Uses of Saccharomyces cerevisiae and its hydroxylation of soy isoflavone aglycones

Saccharomyces cerevisiae Sc45-32 naturally ferments soybean whey to convert soy isoflavone aglycones into 4',6,7-trihydroxyisoflavones, addressing production challenges and environmental issues, achieving efficient and cost-effective hydroxylation.

JP7910835B1Active Publication Date: 2026-08-25QINGDAO AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2026076303
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2026-02-12
Filing Date
2026-04-30
Publication Date
2026-08-25
Estimated Expiration
2046-04-30

AI Technical Summary

Technical Problem

Current methods for producing hydroxylated soy isoflavones, such as 4',6,7-trihydroxyisoflavone, face challenges including high technical hurdles, high production costs, safety concerns with genetically modified organisms, and environmental pollution from unused soy processing by-products, while chemical synthesis methods are complex and environmentally unfriendly.

Method used

Utilizing Saccharomyces cerevisiae Sc45-32 to hydroxylate soy isoflavone aglycones in yellow juice, a soy processing by-product, through natural fermentation under specific conditions, converting soy isoflavone aglycones into high-value 4',6,7-trihydroxyisoflavones.

Benefits of technology

This method is simple, low-cost, and environmentally friendly, effectively converting soy isoflavone aglycones into high-value hydroxylated products, promoting resource utilization and generating economic and social benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007910835000001_ABST
    Figure 0007910835000001_ABST
Patent Text Reader

Abstract

This invention provides a method for directly and efficiently converting low-activity soy isoflavone aglycones into high-value-added hydroxylated products through natural fermentation using soy processing by-products such as soybean juice. [Solution] The present invention discloses the application of Saccharomyces cerevisiae to the hydroxylation of soy isoflavone aglycones, wherein the Saccharomyces cerevisiae is Saccharomyces cerevisiae Sc45-32, and deposit number CGMCC No. 39082 is used. This strain has the ability to convert soy isoflavone aglycones, and can convert soy isoflavone aglycones in yellow juice as a culture medium to hydroxylated soy isoflavone aglycone (4',6,7-Trihydroxyisoflavone).
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of microbial technology, and specifically relates to the use of Saccharomyces cerevisiae and its hydroxylation of soy isoflavone aglycone.

Background Art

[0002] Soy isoflavones are flavonoid compounds widely present in soybeans and their processed products. They have various physiological functions such as antioxidant effects, preventive effects on cardiovascular diseases, improvement of menopausal symptoms, and potential anti-cancer effects. Therefore, they have become natural active ingredients attracting attention in the development fields of functional foods, health foods, and pharmaceuticals. In soybeans, isoflavones mainly exist in the form of glycosides with low biological activity (such as daidzin, genistin, glycitin, etc.). However, in the intestinal tract or during the in vitro fermentation process, these glycosides can be hydrolyzed by microbial-derived β-glucosidase and converted into more biologically active aglycones, namely daizein, genistein, and glycitein.

[0003] Further studies have shown that by modifying the above aglycones through hydroxylation to produce polyhydroxylated isoflavones (such as 4',6,7-trihydroxyisoflavone), their water solubility, biological utilization rate, and target biological activity can be significantly improved. 4',6,7-Trihydroxyisoflavone has a unique "highly hydroxylated" structure, and thus has been proposed for use as a lead compound for functional foods, topical skin agents, or kinase inhibitors, and has extremely high added value. However, the content of this compound in nature is extremely low, and it is extremely difficult to directly extract.

[0004] Currently, methods for producing hydroxylated soy isoflavone aglycones (particularly 4',6,7-trihydroxyisoflavones) rely mainly on molecular biological techniques or chemical synthesis. For example, methods have been reported that use genetic engineering techniques to heterologously express plant or microbial cytochrome P450 hydroxylases in microorganisms (such as yeast and E. coli) to achieve regioselective hydroxylation of specific substrates. Although these methods have a clear objective, they typically have the following problems: (1) high technical hurdles requiring complex gene cloning, expression system construction and optimization; (2) strict process control and high production costs; and (3) potential problems associated with the safety and legal / regulatory constraints of genetically modified organisms. On the other hand, chemical synthesis methods generally involve complex processes, require the use of toxic reagents, and make it difficult to ensure the stereoselectivity of the product, thus not being compatible with environmentally friendly and sustainable development principles.

