Immersion vaccine for larval and juvenile fish

Abstract

The present invention provides a vaccine for fish that is capable of preventing infectious diseases of larval and juvenile fish by activating a defense system of the living body. For example, the present invention provides a vaccine for fish, the vaccine comprising cells of Edwardsiella tarda and being capable of inducing immunity to Edwardsiella tarda in larval and juvenile fish (in particular, glass eel) by immersing the larval and juvenile fish (in particular, glass eel). The present invention also provides a method for inducing Edwardsiella tarda infection in glass eel or black eel.

Description

Immersion vaccine for larvae and fry

[0001] The present invention provides an immersion vaccine for application to larvae and juvenile fish.The present invention also provides an immersion vaccine for application to eel larvae and juvenile fish.

[0002] In eel farming, an infectious disease caused by Edwardsiella tarda (Edwardsiela tarda infection or Edwardsiella tarda disease) was formerly known as paracolo disease and occurred sporadically, causing damage.

[0003] Since warmed eel farming began, paracolovirus has been a year-round disease that causes the most damage to eel farming. While drug administration is one way to combat the disease, it is not possible to eradicate it, and repeated year-round administration of medication is required. Vaccines have been planned and developed in the past, and reports have been published, but no vaccine has actually been put on the market.

[0004] Meanwhile, concerns are growing about the depletion of glass eels (larvae and fry) worldwide, and the Convention on International Trade in Endangered Species of Wild Fauna and Flora prohibits international trade of European eels (Anguilla anguilla) without permission from the exporting government. There are also concerns that Japanese eels (Anguilla japonica) may be subject to similar restrictions for conservation purposes. While recent technological innovations have led to rapid advances in artificial seedling production techniques, it will likely take a considerable amount of time before larvae and fry can be commercially produced. In this environment, the trading price of glass eels (the colloquial name for larvae and fry), the source of capital for aquaculture, continues to rise, placing a growing burden on aquaculture farmers each year. As a result, farmers are struggling to find ways to increase the yield of the larvae and fry they purchase.

[0005] In the development of aquatic vaccines, pathogenicity confirmation tests are first conducted using microorganisms isolated from the source disease. The first step is to induce disease in a control fish species, which is then used to create the original strain for the vaccine. For example, Patent Document 1 introduces a testing method for a flounder Edwardsiella disease vaccine, but as presented in the document, vaccine development is impossible without a pathogenic original strain.

[0006] Non-Patent Document 1 discloses a method for testing a vaccine containing a bacterial strain derived from streptococcosis as an active ingredient. Non-Patent Document 2 discloses a method for testing a vaccine containing a bacterial strain derived from vibriosis as an active ingredient. Non-Patent Document 3 discloses a method for testing a vaccine containing a virus derived from red sea bream iridovirus disease as an active ingredient. Microorganisms used in vaccine production are generally derived from diseased fish, and titer testing is carried out using their pathogenicity against the target fish species.

[0007] The immersion method is used to safely test the potency of vaccines in sweetfish (Non-Patent Document 2). There have been test examples of applying this method to larval and juvenile eels, but it has not yet been put to practical use. The method used in sweetfish is unable to infect larval and juvenile eels with the disease, and while Ishihara et al. (Non-Patent Document 4) have shown a method using high-concentration, long-term immersion, they have not yet been able to establish a testing method.

[0008] Patent Publication No. 2006-312595

[0009] Standard for Animal Biological Products: Yellowtail Alpha Hemolytic Disease Inactivated Vaccine (Injectable) Standard for Animal Biological Products: Sweetfish Vibriosis Inactivated Vaccine Standard for Animal Biological Products: Iridovirus Disease Inactivated Vaccine Journal of the Japanese Society of Fisheries Science 47(8), 999-1002 (1981) Fish Pathology, 51(3), 87-91 (2016) J Fish Dis. 2022 Nov; 45(11): 1683-1689

[0010] Despite the high price of glass eels, the yield of eels is declining due to infectious diseases in eel farms. The only way to solve this problem seems to be to develop a vaccine. Similar problems exist with other fish species. Means to solve the problem

[0011] Glass eels, when released into aquaculture ponds, mature into black eels in about a week. Glass eels then mature and are shipped in approximately six months to a year. Due to the difficulty of recovering the fish after being placed in the ponds, practical vaccine administration is limited to oral administration for the developmental stages beyond black eels (the common name for larval eels). Oral vaccines generally have low efficacy, and feeding the eels up to black eels determines their subsequent growth, so significant obstacles are anticipated for their development. Paracolovirus disease is known to occur year-round in eel farms, starting from the larval stage. Vaccine administration after eels reach adulthood, which allows for injections, has limited effect on improving yields by preventing infection.

