Method for measuring cell concentration

JPWO2023054501A5Inactive Publication Date: 2025-09-22
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2023551618
Authority / Receiving Office
JP · JP
Patent Type
Applications
Priority Date
2022-09-28
Filing Date
2022-09-28
Publication Date
2025-09-22
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

Current methods for measuring cell concentration in samples, particularly in cell therapy research, are complex and lack a simple and efficient approach, as they require calibration curves specific to each biological matrix and separate measurement of target and external standard genes, leading to inaccuracies due to matrix effects.

Method used

The method involves using digital PCR (dPCR) to measure the copy number of specific and external standard genes in standard samples, creating a calibration curve, and then applying this curve to unknown samples to determine cell concentration, allowing for simultaneous measurement and correction across different matrices, thereby improving accuracy.

Benefits of technology

This approach enables highly accurate cell number quantification even when using calibration curves from different matrices, reducing errors and enhancing the efficiency of cell concentration measurement in various biological samples.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

Disclosed is a method for measuring a cell concentration in a sample, comprising: (1) a step of measuring the number of copies of a predetermined gene and an external standard gene in a plurality of standard samples of which cell concentrations are known, by using the digital PCR (dPCR); (2) a step of calibrating the measured value of the predetermined gene measured in the step (1) using the measured value of the external standard and preparing a calibration curve on the basis of the calibrated value and the known cell concentration; (3) a step of measuring the number of copies of the same predetermined gene and an external standard gene in a sample of which a cell concentration is unknown, by using the dPCR; and (4) a step of calibrating the measured value of the predetermined gene measured in the step (3) using the measured value of the external standard and determining a cell concentration by using the calibration curve prepared in the step (2) from the calibrated value.
Need to check novelty before this filing date? Find Prior Art

Description

How to measure cell concentration

[0001] The present invention relates to a method for determining cell concentration in a sample.

[0002] As part of the treatment of various diseases, research and development is underway in cell therapy, in which desired cells or tissues are produced by inducing differentiation from human-derived stem cells (e.g., iPS cells (induced pluripotent stem cells) and ES cells (embryonic stem cells)) and then transplanted into patients. Cell therapy products require measurement of cell concentration, but currently used methods are cumbersome, and no established, simple, and efficient measurement method exists.

[0003] Non-Patent Document 1 reports a method for quantifying cell concentration using a calibration curve prepared by quantitative PCR (qPCR), stating that a calibration curve is required for each tissue, and also describes that the sequence targeted by PCR is the Alu gene.

[0004] Non-Patent Document 2 reports that quantitative PCR (qPCR) using primers / probes designed based on the LINE-1 sequence enables quantification of human cells in various animals, including non-human primates. Patent Document 1 also reports the same, describing that the use of a probe hybridizable to a specific sequence of the human LINE-1 gene makes it possible to quantify and detect human cells by qPCR in a sample collected from a non-human animal to which human cells have been transplanted or administered.

[0005] Non-Patent Document 3 discloses a method for measuring the copy number of a target gene (CAR transgene) by qPCR using canine genomic DNA as an external standard gene in order to analyze the cell dynamics of chimeric antigen receptor (CAR) T cells in a biological sample. A similar report is also made in Patent Document 2.

[0006] In the above literature, real-time PCR is mainly used as qPCR. Another known type of qPCR is dPCR (digital PCR). dPCR is performed by limiting dilution of a biological sample so that each microcompartment contains zero or one (or multiple) copies of the target gene, followed by PCR, and estimating the absolute copy number of the target gene in the biological sample from the ratio of the number of microcompartments that gave a negative amplification signal (did not contain the target gene) to the total number of microcompartments.

[0007] International Publication No. 2019 / 240073 International Publication No. 2021 / 065877

[0008] Shimizu et al., Regenerative Therapy 15 251-257, 2020Yamamoto et al., Drug Metabolism and Pharmacokinetics 36 100359, 2021Yamamoto et al., Scientific Reports volume 10 17884, 2020

[0009] A matrix is ​​a substance contained in a measurement sample other than the object to be measured (for example, a substance that is extracted at the same time as DNA is extracted from a biological sample and cannot be completely removed). When quantifying human cells in a sample collected from an animal, including a human, that has been transplanted with or administered human cells using conventional real-time PCR, the matrix has a different composition for each biological sample (organ and blood), and therefore quantitation is affected by the type of biological sample collected (matrix effect), so it is necessary to create a calibration curve for each type of biological sample.

[0010] Furthermore, when an external standard is used to correct the DNA recovery rate when DNA is extracted from cells, the target gene and the external standard gene must be measured separately in real-time PCR.

[0011] The present invention aims to provide a method for measuring cell concentration in a sample, which enables simultaneous measurement of a target gene and an external standard gene, and enables highly accurate quantification of cell number even when using calibration curves of different matrices.

[0012] As a result of intensive research conducted by the present inventors to achieve the above object, they discovered that by measuring the copy numbers of a target gene and an external standard gene in a standard sample using dPCR, creating a calibration curve using the measured values ​​corrected with the external standard, and then determining the cell concentration using the calibration curve using the value obtained by correcting the copy number of the target gene in the sample measured with dPCR with the external standard, it is possible to quantitate cell number with high accuracy even when using calibration curves with different matrices. Furthermore, by using dPCR in this way, it is possible to simultaneously measure the target gene and the external standard gene.