[0005] Furthermore, in the processing of legume products (tofu, yuba, etc.), a large amount of yellow juice (also called soybean whey or soy water) is produced as a by-product. Yellow juice is rich in unused proteins, sugars, and soy isoflavones in the form of glycosides. Currently, most yellow juice is discharged directly without being utilized, which not only causes serious environmental pollution but also leads to the waste of valuable isoflavone resources. Although research has already been reported on fermenting yellow juice using microorganisms (lactic acid bacteria, yeast, etc.) to increase its utility, the main purposes are usually limited to the decomposition of anti-trophic factors, flavor improvement, or biomass production. There have been no reports yet on a technology that uses yellow juice as a natural culture medium and directly and efficiently converts the soy isoflavone aglycones within it into high-value hydroxylated products (especially 4',6,7-trihydroxyisoflavones) using non-genetically modified natural microbial strains.

[0006] Therefore, in this field, there is a strong desire for the development of simple, low-cost, and environmentally friendly biological conversion technologies. This technology utilizes soy processing by-products such as yellow juice to directly and efficiently convert low-activity soy isoflavone aglycones into high-value-added hydroxylated products through natural fermentation, thereby achieving the dual objectives of resource utilization of by-products and the production of high-value-added products. [Overview of the project]

[0007] In view of the problems that exist in the prior art, the present invention aims to provide an application for the hydroxylation of Saccharomyces cerevisiae and its soy isoflavone aglycone.

[0008] To achieve the above objective, the present invention employs the following technical means.

[0009] It is Saccharomyces cerevisiae, specifically Saccharomyces cerevisiae Sc45-32, with deposit number CGMCC No. 39082.

[0010] The above-mentioned Saccharomyces cerevisiae is used for hydroxylation of soy isoflavone aglycones.

[0011] Based on the above technical means, the above-mentioned Saccharomyces cerevisiae is used in the preparation of 4',6,7-trihydroxyisoflavones.

[0012] Based on the above technical means, yellow juice is used as the culture medium, and fermentation is carried out using Saccharomyces cerevisiae Sc45-32, deposit number CGMCC No. 39082.

[0013] Based on the above technical means, the fermentation conditions are 28-30°C and 150-200 r / min, under which fermentation culture is carried out for 18-48 hours.

[0014] Based on the above technical means, the inoculation amount of Saccharomyces cerevisiae Sc45-32 of deposit number CGMCC No. 39082 into the culture medium is 0.5-5%.

[0015] Based on the above technical means, the yellow juice is the yellow juice produced during the manufacturing process of processed legume products.

[0016] Based on the above technical means, the yellow juice produced during the manufacturing process of the processed legume product is a liquid by-product that is produced after pressing or filtering during the process of manufacturing a processed legume product using soybeans as a raw material.

[0017] Based on the above technical means, the processed bean product is tofu or yuba (tofu skin). [Effects of the Invention]

[0018] The technical means of the present invention have the following effects.

[0019] This invention involves isolating and obtaining Saccharomyces cerevisiae from soybean whey acidified by lactic acid fermentation, which is produced during the tofu manufacturing process. This strain possesses the ability to convert soybean isoflavone aglycones, and using yellow juice as a culture medium, it can convert soybean isoflavone aglycones (Glycitein, Daidzein, Genistein) into hydroxylated soybean isoflavone aglycone (4',6,7-Trihydroxyisoflavone). Currently, the hydroxylation of soybean isoflavone aglycones largely relies on molecular biological methods, but the Saccharomyces cerevisiae Sc45-32 of this invention can hydroxylate soybean isoflavone aglycones to produce 4',6,7-Trihydroxyisoflavone through natural fermentation. The conversion method is simple, low-cost, and environmentally friendly. This method not only has significant application potential in the field of hydroxylation of soy isoflavone aglycones, but it can also promote the effective utilization of by-product resources that are rich in soy isoflavones, such as soybean juice, thereby generating remarkable economic value and social benefits.

