39006

[0327] In a further aspect, the invention provides methods for manufacturing the antisense oligonucleotide of the invention comprising reacting nucleotide units and thereby forming covalently linked contiguous nucleotide units comprised in the oligonucleotide. Preferably, the method uses phosphoramidite chemistry (see for example Caruthers et al, 1987, Methods in Enzymology vol. 154, pages 287-313). In a further embodiment the method further comprises reacting the contiguous nucleotide sequence with a conjugating moiety (ligand) to covalently attach the conjugate moiety to the antisense oligonucleotide. In a further aspect a method is provided for manufacturing the composition of the invention, comprising mixing the antisense oligonucleotide or conjugated antisense oligonucleotide of the invention with a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0328] PHARMACEUTICAL COMPOSITION

[0329] In a further aspect, the invention provides pharmaceutical compositions comprising any of the aforementioned antisense oligonucleotides and / or antisense oligonucleotides conjugates or salts thereof and a pharmaceutically acceptable diluent, carrier, salt and / or adjuvant. A pharmaceutically acceptable diluent includes phosphate -buffered saline (PBS) and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments the pharmaceutically acceptable diluent is sterile phosphate buffered saline. In some embodiments the oligonucleotide is used in the pharmaceutically acceptable diluent at a concentration of 50 - 300pM solution.

[0330] In some embodiments, the antisense oligonucleotide of the invention, or pharmaceutically acceptable salt thereof is in a solid form, such as a powder, such as a lyophilized powder.

[0331] APPLICATIONS

[0332] The antisense oligonucleotide of the invention may be utilized as research reagents for, for example, diagnostics, therapeutics and prophylaxis.

[0333] In research, such oligonucleotides may be used to specifically modulate the synthesis of a target protein in cells (e.g. in vitro cell cultures) and experimental animals thereby facilitating functional analysis of the target or an appraisal of its usefulness as a target for therapeutic intervention. Docket No. P39006

[0334] If employing the antisense oligonucleotide of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.

[0335] The present invention provides an in vivo or in vitro method for modulating target gene expression in a target cell which is expressing the target gene, said method comprising administering an antisense oligonucleotide or conjugate of the invention in an effective amount to said cell.

[0336] In some embodiments, the target cell, is a mammalian cell in particular a human cell. The target cell may be an in vitro cell culture or an in vivo cell forming part of a tissue in a mammal.

[0337] The invention provides an in vivo or in vitro method for modulating target gene expression in a target cell which is expressing the target gene, said method comprising administering an antisense oligonucleotide or the conjugate or the pharmaceutical composition of the invention in an effective amount to said cell.

[0338] The invention provides a method for treating or preventing a disease comprising administering a therapeutically or prophylactically effective amount of an antisense oligonucleotide, or the conjugate or the pharmaceutical composition, of the invention, to a subject suffering from or susceptible to the disease, wherein a patient suffering from the disease is likely to benefit from reduction of expression of the target gene of the antisense oligonucleotide.

[0339] The invention provides for the antisense oligonucleotide or the conjugate or the pharmaceutical composition of the invention for use in medicine.

[0340] The invention provides for the antisense oligonucleotide or the conjugate or the pharmaceutical composition of the invention for use in the treatment or prevention of a disease, wherein a patient suffering from the disease is likely to benefit from reduction of expression of the target gene of the antisense oligonucleotide.

[0341] The invention provides for the use of the oligonucleotide, the conjugate, or the pharmaceutical composition, of the invention, for the preparation of a medicament for treatment or prevention of a disease, wherein a patient suffering from the disease is likely to benefit from reduction of expression of the target gene of the antisense oligonucleotide. Docket No. P39006

[0342] In some embodiments the disease is related to the expression of the target gene.

[0343] ADMINISTRA TION

[0344] The antisense oligonucleotide or pharmaceutical compositions of the present invention may be administered by any suitable method.

[0345] In some embodiments, the administration is parenteral administration, such as, intravenous, subcutaneous, or intra-muscular. In some embodiments the antisense oligonucleotide or conjugate is administered intravenously. In another embodiment the antisense oligonucleotide or conjugate is administered subcutaneously.

[0346] In some embodiments, the administration is via intracerebral administration. In some embodiments, the administration is via intracerebroventricular. In some embodiments, the administration is via intrathecal administration.

[0347] In some embodiments, the administration is an intravitreal injection.

[0348] In some embodiments, the antisense oligonucleotide, antisense oligonucleotide conjugate or pharmaceutical composition of the invention is administered at a dose of 0.1 -15 mg / kg, such as from 0.2 - 10 mg / kg, such as from 0.25 - 5 mg / kg. The administration can be once a week, every 2ndweek, every third week or even once a month.

[0349] The invention also provides for the use of the antisense oligonucleotide or antisense oligonucleotide conjugate of the invention as described for the manufacture of a medicament wherein the medicament is in a dosage form for subcutaneous administration.

[0350] The invention also provides for the use of the antisense oligonucleotide or antisense oligonucleotide conjugate of the invention as described for the manufacture of a medicament wherein the medicament is in a dosage form for intrathecal administration.

[0351] The invention also provides for the use of the antisense oligonucleotide or antisense oligonucleotide conjugate of the invention as described for the manufacture of a medicament wherein the medicament is in a dosage form for ophthalmic administration.

[0352] EMBODIMENTS

[0353] The following numbered clauses are embodiments of the present invention and may be used in combination with any other embodiments described herein. Docket No. P39006

[0354] 1. An antisense oligonucleotide of 10 to 30 nucleotides in length, wherein the antisense oligonucleotide is capable of modulating the expression of a target gene, wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity, such as 100% complementarity, to a target sequence located downstream of a cleavage and polyadenylation site.

[0355] 2. The antisense oligonucleotide of clause 1, wherein modulating the expression of a target gene is reducing the expression of the target gene.

[0356] 3. The antisense oligonucleotide of clause 1 or 2, wherein modulating the expression of a target gene is inhibiting the expression of the target gene.

[0357] 4. The antisense oligonucleotide of any one of clauses 1 to 3, wherein the cleavage and polyadenylation site is located on a pre-mRNA, wherein the pre-mRNA is a transcript of the target gene.

[0358] 5. The antisense oligonucleotide of any one of clauses 1 to 3, wherein the cleavage and polyadenylation site is located within the transcription unit of the target gene.

[0359] 6a. The antisense oligonucleotide of any one of clauses 1 to 5, wherein the target sequence is located between about 1 nucleotide and about 2000 nucleotides, between about 1 nucleotide and about 1000 nucleotides, between about 1 nucleotide and about 500 nucleotides, between about 1 nucleotide and about 400 nucleotides, between about 1 nucleotide and about 300 nucleotides, between about 1 nucleotide and about 200 nucleotides, between about 1 nucleotide and about 100 nucleotides, between about 1 nucleotide and about 50 nucleotides downstream of the cleavage and polyadenylation site.

[0360] 6b. The antisense oligonucleotide of any one of clauses 1 to 5, wherein the target sequence is located between about 5 nucleotide and about 2000 nucleotides, between about 5 nucleotide and about 1000 nucleotides, between about 5 nucleotide and about 500 nucleotides, between about 5 nucleotide and about 400 nucleotides, between about 5 nucleotide and about 300 nucleotides, between about 5 nucleotide and about 200 nucleotides, between about 5 nucleotide and about 100 nucleotides, between about 5 nucleotide and about 50 nucleotides downstream of the cleavage and polyadenylation site.

[0361] 6c. The antisense oligonucleotide of any one of clauses 1 to 5, wherein the target sequence is located between about 10 nucleotide and about 2000 nucleotides, between about 10 nucleotide and about 1000 nucleotides, between about 10 nucleotide and about 500 Docket No. P39006

[0362] nucleotides, between about 10 nucleotide and about 400 nucleotides, between about 10 nucleotide and about 300 nucleotides, between about 10 nucleotide and about 200 nucleotides, between about 10 nucleotide and about 100 nucleotides, between about 10 nucleotide and about 50 nucleotides downstream of the cleavage and polyadenylation site.

[0363] 6d. The antisense oligonucleotide of any one of clauses 1 to 5, wherein the target sequence is located between about 50 nucleotide and about 2000 nucleotides, between about 50 nucleotide and about 1000 nucleotides, between about 50 nucleotide and about 500 nucleotides, between about 50 nucleotide and about 400 nucleotides, between about 50 nucleotide and about 300 nucleotides, between about 50 nucleotide and about 200 nucleotides, between about 50 nucleotide and about 100 nucleotides downstream of the cleavage and polyadenylation site.

[0364] 6e. The antisense oligonucleotide of any one of clauses 1 to 5, wherein the target sequence is located between about 100 nucleotide and about 2000 nucleotides, between about 100 nucleotide and about 1000 nucleotides, between about 100 nucleotide and about 500 nucleotides, between about 100 nucleotide and about 400 nucleotides, between about 100 nucleotide and about 300 nucleotides, between about 100 nucleotide and about 200 nucleotides downstream of the cleavage and polyadenylation site.

[0365] 6f. The antisense oligonucleotide of any one of clauses 1 to 5, wherein the target sequence is located between about 200 nucleotide and about 2000 nucleotides, between about 200 nucleotide and about 1000 nucleotides, between about 200 nucleotide and about 500 nucleotides downstream of the cleavage and polyadenylation site.