[0013] The present invention was completed based on these findings and further investigations, and provides the following method for measuring cell concentration in a sample.

[0014] [1] A method for measuring cell concentration in a sample, comprising the following steps: (1) using digital PCR (dPCR) to measure the copy numbers of a specific gene and an external standard gene in multiple standard samples with known cell concentrations; (2) correcting the measured values ​​of the specific gene in step (1) using the measured values ​​of the external standard and creating a calibration curve based on the corrected values ​​and the known cell concentrations; (3) using dPCR to measure the copy numbers of the same specific gene and the external standard gene in a sample with an unknown cell concentration; and (4) correcting the measured values ​​of the specific gene in step (3) using the measured values ​​of the external standard and determining the cell concentration from the corrected values ​​using the calibration curve created in step (2). [1a] The method described in [1], wherein the digital PCR is droplet digital PCR (ddPCR). [2] The method described in [1] or [1a], wherein in step (1), the copy numbers of the specific gene and the external standard gene are measured simultaneously. [3] The method according to any one of [1] to [2], wherein the matrix of the standard sample used to prepare the calibration curve is different from the matrix of the sample used to measure the cell concentration. [4] The method according to any one of [1] to [3], wherein the accuracy of the cell concentration value determined in step (4) is within ±35%. [5] The method according to any one of [1] to [4], wherein the accuracy of the cell concentration value determined in step (4) is within ±35%. [6] The method according to any one of [1] to [5], wherein the specific gene is the LINE-1 gene. [7] The method according to any one of [1] to [5], wherein the specific gene is the REXO1L1 gene.

[0015] The method for measuring cell concentration of the present invention enables highly accurate quantification of cell numbers even when using calibration curves of different matrices, and also enables simultaneous measurement of target genes and external standard genes.

[0016] 1 is a graph showing the results of measurement by qPCR in Test Example 1. Left: accuracy (%) calculated from each matrix calibration curve before correction, center: accuracy (%) calculated from each matrix calibration curve after correction, right: accuracy (%) calculated from the liver calibration curve after correction.

[0034] FIG. 1 is a graph showing the results of measurement by ddPCR in Test Example 1. Left: accuracy (%) calculated from each matrix calibration curve before correction, center: accuracy (%) calculated from each matrix calibration curve after correction, right: accuracy (%) calculated from the liver calibration curve after correction.

[0035] FIG. 1 is a graph showing the number of human cells in each tissue and blood sample of mice to which human cells were intravenously administered in Test Example 4.

[0017] Hereinafter, embodiments of the present invention will be described in detail.

[0018] The term "comprise(s)" or "comprising" means the inclusion of, but is not limited to, the elements that follow the phrase. Thus, it implies the inclusion of the elements that follow the phrase, but does not imply the exclusion of any other elements. "Consist(s) of" means inclusive of and limited to, any elements that follow the phrase. Thus, the phrase "consisting of" indicates that the listed elements are required or essential, with other elements being substantially absent. "Consist(s) essentially of" means inclusive of any elements that follow the phrase, and is limited to other elements that do not affect the activity or function of the listed element as specified in this disclosure. Thus, the phrase "consisting essentially of" indicates that the listed elements are required or essential, but that other elements are optional and may or may not be present depending on whether they affect the activity or function of the listed elements.

[0019] As used herein, "accuracy" is a measure of the accuracy of a value, indicating its proximity to the true value. That is, the closer the mean value is to the true value, the higher the "accuracy."

[0020] As used herein, "precision" is a measure of the closeness of variation between the values ​​of multiple measurements.

[0021] The method of the present invention for measuring cell concentration in a sample is characterized by comprising the following steps: (1) measuring the copy number of a specific gene and an external standard gene in multiple standard samples with known cell concentrations using digital PCR (dPCR), (2) correcting the measured value of the specific gene measured in step (1) using the measured value of the external standard and creating a calibration curve based on the corrected value and the known cell concentration, (3) measuring the copy number of the same specific gene and the external standard gene in a sample with an unknown cell concentration using dPCR, and (4) correcting the measured value of the specific gene measured in step (3) using the measured value of the external standard and determining the cell concentration from the corrected value using the calibration curve created in step (2).

[0022] In the present invention, the sample for measuring the cell concentration is not particularly limited and includes, for example, a biological sample collected from a non-human animal to which human cells have been transplanted or administered, and a biological sample collected from a human to which human cells have been transplanted or administered, with a biological sample collected from a non-human animal to which human cells have been transplanted or administered being more preferred.

[0023] "Non-human animals" generally refers to animals other than humans, typically laboratory animals (including disease model animals) into which human cells are transplanted or administered. Examples of such laboratory animals include non-human primates (marmosets, cynomolgus monkeys, rhesus monkeys, tufted capuchin monkeys, chimpanzees, etc.), cattle, pigs, goats, sheep, dogs, rabbits, and rodents (mice, rats, etc.). Non-human primates (order Primates) include chimpanzees (subtribe), gorillas (tribe), orangutans (subfamily), gibbons (family), Cercopithecus (superfamily, family), spider monkeys (family), tarsiers (family), and lemurs (infraorder, family). Examples of long-tailed monkeys (monkeys of the Cercopithecidae family) include monkeys of the genus Macaque, such as cynomolgus monkeys, rhesus monkeys, and Japanese macaques.

