Protein expression enhancer, composition, method for producing cells, method for producing viruses or antibodies, and use for enhancing expression of viruses or antibodies
Patent Information
- Application Number
- JP2024568919
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Filing Date
- 2025-06-25
- Publication Date
- 2025-09-16
AI Technical Summary
Current protein drug production, such as antibody and gene therapy drugs using viral vectors, faces low productivity issues, leading to high drug prices due to inefficient protein expression in cells.
A nucleic acid with a specific RNA base sequence (SEQ ID NO: 1) or its corresponding DNA is introduced into cells to enhance protein expression, increasing productivity by up to 2 times, specifically for adeno-associated virus (AAV) vector production.
The nucleic acid significantly enhances protein expression efficiency, demonstrated by increased AAV vector productivity, reducing production costs and improving protein drug manufacturing efficiency.
Abstract
Description
Nucleic acids for enhancing protein expression
[0001] The present invention relates to nucleic acids, vectors, compositions, cells for enhancing protein expression, and uses thereof, as well as methods for producing proteins and methods for enhancing protein expression.
[0002] In recent years, many protein drugs such as antibody drugs and gene therapy drugs using viral vectors have been developed. Proteins such as antibodies and viral vectors used in the above drugs are produced by expressing the protein in cells, etc. However, the low productivity of these methods is one of the reasons why the prices of the above drugs are extremely high.
[0003] For example, it is known that adeno-associated virus (AAV) vector-producing cells that contain and express any one of miRNAs hsa-miR-324, hsa-miR-196a1, and hsa-miR-342 and further contain a nucleic acid that expresses an element essential for viral particle formation of an adeno-associated virus (AAV) vector increase the productivity of adeno-associated virus (AAV) vectors, but no method is known for increasing the productivity of vectors other than adeno-associated virus (AAV) vectors (see Patent Document 1).
[0004] Therefore, there has been a demand for nucleic acids for enhancing protein expression that can enhance protein expression with high efficiency.
[0005] Patent No. 6093358
[0006] The present invention aims to solve the above-mentioned problems of the prior art and to achieve the following objectives: Namely, the present invention provides a nucleic acid for enhancing protein expression that can enhance protein expression with high efficiency, a vector and composition containing the nucleic acid for enhancing protein expression, a cell into which the nucleic acid for enhancing protein expression has been introduced, uses of these, and a method for producing a protein and a method for enhancing protein expression using the nucleic acid for enhancing protein expression.
[0007] As a result of intensive research conducted by the present inventors to achieve the above-mentioned object, they have found that it is possible to provide a protein expression-enhancing nucleic acid that can highly efficiently enhance protein expression using a protein expression-enhancing nucleic acid that comprises RNA consisting of the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to said RNA, a vector and composition that comprise said protein expression-enhancing nucleic acid, a cell into which said protein expression-enhancing nucleic acid has been introduced, uses of these, and a method for producing a protein and a method for enhancing protein expression that use said protein expression-enhancing nucleic acid.
[0008] The present invention is based on the above-mentioned findings of the present inventors, and provides the following means for solving the above problems. Namely, <1> A nucleic acid for enhancing protein expression, comprising RNA having the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to the RNA. <2> A vector comprising the nucleic acid for enhancing protein expression set forth in <1>. <3> A composition comprising the nucleic acid for enhancing protein expression set forth in <1>. <4> A cell into which the nucleic acid for enhancing protein expression set forth in <1> has been introduced. <5> A method for producing a protein, comprising the step of culturing a cell into which a nucleic acid for enhancing protein expression, comprising RNA having the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to the RNA, has been introduced. <6> A method for enhancing protein expression, comprising the step of introducing into a cell a nucleic acid for enhancing protein expression, comprising RNA having the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to the RNA. <7> Use for enhancing protein expression of any of the following: (a) a nucleic acid comprising RNA having the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to the RNA; (b) a vector comprising a nucleic acid comprising RNA having the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to the RNA; (c) a composition comprising a nucleic acid comprising RNA having the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to the RNA; and (d) a cell into which a nucleic acid comprising RNA having the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to the RNA has been introduced.
[0009] According to the present invention, it is possible to solve the above-mentioned conventional problems, achieve the above-mentioned object, and provide a nucleic acid for enhancing protein expression, a vector and composition containing the nucleic acid for enhancing protein expression, a cell into which the nucleic acid for enhancing protein expression has been introduced, uses of these, and a method for producing a protein and a method for enhancing protein expression using the nucleic acid for enhancing protein expression, which can enhance protein expression with high efficiency.
[0010] Figure 1 shows the results of evaluating the AAV productivity of miRNA1185, miRNA3148, miRNA4657, and miRNA6823. Figure 2 shows the results of evaluating the pRC2-miRNA1185 expression plasmid using 293F cells. Figure 3 shows the results of evaluating the pRC2-miRNA1185 expression plasmid using VPCs2.0 cells. Figure 4 shows the results of evaluating the pRC2-miRNA1185 expression plasmid using HEK293T cells.
[0011] (Nucleic Acid for Enhancing Protein Expression) The nucleic acid for enhancing protein expression comprises any of the following (i) to (iii) RNA or DNA corresponding to the RNA, and may further comprise other sequences: (i) RNA consisting of the nucleotide sequence set forth in SEQ ID NO: 1 (ii) RNA having 90% or more sequence identity with the RNA consisting of the nucleotide sequence set forth in SEQ ID NO: 1 and having the effect of enhancing protein expression (iii) RNA having substitution, addition, and / or deletion of up to two bases with respect to the RNA consisting of the nucleotide sequence set forth in SEQ ID NO: 1 and having the effect of enhancing protein expression
[0012] Among these, the nucleic acid for enhancing protein expression preferably includes (i) RNA consisting of the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to the RNA.
[0013] The RNA is a ribonucleic acid and can contain adenine (A), guanine (G), cytosine (C), and uracil (U) as bases. The DNA is a deoxyribonucleic acid and can contain adenine (A), guanine (G), cytosine (C), and thymine (T) as bases. The DNA corresponding to the RNA means DNA having a base sequence in which uracil (U) in the base sequence of the RNA is replaced with thymine (T).
[0014] In SEQ ID NO: 1 in the sequence listing, the symbol "t" represents uracil. Furthermore, in SEQ ID NO: 21 in the sequence listing, the symbol "t" represents thymine. Therefore, the RNA consisting of the base sequence set forth in SEQ ID NO: 1 and the DNA corresponding to the RNA consisting of the base sequence set forth in SEQ ID NO: 1 (i.e., the DNA consisting of the base sequence set forth in SEQ ID NO: 21) are as follows: [RNA consisting of the base sequence set forth in SEQ ID NO: 1] auauacaggggggagacucuuau (SEQ ID NO: 1) [DNA corresponding to the RNA consisting of the base sequence set forth in SEQ ID NO: 1] atatacagggggagactcttat (SEQ ID NO: 21)
[0015] The protein, also referred to as a target protein, is a protein whose expression is enhanced in a host (cell). The expression of the protein can be enhanced by introducing the protein expression-enhancing nucleic acid into the host (cell).