[0366] 7. The antisense oligonucleotide of any one of clauses 1 to 6, wherein the contiguous nucleotide sequence comprises at least one mismatch as compared to the target site sequence.

[0367] 8. The antisense oligonucleotide of clause 7, wherein the mismatch is located at the terminal position of the antisense oligonucleotide-mRNA duplex.

[0368] 9. The antisense oligonucleotide of any one of clauses 1 to 8, wherein one or more nucleoside in the contiguous nucleotide sequence is a 2’ sugar modified nucleoside.

[0369] 10. The antisense oligonucleotide of clause 9, wherein the one or more 2’ sugar modified nucleoside is independently selected from the group consisting of 2’ -O-alkyl-RNA, 2’-O-methyl-RNA, 2’-O-ethyl-RNA, 2’ -alkoxy -RN A, 2’ -O-m ethoxy ethyl-RNA, 2’- Docket No. P39006

[0370] amino-DNA, 2’-fluoro-DNA, arabino nucleic acid (ANA), 2’ -fluoro- ANA and LNA nucleosides.

[0371] 11. The antisense oligonucleotide of clause 10, wherein one or more of the modified nucleoside is a LNA nucleoside.

[0372] 12. The antisense oligonucleotide of any one of clauses 1 to 11, wherein at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphorothioate internucleoside linkages.

[0373] 13. The antisense oligonucleotide of any one of clauses 1 to 12, wherein at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphorodithioate internucleoside linkages.

[0374] 14. The antisense oligonucleotide of any one of clauses 1 to 13, wherein at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphodiester internucleoside linkages.

[0375] 15. The antisense oligonucleotide of clause 12, wherein all the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

[0376] 16. The antisense oligonucleotide of any one of clauses 1 to 15, which is capable of recruiting RNase H, such as RNaseHl.

[0377] 17. The antisense oligonucleotide according to any one of clauses 1 to 16, which is a gapmer.

[0378] 18. The antisense oligonucleotide of clause 17, wherein the gapmer has the formula 5’-F-G-F’-3’.

[0379] 19. The antisense oligonucleotide according to clause 18, wherein region G consists of 6 - 16 DNA nucleosides.

[0380] 20. The antisense oligonucleotide of any one of clauses 1 to 19 which is capable of recruiting RNase H.

[0381] 21. The antisense oligonucleotide of any one of clauses 4 to 20, wherein the target sequence is not a U / GU-rich downstream sequence element (DSE) involved in 3' end processing of the pre-mRNA. Docket No. P39006

[0382] 22. A conjugate comprising the antisense oligonucleotide according to any one of clauses 1 to 21, and at least one conjugate moiety covalently attached to said antisense oligonucleotide.

[0383] 23. A pharmaceutically acceptable salt of the antisense oligonucleotide according to any one of clauses 1 to 21, or the conjugate according to clause 22.

[0384] 24. A pharmaceutical composition comprising the antisense oligonucleotide any one of clauses 1 to 21, the conjugate of clause 22, or the pharmaceutically acceptable salt of clause 23, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0385] 25. An in vivo or in vitro method for modulating the expression of a target gene in a target cell which is expressing the target gene, said method comprising administering an antisense oligonucleotide of any one of clauses 1 to 21, or the conjugate of clause 22, or the pharmaceutical composition of clause 24 in an effective amount to said cell.

[0386] 26. The antisense oligonucleotide of any one of clauses 1 to 19, or the conjugate according to clause 20, or the pharmaceutical composition of clause 22 for use in medicine.

[0387] Another set of following numbered clauses that are embodiments of the present invention and may be used in combination with any other embodiments described herein is as follows.

[0388] Al. An antisense oligonucleotide of 10 to 30 nucleotides in length, wherein the antisense oligonucleotide is capable of modulating the expression of a target gene, wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity, such as 100% complementarity, to a target sequence located downstream of a cleavage and polyadenylation site.

[0389] A2. The antisense oligonucleotide of clause Al, wherein the cleavage and polyadenylation site is located on a pre-mRNA, wherein the pre-mRNA is a transcript of the target gene.

[0390] A3. The antisense oligonucleotide of clause Al or A2, wherein the cleavage and polyadenylation site is located within the transcription unit of the target gene.

[0391] A4. The antisense oligonucleotide of any one of clauses Al to A3, wherein the target sequence is located between about 1 nucleotide and about 2000 nucleotides, between about 1 nucleotide and about 1000 nucleotides, between about 1 nucleotide and about 500 Docket No. P39006

[0392] nucleotides, between about 1 nucleotide and about 400 nucleotides, between about 1 nucleotide and about 300 nucleotides, between about 1 nucleotide and about 200 nucleotides, between about 1 nucleotide and about 100 nucleotides, between about 1 nucleotide and about 50 nucleotides downstream of the cleavage and polyadenylation site.

[0393] A5. The antisense oligonucleotide of any one of clauses Al to A4, wherein one or more nucleoside in the contiguous nucleotide sequence is a 2’ sugar modified nucleoside.

[0394] A6. The antisense oligonucleotide of clause A5, wherein the one or more 2’ sugar modified nucleoside is independently selected from the group consisting of 2’ -O-alkyl-RNA, 2’-O-methyl-RNA, 2’-O-ethyl-RNA, 2’ -alkoxy -RN A, 2’ -O-m ethoxy ethyl-RNA, 2’-amino-DNA, 2’-fluoro-DNA, arabino nucleic acid (ANA), 2 ’-fluoro- ANA and LNA nucleosides.

[0395] A7. The antisense oligonucleotide of any one of clauses Al to A6, which is capable of recruiting RNase H, such as RNaseHl.

[0396] A8. The antisense oligonucleotide according any one of clauses Al to A7, which is a gapmer.

[0397] A9. The antisense oligonucleotide of clause A8, wherein the gapmer has the formula 5’-F-G-F’-3’.

[0398] A10. The antisense oligonucleotide according to clause A9, wherein region G consists of 6 - 16 DNA nucleosides.

[0399] All. A conjugate comprising the antisense oligonucleotide according to any one of clauses Al to A10, and at least one conjugate moiety covalently attached to said antisense oligonucleotide.

[0400] A12. A pharmaceutically acceptable salt of the antisense oligonucleotide according to any one of clauses Al to A10, or the conjugate according to clause All.

[0401] A13. A pharmaceutical composition comprising the antisense oligonucleotide any one of clauses Al to A10, the conjugate of clause All, or the pharmaceutically acceptable salt of clause A12, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant. Docket No. P39006

[0402] A14. An in vivo or in vitro method for modulating the expression of a target gene in a target cell which is expressing the target gene, said method comprising administering an antisense oligonucleotide of any one of clauses Al to A10, or the conjugate of clause All, or the pharmaceutical composition of clause A12 in an effective amount to said cell.

[0403] A15. The antisense oligonucleotide of any one of clauses Al to A10, or the conjugate according to clause All, or the pharmaceutical composition of clause A12 for use in medicine.

[0404] EXAMPLES

[0405] EXAMPLE 1: CHARGED MULTIVESICULAR BODY PROTEIN 1A (CHMP1A)

[0406] 1,1 RNA-Seq Experiment

[0407] We have performed an RNA-Seq analysis of THP1 cells treated with an antisense oligonucleotide (ASO) CP04358, which is perfectly reverse complementary to a region of HIF1 A gene, and has a previously described knock down effect on the HIF1A gene. We have also included three other ASOs of the same expected target sequence as CP04358 but with a different modification pattern (Table 5). In that experiment we were able to confirm the effect of all those tested compounds (but not of negative control ASOs) on the intended target (HIF1A) and we have noticed a consistent knockdown of a gene CHMP1A (Table 6), which in the used gene annotation (see Example) does not harbor any region with even a partial reverse complementarity to the base sequence of the tested ASOs (calculated up to Levenshtein distance 2). We have noticed that downstream of the annotated CHMP1A gene there is a nucleotide sequence which is partially reverse complementary to the used ASOs, with a mismatch at the terminus of the ASO-RNA duplex. It has been previously described that a mismatch at the terminal position oftentimes doesn’t preclude gapmer induced expression level reduction (Watt AT, Swayze G, Swayze EE, Freier SM. Likelihood of Nonspecific Activity of Gapmer Antisense Oligonucleotides Is Associated with Relative Hybridization Free Energy. Nucleic Acid Ther. 2020 Aug;30(4):215-228). We have confirmed that this terminal mismatch doesn’t interfere with gapmer activity of CP04358 and other tested ASOs by performing an experiment which tested mutated target sites Docket No. P39006

[0408] against tested gapmers, and it indeed confirmed that the plausible target site located downstream of CHMP1 A target site supports gapmer activity at the comparable level as a perfectly complementary sequence (see Example).

[0409] We speculated that the CHMP1A 3’end may be incorrectly annotated and that the discovered CP04358 target site downstream of the annotated polyadenylation site may actually be part of the 3’UTR. To respond to that concern we have analyzed read depth coverage of the RNA-Seq data used in the above described experiment, and we have confirmed that the plausible hybridization site of the ASO is indeed located downstream of the 3’ terminus (Figure 1). Taken together, we have described reduction of a CHMP1A gene expression level mediated by a target site which is not perfectly complementary but can support RNase H mediated cleavage and is located downstream of the CHMP1A gene (CHMP1A gene in hg38 reference gene is annotated on the negative strand with coordinates chrl6:89644435-89657721, and the plausible target site mediating it’s knockdown is annotated on the same strand with coordinates chrl6:89644187-89644198, which is over 236 nucleotides away).