Brief Description of the Drawings

[0020] [Figure 1] Shows the colony morphology of Saccharomyces cerevisiae D10. [Figure 2] Is a phylogenetic tree of Saccharomyces cerevisiae D10. [Figure 3] Is a result diagram of the esculin chromogenic method of Saccharomyces cerevisiae Sc45-32 (the left figure is the negative control, and the right figure is the chromogenic result of the hole punching of Saccharomyces cerevisiae Sc45-32). [Figure 4] Is an external view of the yellow juice medium. [Figure 5] Shows the measurement of the conversion ability of isoflavone glycosides by yeast in yellow juice. [Figure 6] Shows the measurement results of the hydroxylase activity of Saccharomyces cerevisiae Sc45-32. [Figure 7] Shows the mass spectrum of 4',6,7-Trihydroxyisoflavone in nontarget metabolism. [Figure 8] Shows the mass spectrum of 4',6,7-Trihydroxyisoflavone in target metabolism (here, RT = 5.269 is the apex time of the main peak. At this time, the concentration of the target substance is the highest. RT = 5.624 is the labeling time of the small peak on the right side of the main peak and the tailing part. Q271.00>168.9(+), Q represents the ion pair, 271.00>168.90 represents the ion transition / mass-to-charge ratio conversion, 271.00 represents the mass of the parent ion, ">" represents the cleavage process, 168.90 represents the mass of the daughter ion generated by cleavage, and (+) represents the positive ion mode). [Figure 9] Shows the content of soy isoflavone aglycon in the fermentation of yellow juice by the D10 strain (here, CK is the non-fermented yellow juice medium, and D10 is the yellow juice fermentation medium by Saccharomyces cerevisiae Sc45-32. Black dots: corresponding to the results of 3 independent measurements of the CK group. Purple dots: corresponding to the results of 3 independent measurements of the D10 group). [Figure 10]Content of 4',6,7-Trihydroxyisoflavone in yellow juice fermentation by strain D10 (where CK is the unfermented yellow juice medium and D10 is the yellow juice fermentation medium by Saccharomyces cerevisiae Sc45-32. Black dots: corresponding to the results of 3 independent measurements of the CK group. Purple dots: corresponding to the results of 3 independent measurements of the D10 group). [Figure 11] Growth curve of strain D10 in yellow juice is shown.

Mode for Carrying Out the Invention

[0021] The terms used in the present invention have the meanings usually understood by those skilled in the art unless otherwise specified. Hereinafter, specific examples will be given and the present invention will be described in more detail while referring to data. The following examples are merely illustrative of the present invention and do not limit the scope of the present invention in any form.

[0022] The experimental methods in the following examples are all in accordance with conventional methods unless otherwise instructed, and are carried out in accordance with the techniques or conditions described in the literature within the technical field or in accordance with the product manuals. The test materials, reagents, drugs, etc. used in the following examples are all available through general distribution channels unless otherwise instructed.

[0023] Example 1 Isolation, purification and identification of strains (1) Isolation and purification of strains: Using a 50 mL sterilized centrifuge tube, collect the acidified soybean whey obtained by lactic acid fermentation through natural fermentation (the yellow juice produced by squeezing tofu, naturally fermented, collected from Laiwu, Jinan, Shandong), and bring it back to the laboratory while keeping it at low temperature at 4°C. Immediately use sterilized water to prepare 10 -3 、10 -4 、10 -5 、10 -6 、10 -7The soybean whey was diluted twice and acidified by lactic acid fermentation after dilution. This was spread onto YPD agar plates and incubated at 28°C for 48 hours. Candidate colonies were picked based on their colony morphology, and plate streak isolation was performed, repeating 2-3 times until a pure single colony was obtained. The purified single colonies were dispensed into glycerol tubes and stored at -80°C for testing.

[0024] (2) Identification of the bacterial strain Morphological identification: The colony and cell morphology of yeast D10 obtained by isolation are shown in Figure 1. The colonies of yeast D10 are circular or irregular in shape, with a raised center, a height of approximately 0.5–2 mm, and a milky white color. The colony diameter is approximately 1–5 mm, and the cell morphology is oval or spherical, clearly distinguishable from bacterial morphology.

[0025] Molecular biological identification: Yeast strain D10 obtained through screening was activated to the logarithmic growth phase, RNA was extracted and reverse transcribed into cDNA, and the 26S rDNA sequence was amplified by PCR using this as a template. The resulting sequence is shown as SEQ ID NO:1. The 26S rDNA gene sequence was subjected to homology analysis using the NCBI BLAST database to identify homologous strains of strain D10. Strains showing high homology to D10 were selected, a phylogenetic tree was constructed, and their genus and species were identified.