[0016] The expression enhancement of the protein is not particularly limited and can be selected appropriately depending on the purpose, but when the nucleic acid for protein expression enhancement is introduced into the host (cell), the expression level of the protein in the host (cell) preferably increases by 1.1-fold or more, more preferably by 1.2-fold or more, even more preferably by 1.5-fold or more, and particularly preferably by 2-fold or more, compared to when the nucleic acid for protein expression enhancement is not introduced into the host (cell).
[0017] The method for confirming the expression level of the protein is not particularly limited and can be appropriately selected from known methods depending on the type of protein, such as Western blotting and ELISA. When the protein is an enzyme, the enzyme activity can be compared using a known method using a substrate appropriate for the type of enzyme, between a case where the protein expression-enhancing nucleic acid is introduced into the host (cell) and a case where the protein expression-enhancing nucleic acid is not introduced into the host (cell). If the enzyme activity is higher when the protein expression-enhancing nucleic acid is introduced into the host (cell), it can be determined that the expression level of the protein has increased. When the protein is a virus, the titer of the virus or the viral vector when the protein expression-enhancing nucleic acid is introduced into the host (cell) and a case where the protein expression-enhancing nucleic acid is not introduced into the host (cell) can be measured and compared using a known virus titer measurement method, such as quantitative PCR. If the titer of the virus or the viral vector when the protein expression-enhancing nucleic acid is introduced into the host (cell) is higher, it can be determined that the expression level of the protein has increased.
[0018] The protein is not particularly limited and can be appropriately selected depending on the purpose. Examples of the protein include viruses such as adeno-associated virus (AAV), adenovirus, parvovirus, coronavirus, retrovirus, lentivirus, herpesvirus, poliovirus, papillomavirus, vaccinia virus, and poxvirus; whole antibody, single-chain antibody, heavy-chain antibody, multivalent antibody, Fab, F(ab'), F(ab') 2 , Fc, Fc fusion protein, bispecific antibody, heavy chain (H chain), light chain (L chain), single chain Fv (scFv), sc(Fv) 2Antibodies such as disulfide-linked Fv (sdFv), diabodies, and antibody-like molecule targeting peptides (microantibodies); enzymes such as phytase, amylase, glucosidase, cellulase, lipase, protease, glutaminase, peptidase, nuclease, oxidase, lactase, xylanase, trypsin, pectinase, isomerase, tissue plasminogen activator (TPA), and urokinase; antibody-binding proteins such as protein A, protein G, and protein L; and human serum albumin. Examples of proteins include serum albumin; epidermal growth factors such as human epidermal growth factor; hormones such as insulin, growth hormone, and leptin; cytokines or growth factors such as erythropoietin, interferon, granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), thrombopoietin, IL-1, IL-6, and stem cell factor (SCF); blood coagulation and fibrinolysis system factors such as blood coagulation factor VIII; fibroin; fluorescent proteins; hepatitis B virus surface antigen; and hirudin. Among these, the protein is preferably a virus or an antibody, more preferably a virus, and even more preferably an adeno-associated virus (AAV). The virus may be a viral vector.
[0019] Adeno-associated virus (AAV) The adeno-associated virus is a virus belonging to the Parvoviridae family that contains linear single-stranded DNA in a capsid. The serotype of the adeno-associated virus is not particularly limited and can be appropriately selected depending on the purpose. Examples include AAV type 1 (AAV1), AAV type 2 (AAV2), AAV type 3 (AAV3), AAV type 4 (AAV4), AAV type 5 (AAV5), AAV type 6 (AAV6), AAV type 7 (AAV7), AAV type 8 (AAV8), AAV type 9 (AAV9), and AAV type 10 (AAV10).
[0020] The virus may be a partial polypeptide constituting the virus. Examples of the partial polypeptide constituting the adeno-associated virus (AAV) include adeno-associated virus-derived VP1, adeno-associated virus-derived VP2, adeno-associated virus-derived VP3, adeno-associated virus-derived Rep, adeno-associated virus-derived Cap, adeno-associated virus-derived AAP, and adeno-associated virus-derived MAAP.
[0021] The host (cell) is not particularly limited and can be appropriately selected depending on the purpose. Examples include bacteria such as Escherichia coli, fungi such as yeast, animal cells, insect cells, and plant cells. However, bacteria such as Escherichia coli or animal cells are preferred, and animal cells are more preferred.
[0022] The animal cells are not particularly limited and can be appropriately selected depending on the purpose. Examples thereof include 293F cells, VPCs2.0 cells, HEK293 cells, HEK293T cells, Hela cells, CHO cells, iPS cells, and mesenchymal stem cells.
[0023] Among these, the host (cell) is preferably the animal cell, more preferably 293F cell, VPCs2.0 cell, or HEK293T cell, and even more preferably 293F cell.
[0024] <(i) RNA Comprising the Base Sequence of SEQ ID NO: 1> The RNA comprising the base sequence of SEQ ID NO: 1 is a miRNA (micro-RNA). The RNA comprising the base sequence of SEQ ID NO: 1 is hsa-miR-1185-1-3p, as described in Analysis 3 of the Examples below.
[0025] As described above, the DNA corresponding to the RNA consisting of the base sequence set forth in SEQ ID NO: 1 is a DNA having a base sequence in which uracil (U) in the base sequence of the RNA consisting of the base sequence set forth in SEQ ID NO: 1 is replaced with thymine (T). Specifically, the DNA corresponding to the RNA consisting of the base sequence set forth in SEQ ID NO: 1 is a DNA consisting of the base sequence set forth in SEQ ID NO: 21. The DNA consisting of the base sequence set forth in SEQ ID NO: 21 can be synthesized, for example, from the RNA consisting of the base sequence set forth in SEQ ID NO: 1 by a known complementary DNA (cDNA) synthesis method using reverse transcriptase.
[0026] <(ii) RNA having 90% or more sequence identity with RNA consisting of the base sequence set forth in SEQ ID NO: 1 and having the effect of enhancing protein expression> The RNA having 90% or more sequence identity with RNA consisting of the base sequence set forth in SEQ ID NO: 1 is not particularly limited and can be appropriately selected depending on the purpose. It is RNA in which one or more bases in the base sequence set forth in SEQ ID NO: 1 have been substituted, added, and / or deleted within a range of 90% or more sequence identity with respect to RNA consisting of the base sequence set forth in SEQ ID NO: 1. However, from the viewpoint of highly efficient enhancement of protein expression, RNA having 95% or more sequence identity with RNA consisting of the base sequence set forth in SEQ ID NO: 1 is preferred.