[0410] We have systematically explored use of gapmers targeting downstream of the annotated gene region to reduce expression level of CFB gene (see Example). Using published dataset we have confirmed that the annotated 3’ end of CFB gene is the same as expressed in A431 cells (Figure 2) and we have tested over 180 compounds targeted downstream of the annotated gene on their ability to reduce CFB level. To our surprise the negative control ASO induced approximately 40% reduction of the CFB level, showing that in the tested model CFB level can be unspecifically affected by ASO treatment. However, compounds CP042502 and CP042505 induced substantially more efficient target knockdown than the negative control ASO, supporting the notion that this reduction is indeed facilitated by the interaction of the ASOs with the RNA synthesized downstream of the CFB polyadenylation site.

[0411] 1.2 Antisense oligonucleotides (ASOs)

[0412] Structures of tested RNase H recruiting antisense oligonucleotides are displayed in the Table 5. Compound “NT ASO” has been previously identified as a negative control ASO and published in Peter H. Hagedorn, Jeffrey M. Brown, Amy Easton, Maria Pierdomenico, Kelli Jones, Richard E. Olson, Stephen E. Mercer, Dong Li, James Loy, Anja M. Hog, Marianne L. Jensen, Martin Gill, and Angela M. Cacace. “Acute Neurotoxicity of Docket No. P39006

[0413] Antisense Oligonucleotides After Intracerebroventricular Injection Into Mouse Brain Can Be Predicted from Sequence Features.” Nucleic Acid Therapeutics. Jun 2022. 151-162.

[0414] Compound CP04358 has a perfect match in HIF1A gene and has been previously described in a patent application W02019 / 073018A1. Compounds CP04358_m8, CP04358_m9, CP04358_ml0 were designed to bind to the same target site as CP04358, however they harbor additional 2’ -methoxy modifications.

[0415] Table 5 Structures of the antisense oligonucleotides

[0416] ASO Also BASE SUGAR SEQ ID referred NO to herein

[0417] as

[0418] CP022946 NT_ASO ECAAATCTTATAATAAE LDLLLDDDDDDDDDDLL 1

[0419] TAE DLL

[0420] CP04358 CP04358 GEAAGCATCCTGT LLDDDDDDDDDLL 2

[0421] CP0134433 CP04358_ GEAAGCAUCCTGT LLDDDDDODDDLL 3 m8

[0422] CP0134434 CP04358_ GEAAGCATCCTGT LLDDDDDDODDLL 4 m9

[0423] CP0134435 CP04358_ GEAAGCATCCTGT LLDDDDDDDODLL 5 mlO

[0424]

[0425] All backbones are fully phosphorothioated. E in the BASE sequence corresponds to 5-methyl-cytosines (5meC). L in the Sugar sequence corresponds to LNA. D in the sugar sequence corresponds to DNA.

[0426] 1.3 Cell treatment and RNA isolation Docket No. P39006

[0427] The human cell line THP-1 was purchased from ECACC (catalog no.: 88081201), maintained as recommended by the supplier in a humidified incubator at 37°C with 5% CO2. For the screening assays, cells were seeded in round bottom 96 multi well plates in media recommended by the supplier (RPMI 1640, 10% FBS, 25 pg / mL gentamicin). The number of cells / well was optimized to 50’000 cells per well. Two pL of 500 mM ASO (dissolved in PBS; or just PBS as a negative control) was added to the cells to achieve a final concentration of 5 pM. Seven days after addition of the ASO, the cells were harvested by 5min centrifuge at 150g, medium removal and addition of 100 pL MagNAPure lysis buffer (Roche) to each well. Each treatment was replicated in four wells and the lysates from identical treatments were pooled for RNA purification. RNA was isolated from the lysates using the MagNAPure 96 system (Roche) according to the manufacturer's protocol. The RNA integrity was assayed using TapeStation High Sensitivity RNA Screen Tape (Agilent). All of the RINe values were above 8. PBS treatment was performed in six replicates, ASO treatment was performed in duplicates.

[0428] 1.4 Sequencing library preparation

[0429] Sequencing libraries were prepared using KAPA mRNA HyperPrep Kit (Roche) according to manufacturer’s instructions. Samples were sequenced on NextSeq 550 (Illumina) using 75bp single-end high yield sequencing kit (two sequencing runs, pooled).

[0430] 1.5 Sequencing results analysis

[0431] Reads from the FASTQ files were mapped to the reference human genome (hg38) using HISAT2 with settings specifying that reads are unpaired, and that they map to the reverse strand. Only mapped sequences with MAPQ greater than 10 were considered for further analysis. Mapped reads were assigned to genes using Rsubread R package and human Ensembl gene annotation version 99, with settings “isPairedEnd = FALSE, strandSpecific = 2, juncCounts = TRUE, allowMultiOverlap = TRUE”. Number of counts for HIF1A gene (Ensembl: ENSG00000100644.17; chromosomal position of the gene is chrl4:61695513-61748259) and CHMP1A (Ensembl: ENSG00000131165.15; chromosomal position of the gene is chrl6:89644435-89657721) in each sample were divided by the total number of mapped reads in a given sample (“Normalized expression level”). Afterwards, normalized expression levels for those two genes for each sample were divided by a median normalized expression levels of those genes in PBS treated samples to produce “Relative expression levels” shown in Table 6. The results indicate that HIF1 A and CHMP1A genes are affected by the tested ASOs in a very similar manner. This is counterintuitive, as HIF1 A Docket No. P39006

[0432] harbors a perfect target site in its gene body (chromosomal position of the perfect match is chrl4:61734171-61734183), however CHMP1 A gene doesn’t harbor a target sites for the tested compounds, even when allowing for the edit distance of two (insertions, deletions, or mismatches) between the reverse complement of the ASO base sequence and CHMP1A gene sequence. Surprisingly, we have identified a sequence with a partial (one mismatch) reverse complementary match to the base sequences of the tested ASOs outside of the annotated CHMP1A gene region. The chromosomal position of the putative match is chrl6:89644187-89644198, hence it is separated from the CHMP1A 3’ terminus by 237 nucleotides.

[0433] Table 6. Relative expression levels of selected genes upon ASO treatment

[0434] ASO HIF1A (%) CHMP1A (%)

[0435] PBS 101 94

[0436] PBS 94 102

[0437] PBS 99 105

[0438] PBS 98 97

[0439] PBS 103 103

[0440] PBS 102 98

[0441] NT_ASO 99 97

[0442] NT_ASO 95 93

[0443] CP04358 48 52

[0444] CP04358 53 53

[0445] CP04358_m8 47 50

[0446]

[0447] Docket No. P39006

[0448] CP04358_m8 46 44

[0449] CP04358_m9 39 48

[0450] CP04358_m9 38 39

[0451] CP04358_ml0 65 79

[0452] CP04358_ml0 73 71

[0453]

[0454] 1.6 Confirmation of the CHMP1A 3’terminus

[0455] We hypothesized that the 3’ terminus of CHMP1A is incorrectly annotated, and that the mismatched ASO target site is part of the expressed sequence. To test that, we combined all the BAM files from PBS treated samples from HISAT2 mapping (from the above -described experiment) and looked at the read-depth coverage calculated by IGV (Integrative Genomics Viewer) shown on Figure 1. To our surprise, the read depth coverage is consistent with the gene annotation, and the 1 -mismatch off-target site (shown in the “CP04358.bed” track) is clearly positioned downstream from CHMP1A 3’ terminus (CHMP1A is expressed from the hg38 negative strand).

[0456] 1.7 Confirmation that the mismatch doesn’t interfere with antisense activity

[0457] CP04358, CP04358_m8, CP04358_m9, CP04358_ml0 are reverse complementary, and are expected to bind and cleave most effectively to RNA molecules harboring sequence “ACAGGAUGCUUGC”. However, the sequence of a putative 1 -mismatch target site identified outside of CHMP1A is “GCAGGAUGCUUGC”. To confirm that the target sequence with one mismatch at a terminal position can still support RNase H-mediated RNA degradation we have employed a method we call “Target Variant Sequencing”. In this experiment we have tested compounds of identical chemical structure as CP04358, CP04358_m8, CP04358_m9, CP04358_ml0 except with all the cytosines replaced with 5-methyl-cytosines, named 5meC-CP04358, 5meC-CP04358_m8, 5meC-CP04358_m9, 5meC-CP04358_ml0, respectively.

[0458] Experimental steps employed: Docket No. P39006

[0459] 1. We have prepared a plasmid pool based on pcDNA3.1+, in which between restriction sites BamHI and EcoRI we have cloned sequence of EGFP gene followed by first 50 nucleotides of human ACTB 3’ UTR.