[0012] Before eels begin farming, they are raised in small tanks for a period of time, which is considered an ideal time for mass vaccination. However, larval and juvenile eels have a strong resistance to infectious diseases. For example, the greatest challenge in developing a vaccine for paracolovirus disease (P. koroglossi) in larval and juvenile eels was artificially infecting them with Edwardsiella bacteria. Because larval and juvenile eels are small, it is difficult to inject the bacteria into their bodies; the only viable methods for infection are immersion or oral administration. However, the inability to achieve infection through immersion or oral administration of the challenge bacteria has hindered the establishment of vaccine testing methods and vaccine development. Effective vaccine evaluation methods are essential for vaccine development; without such methods, vaccine development is impossible.

[0013] The present invention provides a titer testing method that will serve as the basis for the development of a vaccine that is effective against larval fish, and also provides an immersion vaccine that is effective against larval fish.

[0014] The present inventors have discovered a method for infecting larval fish (especially larval eels) with a challenge strain. They have also found that immersion vaccination induces immunity in larval fish (especially larval eels). This makes it possible to provide a vaccine whose effectiveness in larval fish has been confirmed, which is advantageous for, for example, enhancing the effect of improving the yield of the eels.

[0015] The present invention provides the following: (1) A vaccine for inducing immunity in fish (e.g., their larvae and juveniles) against a fish infectious disease, for example, Edwardsiella tarda infection (parachoroidism), comprising a bacterium (e.g., Edwardsiella tarda) causative agent of Edwardsiella tarda infection (parachoroidism) or an immunogenic portion thereof. (2) The vaccine according to (1) above, wherein the body weight of the target fish is less than 0.5 g. (3) The vaccine according to (1) or (2) above, wherein the target fish (i.e., the larvae and juveniles) are glass eels. (4) The vaccine according to any of (1) to (3) above, which is administered to fish by the immersion method. (5) The vaccine according to any of (1) to (4) above, wherein the bacterium comprises an inactivated bacterium. (6) The vaccine according to any of (1) to (5) above, further comprising an adjuvant. (7) The vaccine according to any one of (1) to (6) above, wherein the adjuvant comprises fucoidan. (8) The vaccine according to any one of (1) to (7) above, wherein the bacterial cells are derived from a causative bacterial strain isolated from an eel infected with paracortisol disease. (9) A method for testing the effectiveness of an immersion vaccine, comprising: immunizing glass eels or Japanese sand eels with the immersion vaccine, then removing mucus from the body surface or gills of the glass eels or Japanese sand eels, and contacting the mucus-removed glass eels or Japanese sand eels with the challenge bacterial cells, wherein the effectiveness of the immersion vaccine is demonstrated if the mortality rate due to the challenge bacterial cells is reduced compared to a control that was not treated with the immersion vaccine. (10) A method for promoting infection of the cause of an infectious disease in glass eels or Japanese sand eels, comprising removing mucus from the body surface or gills of the glass eels or Japanese sand eels. (11) The method according to (9) or (10) above, wherein removing the mucus comprises immersing the glass eels or black sand eels in a solution containing an effective amount of a surfactant and suitable for their survival.(12) A method for producing a vaccine for inducing immunity against a fish infectious disease in larvae and fry, comprising: confirming the effectiveness (presence or absence, or degree of effectiveness) of inactivated cells of a causative bacterium of a fish infectious disease or a part of the immunogenicity of the causative bacterium against a challenging strain in larvae and fry; and obtaining a vaccine (e.g., a vaccine whose presence or absence, or degree of effectiveness, has been confirmed) containing the inactivated cells of the causative bacterium of a fish infectious disease or a part of the immunogenicity of the causative bacterium whose effectiveness has been confirmed and a pharmaceutically acceptable additive.