[0027] The DNA corresponding to the RNA having 90% or more sequence identity with the RNA consisting of the base sequence set forth in SEQ ID NO: 1 and having the effect of enhancing protein expression is a DNA having 90% or more sequence identity with the DNA consisting of the base sequence set forth in SEQ ID NO: 21. The DNA having 90% or more sequence identity with the DNA consisting of the base sequence set forth in SEQ ID NO: 21 can be synthesized from the RNA having 90% or more sequence identity with the RNA consisting of the base sequence set forth in SEQ ID NO: 1 and having the effect of enhancing protein expression by a known complementary DNA (cDNA) synthesis method using reverse transcriptase.
[0028] The RNA having the effect of enhancing protein expression refers to RNA that can increase the expression level of the protein when the RNA and the protein are expressed in a host (cell) compared to when the RNA is not expressed.
[0029] The increase in the expression level of the protein is not particularly limited and can be selected appropriately depending on the purpose, but it is preferable that the expression of the protein in the host (cell) is increased by 1.1-fold or more, more preferably by 1.2-fold or more, even more preferably by 1.5-fold or more, and particularly preferably by 2-fold or more, compared to when the RNA is not introduced into the host (cell).
[0030] The increase in the expression level of the protein due to the RNA having the effect of enhancing protein expression can be confirmed by the same method as that described in the description of enhancement of protein expression.
[0031] <(iii) RNA Having Substitution, Addition, and / or Deletion of Up to 2 Bases with Respect to RNA Comprising the Base Sequence Set forth in SEQ ID NO: 1 and Having an Activity of Enhancing Protein Expression> The RNA having substitution, addition, and / or deletion of up to 2 bases with respect to the RNA comprising the base sequence set forth in SEQ ID NO: 1 is RNA in which up to 2 bases have been substituted, added, and / or deleted with respect to the RNA comprising the base sequence set forth in SEQ ID NO: 1. The RNA having substitution, addition, and / or deletion of up to 2 bases with respect to the RNA comprising the base sequence set forth in SEQ ID NO: 1 is not particularly limited and can be appropriately selected depending on the purpose, but from the viewpoint of highly efficiently enhancing protein expression, RNA having substitution, addition, and / or deletion of one base with respect to the RNA comprising the base sequence set forth in SEQ ID NO: 1 is preferred.
[0032] The DNA corresponding to the RNA having a substitution, addition, and / or deletion of up to two bases relative to the RNA consisting of the base sequence set forth in SEQ ID NO: 1 and having the effect of enhancing protein expression is a DNA having a substitution, addition, and / or deletion of up to two bases relative to the DNA consisting of the base sequence set forth in SEQ ID NO: 21. Note that the substitution, addition, and / or deletion of up to two bases in the DNA having a substitution, addition, and / or deletion of up to two bases relative to the DNA consisting of the base sequence set forth in SEQ ID NO: 21 is the substitution, addition, and / or deletion of bases corresponding to the substitution, addition, and / or deletion of up to two bases in the RNA having a substitution, addition, and / or deletion of up to two bases relative to the RNA consisting of the base sequence set forth in SEQ ID NO: 1 and having the effect of enhancing protein expression. The DNA having a substitution, addition, and / or deletion of up to two bases in the DNA consisting of the base sequence set forth in SEQ ID NO: 21 can be synthesized from RNA having a substitution, addition, and / or deletion of up to two bases in the RNA consisting of the base sequence set forth in SEQ ID NO: 1, and having a protein expression enhancing effect, by a known complementary DNA (cDNA) synthesis method using reverse transcriptase.
[0033] The RNA having the effect of enhancing protein expression refers to RNA that can increase the expression level of the protein when the RNA and the protein are expressed in a host (cell) compared to when the RNA is not expressed.
[0034] The increase in the expression level of the protein is not particularly limited and can be selected appropriately depending on the purpose, but it is preferable that the expression of the protein in the host (cell) is increased by 1.1-fold or more, more preferably by 1.2-fold or more, even more preferably by 1.5-fold or more, and particularly preferably by 2-fold or more, compared to when the RNA is not introduced into the host (cell).
[0035] The increase in the expression level of the protein due to the RNA having the effect of enhancing protein expression can be confirmed by the same method as that described in the description of enhancement of protein expression.
[0036] <Other Sequences> The other sequences are not particularly limited and can be appropriately selected depending on the purpose.
[0037] (Vector) The vector contains the nucleic acid for enhancing protein expression and may further contain other elements. The nucleic acid for enhancing protein expression is as described above in the section (Nucleic acid for enhancing protein expression).
[0038] The vector is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include the pRC2 vector.
[0039] <Other Elements> Examples of the other elements include a nucleic acid encoding the protein (target protein), a nucleic acid having a promoter sequence, and a nucleic acid having a polyA addition signal sequence. The protein is as described above in the section (Nucleic Acid for Enhancing Protein Expression). Among these, the protein preferably contains a nucleic acid encoding a virus or an antibody, more preferably contains a nucleic acid encoding a virus, and even more preferably contains a nucleic acid encoding an adeno-associated virus (AAV).
[0040] (Composition) The composition contains the nucleic acid for enhancing protein expression and may further contain other elements. The nucleic acid for enhancing protein expression is as described above in the section (Nucleic acid for enhancing protein expression).
[0041] The other elements are as described above in (Vector). In addition, the composition may contain a transfection reagent, an enhancer, etc., in order to use the composition for transfection.
[0042] (Cells) The cells are cells into which the nucleic acid for enhancing protein expression has been introduced. The nucleic acid for enhancing protein expression is as described above in the section (Nucleic acid for enhancing protein expression).
[0043] The method of introduction is not particularly limited and can be appropriately selected depending on the purpose. Examples include introduction using cationic lipids, introduction using calcium phosphate coprecipitation, introduction using DEAE-dextran, introduction using cationic polymers, introduction using viruses, introduction using electroporation, introduction using nanoparticles, introduction using microinjection, and introduction using lasers.
[0044] The cells are not particularly limited and can be selected appropriately depending on the purpose, and examples thereof include bacteria such as Escherichia coli, fungi such as yeast, animal cells, insect cells, and plant cells. However, bacteria such as Escherichia coli or animal cells are preferred, and animal cells are more preferred. The animal cells are not particularly limited and can be selected appropriately depending on the purpose, and examples thereof include 293F cells, VPCs2.0 cells, HEK293 cells, HEK293T cells, HeLa cells, CHO cells, iPS cells, and mesenchymal stem cells. Among these, 293F cells, VPCs2.0 cells, or HEK293T cells are preferred, and 293F cells are more preferred.