[0460] 2. To a plasmid from point 1. we have cloned, via Notl and Xbal, a pooled library of several hundred different DNA fragments, among which was a sequence containing a subsequence with a perfect complementarity to CP04358 (pm=“GTTCAGAGTTCTACAGTCCGACGATCCCACAGGACAGTACAGGATGCTTGC CAAAAGAGGTGGTGGAATTCTCGGGTGCCAAGG”) as well as a sequence containing a subsequence corresponding to the mismatched target site (mml=“GTTCAGAGTTCTACAGTCCGACGATCCCACAGGACAGTGCAGGATGCTTG CCAAAAGAGGTGGTGGAATTCTCGGGTGCCAAGG”), as well as an unrelated sequence (ur=“GTTCAGAGTTCTACAGTCCGACGATCGTGTCATCACACTGAATACCAATGCT GAACTTTTTAATGGAATTCTCGGGTGCCAAGG”)

[0461] 3. Pool of plasmids was transfected into SK-N-AS cells.

[0462] 4. On the next day, the transfection was microscopically confirmed (EGFP fluorescence), and cells were seeded in 48 well plate. (75000 cells / well)

[0463] 5. After a couple of hours, after cells adhered to the bottom of the wells, antisense oligonucleotides were added to the media to a final concentration of 1 pM or lOpM.

[0464] 6. After 48 hours, cells were lysed and RNA purified using MagNA Pure system (Roche), which includes DNase treatment

[0465] 7. RNA was transferred to 96-well plates, heated to 90°C for 1 min and placed on ice

[0466] 8. RT-PCR was performed with SuperScript™ IV One-Step RT-PCR System (Invitrogen, cat. 12595100). Specifically, master mix was prepared by mixing 100 volumes of 2x Platinum SuperFi RT-PCR Master Mix, 1 volume of 100 pM RP1 primer (sequence: AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA), 2 volumes of SuperScript IV RT Mix and 47 volumes of H2O. 15 pL of the master mix was distributed in each well of the new 96-well plate. To each well, different index primer was added (1 pL of 10 pM solution; sequence:

[0467] CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCCTTGGCACCCGAG Docket No. P39006

[0468] AATTCCA, where xxxxxx corresponds to a well -identifying index). Subsequently, to each well 4 pL of the purified RNA was added.

[0469] 9. RT-PCR plate was placed in a thermocycler and a following program was run: 55°C for 10 minutes; 98°C for 3 minutes; 18 cycles of (98°C for 30 sec; 60°C for 30 sec; 72°C for 30 sec); 72°C for 10 minutes; hold at 4°C

[0470] 10. Pooling: lOpL from each RT-PCR well was transferred to a tube containing 25 pL 500 pM EDTA. The pool was purified with two columns from Monarch® PCR & DNA Cleanup Kit (5 pg) (New England Biolabs), followed by purification with KAPA Pure Beads (Roche) using 25 pL of the eluent from the column purification and 45 pL beads. Final elution in 10 pL H2O.

[0471] 11. Purified RT-PCR product was quantified with Agilent D1000 ScreenTape, and mixed with PhiX Control at a 2:1 molar ratio. Subsequently it was sequenced on NextSeq550 instrument (Illumina) using paired end sequencing kit (2x 76 bp)

[0472] Data analysis steps:

[0473] FASTQ files (R1 = FASTQ file first in the pair, R2 = FASTQ file second in the pair) were trimmed with (cutadapt v 1.18) and the sequences of inserts were summarized with command line commands:

[0474] cutadapt -a TGGAATTCTCGGGTGCCAAGG -A GATCGTCGGACTGTAGAACTCTGAAC -m 36 -M 43 — trimmed-only — pair-filter=any -o Rl_trimmed.fastq.gz -p R2_trimmed. fastq. gz i"$index"_S"$index"_Rl_001. fastq. gz i " $index"_S " $index"_R2_001. fastq. gz

[0475] gzcat Rl_trimmed. fastq. gz| awk '(NR%4==2){print}' > Rl.txt

[0476] gzcat R2_trimmed. fastq. gz| awk '(NR%4==2){print}' | tr ACGT TGCA | rev > R2.txt

[0477] paste Rl.txt R2.txt | awk ' {if($ 1 ==$2)print($ 1 ) } ' | sort | uniq -c | awk 'BEGIN { OFS = "\t"}{print($2,$l)}' | sort > summarized / " $index"_counts. txt

[0478] 12. Counts of the inserts specified in point 2 were extracted from files with insert counts for both wells treated with ASOs of inserts as well as PBS treated. For each sample, the number of reads of ‘pm’ insert and number of reads of ‘mml’ insert were divided by number of reads of ‘ur’ insert to calculate pm normalized and mml normalized. Next, Docket No. P39006

[0479] median of pm normalzied and mml normalized values for PBS treated wells was calculated. Next pm normalized and mml normalized for each treated sample were divided by respective median of PBS samples to derive pm_remaining_% and mml_remaining_% (Table 7). The results demonstrate that tested compounds can efficiently cleave target site with a mismatch at position 1 of the same sequence as a sequence located downstream of CHMP1A 3’ terminus.

[0480] Table 7

[0481] Treatment Replicate pm_remaining_% mm1_remaining_%

[0482] 5meC-CP04358 10μM 1 25% 45%

[0483] 5meC-CP04358 10μM 2 22% 23%

[0484] 5meC-CP04358 1μM 1 42% 41%

[0485] 5meC-CP04358 1μM 2 44% 41%

[0486] 5meC-CP04358_m10 10μM 1 49% 42%

[0487] 5meC-CP04358_m10 10μM 2 44% 51%

[0488] 5meC-CP04358_m10 1μM 1 58% 68%

[0489] 5meC-CP04358_m10 1μM 2 72% 92%

[0490] 5meC-CP04358_m8 10μM 1 21% 32%

[0491] 5meC-CP04358_m8 10μM 2 27% 36%

[0492] 5meC-CP04358_m8 1μM 1 47% 54%

[0493] 5meC-CP04358_m8 1μM 2 43% 48%

[0494]

[0495] Docket No. P39006

[0496] 5meC-CP04358_m9 10μM 1 38% 49%

[0497] 5meC-CP04358_m9 10μM 2 33% 39%

[0498] 5meC-CP04358_m9 1μM 1 44% 58%

[0499] 5meC-CP04358_m9 1μM 2 43% 52%

[0500]

[0501] EXAMPLE 2: COMPLEMENT FACTOR B (CEB)

[0502] 2.1 Confirmation of CFB 3’ terminus in A431 cells

[0503] FASTQ files from a stranded RNA-Seq assay performed on untreated A431 cells were downloaded from Gene Expression Omnibus (Edgar R, Domrachev M, Lash AE. Gene Expression Omnibus: NCBI gene expression and hybridization array data repository Nucleic Acids Res. 2002 Jan l;30(l):207-10) from following accessions SRR18839666, SRR18839668, SRR18839670, SRR18839667, SRR18839669, SRR18839671. FASTQ files from those six accessions were concatenated and mapped to the reference human genome (hg38) using HISAT2 (version 2.2.1) with settings specifying that reads are unpaired, and that they map to the reverse strand. Only mapped sequences with MAPQ greater than 10 were considered for further analysis. Only mapped sequences with a flag equal to 16 (mapping to negative strand) were considered for further analysis. IGV (James T. Robinson, Helga Thorvaldsdottir, Wendy Winckler, Mitchell Guttman, Eric S. Lander, Gad Getz, Jill P. Mesirov. Integrative Genomics Viewer. Nature Biotechnology 29, 24-26 (2011)) was used to visualize the read depth coverage, as shown in Figure XYZ7. The read depth coverage indicates that the 3’ terminus of CFB gene utilized in A431 cells corresponds to the the 3’ terminus as annotated in the under RefSeq id NM 001710.6 (In hg38 human reference genome CFB is annotated on a positive strand of chromosome 6 and the 3’ terminus is located at position 31952084).

[0504] 2.2 In vitro screening of ASOs targeting Complement Factor B (CFB) downstream of the 3 ’ terminus of the gene

[0505] An oligonucleotide screen is performed in A431 Cell Line using the LNA oligonucleotides in Table 8 targeting SEQ ID NO: 190. The human cell line A431 is Docket No. P39006

[0506] maintained in a humidified incubator at 37° C with 5% CO2. For the screening assays, cells are seeded in 96 multi well plates in media recommended by the supplier (EMEM, 10% FBS, 2 mM Glutamine, 0.1 mM NEAA, 25 pg / ml Gentamicin), seeding 4000 cells per well. Cells are incubated between 0 and 24 hours before addition of the oligonucleotide in concentration of 5 μM (dissolved in PBS). Three days after addition of the oligonucleotide, the cells are harvested. RNA was extracted using the PureLink Pro 96 RNA Purification kit (Thermo Fisher Scientific) according to the manufacturer’s instructions and eluated in 50μL water. cDNA synthesis and qPCR is performed using qScript XLT one-step RT-qPCR ToughMix Low ROX, 95134-100 (Quanta Biosciences). Target transcript levels are quantified using FAM labeled TaqMan assays from Thermo Fisher Scientific in a multiplex reaction with a VIC labeled GUSB control. TaqMan primer assays for the target transcript of interest CFB is Hs00156060_ml (FAM-MGB probe, Life Technologies) and a reference gene GUSB is 4326320E (VIC-MGB probe, Life Technologies). The relative CFB mRNA expression levels are determined as % of control (PBS-treated cells) i.e. the lower the value the larger the inhibition. Results shown in Table 9.