[0026] SEQ ID NO:1 (5'→3') ACTGACCTGCGGAGGTCATTAAAGAAATTTAATAATTTTGAAAATGGATTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAACATACAAGGGGGGGGGGAGAGAGAGAGAGGGGTTTT

[0027] The phylogenetic tree of yeast strain D10 is shown in Figure 2. Comparison results from the BLAST database showed that yeast strain D10 has the highest homology with Saccharomyces cerevisiae strain HBUAS61417, with a sequence similarity of 99.75%. Based on a comprehensive analysis of morphological and physiological / biochemical characteristics, strain D10 was identified as Saccharomyces cerevisiae and named Saccharomyces cerevisiae Sc45-32. This strain was deposited with the Center for Ordinary Microorganisms (CGMCC), China Microbial Species Depositary Administration, on December 10, 2025, with deposit number CGMCC No. 39082. The recommended taxonomic name is Saccharomyces cerevisiae. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing.

[0028] Example 2 Identification of the hydrolytic ability of soy isoflavone glycosides by Saccharomyces cerevisiae Sc45-32 (1) Cellobiose plate method YPD-cellobiose agar medium was prepared using cellobiose as a carbon source: 2% cellobiose was added as a carbon source to sugar-free YPD agar medium and sterilized at 121°C for 20 minutes. Colonies of Saccharomyces cerevisiae Sc45-32 were isolated onto cellobiose medium by streak and cultured at 37°C for 24-48 hours to observe whether Saccharomyces cerevisiae Sc45-32 grew on the cellobiose plate. On the cellobiose plate, cellobiose is the only carbon source in the plate, and since β-glucosidase can hydrolyze cellobiose to glucose, only strains capable of secreting β-glucosidase can grow on the cellobiose plate. Saccharomyces cerevisiae Sc45-32 can grow on cellobiose plates, which indicates that Saccharomyces cerevisiae Sc45-32 can produce β-glucosidase.

[0029] Conclusion: Saccharomyces cerevisiae Sc45-32 can grow on cellobiose plates and has the ability to produce β-glucosidase.

[0030] (2) Screening by Esculin colorimetric method The β-glucosidase production activity of the Saccharomyces cerevisiae Sc45-32 strain will be further confirmed using the esculin colorimetric method.

[0031] Esculin-chromogenic media were prepared by adding 0.3% esculin and 0.05% iron citrate to YPD agar medium, respectively. Saccharomyces cerevisiae Sc45-32 was inoculated into the esculin-chromogenic media by perforation using a toothpick, and the color reaction was performed. The results are shown in Figure 3. Strains that secrete β-glucosidase hydrolyze esculin in the medium, producing glucose and esculetin. The produced esculetin reacts with the iron ions of iron citrate previously added to the medium, producing a dark brown or black phenolic iron complex. The larger the black ring and the darker the color, the stronger the enzyme production capacity. As shown in Figure 4, a clear black ring with a dark brown margin is observed around Saccharomyces cerevisiae Sc45-32, indicating strong β-glucosidase production capacity.

[0032] (3) Measurement of β-glucosidase enzyme activity Microbial fermentation broth: Saccharomyces cerevisiae Sc45-32 was ultrasonically disrupted (ice bath, 20% or 200W output, 3s ultrasound, 10s rest, repeated 30 times), centrifuged for 20 minutes at 2-8°C (5000 r / min), and the supernatant was collected by centrifugation. Enzyme activity was measured using a microbial β-glucosidase (β-glu) ELISA detection kit (Jiangsu Fermentation Kit). The measurement results showed that the β-glucosidase enzyme activity of Saccharomyces cerevisiae Sc45-32 was 44.32 ± 0.95 U / mL.

[0033] Example 3 Nutritional component measurement after yellow juice fermentation using Saccharomyces cerevisiae Sc45-32 (1) Preparation of soy milk: Wash 500g of dried soybeans, soak them in water overnight at room temperature, drain and wash them, and mix 1000g of wet soybeans with 5400mL of water in a soy milk grinder (model FSM-100, Shenyang Machinery No. 3 Factory, China) (ratio of wet soybeans to water = 1:5.4 w / v). Filter the resulting slurry through gauze to obtain soy milk. Heat the soy milk to 100°C and hold for 5 minutes. Pour 700mL of hot soy milk (100°C) into a stainless steel container and cool to 80±2°C. Slowly pour the acidic whey (fermented) solution (purchased from Laiwu Lijilong Qiancheng Tofu Workshop, Jinan, Shandong) into the stainless steel container, stirring gently at the same time, and stop adding the acidic whey when the soy milk coagulates. The volume of acidic whey used was approximately 185mL.