[0045] (Method for Producing Protein) The method for producing a protein comprises a step of culturing cells into which a nucleic acid for enhancing protein expression, comprising any one of the following RNAs (i) to (iii) or DNA corresponding to the RNA, has been introduced, and may further comprise other steps: (i) RNA consisting of the nucleotide sequence set forth in SEQ ID NO: 1 (ii) RNA having 90% or more sequence identity with the RNA consisting of the nucleotide sequence set forth in SEQ ID NO: 1 and having the effect of enhancing protein expression (iii) RNA having substitution, addition, and / or deletion of up to two bases relative to the RNA consisting of the nucleotide sequence set forth in SEQ ID NO: 1 and having the effect of enhancing protein expression
[0046] The nucleic acid for enhancing protein expression is as described above in the section (Nucleic acid for enhancing protein expression).
[0047] The cells are as described above in the section (Cells).
[0048] The culturing method is not particularly limited and can be appropriately selected depending on the purpose, and examples thereof include a method in which the cells are seeded in a culture medium and allowed to stand, stirred, or shaken. A cell growth inhibitor can be added to the culture medium.
[0049] <Other Steps> The other steps are not particularly limited and can be appropriately selected depending on the purpose. Examples of the other steps include a step of introducing the nucleic acid for enhancing protein expression into the cells, and a step of purifying the protein after the culturing step.
[0050] A cell into which a nucleic acid for enhancing protein expression containing any of the RNAs (i) to (iii) or DNA corresponding to the RNA has been introduced can be suitably obtained by introducing the nucleic acid for enhancing protein expression into the cell. The introduction is as described above in the section (Cells).
[0051] (Method for enhancing protein expression) The method for enhancing protein expression includes a step of introducing into a cell a nucleic acid for enhancing protein expression, which includes any of RNAs (i) to (iii) below or DNA corresponding to the RNA, and may further include other steps:
[0052] The nucleic acid for enhancing protein expression is as described above in the section (Nucleic acid for enhancing protein expression).
[0053] The cells and the introduction are as described above in the section (Cells).
[0054] Examples of the other steps include a step of culturing the cells, a step of purifying the protein after the culturing step, etc. These other steps are as described above in the section (Method for producing proteins).
[0055] (Use for enhancing protein expression) The use for enhancing protein expression is use for enhancing protein expression of any of the following: (a) a nucleic acid comprising any of the following RNAs (i) to (iii) or DNA corresponding to said RNAs, (b) a vector comprising any of the following RNAs (i) to (iii) or DNA corresponding to said RNAs, (c) a composition comprising any of the following RNAs (i) to (iii) or nucleic acid comprising DNA corresponding to said RNAs, and (d) a cell into which a nucleic acid comprising any of the following RNAs (i) to (iii) or DNA corresponding to said RNAs has been introduced: (i) RNA consisting of the nucleotide sequence set forth in SEQ ID NO: 1, (ii) RNA having 90% or more sequence identity with RNA consisting of the nucleotide sequence set forth in SEQ ID NO: 1 and having a protein expression enhancing effect, or (iii) RNA having substitution, addition, and / or deletion of up to two bases relative to RNA consisting of the nucleotide sequence set forth in SEQ ID NO: 1 and having a protein expression enhancing effect.
[0056] Among these, the use for enhancing protein expression is preferably the use for enhancing protein expression of any of (a) a nucleic acid comprising RNA having the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to the RNA, (b) a vector comprising a nucleic acid comprising RNA having the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to the RNA, (c) a composition comprising a nucleic acid comprising RNA having the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to the RNA, and (d) a cell into which a nucleic acid comprising RNA having the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to the RNA has been introduced.
[0057] The (a) nucleic acid is as described above in the section (Nucleic acid for enhancing protein expression).
[0058] The (b) vector is as described in the above section (Vector).
[0059] The (c) composition is as described in the above (Composition) section.
[0060] The (d) cells are as described in the above (Cells) section.
[0061] Examples of the present invention will be described below, but the present invention is not limited to these examples in any way.
[0062] <Production Example 1: Preparation of antibody-expressing CHO cells> A humanized monoclonal antibody expression gene was introduced into CHO cells (derived from the CHO-K1 strain) to construct a CHO cell line stably expressing an IgG1 antibody. Specifically, this was done as follows. PCR amplification was performed using plasmid DNA containing the IgG1 light chain and heavy chain sequences as a template to obtain the light chain sequence (0.7 kb fragment) and the heavy chain sequence (1.4 kb fragment). The obtained fragment was inserted into a Mammalian PowerExpress System expression vector (Toyobo Co., Ltd.) to construct an IgG1 antibody expression plasmid. The IgG1 antibody expression plasmid was treated with the restriction enzyme SspI to linearize the DNA, which was then transfected into CHO cells (derived from the CHO-K1 strain) using the gene transfection reagent Lipofectamine (Thermo Fisher Scientific) and cultured in a 125-mL Erlenmeyer flask (Corning). The antibiotic puromycin (Nacalai Tesque) was added to a final concentration of 20 μg / mL, and the cells were repeatedly subcultured until cell growth stabilized. From the resulting pool of cells, single colonies were isolated using the ClonePix2 system (Molecular Devices) and seeded onto a 96-well multiplate. Clonal cells exhibiting good cell growth were selected using a Clone Select Imager (Molecular Devices) and expanded. The secreted antibody concentrations in the culture supernatants of multiple clone cells were measured by biolayer interferometry using an OctetQKe (Sartorius). The standard IgG1 sample used was an IgG1 antibody expressed in CHO cells (purified by affinity chromatography and size exclusion chromatography, with a purity of 99% or higher as determined by SDS-PAGE). As a result, a CHO cell line stably expressing an IgG1 antibody was established, demonstrating good cell proliferation and antibody productivity.
[0063] Cell cloning was performed using a CHO cell line stably expressing an IgG1 antibody as the parent cell. The parent cells were seeded in a semi-solid medium mainly composed of BalanCD CHO GrowthA (Fujifilm Wako Pure Chemical Industries, Ltd.) and cultured for approximately two weeks to form clonal cell colonies. Single colonies were then isolated using the ClonePix2 system (Molecular Devices), an animal cell colony picking system. Multiple isolated clonal cell colonies were seeded in 96-well plates. After seeding in the plates, clones with excellent cell proliferation were expanded to 24-well plates using a cell growth plate imager, Clone Select Imager (Molecular Devices), while still in static culture. Subsequently, they were similarly expanded to 6-well plates. Finally, the cells were cultured in a 125-mL Erlenmeyer flask (Corning) at 5% CO 2 The cells were cultured with shaking at 37°C, and several CHO cell lines exhibiting good cell proliferation were established. Of the established cells, IgG1-A cells and IgG1-B cells were analyzed for cell proliferation and antibody production as follows.