[0024] The biological sample collected from a non-human animal or human is not particularly limited as long as it can be used to prepare a sample for dPCR, and various organs, tissues, cell populations, and body fluids can be used as the biological sample. Organs from which biological samples can be collected include, for example, the brain (e.g., olfactory bulb, amygdala, basal ganglia, hippocampus, thalamus, hypothalamus, subthalamic nucleus, cerebral cortex, medulla oblongata, cerebellum, occipital lobe, frontal lobe, temporal lobe, putamen, caudate nucleus, brainstem, substantia nigra, whole brain, etc.), spinal cord, pituitary gland, stomach, pancreas, kidney, liver, gonads, thyroid, gallbladder, bone marrow, adrenal gland, skin, muscle, lung, digestive tract (e.g., large intestine, small intestine, etc.), blood vessels, heart, thymus, spleen, submandibular gland, peripheral blood, peripheral blood cells, prostate, testes, testes, ovaries, placenta, uterus, bone, joints, and skeletal muscle. Tissues and cell populations contained in these organs can also be used as biological samples. The biological sample may be a cancerous tissue or cell population. Examples of body fluids include blood, plasma, serum, lymph, cerebrospinal fluid, saliva, bile, urine, and stool.

[0025] The human cells to be transplanted or administered to a non-human animal or human are not particularly limited, as long as they can be transplanted or administered to an organ or the like of a non-human animal or human as described above, and human genomic DNA can be extracted from them when preparing a sample for dPCR. Examples of such human cells include splenocytes, neurons, glial cells, pancreatic beta cells, bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells, fibroblasts, fibrocytes, muscle cells (e.g., skeletal muscle cells, cardiac muscle cells, myoblasts, and satellite cells), adipocytes, immune cells (e.g., macrophages, T cells, B cells, natural killer cells, mast cells, neutrophils, basophils, eosinophils, monocytes, and megakaryocytes), synoviocytes, chondrocytes, osteocytes, osteoblasts, osteoclasts, mammary gland cells, hepatocytes, stromal cells, oocytes, and sperm cells, as well as stem cells (including induced pluripotent stem cells (iPS cells) and embryonic stem cells (ES cells)) that can be induced to differentiate into these cells, progenitor cells, blood cells, oocytes, and fertilized eggs. Furthermore, human cells also include the above-mentioned human-derived cells produced by inducing the differentiation of the above-mentioned stem cells in vitro.

[0026] Before measurement by dPCR, the sample can be subjected to various pretreatments as appropriate. Such pretreatments include, for example, DNA extraction from biological samples. The DNA extraction method is not particularly limited, and known methods can be appropriately selected, such as phenol-chloroform extraction, cetyltrimethylammonium bromide (CTAB) method, alkaline heat extraction, commercially available DNA extraction kits (e.g., MagMAX DNA Multi-Sample Ultra 2.0 Kit), commercially available DNA extraction equipment (e.g., KingFisher Flex), and the like.

[0027] The specific gene in the present invention is a gene used for measuring cell concentration, and can be selected from, for example, genes contained in human cells. Among these, genes that enable quantification of human cells in various animals, including non-human primates, i.e., genes having a sequence specific to humans, are preferred. Examples of such specific genes include LINE-1, REXO1L1, Alu, DUF1220, SPDYE3, GOLGA8G, HRNR, USP17, GOLGA6L9, PSG3, and TCEB3C. When transplanting or administering human cells into a human, if there is a difference in gene sequence between the cells to be transplanted or administered and the human to be transplanted or administered, targeting that site makes it possible to quantitate human cells. For example, when the cells to be transplanted or administered are male and the human to be transplanted or administered is female, examples include targeting a Y chromosome-specific gene or utilizing SNP. In the present invention, the specific gene is not limited to a region encoding protein or RNA.

[0028] The nucleotide sequence of the human LINE-1 ("Long interspersed nucleotide factor-1", "Long interspersed nuclear elements-1") gene is registered under a given accession number in the GenBank database provided by NCBI (National Center for Biotechnology Information) (e.g., GenBank Accession No.: KP237032, GenBank Accession No.: JN698885, GenBank Accession No.: GU477637, etc.). There are many families of human LINE-1 genes, and as used herein, "human LINE-1 gene" also includes family genes other than those exemplified above.

[0029] The nucleotide sequence of the human REXO1L1 ("REXO1 like 1", REXO1L1P, GOR) gene (Entrez Gene ID: 254958) is registered under a specific accession number in the RefSeq database provided by NCBI (RefSeq accession number: NG_053157 REGION: 101..1255).

[0030] The human Alu (Arthrobacter luteus) gene is a short strand of DNA originally characterized by the action of the Alu restriction enzyme. It is the most abundant transposable element present in the human genome, with over one million copies distributed throughout the genome, enabling highly sensitive detection of genomic DNA derived from human cells in animals (see Non-Patent Document 1).

[0031] The human DUF1220 gene (Oldubai protein domain) (Entrez Gene ID: 400818) is the human-specific multicopy gene with the highest copy number of any coding region in the genome, and is similar to the human-specific Alu gene.