[0034] (2) Preparation of yellow juice medium: The fresh yellow juice prepared in step (1) above was centrifuged at 4000 rpm for 10 minutes to remove insoluble matter. The supernatant was collected and sterilized at 121°C for 15 minutes to obtain yellow juice medium.

[0035] The appearance of the aforementioned yellow juice culture medium is shown in Figure 4. The water, fat, protein, and total sugar content of three lots of yellow juice medium prepared using the method described above was measured. Water content was measured according to GB5009.3-2016, fat content according to GB5009.6-2016, protein content according to GB5009.5-2016, and total sugar content according to GB / T 15672-2009. The results are shown in Table 1.

[0036] Table 1 Nutritional Analysis of Yellow Juice JPEG0007910835000002.jpg49128 Note: Different lowercase letters indicate a statistically significant difference, p<0.05.

[0037] As can be seen from Table 1, the yellow juice exhibits a certain degree of lot stability. The yellow juice contains a large amount of water, as well as certain amounts of carbon and nitrogen sources, which are nutrients necessary for microbial growth. It has the basic conditions for microbial growth and can be used for microbial fermentation. No significant differences were observed in the measurement results, indicating that the lot stability of the yellow juice is good.

[0038] (3) Fermentation of yellow juice medium with Saccharomyces cerevisiae Sc45-32: 200 μL of Saccharomyces cerevisiae Sc45-32 strain, stored in a -80°C freezer, was taken and inoculated into YPD medium. The medium was activated by shaking overnight at 28°C and 150 r / min. The activated bacterial suspension was then inoculated at a 1% dose into the yellow juice medium prepared above, and fermented and cultured at 28°C and 150 r / min for 24 hours.

[0039] (4) Analysis of soy isoflavone content in fermented yellow juice by HPLC The fermented liquid and unfermented yellow juice medium were each mixed with 80% methanol solution for chromatography in a 1:1 ratio. The mixture was sonicated at 200W and 24kHz for 1 hour, then shaken and mixed. The mixture was centrifuged at 11000 r / min for 20 minutes, the supernatant was collected, filtered through a 0.22 μm organic filter, injected into a 1.5 mL sample vial, stored at -20°C, and subjected to HPLC analysis.

[0040] Measurement of soy isoflavone chromatography conditions by HPLC: Chromatography column: C18 column, Detector: Waters 2695 UV detector, Mobile phase: A: 0.1% (V / V) aqueous acetic acid solution, B: 10.1% (V / V) acetonitrile acetate solution, Column temperature: 35°C, Detection wavelength: 260 nm, Injection volume: 10 μL, Analysis time: 60 min. Gradient elution conditions are shown in Table 2:

[0041] Table 2 Gradient elution procedure JPEG0007910835000003.jpg70129

[0042] Preparation of standard curves: 1 mg each of daidzin, daidzein, genistin, genistein, glycitin, and glycitein standards were weighed and dissolved in 70% DMSO for chromatography to prepare a 500 μg / mL standard stock liquor. Appropriate amounts of each standard stock liquor were taken, and mixed standard solutions with concentrations of 50 μg / mL, 40 μg / mL, 30 μg / mL, 20 μg / mL, and 10 μg / mL were prepared using 70% DMSO. The mixed standard solutions of each concentration were analyzed by HPLC, and the chromatographic peak area of ​​each component at different concentrations was measured. Standard curves for the six standards were then created using linear regression, with the peak area (y) corresponding to the standard mass concentration (x) of each component.

[0043] Calculation of isoflavone content in fermented yellow juice: The peak area of ​​each component in the fermented yellow juice was measured by HPLC, and the values ​​were substituted into the standard curves of each standard product to determine the concentration of each component in the sample. The content of daidzin, glycitin, genistin, daidzein, glycitein, and genistein, as well as the percentage of soy isoflavone aglycone, were calculated. The results are shown in Figure 5. Compared to the unfermented control group (CK), the total soy isoflavone glycosides in the fermented yellow juice by Saccharomyces cerevisiae Sc45-32 decreased from 410.633±13.18 μg / mL to 51.2±0.58 μg / mL. The concentration of soy isoflavone aglycone increased from 9.818±1.23 μg / mL to 163.784±4.75 μg / mL. This indicates that as soy isoflavone glycosides decrease during the fermentation process, aglycone gradually increases, and soy isoflavone glycosides are sequentially converted to aglycone during fermentation. The proportion of soy isoflavone aglycone also increased from 2.33% before fermentation to 76.29%, demonstrating that Saccharomyces cerevisiae Sc45-32 has the ability to convert soy isoflavone glycosides to soy isoflavone aglycone.