[0064] <<Analysis 1: Cell proliferation analysis of IgG1-A cells and IgG1-B cells>> IgG1-A cells and IgG1-B cells were cultured with shaking using a 125-mL Erlenmeyer flask (Corning). Shaking culture was performed using a Climoshaker ISF1-X (Kuhner) under conditions of 37°C, 80% humidity, 5% carbon dioxide concentration, and 80 rpm. Batch culture was performed using BalanCD CHO Growth A (Fujifilm Wako Pure Chemical Industries, Ltd., containing 4 mM L-glutamine) as a serum-free medium for CHO cells. The cell density was 0.3 x 10 6 The cells were seeded at 1000 cells / mL, and cell counts were measured using a Countess II cell counter (Thermo Fisher Scientific) at appropriate intervals up to 214 hours after seeding. Cultures were performed in three flasks (n=3) for each cell type. The results showed that the cell proliferation rates of IgG1-A cells and IgG1-B cells were comparable.
[0065] <<Analysis 2: Analysis of antibody production in IgG1-A cells and IgG1-B cells>> From day 4 of culture onwards, the culture medium was sampled, and the supernatant obtained by removing cells was used to measure the antibody concentration in the culture medium by biolayer interferometry. An OctetQKe (Sartorius) was used for measurement. The standard IgG1 sample used was an IgG1 antibody expressed in CHO cells (purified by affinity chromatography and size exclusion chromatography, with a purity of 99% or higher by SDS-PAGE). The results showed that IgG1 production from IgG1-B cells was approximately 1.4 times higher than that of IgG1-A cells after 214 hours.
[0066] <<Analysis 3: miRNA expression analysis in IgG1-A cells and IgG1-B cells>> A portion of the sample was collected on day 6 of culture, and the cell number was measured using a cell counter Countess II (Thermo Fisher Scientific). 7Cells of approximately 1000 cells were prepared by centrifugation, and the cell pellet was frozen and stored at -80°C. The following analysis was outsourced to Filgen Co., Ltd. Using the RNA extraction kit miRNeasy Mini kit (QIAGEN), total RNA including small RNA was extracted from the frozen and stored IgG1-A cells and IgG1-B cells. Next, the total RNA was labeled with biotin using the FlashTag Biotin HSR RNA Labeling Kit (Thermo Fisher Scientific). Subsequently, biotin-labeled RNA was hybridized with a GeneChip® miRNA 4.0 Array (Thermo Fisher Scientific) using a GeneChip® Hybridization Oven (Thermo Fisher Scientific), and the array was washed using a GeneChip® Fluidics station (Thermo Fisher Scientific). After array preparation, scanning was performed using a GeneChip® Scanner 3000 7G (Thermo Fisher Scientific) to compare expression between IgG1-A cells and IgG1-B cells. Some of the results of miRNA expression analysis in IgG1-A cells and IgG1-B cells are shown in Table 1.
[0067]
[0068] From the results in Table 1, the expression of hsa-miR-1185-1-3p (hereinafter sometimes referred to as "miRNA1185") in IgG1-B cells was approximately 8.0 times that of IgG1-A cells, the expression of hsa-miR-3148 (hereinafter sometimes referred to as "miRNA3148") in IgG1-B cells was approximately 3.2 times that of IgG1-A cells, the expression of hsa-miR-4657 (hereinafter sometimes referred to as "miRNA4657") in IgG1-B cells was approximately 2.9 times that of IgG1-A cells, and the expression of hsa-miR-6823-3p (hereinafter sometimes referred to as "miRNA6823") in IgG1-B cells was approximately 4.5 times that of IgG1-A cells.
[0069] <Production Example 2: Construction of miRNA Expression Plasmids> As described below, pRC2-mi342 (Takara Bio Inc.) was modified to construct each miRNA expression plasmid (pRC2-miRNA1185 expression plasmid, pRC2-miRNA3148 expression plasmid, pRC2-miRNA4657 expression plasmid, and pRC2-miRNA6823 expression plasmid).
[0070] <<Production Example 2-1 Preparation of Backbone Plasmid DNA Fragment>> pRC2-mi342 was digested with SnaBI (New England) and SmaI (New England) to obtain a backbone plasmid DNA fragment lacking an approximately 0.6 kb sequence (SEQ ID NO: 2) containing the hsa-miR-342 expression cassette. The approximately 0.6 kb sequence (SEQ ID NO: 2) contains a SnaBI site, a CMV promoter sequence, the hsa-miR-342 expression cassette containing the hsa-miR-342 sequence, a polyA signal, and a SmaI site.
[0071] <<Production Example 2-2 Preparation of CMV Promoter Region and Poly(A) Addition Signal Region>> Using pRC2-mi342 as a template, the CMV promoter region and poly(A) addition signal region were each amplified by PCR. The CMV promoter region was amplified using a CMV promoter forward primer consisting of the nucleotide sequence set forth in SEQ ID NO: 3 and a CMV promoter reverse primer consisting of the nucleotide sequence set forth in SEQ ID NO: 4. The poly(A) addition signal region was amplified using a poly(A) signal forward primer consisting of the nucleotide sequence set forth in SEQ ID NO: 5 and a poly(A) signal reverse primer consisting of the nucleotide sequence set forth in SEQ ID NO: 6. These primers contained approximately 20 bp of homologous regions to the backbone plasmid DNA and each miRNA expression cassette for linking the PCR fragment and the backbone plasmid DNA fragment. In SEQ ID NO: 4 and SEQ ID NO: 5, the 17 bases at the 3' end are homologous to the backbone plasmid DNA, and the 23 bases at the 5' end are homologous to each miRNA. PCR was performed using Prime STAR MAX DNA Polymerase (Takara Bio Inc.) under the reaction conditions described in the attached manual. The same enzyme was used in all PCRs for preparing the following plasmids.
[0072] <<Production Example 2-3 Preparation of each miRNA>> The sequences of each miRNA (miRNA1185, miRNA3148, miRNA4657, and miRNA6823) were obtained from miRBase (https: / / mirbase.org / ), a miRNA database. The Accession number in miRBase for miRNA1185 is MIMAT0022838, the Accession number in miRBase for miRNA3148 is MIMAT0015021, the Accession number in miRBase for miRNA4657 is MIMAT0019724, and the Accession number in miRNA6823 is MIMAT0027547. With reference to human genome information, primers were designed approximately 50 bp to 100 bp upstream and downstream of each miRNA. For miRNA1185, a forward primer for hsa-miR-1185 consisting of the nucleotide sequence set forth in SEQ ID NO:7 and a reverse primer for hsa-miR-1185 consisting of the nucleotide sequence set forth in SEQ ID NO:8 were used as primers. For miRNA3148, a forward primer for hsa-miR-3148 consisting of the nucleotide sequence set forth in SEQ ID NO:9 and a reverse primer for hsa-miR-3148 consisting of the nucleotide sequence set forth in SEQ ID NO:10 were used as primers. For miRNA4657, a forward primer for hsa-miR-4657 consisting of the nucleotide sequence set forth in SEQ ID NO:11 and a reverse primer for hsa-miR-4657 consisting of the nucleotide sequence set forth in SEQ ID NO:12 were used as primers. For miRNA6823, the primers used were a forward primer for hsa-miR-6823 consisting of the nucleotide sequence set forth in SEQ ID NO: 13 and a reverse primer for hsa-miR-6823 consisting of the nucleotide sequence set forth in SEQ ID NO: 14. A homologous region of about 20 bp to the backbone plasmid DNA was inserted into these primers for ligation with the PCR fragment and the backbone plasmid DNA fragment.In SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, and SEQ ID NO:13, the 17 bases at the 5' end are homologous to the backbone plasmid DNA, and in SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, and SEQ ID NO:14, the 18 bases at the 5' end are homologous to the backbone plasmid DNA. The genome extracted from HEK293 cells (ATCC) was used as a template. The DNeasy Blood & Tissue Kit (QIAGEN) was used for genome extraction. The reaction conditions were as described in the attached manual. Using each of the primers and the genome extracted from the HEK293 cells, DNA fragments containing expression cassettes for each miRNA (miRNA1185, miRNA3148, miRNA4657, and miRNA6823) were PCR amplified.