[0507] Table 8: Structures of the ASOs

[0508] SEQ ID ASO BASE SUGAR NO

[0509] CP042384 AAAAGGATCTGGAACACAGG LLDDDDDDDDDDDDDDDLLL 6

[0510] CP042456 AAAAGGATCTGGAACACAGG LLLDDDDDDDDDDDDDDLLL 7

[0511] CP042385 AAAAGGATCTGGAACAEAG LLLLDDDDDDDDDDDDLLL 8

[0512] CP042386 EAAAAGGATCTGGAACAEAG LDDDDDDDDDDDDDDDLLLL 9

[0513] CP042457 AAAAGGATCTGGAACAEAG LLLLDDDDDDDDDDDLLLL 10

[0514] CP042458 EAAAAGGATCTGGAACAEAG LLLDDDDDDDDDDDDDDLLL 11

[0515] CP042507 EAAAAGGATCTGGAACAEAG LLLDDDDDDDDDDDDDLLLL 12

[0516] CP042387 AAAAGGATCTGGAAEAEA LLLLDDDDDDDDDDLLLL 13

[0517]

[0518] Docket No. P39006

[0519] CP042388 EAAAAGGATCTGGAACAEA LLLLDDDDDDDDDDDDLLL 14

[0520] CP042389 ECAAAAGGATCTGGAACAEA LDDDDDDDDDDDDDDDDDLL 15

[0521] CP042459 EAAAAGGATCTGGAAEAEA LLDDDDDDDDDDDDDLLLL 16

[0522] CP042460 ECAAAAGGATCTGGAACAEA LDDDDDDDDDDDDDDDDLLL 17

[0523] CP042508 EAAAAGGATCTGGAAEAEA LLLLDDDDDDDDDDDLLLL 18

[0524] CP042390 AAAAGGATCTGGAAEAE LLLLDDDDDDDDDLLLL 19

[0525] CP042391 EAAAAGGATCTGGAAEAE LLLLDDDDDDDDDDLLLL 20

[0526] CP042392 ECAAAAGGATCTGGAAEAE LDDDDDDDDDDDDDDLLLL 21

[0527] CP042393 ECCAAAAGGATCTGGAACAE LDDDDDDDDDDDDDDDDDLL 22

[0528] CP042461 EEAAAAGGATCTGGAACAE LLLLDDDDDDDDDDDDDLL 23

[0529] CP042394 EAAAAGGATCTGGAAEA LLLLDDDDDDDDDLLLL 24

[0530] CP042395 EEAAAAGGATCTGGAAEA LLDDDDDDDDDDDDDDLL 25

[0531] CP042396 ECCAAAAGGATCTGGAAEA LDDDDDDDDDDDDDDDDLL 26

[0532] CP042462 EEAAAAGGATCTGGAAEA LLLDDDDDDDDDDDDDLL 27

[0533] CP042463 ECCAAAAGGATCTGGAAEA LDDDDDDDDDDDDDDDLLL 28

[0534] CP042509 EEAAAAGGATCTGGAAEA LLLLDDDDDDDDDDDLLL 29

[0535] CP042510 ECCAAAAGGATCTGGAAEA LDDDDDDDDDDDDDDLLLL 30

[0536] CP042397 EEAAAAGGATCTGGAAE LLLLDDDDDDDDDDLLL 31

[0537]

[0538] Docket No. P39006

[0539] CP042398 EECAAAAGGATCTGGAAE LLDDDDDDDDDDDDDDLL 32

[0540] CP042464 EEAAAAGGATCTGGAAE LLLDDDDDDDDDDLLLL 33

[0541] CP042465 EECAAAAGGATCTGGAAE LLDDDDDDDDDDDDDLLL 34

[0542] CP042511 EEEAAAAGGATCTGGAAE LLLDDDDDDDDDDDDLLL 35

[0543] CP042399 ECCAAAAGGATCTGGAA LDDDDDDDDDDDDLLLL 36

[0544] CP042400 EECCAAAAGGATCTGGAA LLDDDDDDDDDDDDDDLL 37

[0545] CP042466 EEEAAAAGGATCTGGAA LLLDDDDDDDDDDDDLL 38

[0546] CP042512 EEEAAAAGGATCTGGAA LLLLDDDDDDDDDDDLL 39

[0547] CP042546 GCCCCAAAAGGATCTGGA LDDDDDDDDDDDDDDDLL 40

[0548] CP042547 ACTCCCTTGCCCCAAAAG LDDDDDDDDDDDDDDDLL 41

[0549] CP042548 TGTTCCCCACTCCCTTGE LDDDDDDDDDDDDDDDLL 42

[0550] CP042549 EAGTGCCTGTTCCCCAET LDDDDDDDDDDDDDDDLL 43

[0551] CP042550 AACATGGCCAGTGCCTGT LDDDDDDDDDDDDDDDLL 44

[0552] CP042401 GTAACAACATGGCCAGTG LDDDDDDDDDDDDDDDLL 45

[0553] CP042402 TGTAACAACATGGCCAGTG LDDDDDDDDDDDDDDDDLL 46

[0554] CP042467 GTAACAACATGGCCAGTG LDDDDDDDDDDDDDDLLL 47

[0555] CP042403 GTAACAACATGGCCAGT LDDDDDDDDDDDDDLLL 48

[0556] CP042404 TGTAACAACATGGCCAGT LDDDDDDDDDDDDDDDLL 49

[0557]

[0558] Docket No. P39006

[0559] CP042468 GTAACAACATGGCEAGT LDDDDDDDDDDDDLLLL 50

[0560] CP042469 TGTAACAACATGGCCAGT LLDDDDDDDDDDDDDDLL 51

[0561] CP042405 TGTAACAACATGGCEAG LDDDDDDDDDDDDDLLL 52

[0562] CP042406 GTGTAACAACATGGCCAG LLDDDDDDDDDDDDDDLL 53

[0563] CP042407 AGTGTAACAACATGGCCAG LDDDDDDDDDDDDDDDDLL 54

[0564] CP042408 EAGTGTAACAACATGGCCAG LDDDDDDDDDDDDDDDDDLL 55

[0565] CP042470 TGTAACAACATGGCEAG LLDDDDDDDDDDDDLLL 56

[0566] CP042471 GTGTAACAACATGGCEAG LDDDDDDDDDDDDDDLLL 57

[0567] CP042472 AGTGTAACAACATGGCCAG LLDDDDDDDDDDDDDDDLL 58

[0568] CP042513 AGTGTAACAACATGGCEAG LDDDDDDDDDDDDDDDLLL 59

[0569] CP042409 GTGTAACAACATGGCEA LLDDDDDDDDDDDDDLL 60

[0570] CP042410 AGTGTAACAACATGGCEA LDDDDDDDDDDDDDDDLL 61

[0571] CP042411 EAGTGTAACAACATGGCEA LDDDDDDDDDDDDDDDDLL 62

[0572] CP042473 GTGTAACAACATGGEEA LDDDDDDDDDDDDDLLL 63

[0573] CP042474 AGTGTAACAACATGGCEA LLDDDDDDDDDDDDDDLL 64

[0574] CP042514 GTGTAACAACATGGCEA LLLDDDDDDDDDDDDLL 65

[0575] CP042412 GTGTAACAACATGGEE LLDDDDDDDDDDDDLL 66

[0576] CP042413 AGTGTAACAACATGGEE LLDDDDDDDDDDDDDLL 67

[0577]

[0578] Docket No. P39006

[0579] CP042414 EAGTGTAACAACATGGEE LDDDDDDDDDDDDDDDLL 68

[0580] CP042475 GTGTAACAACATGGEE LLLDDDDDDDDDDDLL 69

[0581] CP042515 AGTGTAACAACATGGEE LDDDDDDDDDDDDDLLL 70

[0582] CP042551 EAGTGTAACAACATGGEE LDDDDDDDDDDDDDDLLL 71

[0583] CP042415 AGTGTAACAACATGGE LLLDDDDDDDDDDDLL 72

[0584] CP042416 EAGTGTAACAACATGGE LLDDDDDDDDDDDDDLL 73

[0585] CP042417 TEAGTGTAACAACATGGE LLDDDDDDDDDDDDDDLL 74

[0586] CP042418 ETCAGTGTAACAACATGGE LDDDDDDDDDDDDDDDDLL 75

[0587] CP042476 EAGTGTAACAACATGGE LLLDDDDDDDDDDDDLL 76

[0588] CP042477 TCAGTGTAACAACATGGE LDDDDDDDDDDDDDDLLL 77

[0589] CP042516 AGTGTAACAACATGGE LLLDDDDDDDDDDLLL 78

[0590] CP042517 EAGTGTAACAACATGGE LDDDDDDDDDDDDLLLL 79

[0591] CP042518 TEAGTGTAACAACATGGE LLDDDDDDDDDDDDDLLL 80

[0592] CP042419 TEAGTGTAACAACATGG LLLLDDDDDDDDDDDLL 81

[0593] CP042420 ETEAGTGTAACAACATGG LLLDDDDDDDDDDDDDLL 82

[0594] CP042421 TETCAGTGTAACAACATGG LLDDDDDDDDDDDDDDDLL 83

[0595] CP042422 ATCTCAGTGTAACAACATGG LLDDDDDDDDDDDDDDDDLL 84

[0596] CP042478 ETCAGTGTAACAACATGG LDDDDDDDDDDDDDLLLL 85

[0597]