[0044] Example 4 Measurement of hydroxylase activity of Saccharomyces cerevisiae Sc45-32 200 μL of Saccharomyces cerevisiae Sc45-32 was collected from a freezer stored at -80°C, inoculated into YPD liquid medium, and first activated by shaking overnight at 28°C and 150 r / min. Then, a 1% inoculation was added to yellow juice medium prepared using the above method, and fermented and cultured for 24 hours at 28°C and 150 r / min with shaking.

[0045] The enzyme activities of tyrosinase (TyR), cytochrome P450 hydroxylase (CYPH), and flavin monooxygenase (FMO) were measured using the following method:

[0046] (1) Measurement of CYP450 enzyme activity: Cells in the microbial fermentation broth were sonicated (ice bath, 20% or 200W output, sonication for 3 seconds, rest for 10 seconds, repeated 30 times), centrifuged for 20 minutes at 2-8°C (5000 r / min), the supernatant was collected after centrifugation, and measured using the microbial cytochrome P450 hydroxylase (CYPH) ELISA detection kit (Jiangsu Fermentation Immunity).

[0047] (2) Measurement of tyrosinase enzyme activity: Microbial fermentation broth was subjected to sonication of cells (ice bath, 20% or 200W output, sonication for 3s, rest for 10s, repeated 30 times), centrifuged for 20 minutes under conditions of 2-8°C (5000r / min), the supernatant was collected after centrifugation, and measured using a microbial tyrosinase (TyR) ELISA detection kit (Jiangsu Fermentation Immunity).

[0048] (3) Measurement of flavin monooxygenase (FMO) enzyme activity: Microbial fermentation broth was subjected to cell sonication (ice bath, 20% or 200W output, sonication for 3s, rest for 10s, repeated 30 times), centrifuged for 20 minutes under conditions of 2-8°C (5000r / min), the supernatant was collected after centrifugation, and measured using a microbial flavin monooxygenase (FMO) ELISA detection kit (Jiangsu Fermentation Immunity).

[0049] The results of the measurement of tyrosinase (TyR), cytochrome P450 hydroxylase (CYPH), and flavin monooxygenase (FMO) enzyme activity of Saccharomyces cerevisiae Sc45-32 are shown in Figure 6, indicating that Saccharomyces cerevisiae Sc45-32 has high tyrosinase (TyR), cytochrome P450 hydroxylase (CYPH), and flavin monooxygenase (FMO) enzyme activity.

[0050] Example 5 Application of the production of 4',6,7-trihydroxyisoflavones by hydroxylation of soy isoflavone aglycones of Saccharomyces cerevisiae Sc45-32

[0051] 1. Non-targeted LC-MS / MS mass spectral analysis of soy isoflavones in fermented yolk juice

[0052] 200 μL of Saccharomyces cerevisiae Sc45-32, stored in a -80°C freezer, was inoculated into YPD liquid medium. First, the inoculated bacterial suspension was activated by shaking overnight at 28°C and 150 r / min. Then, a 1% inoculation was added to yellow juice medium prepared using the above method, and fermentation culture was performed for 24 hours by shaking at 28°C and 150 r / min.

[0053] 400 μL of the fermented sample described above was taken, and 4',6,7-trihydroxyisoflavone was centrifuged at 4°C for 10 min. The supernatant was collected and subjected to measurement in an apparatus. The results are shown in Figure 7, and (4',6,7-Trihydroxyisoflavone) was detected in the fermented broth of Saccharomyces cerevisiae Sc45-32.

[0054] 2. Targeted LC-MS / MS mass spectral analysis of soy isoflavones in fermented yolk juice

[0055] 200 μL of Saccharomyces cerevisiae Sc45-32, stored in a -80°C freezer, was inoculated into YPD liquid medium. First, the inoculated bacterial suspension was activated by shaking overnight at 28°C and 150 r / min. Then, a 1% inoculation was added to the yellow juice medium prepared using the above method, and fermentation culture was performed for 24 hours by shaking at 28°C and 150 r / min.