[0032] Gene IDs for genes other than those mentioned above are as follows: Human SPDYE3 ("speedy / RINGO cell cycle regulator family member E3", SPDYB2) gene: Entrez Gene ID: 441272 Human GOLGA8G ("golgin A8 family member G", GOLGA8F) gene: Entrez Gene ID: 283768 Human HRNR ("hornerin", FLG3, S100A16, S100a18) gene: Entrez Gene ID: 388697 Human USP17 ("ubiquitin specific peptidase 17 like family member 2", USP17L2, DUB3, DUB-3) gene: Entrez Gene ID: 377630 Human GOLGA6L9 ("golgin A6 family like 9", GOLGA6L20) gene: Entrez Gene ID: 440295 Human PSG3 ("pregnancy specific beta-1-glycoprotein 3") gene: Entrez Gene ID: 5671 Human TCEB3C ("elongin A3, pseudogene", ELOA3P, ELOA3, ELOA3A, HsT829, ELOA3AP, TCEB3L2) gene: Entrez Gene ID: 162699

[0033] The external standard gene in the present invention is a gene used as an external standard for correcting the quantitative value of a specific gene in dPCR, and is a DNA having a base sequence that does not cross-react with the specific gene, i.e., is not amplified by primers for the specific gene. Conversely, the external standard gene must also have a base sequence that does not cross-react with the specific gene and other genes in the biological sample. It is desirable that the external standard gene contain a base sequence (gene, etc.) that is not possessed by humans. By using such an external standard gene, the impact of fluctuations in the recovery rate of the specific gene on the quantitative value can be suppressed, making it possible to improve accuracy.

[0034] The external standard gene is not particularly limited as long as it is a gene having a base sequence with the above-mentioned characteristics. Representative external standard genes include genomic DNA of mammals other than humans, preferably mammals other than primates, such as cows, pigs, goats, sheep, dogs, cats, rabbits, and rodents (mouse, rats, etc.). Furthermore, artificial nucleic acids containing artificially designed and synthesized sequences may also be used as external standard genes. The external standard gene is not limited to regions encoding proteins and RNAs, and the entire region of genomic DNA can be widely used.

[0035] The external standard gene may be DNA that has been isolated in advance so that the amount to be added can be easily adjusted, or may be DNA contained in the cells of a mammal other than human. The amount of the external standard gene to be added to the sample is not particularly limited and can be adjusted as appropriate.

[0036] dPCR is performed by limiting dilution of a biological sample so that each microcompartment (well or droplet) contains 0 or 1 (or more) target genes, followed by PCR, and estimating the absolute copy number of the target gene in the biological sample from the ratio of the number of microcompartments with a negative amplification signal (that did not contain the target gene) to the total number of microcompartments. During this estimation, the possibility of the presence of microcompartments containing multiple target genes is corrected using a Poisson distribution. The amplification signal in dPCR can be based on a fluorescent probe method (e.g., TaqMan method, molecular beacon method, cycling probe method), an intercalator method using a reagent that emits fluorescence by binding to double-stranded DNA, or the like. In addition, in the present invention, dPCR is preferably droplet digital PCR (ddPCR), and ddPCR is a dPCR in which droplets (droplets) are created using microchannel technology or the like when creating microcompartments, and PCR is performed on each droplet.

[0037] Basic reagents, kits, devices, etc. for performing dPCR are also commercially available, and these can also be used in the present invention. Examples of commercially available dPCR devices include BIO-RAD's QX200 Droplet Digital PCR System, QX ONE Droplet Digital PCR System, Thermo Fisher Scientific's QuantStudio™ 3D digital PCR System, and Qiagen's QIAcuity Digital PCR System. The base sequences and base lengths of the primers (forward and reverse primers) for the specific gene and external standard gene required for performing dPCR, and the probes used when employing the fluorescent probe method, can be appropriately designed by those skilled in the art so that the specific gene and external standard gene can be specifically amplified (without cross-reacting with other genes) (see, for example, WO 2019 / 240073). The probes and primers may be sequences that are completely complementary to the target sequence, may contain mismatches, or may have a base sequence that is homologous to the target sequence to a degree that allows hybridization under high stringency (stringent hybridization conditions). The fluorescent substance and the quencher that form a FRET pair with the fluorescent substance used when the fluorescent probe method is employed are not particularly limited and can be appropriately determined by a person skilled in the art. Furthermore, measurement of the copy number of a gene by dPCR can be carried out according to a known method, for example, according to the manual of the manufacturer of the dPCR device.

[0038] Step (1) In step (1), the copy numbers of a specific gene and an external standard gene in multiple standard samples with known cell concentrations are measured using dPCR to create a calibration curve.

[0039] A wide variety of methods capable of adjusting cell concentrations can be used to prepare standard samples. Examples include visual counting under a microscope using a hemocytometer, using an automated cell counter, and using a flow cytometer. Once the concentration of one type of cell can be adjusted, the concentrations of other cells can be adjusted by serial dilution. Standard samples can be prepared by adding cells at each concentration adjusted in this way to the above-mentioned biological sample. In addition to biological samples, cells may also be added to cell culture media and buffers.

[0040] The number of concentrations of standard samples to be used in step (1) is not particularly limited as long as it is possible to draw a calibration curve, and is, for example, 2 or more, preferably 3 or more, more preferably 4 or more, even more preferably 5 or more, and particularly preferably 6 or more, with the upper limit being, for example, 30.