[0073] <<Production Example 2-4: Construction of pRC2-miRNA1185 expression plasmid, pRC2-miRNA3148 expression plasmid, pRC2-miRNA4657 expression plasmid, and pRC2-miRNA6823 expression plasmid>> The backbone plasmid DNA fragment prepared in Production Example 2-1 and the three PCR amplified fragments prepared in Production Examples 2-2 and 2-3 (DNA fragments containing the CMV promoter region, poly A addition signal region, and expression cassettes for each miRNA) were ligated using NEB Builder (New England). E. coli NEB Stable competent cells (New England) were transformed with these plasmids to obtain pRC2-miRNA1185 expression plasmid, pRC2-miRNA3148 expression plasmid, pRC2-miRNA4657 expression plasmid, and pRC2-miRNA6823 expression plasmid (hereinafter, these four may be collectively referred to as "pRC2-miRNA expression plasmids"). The DNA sequence of the pRC2-miRNA expression plasmid extracted from the resulting transformant was confirmed to be the expected sequence.
[0074] Test Example 1: Quantification of miRNA Test Example 1-1: Preparation of miRNA Expression Plasmids E. coli NEB Stable Competent cells were transformed with each of the pRC2-miRNA expression plasmids constructed in Production Example 2, and then cultured to prepare large amounts of each plasmid. Nucleobond Xtra Midi EF (Machliner Gel) was used to purify each plasmid.
[0075] <<Test Example 1-2 Preparation of 293F Cells>> Suspension HEK293 cells (Thermo Fisher Scientific; FreeStyle™ 293F cells) were cultured at a concentration of 1 x 10 in F17 medium (Thermo Fisher Scientific) containing 4 mM GlutaMAX (Thermo Fisher Scientific). 6 The cells were suspended at 1000 cells / mL. Five mL of this suspension was seeded into a 50 mL centrifuge tube with a filter cap. 2 The cells were placed in an incubator at 37°C under atmospheric pressure and cultured with shaking at 200 rpm for 1 hour for transfection.
[0076] <<Test Example 1-3: Plasmid introduction (transfection) into 293F cells>> Each pRC2-miRNA expression plasmid (1 μg / μL, 4 μL) prepared in Test Example 1-1 was mixed with PEI MAX (1 μg / μL, 12 μL, PolySciences) in Opti-MEM (Thermo Fisher Scientific), and the plasmid was introduced into the 293F cells prepared in Test Example 1-2. 2 The cells were placed in an incubator at 37°C under atmospheric pressure and cultured at 200 rpm for 3 days. As a negative control, pRC2, a plasmid not carrying a miRNA expression cassette, was prepared by digesting pRC2-mi342 with SnaBI (New England) and SmaI (New England). A similar plasmid was prepared, and transfection and culture were carried out.
[0077] <<Test Example 1-4: RNA Extraction and Quantification>> Transfected 293F cells were collected, and total RNA was extracted using miRNeasy Minikit (QIAGEN). miRNA was quantified using Mir-X™ miRNA qRT-PCR TB Green™ Kit (Takara Bio Inc.). The procedure followed the method described in the kit. Poly(A) was added to the extracted total RNA using mRQ Enzyme, followed by reverse transcription, and then measurement was performed by quantitative PCR using mRQ 3' Primer and primers specific to each miRNA. For miRNA1185, a miRNA1185 quantification primer consisting of the nucleotide sequence set forth in SEQ ID NO: 15 was used as the primer (primer specific to each miRNA). For miRNA3148, a miRNA3148 quantification primer consisting of the nucleotide sequence set forth in SEQ ID NO: 16 was used as the primer (primer specific to each miRNA). For miRNA4657, a miRNA4657 quantification primer consisting of the nucleotide sequence set forth in SEQ ID NO: 17 was used as the primer (primer specific to each miRNA). For miRNA6823, a miRNA6823 quantification primer consisting of the nucleotide sequence set forth in SEQ ID NO: 18 was used as the primer (primer specific to each miRNA). The results are shown in Table 2. In Table 2, "control" indicates the Ct value of 293F cells transfected with the negative control (plasmid pRC2), and "sample" indicates the Ct value of 293F cells transfected with a plasmid expressing each miRNA (pRC2-miRNA expression plasmid). ΔΔCt indicates the difference in Ct value between the control and sample, which is the cycle number at which the threshold value was reached. It was found that the Ct value reached the threshold earlier in all samples, indicating an increase in miRNA. "Fold" indicates the rate of increase in the sample relative to the control.
[0078] The results in Table 2 confirmed that all miRNAs were increased.
[0079] Test Example 2: Evaluation of AAV productivity of miRNA Test Example 2-1: Preparation of 293F cells 293F cells were prepared in the same manner as in Test Example 1-2.
[0080] <<Test Example 2-2: Plasmid introduction (transfection) into 293F cells>> Each pRC2-miRNA expression plasmid (1 μg / μL, 4 μL) prepared in Test Example 1-1, pAAV-Venus (1 μg / μL, 1 μL), pHelper (1 μg / μL, 1 μL), and PEI MAX (1 μg / μL, 12 μL) were mixed in Opti-MEM and allowed to stand. The plasmid DNA-PEI mixture was added to the 293F cell culture medium prepared in Test Example 2-1 to introduce the plasmid into the cells. The mixture was incubated at 8% CO 2 The cells were placed in an incubator at 37°C under atmospheric conditions and cultured at 200 rpm for 4 hours, after which 50 μL of nocodazole (Cayman Chemical Co.) adjusted to 50 μM using DMSO was added, and the cells were cultured for an additional 3 days under the same conditions.