[0598] Docket No. P39006

[0599] CP042479 TCTCAGTGTAACAACATGG LDDDDDDDDDDDDDDLLLL 86

[0600] CP042480 ATCTCAGTGTAACAACATGG LDDDDDDDDDDDDDDDDLLL 87

[0601] CP042519 TEAGTGTAACAACATGG LLLDDDDDDDDDDLLLL 88

[0602] CP042520 ATETCAGTGTAACAACATGG LLLDDDDDDDDDDDDDDDLL 89

[0603] CP042423 ETCAGTGTAACAAEATG LLDDDDDDDDDDDLLLL 90

[0604] CP042424 TETCAGTGTAACAACATG LLLDDDDDDDDDDDDLLL 91

[0605] CP042425 ATCTCAGTGTAACAAEATG LDDDDDDDDDDDDDDLLLL 92

[0606] CP042426 GATCTCAGTGTAACAACATG LLDDDDDDDDDDDDDDDDLL 93

[0607] CP042481 ETEAGTGTAACAACATG LLLLDDDDDDDDDDLLL 94

[0608] CP042482 ATETCAGTGTAACAACATG LLLDDDDDDDDDDDDDLLL 95

[0609] CP042483 GATCTCAGTGTAACAACATG LLDDDDDDDDDDDDDDDLLL 96

[0610] CP042521 ETEAGTGTAACAAEATG LLLDDDDDDDDDDLLLL 97

[0611] CP042522 TETEAGTGTAACAACATG LLLLDDDDDDDDDDDLLL 98

[0612] CP042523 ATCTCAGTGTAACAAEATG LLDDDDDDDDDDDDDLLLL 99

[0613] CP042524 GATCTCAGTGTAACAAEATG LDDDDDDDDDDDDDDDLLLL 100

[0614] CP042427 TETCAGTGTAACAAEAT LLLDDDDDDDDDDDLLL 101

[0615] CP042428 ATCTCAGTGTAACAAEAT LLDDDDDDDDDDDDLLLL 102

[0616] CP042429 GATCTCAGTGTAACAACAT LLLDDDDDDDDDDDDDDLL 103

[0617]

[0618] Docket No. P39006

[0619] CP042430 TGATCTCAGTGTAACAAEAT LDDDDDDDDDDDDDDDDLLL 104

[0620] CP042484 TETCAGTGTAACAAEAT LLLDDDDDDDDDDLLLL 105

[0621] CP042485 ATETCAGTGTAACAAEAT LLLDDDDDDDDDDDLLLL 106

[0622] CP042486 GATCTCAGTGTAACAAEAT LLDDDDDDDDDDDDDDLLL 107

[0623] CP042487 TGATCTCAGTGTAACAACAT LLLDDDDDDDDDDDDDDDLL 108

[0624] CP042525 TETEAGTGTAACAAEAT LLLLDDDDDDDDDDLLL 109

[0625] CP042526 GATCTCAGTGTAACAAEAT LLDDDDDDDDDDDDDLLLL 110

[0626] CP042527 TGATCTCAGTGTAACAAEAT LLDDDDDDDDDDDDDDDLLL 111

[0627] CP042431 GATCTCAGTGTAACAAEA LLLDDDDDDDDDDDDDLL 112

[0628] CP042432 TGATCTCAGTGTAACAAEA LDDDDDDDDDDDDDDLLLL 113

[0629] CP042433 TTGATCTCAGTGTAACAAEA LDDDDDDDDDDDDDDDLLLL 114

[0630] CP042488 GATCTCAGTGTAACAAEA LLLDDDDDDDDDDDLLLL 115

[0631] CP042489 TGATCTCAGTGTAACAAEA LLDDDDDDDDDDDDDLLLL 116

[0632] CP042490 TTGATCTCAGTGTAACAAEA LLDDDDDDDDDDDDDDLLLL 117

[0633] CP042528 GATETCAGTGTAACAAEA LLLLDDDDDDDDDDDDLL 118

[0634] CP042529 TGATCTCAGTGTAACAAEA LLLDDDDDDDDDDDDLLLL 119

[0635] CP042530 TTGATCTCAGTGTAACAAEA LLLLDDDDDDDDDDDDDDLL 120

[0636] CP042434 GATCTCAGTGTAAEAAE LLLDDDDDDDDDDLLLL 121

[0637]

[0638] Docket No. P39006

[0639] CP042435 TTGATCTCAGTGTAAEAAE LLDDDDDDDDDDDDDLLLL 122

[0640] CP042436 TTTGATCTCAGTGTAACAAE LLLDDDDDDDDDDDDDDLLL 123

[0641] CP042491 TTGATCTCAGTGTAACAAE LLLLDDDDDDDDDDDDLLL 124

[0642] CP042492 TTTGATCTCAGTGTAAEAAE LLDDDDDDDDDDDDDDLLLL 125

[0643] CP042531 GATETCAGTGTAAEAAE LLLLDDDDDDDDDLLLL 126

[0644] CP042532 TTGATCTCAGTGTAAEAAE LLLDDDDDDDDDDDDLLLL 127

[0645] CP042533 TTTGATCTCAGTGTAAEAAE LLLDDDDDDDDDDDDDLLLL 128

[0646] CP042437 TGATCTCAGTGTAACAA LLLLDDDDDDDDDDDLL 129

[0647] CP042438 TTGATCTCAGTGTAAEAA LLDDDDDDDDDDDDLLLL 130

[0648] CP042439 TTTGATCTCAGTGTAAEAA LLDDDDDDDDDDDDDLLLL 131

[0649] CP042440 GTTTGATCTCAGTGTAACAA LLLDDDDDDDDDDDDDDDLL 132

[0650] CP042493 TGATCTCAGTGTAAEAA LLLLDDDDDDDDDLLLL 133

[0651] CP042494 TTGATCTCAGTGTAAEAA LLLDDDDDDDDDDDLLLL 134

[0652] CP042495 TTTGATCTCAGTGTAAEAA LLLDDDDDDDDDDDDLLLL 135

[0653] CP042496 GTTTGATCTCAGTGTAACAA LLLLDDDDDDDDDDDDDDLL 136

[0654] CP042534 TTGATCTCAGTGTAAEAA LLLLDDDDDDDDDDLLLL 137

[0655] CP042535 TTTGATCTCAGTGTAAEAA LLLLDDDDDDDDDDDLLLL 138

[0656] CP042536 GTTTGATCTCAGTGTAAEAA LLLDDDDDDDDDDDDDDLLL 139

[0657]

[0658] Docket No. P39006

[0659] CP042441 TTGATCTCAGTGTAAEA LLDDDDDDDDDDDDLLL 140

[0660] CP042442 TTTGATCTCAGTGTAAEA LLLDDDDDDDDDDDDLLL 141

[0661] CP042443 GTTTGATCTCAGTGTAAEA LDDDDDDDDDDDDDDDLLL 142

[0662] CP042444 GGTTTGATCTCAGTGTAAEA LDDDDDDDDDDDDDDDDDLL 143

[0663] CP042497 TTGATCTCAGTGTAAEA LLLLDDDDDDDDDDLLL 144

[0664] CP042498 GTTTGATCTCAGTGTAAEA LLDDDDDDDDDDDDDDDLL 145

[0665] CP042537 TTTGATCTCAGTGTAAEA LLLLDDDDDDDDDDDLLL 146

[0666] CP042538 GTTTGATCTCAGTGTAAEA LLLDDDDDDDDDDDDDLLL 147

[0667] CP042539 GGTTTGATCTCAGTGTAAEA LDDDDDDDDDDDDDDDDLLL 148

[0668] CP042552 TTTGATCTCAGTGTAAEA LLLLDDDDDDDDDDLLLL 149

[0669] CP042445 GTTTGATCTCAGTGTAAE LLLDDDDDDDDDDDDDLL 150

[0670] CP042446 GGTTTGATCTCAGTGTAAE LDDDDDDDDDDDDDDDLLL 151

[0671] CP042447 AGGTTTGATCTCAGTGTAAE LDDDDDDDDDDDDDDDDDLL 152

[0672] CP042499 GTTTGATCTCAGTGTAAE LDDDDDDDDDDDDDLLLL 153

[0673] CP042500 GGTTTGATCTCAGTGTAAE LLDDDDDDDDDDDDDDDLL 154

[0674] CP042501 AGGTTTGATCTCAGTGTAAE LLDDDDDDDDDDDDDDDDLL 155

[0675] CP042540 GGTTTGATCTCAGTGTAAE LDDDDDDDDDDDDDDLLLL 156

[0676] CP042448 GTTTGATCTCAGTGTAA LDDDDDDDDDDDDDLLL 157

[0677]