[0041] The number of standard samples for each known concentration used in step (1) is not particularly limited, and may be, for example, one or more, preferably two or more, and more preferably two.

[0042] In step (1), when standard samples with known cell concentrations are used as QC (quality control) rather than for preparing a calibration curve, the number of standard samples for each known concentration is not particularly limited and is, for example, 3 or more, preferably 4 or more, more preferably 5 or more, and even more preferably 6 or more, with an upper limit of, for example, 100.

[0043] By performing dPCR, it is possible to simultaneously measure the copy number of a specific gene and the copy number of an external standard gene, and therefore it is preferable to simultaneously measure the copy number of a specific gene and the copy number of an external standard gene.

[0044] Step (2) In step (2), the measured value of the specific gene measured in step (1) is corrected using the measured value of an external standard, and a calibration curve is created based on the corrected value and the known cell concentration.

[0045] The method for correcting the measurement value of the specific gene measured in step (1) using the measurement value of the external standard is not particularly limited. For example, (measurement value of the specific gene / measurement value of the external standard) can be calculated and used as the corrected value.

[0046] The calibration curve can be prepared by a conventional method such as the least squares method using software.

[0047] Step (3) In step (3), the copy numbers of the same specific gene and an external standard gene in a sample with an unknown cell concentration are measured using dPCR.

[0048] By performing dPCR, it is possible to simultaneously measure the copy number of a specific gene and the copy number of an external standard gene, and therefore it is preferable to simultaneously measure the copy number of a specific gene and the copy number of an external standard gene.

[0049] Step (4) In step (4), the measured value of the specific gene measured in step (3) is corrected using the measured value of an external standard, and the cell concentration is determined from the corrected value using the calibration curve created in step (2).

[0050] The method for correcting the measurement value of the specific gene measured in step (3) using the measurement value of the external standard is not particularly limited, and for example, (measurement value of the specific gene / measurement value of the external standard) can be calculated and used as the corrected value. The final measurement value is the number of cells per unit amount (mass, volume) of the sample, and can be expressed in units such as "cells / μL blood" or "cells / mg tissue."

[0051] The accuracy of the cell concentration value determined in step (4) is preferably within ±35%, more preferably within ±30%, even more preferably within ±25%, particularly preferably within ±20%, and most preferably within ±15%. The "accuracy" value here is the difference between the average determined cell concentration value and the known concentration, expressed as a percentage of the known concentration (relative error, RE).

[0052] It is also desirable that the accuracy of the cell concentration value determined in step (4) meets the following criteria: (1) 67% or more of all QC samples are within the specified value, and (2) 50% or more of each concentration are within the specified value, and (3) the average value of each concentration is within the specified value. Examples of the specified value include ±35%, ±30%, ±25%, ±20%, and ±15%.

[0053] The accuracy of the cell concentration determined in step (4) is preferably within ±35%, more preferably within ±30%, even more preferably within ±25%, particularly preferably within ±20%, and most preferably within ±15%. The "accuracy" value here refers to the coefficient of variation (CV).

[0054] The accuracy and precision shown above can be calculated by using a standard sample with a known cell concentration as a QC.

[0055] By measuring the cell concentration in a sample using the method of the present invention, it is possible to quantify the number of cells with high accuracy even if the matrix of the standard sample used to prepare the calibration curve is different from the matrix of the sample used to measure the cell concentration. Therefore, in order to measure the cell concentration efficiently, it is desirable that the matrix of the standard sample used to prepare the calibration curve is different from the matrix of the sample used to measure the cell concentration. In other words, it is possible to prepare a calibration curve using one type of matrix and then use that calibration curve to quantify the number of cells in many other types of matrices.

[0056] The following examples are provided to further explain the present invention. However, the present invention is not limited to these examples. In the examples, qPCR refers to real-time PCR.

[0057] Primers and probes The following primers and probes were used in the following experiments: LINE1 SEQ ID NO: 1: TGAGTTCATATCCTTTGTAGGGA SEQ ID NO: 2: CCATTACTGGGTATATACCCAAATGAG SEQ ID NO: 3: GCGCTGCACCCACTAATGT External standard gene SEQ ID NO: 4: GCCTTGGCTGCGCAGGCTGCTGTGGTGCAG SEQ ID NO: 5: CGCCCATGTATTACTTCATCTGTTGCC SEQ ID NO: 6: CACGGCGATGGCGCCCAGGAA REXO1L1 SEQ ID NO: 7: TTGCCCCAAGTCCAA SEQ ID NO: 8: TCGCCCAAGACGAGCATCA SEQ ID NO: 9: TTTGGGCGCTGAAAAAGCT

[0058] Test Example 1 Amplification of DNA derived from human cells in CB-17 SCID mouse samples ATL solution (150 μL, DNeasy Blood & Tissue Kits, QIAGEN) prepared by dissolving 15 mg of liver, kidney, heart, and testis, and 7.5 mg of lung and spleen from CB-17 SCID mice, and 50 μL of blood were used as samples. Human cells (peripheral blood T cells, Cryo-T8: Human CD8) equivalent to 30, 100, 1,000, 5,000, 30,000, and 100,000 cells, respectively, were added to the samples. + Standard curve samples (n = 2) were prepared by adding 70 μL of ATL solution containing negatively selected (5-8M cells, Precision Bioservices), and a blank sample was prepared by adding 70 μL of ATL solution without human cells. QC samples (n = 4) corresponding to 30, 100, 1,000, and 10,000 cells were prepared in the same manner as above. Dog Genomic DNA, Male (Zyagen) was added to all samples as an external standard gene to correct for DNA recovery. Genomic DNA was extracted from each of these samples using a commercially available DNA extraction reagent (DNeasy Blood & Tissue Kits, QIAGEN), and the same extracts were then used for qPCR and ddPCR quantification, respectively.