[0081] <<Test Example 2-3: Recovery of AAV>> The resulting culture medium was centrifuged to separate the supernatant and cell pellet. A 1 / 4 volume of 40% PEG 8000 (Sigma-Aldrich) solution was added to the supernatant to a final concentration of 10%, thereby precipitating AAV. 1 mL of 0.1% Triton X-100 (Sigma-Aldrich) solution was added to the residue to disrupt the cells, and then 1 μL of Kaneka Endonuclease (Kaneka Corporation) was added to degrade DNA. 15 μL of EDTA (Nippon Gene Co., Ltd.) was added, followed by centrifugation, and the supernatant was collected (supernatant-derived sample). 1 mL of 0.1% Triton X-100 solution was added to the cell pellet to disrupt the cells, and then 1 μL of Kaneka Endonuclease was added to degrade DNA. 15 μL of EDTA (Nippon Gene Co., Ltd.) was added, and the mixture was centrifuged to collect the supernatant (cell-derived sample). The supernatant was stored at 4° C. or −20° C. until subjected to quantitative PCR.
[0082] <<Test Example 2-4: Measurement of AAV genome titer>> The titer of the AAV vector contained in the sample prepared in Test Example 2-3 was measured by quantitative PCR (QuantStudio3, SYBR-Green method) using primers (a forward primer for AAV titer measurement consisting of the nucleotide sequence set forth in SEQ ID NO: 19 and a reverse primer for AAV titer measurement consisting of the nucleotide sequence set forth in SEQ ID NO: 20). The quantitative PCR was carried out using a sample (total of 25 μL) consisting of 12.5 μL of PowerUp™ SYBR® Green Master Mix (Thermo Fisher Scientific), 0.125 μL each of primers (50 μM, SEQ ID NO: 19 and SEQ ID NO: 20), 11.25 μL of sterile water, and 1 μL of a standard or a 5000-fold diluted sample, and a PCR reaction was carried out on the sample using QuantStudio3 (Thermo Fisher Scientific) by repeating 30 cycles of 94°C / 15 seconds (thermal denaturation), 60°C / 30 seconds (annealing), and 72°C / 30 seconds (extension reaction). The above standard was prepared by linearizing pAAV-MCS Expression Vector (0.67 μg / μL, TE solution, Cell Biolabs) by digestion with PvuII (Takara Bio Inc.) at 37°C for 2 hours. The results of quantitative PCR (AAV production amount) are shown in Figure 1. In Figure 1, vg / L indicates the amount of vector genome per volume of culture medium. The bar in Figure 1 indicates the standard deviation. The highest AAV production was achieved when the pRC2-miRNA1185 expression plasmid was used, and it was thought that the increase in AAV production amount was due to the effect of hsa-miR-1185.
[0083] Example 1 Evaluation of pRC2-miRNA1185 Expression Plasmid Using 293F Cells Improvement of AAV productivity by miRNA1185 was verified using 293F cells.
[0084] <<Example 1-1 Preparation of 293F Cells>> 293F cells were prepared in the same manner as in Test Example 1-2.
[0085] <<Example 1-2 Plasmid introduction (transfection) into 293F cells>> The pRC2-miRNA1185 expression plasmid (1 μg / μL, 3 μL), pAAV-Venus (1 μg / μL, 1 μL), pHelper (1 μg / μL, 2 μL), and PEI MAX (1 μg / μL, 12 μL) prepared in Test Example 1-1 were mixed in Opti-MEM and allowed to stand. The plasmid DNA-PEI mixture was added to the 293F cell culture medium prepared in Example 1-1 to introduce the plasmid into the cells. The mixture was incubated at 8% CO 2 The cells were placed in an incubator at 37°C under atmospheric conditions and cultured at 200 rpm for 4 hours, after which 50 µL of nocodazole adjusted to 50 µM using DMSO was added, and the cells were cultured for an additional 3 days under the same conditions.
[0086] As a negative control, pRC2-mi342 was digested with SnaBI (New England) and SmaI (New England) to prepare a plasmid pRC2 without a miRNA expression cassette. Transfection and cultivation were also performed in the same manner.
[0087] <<Example 1-3 Recovery of AAV>> AAV was recovered in the same manner as in Test Example 2-3.
[0088] <<Example 1-4 Measurement of AAV genome titer>> Measurement was performed in the same manner as in Test Example 2-4. The results of quantitative PCR are shown in Figure 2. In Figure 2, vg / L indicates the amount of vector genome per volume of culture medium, and "control" indicates the results for the negative control (plasmid pRC2). When the pRC2-miRNA1185 expression plasmid was used, productivity increased compared to the negative control.
[0089] Example 2 Evaluation of pRC2-miRNA1185 Expression Plasmid Using VPCs2.0 Cells Improvement of AAV productivity by miRNA1185 was verified using VPCs2.0 cells (Thermo Fisher Scientific), which are believed to have higher productivity.
[0090] <<Example 2-1 Preparation of VPCs2.0 Cells>> VPCs2.0 cells were cultured at a density of 3 x 10 in Viral Production Medium (Thermo Fisher Scientific) containing 4 mM GlutaMAX (Thermo Fisher Scientific). 6 The cells were suspended at 1000 cells / mL. Five mL of this suspension was seeded into a 50 mL centrifuge tube with a filter cap. 2 The cells were placed in an incubator at 37°C under atmospheric pressure and cultured with shaking at 200 rpm for 1 hour for transfection.
[0091] <<Example 2-2 Plasmid introduction (transfection) into VPCs2.0 cells>> The pRC2-miRNA1185 expression plasmid (1 μg / μL, 5 μL), pAAV-Venus (1 μg / μL, 1.25 μL), pHelper (1 μg / μL, 1.25 μL), and PEI MAX (1 μg / μL, 15 μL) prepared in Test Example 1-1 were mixed in Opti-MEM and allowed to stand. The plasmid DNA-PEI mixture was added to the VPCs2.0 cell culture medium prepared in Example 2-1 to introduce the plasmid into the cells. The mixture was incubated at 8% CO 2 The cells were placed in an incubator at 37°C under atmospheric conditions and cultured at 200 rpm for 4 hours, after which 50 µL of nocodazole adjusted to 50 µM using DMSO was added, and the cells were cultured for an additional 3 days under the same conditions.
[0092] As a negative control, pRC2-mi342 was digested with SnaBI (New England) and SmaI (New England) to prepare a plasmid pRC2 without a miRNA expression cassette. Transfection and cultivation were also performed in the same manner.
[0093] <<Example 2-3 Recovery of AAV>> AAV was recovered in the same manner as in Test Example 2-3.
[0094] <<Example 2-4 Measurement of AAV genome titer>> Measurement was performed using the same method as in Test Example 2-4. The results of quantitative PCR are shown in Figure 3. In Figure 3, vg / L indicates the amount of vector genome per volume of culture medium, and "control" indicates the results for the negative control (plasmid pRC2). When VPCs2.0 cells were used, productivity increased compared to the negative control due to the effect of the pRC2-miRNA1185 expression plasmid, as was the case when 293F cells were used.