[0056] After freezing and concentrating a 20 mL fermentation broth sample for 72 hours, it was redissolved in 10 mL of 80% methanol, extracted by sonication for 1 hour, centrifuged at 11000 r / min for 20 minutes to remove precipitate, and then 20 mL of 80% methanol for chromatography was added and sonicated again, followed by centrifuging at 11000 r / min for 20 minutes to remove precipitate. The supernatants were collected in parallel from the three resulting sets, the yellow juice was used as a blank, stored in a freezer at -20°C, and subjected to targeted LC-MS / MS analysis.

[0057] The mass spectrum of 4',6,7-trihydroxyisoflavones during target metabolism is shown in Figure 8, the soy isoflavone aglycone content in the fermented yellow juice is shown in Figure 9, and the 4',6,7-trihydroxyisoflavones content in the fermented yellow juice is shown in Figure 10.

[0058] As can be seen from Figures 8 to 10, 4',6,7-trihydroxyisoflavones were detected in the fermented soybean juice with Saccharomyces cerevisiae Sc45-32. After fermenting the soybean juice with Saccharomyces cerevisiae Sc45-32 for 24 hours, the total soybean isoflavone aglycone (Glycitein, Daidzein, Genistein) content increased from 403.86±13.80 ng / mL in the unfermented soybean juice to 11209.74±193.80 ng / mL, and the 4',6,7-trihydroxyisoflavones content increased from 6.61±0.20 ng / mL in the unfermented soybean juice to 403.12±9.06 ng / mL.

[0059] 3. Growth curve of Saccharomyces cerevisiae Sc45-32 Saccharomyces cerevisiae Sc45-32, stored in a -80°C freezer, was subcultured for two generations. A 1% inoculum was then added to yellow juice medium, and the culture was incubated at 28-30°C with shaking at 150 r / min for 24 hours. The OD (Oxygen Demand) after 24 hours of fermentation was measured using a microbial growth curve analyzer. 600 The value was measured, and OD600 represents the absorbance at 600 nanometers. This is a standard indicator for measuring bacterial concentration in microbial experiments; a higher value indicates a cloudier bacterial suspension and a higher bacterial count. Measurements were taken every two hours, with uninoculated yellow juice used as a control. The results are shown in Figure 11. Saccharomyces cerevisiae Sc45-32 reaches the logarithmic growth phase after approximately 8 hours of fermentation and the stationary phase after approximately 18 hours. This can be used as a "gold standard" to determine whether the fermentation process is normal, whether the yellow juice lot is stable, and whether or not contamination is present.

[0060] While preferred embodiments of the present invention have been described above, the invention is not limited to other forms, and those skilled in the art can modify or alter the technical content disclosed above to obtain equivalent variations and equivalent embodiments. However, any simple modifications, equivalent variations, and alterations made to the above embodiments based on the technical idea of ​​the present invention, as long as they do not deviate from the content of the technical means of the present invention, shall all be covered by the technical means of the present invention.

Claims

1. A Saccharomyces cerevisiae characterized by being Saccharomyces cerevisiae Sc45-32, with deposit number CGMCC No. 39082.

2. A method for producing hydroxylated soy isoflavone aglycones using Saccharomyces cerevisiae as described in claim 1.

3. The production method according to claim 2, wherein the hydroxylated soy isoflavone aglycone is 4',6,7-trihydroxyisoflavones.

4. The production method according to claim 3, comprising the step of using yellow juice as a culture medium and carrying out fermentation using Saccharomyces cerevisiae Sc45-32 with deposit number CGMCC No. 39082.

5. The production method according to claim 4, wherein the fermentation conditions are 28 to 30°C and 150 to 200 r / min, and fermentation culture is carried out for 18 to 48 hours.

6. The production method according to claim 4, wherein the amount of Saccharomyces cerevisiae Sc45-32 of deposit number CGMCC No. 39082 inoculated into the culture medium is 0.5 to 5%.

7. The production method according to claim 4, wherein the aforementioned yellow juice is yellow juice produced during the manufacturing process of processed legume products.

8. The production method according to claim 7, wherein the yellow juice produced during the manufacturing process of the processed legume product is a liquid by-product produced after pressing or filtering during the process of manufacturing a processed legume product using soybeans as a raw material.

9. The production method according to claim 8, wherein the processed bean product is tofu or yuba (tofu skin).

Citation Information

Patent Citations

  • Soy whey-based beverages

    JP2020517252A