[0059] qPCR was performed using TaqPath ProAmp Master Mixes (containing a DNA polymerase with 5' to 3' exonuclease activity (Thermo Fisher Scientific)), the probe of SEQ ID NO: 1 (10 pmol / well), the forward primer of SEQ ID NO: 2 (20 pmol / well), and the reverse primer of SEQ ID NO: 3 (20 pmol / well). qPCR was performed using a QuantStudio 7 System (Thermo Fisher Scientific) with 40 cycles of 50°C for 2 minutes, 95°C for 10 minutes, and (95°C for 15 seconds and 60°C for 1 minute). Measurement of the target gene and external control gene were performed separately in qPCR.

[0060] ddPCR was performed using ddPCR Multiplex Supermix (BIO-RAD), DTT (BIO-RAD), restriction enzyme ScaI (Takara Bio Inc.), the probe of SEQ ID NO: 1 (5 pmol / well), the forward primer of SEQ ID NO: 2 (54 pmol / well), the reverse primer of SEQ ID NO: 3 (54 pmol / well), the probe of SEQ ID NO: 4 (5 pmol / well), the forward primer of SEQ ID NO: 5 (10 pmol / well), and the reverse primer of SEQ ID NO: 6 (10 pmol / well). ddPCR was performed using a QX200 Droplet Digital PCR System (BIO-RAD) with 45 cycles of 95°C for 10 minutes, 94°C for 30 seconds, and (94°C for 30 seconds and 58°C for 1 minute 30 seconds) followed by 98°C for 10 minutes.

[0061] For qPCR measurements, a calibration curve was constructed from the Ct value of the target gene and the cell count of each calibration sample. A calibration curve was also constructed from the difference between the Ct value of the target gene and the Ct value of the external standard gene (Delta Ct) and the cell count of each calibration sample. The accuracy of the QC sample calculated using these calibration curves is shown in Figure 1. Circles indicate the accuracy of each QC sample, horizontal lines indicate the mean, and dotted lines indicate ±35%. While the accuracy (relative error, RE) of some QC samples calculated using the calibration curve constructed from the Ct value of the target gene and the cell count of each calibration sample was outside the ±35% range, correction for the external standard gene was found to improve accuracy. Furthermore, the accuracy of all organ and blood QC samples was calculated using the liver calibration curve corrected for the external standard gene, and the results are shown in Figure 1 and Table 1. Although the accuracy (RE) was generally within ±35% for all organs, 38% of the blood QC samples were outside the ±35% range (Fig. 1), and the mean values ​​exceeded 35% for the blood QC samples (1000 cells / 50 μL) and liver QC samples (1000 and 10,000 cells / 15 mg) (Table 1).

[0062] For ddPCR measurements, a calibration curve was constructed from the copy number of the target gene and the cell count of each calibration sample. Additionally, a calibration curve was constructed from the copy number of the target gene divided by the copy number of the external standard gene and the cell count of each calibration sample. The accuracy of the cell counts of each QC sample calculated using these calibration curves is shown in Figure 2. Similar to the results of qPCR measurements, accuracy was improved by correcting for the external standard gene. The accuracy of QC samples with other matrices was also calculated from the corrected liver calibration curves, as shown in Figure 2 and Table 1. Although the accuracy (RE) exceeded 35% for two samples in testis and blood, the mean RE and precision (coefficient of variation, CV, %) for the mean values ​​at each concentration were within ±35%, demonstrating satisfactory results. It is believed that excellent quantitation was achieved by correcting for recovery using the external standard gene and avoiding matrix effects using ddPCR.

[0063]

[0064] [Test Example 2] Day-to-day reproducibility test / amplification of human cell-derived DNA in CB-17 SCID mouse samples A DNA / RNA shield solution (200 μL, ZYMO RESEARCH) prepared by dissolving 20 mg of CB-17 SCID mouse liver was used as a sample, and human cells (peripheral blood T cells, Cryo-T8: Human CD8 + Standard curve samples (n = 2) were prepared by adding 70 μL of DNA / RNA shield solution containing negatively selected (5-8M cells, Precision Bioservices), and a blank sample was prepared by adding 70 μL of DNA / RNA shield solution without human cells. QC samples (n = 4) equivalent to 3, 100, 1,000, and 10,000 cells were prepared using the same method as above from the liver, kidney, heart, lung, spleen, testis, and blood of CB-17 SCID mice. Dog Genomic DNA, Male (Zyagen) was added to all samples as an external standard gene for DNA recovery correction. Genomic DNA was extracted from each of these samples using a commercially available DNA extraction reagent (MagMAX DNA Multi-Sample Ultra 2.0 Kit, Applied Biosystems) and a Kingfisher Flex (Thermo Fisher Scientific) extractor, followed by ddPCR quantification.