[0095] Example 3 Evaluation of pRC2-miRNA1185 Expression Plasmid Using HEK293T Cells The improvement of AAV productivity by miRNA1185 was verified using HEK293T cells (ATCC), which are adherent cells.
[0096] <<Example 3-1 Preparation of HEK293T Cells>> HEK293T cells were cultured at a density of 5.3 × 10 in Advanced D-MEM medium (Thermo Fisher Scientific) containing 5% fetal bovine serum (Thermo Fisher Scientific), 4 mM GlutaMAX, and 0.5% penicillin-streptomycin mixture (Nacalai Tesque). 4 12 mL of this suspension was placed in a 9 cm cell culture dish (Sumitomo Bakelite Co., Ltd., 57 cm 2 ) and 5% CO 2 The cells were cultured in an incubator at 37°C under atmospheric conditions for 3 days.
[0097] <<Example 3-2 Plasmid Introduction (Transfection) into HEK293T Cells>> On the day of transfection, the culture medium was removed and replaced with 19 mL of Advanced D-MEM medium (Thermo Fisher Scientific) containing 4 mM GlutaMAX and a 0.5% penicillin-streptomycin mixture. The pRC2-miRNA1185 expression plasmid (1 μg / μL, 16 μL) prepared in Test Example 1-1, pAAV-Venus (1 μg / μL, 4 μL), pHelper (1 μg / μL, 4 μL), and PEI MAX (1 μg / μL, 48 μL) were mixed in Opti-MEM and allowed to stand. The plasmid DNA-PEI mixture was added to the HEK293T cell culture medium prepared in Example 3-1 to introduce the plasmid into the cells.
[0098] As a negative control, pRC2-mi342 was digested with SnaBI (New England) and SmaI (New England) to prepare a plasmid pRC2 without a miRNA expression cassette. Transfection and cultivation were also performed in the same manner.
[0099] <<Example 3-3 Recovery of AAV>> Cultured HEK293T cells were detached from the dish using Accutase (Innovative Cell Technologies), and then centrifuged to separate the supernatant and cell pellet, which were then recovered in the same manner as in Test Example 2-3.
[0100] <<Example 3-4 Measurement of AAV genome titer>> Measurement was performed using the same method as in Test Example 2-4. The results of quantitative PCR are shown in Figure 4. In Figure 4, vg / dish (9 cm) indicates the amount of vector genome per 9 cm dish, and "control" indicates the results for the negative control (plasmid pRC2). When HEK293T cells, which are adherent cells, were used, productivity increased compared to the negative control due to the effect of pRC2-miRNA1185, as was the case when suspension cells, 293F cells and VPCs2.0 cells, were used.
[0101] Examples of aspects of the present invention include the following: <1> A nucleic acid for enhancing protein expression, comprising DNA corresponding to RNA consisting of the nucleotide sequence set forth in SEQ ID NO: 1. <2> A vector comprising the nucleic acid for enhancing protein expression set forth in <1>. <3> The vector according to <2>, comprising a nucleic acid encoding a virus. <4> The vector according to <3>, in which the virus is an adeno-associated virus. <5> A composition comprising the nucleic acid for enhancing protein expression set forth in <1>. <6> The composition according to <5>, comprising a nucleic acid encoding a virus. <7> The composition according to <6>, in which the virus is an adeno-associated virus. <8> A cell into which the nucleic acid for enhancing protein expression set forth in <1> has been introduced. <9> A method for producing a protein, comprising the step of culturing a cell into which a nucleic acid for enhancing protein expression, comprising RNA consisting of the nucleotide sequence set forth in SEQ ID NO: 1 or DNA corresponding to the RNA, has been introduced. <10> A method for enhancing protein expression, comprising the step of introducing into a cell a nucleic acid for enhancing protein expression, comprising RNA consisting of the nucleotide sequence set forth in SEQ ID NO: 1 or DNA corresponding to the RNA. <11> Use for enhancing protein expression of any of the following: (a) a nucleic acid comprising RNA having the nucleotide sequence set forth in SEQ ID NO: 1 or DNA corresponding to the RNA; (b) a vector comprising RNA having the nucleotide sequence set forth in SEQ ID NO: 1 or DNA corresponding to the RNA; (c) a composition comprising a nucleic acid comprising RNA having the nucleotide sequence set forth in SEQ ID NO: 1 or DNA corresponding to the RNA; and (d) a cell into which a nucleic acid comprising RNA having the nucleotide sequence set forth in SEQ ID NO: 1 or DNA corresponding to the RNA has been introduced. <12> Use for enhancing protein expression of the vector set forth in <11>, wherein the vector comprises a nucleic acid encoding a virus. <13> Use for enhancing protein expression of the vector set forth in <12>, wherein the virus is an adeno-associated virus. <14> Use for enhancing protein expression of the composition set forth in <11>, wherein the composition comprises a nucleic acid encoding a virus.<15> Use of the composition according to <14> above for enhancing protein expression, wherein the virus is an adeno-associated virus.
[0102] This international application claims priority based on Japanese Patent Application No. 2023-001001, filed on January 6, 2023, the entire contents of which are incorporated herein by reference.
Claims
1. A protein expression enhancer comprising RNA consisting of the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to said RNA, said protein expression enhancer being used to enhance the expression of a virus or antibody.
2. A protein expression enhancer as described in claim 1, wherein a vector contains RNA consisting of the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to said RNA.
3. A protein expression enhancer as described in claim 2, wherein the vector contains nucleic acid encoding a virus.
4. The protein expression enhancing agent according to claim 3 , wherein the virus is an adeno-associated virus.
5. A composition comprising the protein expression enhancer of claim 1.
6. The composition of claim 5 , comprising a nucleic acid encoding a virus.
7. The composition of claim 6 , wherein the virus is an adeno-associated virus.
8. A method for producing a cell comprising introducing into a cell RNA having a base sequence set forth in SEQ ID NO: 1 or DNA corresponding to said RNA, A method for producing cells, comprising enhancing expression of a virus or antibody in the cells.
9. A method for producing a virus or antibody, comprising the step of culturing cells into which RNA consisting of the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to said RNA has been introduced.
10. A method for enhancing expression of a virus or antibody, comprising the step of introducing RNA consisting of the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to said RNA into a cell.
11. (a) a nucleic acid comprising RNA consisting of the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to said RNA; (b) a vector containing a nucleic acid containing RNA consisting of the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to said RNA; (c) a composition comprising a nucleic acid comprising RNA having the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to said RNA; and (d) A cell into which a nucleic acid containing RNA consisting of the base sequence set forth in SEQ ID NO: 1 or DNA corresponding to said RNA has been introduced. Use of the above for enhancing expression of any of the viruses or antibodies.