[0016] (13) The vaccine according to any one of (1) to (8) above, which has been confirmed to be effective in reducing mortality to the challenge strain in larvae and fry, particularly glass eels or Japanese black eels, or eel larvae and fry weighing less than 0.5 g, by 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 100%. (14) The method according to (12) above, which has been confirmed to be effective in reducing mortality to the challenge strain in larvae and fry, particularly glass eels or Japanese black eels, or eel larvae and fry weighing less than 0.5 g, by 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 100%.

[0017] Infecting target fish species with a disease is the first hurdle when considering a vaccine, and clearing this hurdle is a necessary and sufficient condition for vaccine development.

[0018] Figure 4 shows the effect of challenge with the Edwardsiella tarda challenge strain on pretreated glass eels. Figure 4 shows the effect of challenge with the Edwardsiella tarda challenge strain on pretreated glass eels without pretreatment. Figure 4 shows the dose-dependency of the effect on survival of challenge with the Edwardsiella tarda challenge strain on pretreated eels. Figure 4 shows the effect of additional treatment with fucoidan on survival of challenge with the Edwardsiella tarda challenge strain on pretreated eels. Figure 4 shows the effect of immersion vaccination on survival of challenge with the Edwardsiella tarda challenge strain on pretreated eels. In Figure 4A, vaccination was performed on glass eels, and challenge was performed at the black eel stage. Figure 4B shows the effect of immersion vaccination on survival of challenge with the Edwardsiella tarda challenge strain on pretreated eels. In Figure 4C, the vaccine treatment was performed against Kuroko and the challenge was performed against Kuroko. The time course of the number of surviving glass eels with various challenge strains is shown.

[0019] As used herein, "farmed fish" refers to fish that are farmed for food, such as yellowtail (yellowtail), red sea bream, amberjack, bluefin tuna, tiger pufferfish, flounder, striped jack, horse mackerel, yellowtail amberjack, stonefish, filefish, rockfish, scorpionfish, black porgy, rockfish, sea bass, red sea bream, grunt, meagre, black sea bream, chub mackerel, yellowtail grouper, grouper, and eel. Fish may be, for example, Actinopterygii, Neopterygii, or Teleostei.

[0020] As used herein, "Edwardsiela tarda" refers to the gram-negative bacillus that causes paracolo disease. While Edwardsiela tarda has long been identified as the causative agent of paracolo disease, the Japanese Society of Fish Pathology, as of March 2023, has identified it as Edwardsiela pissicida. However, the causative agent of paracolo disease in fish (e.g., farmed fish) is also commonly referred to as Edwardsiela tarda. In accordance with conventional usage, this specification will refer to Edwardsiela tarda unless otherwise noted. Edwardsiela tarda belongs to the genus Edwardsiela in the family Hafniaceae of the Enterobacteriaceae class. Edwardsiela anguillarum, a recently separated species from Edwardsiela pissicida, is also known as the causative agent of paracolo disease. Paracolo disease is considered a zoonotic disease and can affect a wide variety of animals, including fish, amphibians, reptiles, and mammals. Edwardsiella tarda isolated from fish could be developed as a vaccine for fish. Edwardsiella tarda isolated from the same fish species would preferably be developed as a vaccine for that species. In one aspect, Edwardsiella tarda is isolated from eels.

[0021] As used herein, "immunity" refers to a defense mechanism of vertebrates against foreign substances (e.g., invaders). Immunity includes innate immunity and adaptive immunity. Adaptive immunity includes antigen-specific immunity. A vertebrate immunized with a vaccine can induce specific immunity against components contained in the vaccine. Immunological memory is the ability of the immune system to quickly and specifically recognize and mount an immune response to an antigen previously encountered by an individual. Immunological memory forms the basis of vaccine effectiveness. Immunological memory occurs after the primary immune response to an antigen. After the primary immune response, memory T cells and memory B cells remain, and can immediately respond and eliminate the antigen when the same antigen is encountered again. Memory cells are long-lived and can persist in the body for decades.