[0065] ddPCR was performed in duplex using ddPCR Multiplex Supermix (BIO-RAD), DTT (BIO-RAD), restriction enzyme ScaI (Takara Bio Inc.), the probe of SEQ ID NO: 1 (5 pmol / well), the forward primer of SEQ ID NO: 2 (54 pmol / well), the reverse primer of SEQ ID NO: 3 (54 pmol / well), the probe of SEQ ID NO: 4 (5 pmol / well), the forward primer of SEQ ID NO: 5 (10 pmol / well), and the reverse primer of SEQ ID NO: 6 (10 pmol / well). ddPCR was performed using a QX200 Droplet Digital PCR System (BIO-RAD) with 45 cycles of 95°C for 10 minutes, 94°C for 30 seconds, and (94°C for 30 seconds and 58°C for 1 minute 30 seconds) followed by 98°C for 10 minutes. The above steps were performed three times to confirm interday reproducibility.

[0066] A calibration curve was created from the value obtained by dividing the copy number of the target gene by the copy number of the external standard gene and the cell count of each calibration curve sample. The cell count of each QC sample was calculated using this calibration curve, and the results are shown in Table 2. For all QC samples, the average accuracy (RE) of the calculated value relative to the added cell count (nominal), the accuracy (RE) of more than 50% of the QC samples at each concentration, and the accuracy (RE) and precision (CV) of more than two-thirds of the total QC samples were all within ±35%, demonstrating the excellent quantitative performance of this method.

[0067]

[0068] [Test Example 3] Examination of strain differences / Amplification of human cell-derived DNA in NSG and NOG mouse samples A DNA / RNA shield solution (200 μL, ZYMO RESEARCH) prepared by dissolving 20 mg of CB-17 SCID mouse liver was used as a sample, and human cells (peripheral blood T cells, Cryo-T8: Human CD8 +A calibration curve sample (n = 2) was prepared by adding 70 μL of DNA / RNA shield solution containing negatively selected (5-8M cells, Precision Bioservices), and a blank sample was prepared by adding 70 μL of DNA / RNA shield solution without human cells. scid Il2rg tm1Wjl / SzJ mice (NSG), NOD.Cg-Prkdc scid Il2rg tm1Sug QC samples (n = 4) equivalent to 100 cells were prepared from the liver, heart, kidney, spleen, lung, testis, and blood of 1 / ShiJic mice (NOG). Dog Genomic DNA, Male (Zyagen) was added to all samples as an external standard gene to normalize DNA recovery. Genomic DNA was extracted from each of these samples using a commercially available DNA extraction reagent (MagMAX DNA Multi-Sample Ultra 2.0 Kit, Applied Biosystems) and Kingfisher Flex (Thermo Fisher Scientific), followed by ddPCR quantification.

[0069] ddPCR was performed in duplex using ddPCR Multiplex Supermix (BIO-RAD), DTT (BIO-RAD), restriction enzyme ScaI (Takara Bio Inc.), the probe of SEQ ID NO: 1 (5 pmol / well), the forward primer of SEQ ID NO: 2 (54 pmol / well), the reverse primer of SEQ ID NO: 3 (54 pmol / well), the probe of SEQ ID NO: 4 (5 pmol / well), the forward primer of SEQ ID NO: 5 (10 pmol / well), and the reverse primer of SEQ ID NO: 6 (10 pmol / well). ddPCR was performed using a QX200 Droplet Digital PCR System (BIO-RAD) with 45 cycles of 95°C for 10 minutes, 94°C for 30 seconds, and (94°C for 30 seconds and 58°C for 1 minute 30 seconds) followed by 98°C for 10 minutes.

[0070] A calibration curve was created using the target gene copy number divided by the external standard gene copy number and the cell count of the calibration curve sample. The cell counts of QC samples from NSG and NOG mice were calculated using this CB-17 SCID mouse liver calibration curve. The results are shown in Table 3. For all QC samples from each mouse, the average accuracy (RE) of the calculated values ​​relative to the nominal number of added cells, the accuracy (RE) of over 50% of the QC samples in each matrix, and the accuracy (RE) and precision (CV) of over two-thirds of the total QC samples were within ±35%, providing excellent results. This method demonstrates the feasibility of quantifying samples from different strains using the same calibration curve.

[0071]

[0072] [Test Example 4] Cell Administration Test / Amplification of DNA Derived from Human Cells in CB-17 SCID Mouse Samples CB-17 SCID mice were inoculated with 1,000,000 human cells (peripheral blood T cells, Cryo-T8: Human CD8 + Negatively Selected (5-8M cells, Precision Bioservices) was administered intravenously, and the liver, kidney, heart, lung, spleen, testis, and blood were collected 10 minutes, 1 hour, and 24 hours after administration and used as cell-administered samples for DNA extraction. DNA / RNA shield solution (200 μL, ZYMO RESEARCH) prepared by dissolving 20 mg of CB-17 SCID mouse liver was used as a standard curve sample, to which were added 3, 100, 1,000, 3,000, 5,000, and 10,000 human cells (peripheral blood T cells, Cryo-T8: Human CD8 +Standard curve samples (n = 2) were prepared by adding 70 μL of DNA / RNA shield solution containing negatively selected (5-8M cells, Precision Bioservices), and a blank sample was prepared by adding 70 μL of DNA / RNA shield solution without human cells. Samples included 200 μL of DNA / RNA shield solution containing liver, kidney, heart, lung, spleen, and testis (ZYMO RESEARCH), and 50 μL of blood. Dog Genomic DNA, Male (Zyagen) was added to all samples as an external standard gene for DNA recovery correction. Genomic DNA was extracted from each sample using commercially available DNA extraction reagents (MagMAX DNA Multi-Sample Ultra 2.0 Kit, Applied Biosystems) and Kingfisher Flex (Thermo Fisher Scientific), followed by ddPCR quantification.