[0678] Docket No. P39006

[0679] CP042449 GGTTTGATCTCAGTGTAA LDDDDDDDDDDDDDDLLL 158

[0680] CP042450 AGGTTTGATCTCAGTGTAA LLDDDDDDDDDDDDDDDLL 159

[0681] CP042451 EAGGTTTGATCTCAGTGTAA LDDDDDDDDDDDDDDDDDLL 160

[0682] CP042502 GGTTTGATCTCAGTGTAA LLDDDDDDDDDDDDDLLL 161

[0683] CP042503 AGGTTTGATCTCAGTGTAA LDDDDDDDDDDDDDDDLLL 162

[0684] CP042504 EAGGTTTGATCTCAGTGTAA LLDDDDDDDDDDDDDDDDLL 163

[0685] CP042541 EAGGTTTGATCTCAGTGTAA LDDDDDDDDDDDDDDDDLLL 164

[0686] CP042452 GTCAGGTTTGATCTEA LDDDDDDDDDDDDLLL 165

[0687] CP042505 GTCAGGTTTGATETEA LDDDDDDDDDDDLLLL 166

[0688] CP042553 ETGTCAGGTTTGATCTEA LDDDDDDDDDDDDDDLLL 167

[0689] CP042453 ETGTCAGGTTTGATET LDDDDDDDDDDDDDLL 168

[0690] CP042454 GCTGTCAGGTTTGATE LDDDDDDDDDDDDLLL 169

[0691] CP042542 GETGTCAGGTTTGATE LLDDDDDDDDDDDDLL 170

[0692] CP042554 AAAAAEGGCTGTCAGGTT LLLDDDDDDDDDDDLLLL 171

[0693] CP042555 AAAECTTTAAAAACGGET LLLLDDDDDDDDDDLLLL 172

[0694] CP042556 TTGGGGTTAAACCTTTAA LLLLDDDDDDDDDDDLLL 173

[0695] CP042557 AETTGGGATTGGGGTTAA LLDDDDDDDDDDDDLLLL 174

[0696] CP042558 TTTTCAGCACTTGGGATT LLLLDDDDDDDDDDDLLL 175

[0697]

[0698] Docket No. P39006

[0699] CP042559 ECTCTGGTTTTTCAGEAE LDDDDDDDDDDDDDDLLL 176

[0700] CP042560 ECCTCAGCCTCTGGTTTT LDDDDDDDDDDDDDDDLL 177

[0701] CP042561 TACACATCTCCCTCAGEE LDDDDDDDDDDDDDDDLL 178

[0702] CP042562 TGGAAGCTTACACATETE LLDDDDDDDDDDDDDLLL 179

[0703] CP042563 EACTGAGGTGGAAGCTTA LLDDDDDDDDDDDDDLLL 180

[0704] CP042564 EAGTAAAACACTGAGGTG LLDDDDDDDDDDDDLLLL 181

[0705] CP042565 GETGGTCTCAGTAAAAEA LLDDDDDDDDDDDDDLLL 182

[0706] CP042566 GCCCCAATGCTGGTCTEA LDDDDDDDDDDDDDDDLL 183

[0707] CP042567 ECTCATATGCCCCAATGE LDDDDDDDDDDDDDDDLL 184

[0708] CP042568 TCCTTGTGCCTCATATGE LDDDDDDDDDDDDDDDLL 185

[0709] CP042569 AGCTGGATTCCTTGTGEE LDDDDDDDDDDDDDDDLL 186

[0710] CP042570 GGAACAGAGCTGGATTEE LDDDDDDDDDDDDDDLLL 187

[0711] CP042571 GGCTTCTAGGGAACAGAG LLDDDDDDDDDDDDDDLL 188

[0712] CP05987 TTGAATAAGTGGATGT LLLDDDDDDDDDDLLL 189

[0713]

[0714] All backbones are fully phosphorothioated. E in the BASE sequence corresponds to 5meC. L in the Sugar sequence corresponds to LNA. D in the sugar sequence corresponds to DNA.

[0715] Table 9: Results

[0716] Distance of the first

[0717] CPO nucleotide reverse Replicate 1 Replicate 2 Average

[0718]

[0719] Docket No. P39006

[0720] complementary to

[0721] the ASO from CFB

[0722] 3'end

[0723] CP042384-1 1 60.2 65.3 62.75

[0724] CP042456-1 1 62.5 64.15 63.325

[0725] CP042385-1 2 61.75 68.6 65.175

[0726] CP042386-1 2 63.35 68.85 66.1

[0727] CP042457-1 2 60.95 70.3 65.625

[0728] CP042458-1 2 99.6 77.55 88.575

[0729] CP042507-1 2 68.85 68.15 68.5

[0730] CP042387-1 3 74.9 88 81.45

[0731] CP042388-1 3 86.9 73.7 80.3

[0732] CP042389-1 3 115.3 65.5 90.4

[0733] CP042459-1 3 76.85 75.05 75.95

[0734] CP042460-1 3 85.7 83.45 84.575

[0735] CP042508-1 3 72.4 83.3 77.85

[0736] CP042390-1 4 66.35 75.1 70.725

[0737] CP042391-1 4 57.05 70.1 63.575

[0738] CP042392-1 4 61.2 65.8 63.5

[0739]

[0740] Docket No. P39006

[0741] CP042393-1 4 70.6 67.1 68.85

[0742] CP042461-1 4 79.8 90.2 85

[0743] CP042394-1 5 81.6 80.65 81.125

[0744] CP042395-1 5 83.05 72.7 77.875

[0745] CP042396-1 5 61.85 93.8 77.825

[0746] CP042462-1 5 75.6 91.45 83.525

[0747] CP042463-1 5 63.45 63.3 63.375

[0748] CP042509-1 5 82.75 89.6 86.175

[0749] CP042510-1 5 72.9 81.15 77.025

[0750] CP042397-1 6 75.75 72.3 74.025

[0751] CP042398-1 6 66.55 53.45 60

[0752] CP042464-1 6 62.95 65.4 64.175

[0753] CP042465-1 6 65.4 50.25 57.825

[0754] CP042511-1 6 69.9 71.05 70.475

[0755] CP042399-1 7 49.1 48.75 48.925

[0756] CP042400-1 7 63.8 59.5 61.65

[0757] CP042466-1 7 57.5 60 58.75

[0758] CP042512-1 7 70.8 63.05 66.925

[0759]

[0760] Docket No. P39006

[0761] CP042546-1 8 59.15 66.95 63.05

[0762] CP042547-1 16 65.65 59.75 62.7

[0763] CP042548-1 24 52.95 46.2 49.575

[0764] CP042549-1 31 57.5 56 56.75

[0765] CP042550-1 39 48.25 48.5 48.375

[0766] CP042401-1 44 51.35 46.7 49.025

[0767] CP042402-1 44 67.65 60.15 63.9

[0768] CP042467-1 44 41.15 54.3 47.725

[0769] CP042403-1 45 38.45 46.2 42.325

[0770] CP042404-1 45 70.95 80.8 75.875

[0771] CP042468-1 45 71.35 66.35 68.85

[0772] CP042469-1 45 67.25 75 71.125

[0773] CP042405-1 46 55.25 51.55 53.4

[0774] CP042406-1 46 36.8 34.8 35.8

[0775] CP042407-1 46 54.1 42.6 48.35

[0776] CP042408-1 46 60.65 50.95 55.8

[0777] CP042470-1 46 60.6 69.4 65

[0778] CP042471-1 46 61.45 57.25 59.35

[0779]

[0780] Docket No. P39006

[0781] CP042472-1 46 47.95 49.9 48.925

[0782] CP042513-1 46 70.95 56.4 63.675

[0783] CP042409-1 47 47.9 39.25 43.575

[0784] CP042410-1 47 53.75 53.35 53.55

[0785] CP042411-1 47 81.65 81.95 81.8

[0786] CP042473-1 47 60.35 59.75 60.05

[0787] CP042474-1 47 55.55 52.75 54.15

[0788] CP042514-1 47 46.85 47.45 47.15

[0789] CP042412-1 48 58.3 74.8 66.55

[0790] CP042413-1 48 51.95 56.6 54.275

[0791] CP042414-1 48 76.2 67.45 71.825

[0792] CP042475-1 48 81.35 63.4 72.375

[0793] CP042515-1 48 72.95 60.85 66.9

[0794] CP042551-1 48 71.85 67.2 69.525

[0795] CP042415-1 49 41.85 61.65 51.75

[0796] CP042416-1 49 33.6 35.5 34.55

[0797] CP042417-1 49 67.7 50.3 59

[0798] CP042418-1 49 71.4 67.4 69.4

[0799]

[0800] Docket No. P39006

[0801] CP042476-1 49 30.8 33.25 32.025

[0802] CP042477-1 49 49.65 56.7 53.175

[0803] CP042516-1 49 51.25 58.55 54.9

[0804] CP042517-1 49 53.4 56.4 54.9

[0805] CP042518-1 49 31.05 34.6 32.825

[0806] CP042419-1 50 61.3 61.8 61.55

[0807] CP042420-1 50 37.5 42.8 40.15

[0808] CP042421-1 50 64.8 58.7 61.75

[0809] CP042422-1 50 65.5 56.6 61.05

[0810] CP042478-1 50 62.35 72.45 67.4

[0811] CP042479-1 50 62.1 62.9 62.5

[0812] CP042480-1 50 53.45 55.25 54.35

[0813] CP042519-1 50 57.45 48.4 52.925

[0814] CP042520-1 50 58.4 61.2 59.8

[0815] CP042423-1 51 65.4 69.9 67.65

[0816] CP042424-1 51 66.35 51.2 58.775

[0817] CP042425-1 51 98.55 90.25 94.4

[0818] CP042426-1 51 78.5 75.6 77.05

[0819]