[0073] ddPCR was performed in duplex using ddPCR Multiplex Supermix (BIO-RAD), DTT (BIO-RAD), restriction enzyme ScaI (Takara Bio Inc.), the probe of SEQ ID NO: 1 (5 pmol / well), the forward primer of SEQ ID NO: 2 (54 pmol / well), the reverse primer of SEQ ID NO: 3 (54 pmol / well), the probe of SEQ ID NO: 4 (5 pmol / well), the forward primer of SEQ ID NO: 5 (10 pmol / well), and the reverse primer of SEQ ID NO: 6 (10 pmol / well). ddPCR was performed using a QX200 Droplet Digital PCR System (BIO-RAD) with 45 cycles of 95°C for 10 minutes, 94°C for 30 seconds, and (94°C for 30 seconds and 58°C for 1 minute 30 seconds) followed by 98°C for 10 minutes.

[0074] A standard curve was created from the value obtained by dividing the copy number of the target gene by the copy number of the external standard gene and the cell number of the standard curve sample. Using this standard curve, human cells (peripheral blood T cells, Cryo-T8: Human CD8 + Negatively Selected (5-8M cells, Precision Bioservices) was administered intravenously at 1,000,000 cells / animal, and the cell counts in each tissue and blood sample of mice were calculated. The results are shown in Figure 3.

[0075] Test Example 5 Amplification of DNA derived from human cells in CB-17 SCID mouse samples (REXO1L1) ddPCR quantification was performed using the REXO1L1 gene in the DNA extract obtained in Test Example 2. Samples ranging from 10 to 10,000 cells were measured for the calibration curve, and samples ranging from 100 to 10,000 cells were measured for the QC samples.

[0076] ddPCR was performed using ddPCR Multiplex Supermix (BIO-RAD), DTT (BIO-RAD), restriction enzyme ScaI (Takara Bio Inc.), the probe of SEQ ID NO: 7 (5 pmol / well), the forward primer of SEQ ID NO: 8 (54 pmol / well), the reverse primer of SEQ ID NO: 9 (54 pmol / well), the probe of SEQ ID NO: 4 (5 pmol / well), the forward primer of SEQ ID NO: 5 (10 pmol / well), and the reverse primer of SEQ ID NO: 6 (10 pmol / well). ddPCR was performed using a QXONE (BIO-RAD) kit. DNA was amplified and quantified using 45 cycles of 95°C for 10 minutes, 94°C for 30 seconds, and (94°C for 30 seconds and 58°C for 1 minute 30 seconds) at 98°C for 10 minutes.

[0077] A standard curve was created from the value obtained by dividing the copy number of the target gene by the copy number of the external standard gene and the cell count of each standard curve sample. The cell count of each QC sample was calculated using this standard curve, and the results are shown in Table 4. The average accuracy (RE) of the calculated value relative to the added cell count (nominal), the accuracy (RE) of more than 50% of the QC samples at each concentration, and the accuracy (RE) and precision (CV) of more than two-thirds of the total QC samples were all within ±35%, which was good.

[0078]

[0079] This application is based on Japanese Patent Application No. 2021-160065 filed on September 29, 2021, the contents of which are incorporated in their entirety herein.

Claims

1. A method for measuring the cell concentration in a sample, comprising the following steps: (1) measuring the copy numbers of a specific gene and an external standard gene in a plurality of standard samples with known cell concentrations using digital PCR (dPCR); (2) correcting the measured value of the specific gene measured in step (1) using the measured value of the external standard, and creating a calibration curve based on the corrected value and the known cell concentration; (3) measuring the copy numbers of the same specific gene and the external standard gene in a sample with unknown cell concentration using dPCR; and (4) correcting the measured value of the specific gene measured in step (3) using the measured value of the external standard, and determining the cell concentration using the calibration curve created in step (2) from the corrected value.

2. The method according to claim 1, wherein in step (1), the measurement of the copy number of the specific gene and the measurement of the copy number of the external standard gene are performed simultaneously.

3. The method according to claim 1, wherein the matrix of the standard sample used to create the calibration curve is different from the matrix of the sample used for measuring the cell concentration.

4. The method according to claim 1, wherein the accuracy of the cell concentration value determined in step (4) is within ±35%.

5. The method according to claim 1, wherein the precision of the cell concentration value determined in step (4) is within ±35%.

6. The method according to claim 1, wherein the specific gene is the LINE-1 gene.

7. The method according to claim 1, wherein the specific gene is the REXO1L1 gene.