[0820] Docket No. P39006

[0821] CP042481-1 51 63.75 63.1 63.425

[0822] CP042482-1 51 52.2 47.85 50.025

[0823] CP042483-1 51 64.05 60.3 62.175

[0824] CP042521-1 51 65.5 79.85 72.675

[0825] CP042522-1 51 56.05 64.5 60.275

[0826] CP042523-1 51 74.7 68.9 71.8

[0827] CP042524-1 51 57.3 62.3 59.8

[0828] CP042427-1 52 58.55 64.8 61.675

[0829] CP042428-1 52 66.65 56.8 61.725

[0830] CP042429-1 52 74.4 55.8 65.1

[0831] CP042430-1 52 82.1 67.35 74.725

[0832] CP042484-1 52 47.55 48.1 47.825

[0833] CP042485-1 52 58 62.35 60.175

[0834] CP042486-1 52 59.4 67.65 63.525

[0835] CP042487-1 52 68.3 70.15 69.225

[0836] CP042525-1 52 45.55 37.7 41.625

[0837] CP042526-1 52 53.2 60.25 56.725

[0838] CP042527-1 52 61.85 74.2 68.025

[0839]

[0840] Docket No. P39006

[0841] CP042431-1 53 87.15 70.35 78.75

[0842] CP042432-1 53 76.9 58.75 67.825

[0843] CP042433-1 53 66.8 64.75 65.775

[0844] CP042488-1 53 55.95 63.65 59.8

[0845] CP042489-1 53 39.6 39.45 39.525

[0846] CP042490-1 53 41.3 45.2 43.25

[0847] CP042528-1 53 87.45 99.55 93.5

[0848] CP042529-1 53 61.4 74.05 67.725

[0849] CP042530-1 53 55.85 48.15 52

[0850] CP042434-1 54 71.9 81.25 76.575

[0851] CP042435-1 54 61.1 51.85 56.475

[0852] CP042436-1 54 41.9 43.85 42.875

[0853] CP042491-1 54 54.45 56.2 55.325

[0854] CP042492-1 54 58.05 62.45 60.25

[0855] CP042531-1 54 52 49.8 50.9

[0856] CP042532-1 54 58.7 53.85 56.275

[0857] CP042533-1 54 68.2 51.35 59.775

[0858] CP042437-1 55 57.25 68.55 62.9

[0859]

[0860] Docket No. P39006

[0861] CP042438-1 55 69.15 64.6 66.875

[0862] CP042439-1 55 65.2 46.95 56.075

[0863] CP042440-1 55 46.8 59.2 53

[0864] CP042493-1 55 77.35 79.55 78.45

[0865] CP042494-1 55 65.45 84.4 74.925

[0866] CP042495-1 55 67.3 70.5 68.9

[0867] CP042496-1 55 78.3 53.5 65.9

[0868] CP042534-1 55 82.85 90.75 86.8

[0869] CP042535-1 55 71.15 83.9 77.525

[0870] CP042536-1 55 61.1 61.05 61.075

[0871] CP042441-1 56 50.9 56.25 53.575

[0872] CP042442-1 56 45.95 38.55 42.25

[0873] CP042443-1 56 49.9 47.65 48.775

[0874] CP042444-1 56 53.3 51.8 52.55

[0875] CP042497-1 56 47.95 47.85 47.9

[0876] CP042498-1 56 48.8 54.45 51.625

[0877] CP042537-1 56 57 47.9 52.45

[0878] CP042538-1 56 94.8 64.6 79.7

[0879]

[0880] Docket No. P39006

[0881] CP042539-1 56 49.95 49.85 49.9

[0882] CP042552-1 56 59.4 73.5 66.45

[0883] CP042445-1 57 62.85 68.75 65.8

[0884] CP042446-1 57 55.35 51.55 53.45

[0885] CP042447-1 57 53.7 57.65 55.675

[0886] CP042499-1 57 55.7 47.55 51.625

[0887] CP042500-1 57 39.2 44.1 41.65

[0888] CP042501-1 57 58.3 53.35 55.825

[0889] CP042540-1 57 54.45 53.8 54.125

[0890] CP042448-1 58 41.1 44.2 42.65

[0891] CP042449-1 58 34.75 33.4 34.075

[0892] CP042450-1 58 36.05 38.75 37.4

[0893] CP042451-1 58 60.45 64.1 62.275

[0894] CP042502-1 58 16.75 16.85 16.8

[0895] CP042503-1 58 46.7 52.45 49.575

[0896] CP042504-1 58 74.7 66.75 70.725

[0897] CP042541-1 58 54.7 59.45 57.075

[0898] CP042452-1 64 39.2 42.9 41.05

[0899]

[0900] Docket No. P39006

[0901] CP042505-1 64 20.1 19.45 19.775

[0902] CP042553-1 64 43.3 44.5 43.9

[0903] CP042453-1 66 56.25 52.7 54.475

[0904] CP042454-1 67 42.75 47.8 45.275

[0905] CP042542-1 67 44.65 64.45 54.55

[0906] CP042554-1 72 34.75 49.45 42.1

[0907] CP042555-1 80 64 72.95 68.475

[0908] CP042556-1 88 35.8 32.8 34.3

[0909] CP042557-1 96 51.05 47.45 49.25

[0910] CP042558-1 104 29.85 29.45 29.65

[0911] CP042559-1 112 42.65 53.95 48.3

[0912] CP042560-1 119 55.7 81.35 68.525

[0913] CP042561-1 128 59.7 76.9 68.3

[0914] CP042562-1 136 32.45 45.15 38.8

[0915] CP042563-1 144 68.3 70.75 69.525

[0916] CP042564-1 152 54.05 63.35 58.7

[0917] CP042565-1 160 35.35 40.9 38.125

[0918] CP042566-1 168 36.35 30.05 33.2

[0919]

[0920] Docket No. P39006

[0921] CP042567-1 176 59 67.5 63.25

[0922] CP042568-1 184 47.35 58.45 52.9

[0923] CP042569-1 192 41.3 62.75 52.025

[0924] CP042570-1 199 87.95 78.45 83.2

[0925] CP042571-1 208 37.8 46.55 42.175

[0926] CP05987-3 Negative control 68.4 57.9 63.15

[0927] CP05987-3 Negative control 58.25 61.15 59.7

[0928] CP05987-3 Negative control 67.65 59.25 63.45

[0929]

Claims

Docket No. P39006CLAIMSWhat is claimed is:

1. An antisense oligonucleotide of 10 to 30 nucleotides in length, wherein the antisense oligonucleotide is capable of modulating the expression of a target gene, wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity, such as 100% complementarity, to a target sequence located downstream of a cleavage and polyadenylation site, wherein the antisense oligonucleotide is capable of recruiting RNase H.

2. The antisense oligonucleotide of claim 1, wherein the cleavage and polyadenylation site is located on a pre-mRNA, wherein the pre-mRNA is a transcript of the target gene.

3. The antisense oligonucleotide of claim 1 or 2, wherein the cleavage and polyadenylation site is located within the transcription unit of the target gene.

4. The antisense oligonucleotide of any one of clauses 1 to 3, wherein the target sequence is located between about 50 nucleotide and about 2000 nucleotides, between about 50 nucleotide and about 1000 nucleotides, between about 50 nucleotide and about 500 nucleotides, between about 50 nucleotide and about 400 nucleotides, between about 50 nucleotide and about 300 nucleotides, between about 50 nucleotide and about 200 nucleotides, between about 50 nucleotide and about 100 nucleotides downstream of the cleavage and polyadenylation site.

5. The antisense oligonucleotide of any one of claims 1 to 4, wherein one or more nucleoside in the contiguous nucleotide sequence is a 2’ sugar modified nucleoside.

6. The antisense oligonucleotide of claim 5, wherein the one or more 2’ sugar modified nucleoside is independently selected from the group consisting of 2’-O-alkyl-RNA, 2’-O-methyl-RNA, 2’-O-ethyl-RNA, 2’ -alkoxy -RNA, 2’-O-methoxyethyl-RNA, 2’-amino-DNA, 2’-fluoro-DNA, arabino nucleic acid (ANA), 2’-fluoro-ANA and LNA nucleosides.

7. The antisense oligonucleotide of any one of claims 1 to 6, which is capable of recruiting RNase H, such as RNaseHl.

8. The antisense oligonucleotide according any one of claims 1 to 7, which is a gapmer.Docket No. P390069. The antisense oligonucleotide of claim 8, wherein the gapmer has the formula 5’-F-G-F’-3’.

10. The antisense oligonucleotide according to claim 9, wherein region G consists of 6 - 16 DNA nucleosides.

11. A conjugate comprising the antisense oligonucleotide according to any one of claims 1 to 10, and at least one conjugate moiety covalently attached to said antisense oligonucleotide.

12. A pharmaceutically acceptable salt of the antisense oligonucleotide according to any one of claims 1 to 10, or the conjugate according to claim 11.

13. A pharmaceutical composition comprising the antisense oligonucleotide any one of claims 1 to 10, the conjugate of claim 11, or the pharmaceutically acceptable salt of claim 12, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

14. An in vivo or in vitro method for modulating the expression of a target gene in a target cell which is expressing the target gene, said method comprising administering an antisense oligonucleotide of any one of claims 1 to 10, or the conjugate of claim 11, or the pharmaceutical composition of claim 12 in an effective amount to said cell.

15. The antisense oligonucleotide of any one of claims 1 to 10, or the conjugate according to claim 11, or the pharmaceutical composition of claim 12 for use in medicine.