[0022] As used herein, a "vaccine" refers to a composition used to induce specific immunity against a cause of infectious disease in a subject (e.g., fish, preferably farmed fish). A subject (e.g., farmed fish) administered with the vaccine may induce specific immunity against the cause of infectious disease and acquire resistance to infection. A subject (e.g., farmed fish) administered with the vaccine may, for example, experience reduced symptoms of infectious disease or an improved survival rate from infectious disease. Vaccines for aquatic fish (e.g., farmed fish) are preferably attenuated vaccines or inactivated vaccines. Inactivated vaccines may preferably be whole particle vaccines. Inactivated vaccines can be obtained, for example, by subjecting bacterial cells to physical or chemical treatment (preferably, treatment with formalin). The formalin concentration and bacterial cell treatment conditions can be appropriately determined by those skilled in the art. Inactivated vaccines may further contain an adjuvant in addition to inactivated bacterial cells. Oral administration of the vaccine is achieved by feeding fish with feed containing the vaccine. Vaccine administration by immersion is achieved by immersing fish in rearing water containing the vaccine. The rearing water preferably meets the standards for aquatic use.

[0023] In this specification, "eel" is a general term for fish of the Anguilla genus in the Anguillidae family. Japanese eels, European eels, and American eels are abundant, and Japanese eels and European eels are actively farmed. Eels hatch from eggs in the sea and develop into adult eels through preleptocephalus (larvae up to approximately 1 cm), leptocephalus (larvae up to approximately 1-6 cm), glass eels (juveniles up to approximately 5-6 cm), and black eels (juveniles). Glass eels are thought to grow in the sea, then migrate from the sea to rivers, where they are subsequently reared. Glass eels and later have morphological characteristics similar to those of adult fish. Glass eels are small and transparent because they lack pigment. Glass eels, when raised under warm conditions (for example, at about 28°C to about 30°C), grow into black eels in about a week. Black eels have a black pigment. Eel farming begins with capturing wild glass eels. In Japan, eel fry (glass eels) that have reached the coast of Japan on ocean currents are caught and then farmed. Eel farming is typically carried out in eel ponds under heated conditions in a greenhouse.

[0024] <Vaccine of the Present Invention> According to the present invention, a vaccine against infectious diseases in farmed fish (especially eels) is provided.

[0025] Vaccines contain pathogens that cause infectious diseases in fish or immunogenic parts thereof, which induce immunity against the pathogen in vaccinated fish, enabling them to acquire resistance to infectious diseases.

[0026] The pathogen can be a microorganism (e.g., a bacterium) or a virus. In a preferred embodiment, the pathogen is a bacterium of the genus Edwardsiella, preferably Edwardsiella tarda (i.e., E. piscicida) or E. anguillarum. The vaccine can be a live vaccine, an attenuated vaccine, or preferably an inactivated vaccine. The vaccine can be a whole particle vaccine or a split vaccine. In one embodiment, the vaccine can include a whole particle inactivated vaccine.

[0027] Vaccines for farmed fish include those administered by injection, those administered orally, and those administered by immersion. In a preferred embodiment of the present invention, the vaccine is administered by immersion.

[0028] According to the present invention, the eels may be eel larvae and fry weighing less than 0.5 g, such as glass eels or black eels. The eel larvae and fry preferably weigh 0.1 g to 0.5 g per tail, 0.1 g to 0.4 g per tail, 0.1 g to 0.3 g per tail, 0.1 g to 0.2 g per tail, 0.2 g to 0.4 g per tail, or 0.2 g to 0.3 g per tail, preferably 0.1 g to 0.2 g per tail (the same applies below). In one embodiment, the weight of the eel larvae and fry may be 2,000 to 10,000, 3,000 to 9,000, 4,000 to 8,000, 5,000 to 10,000, 5,000 to 9,000, 5,000 to 8,000, or 5,000 to 7,000 per kg of larvae and fry. Eels at this developmental stage have strong resistance to infectious diseases, and there are no conditions that would allow them to develop and die, making it difficult to evaluate the effectiveness of a vaccine. However, in the present invention, by pretreating the eel larvae, we have succeeded in weakening their defenses against infectious diseases, causing them to develop infectious diseases and die. This has made it possible to clarify the effectiveness of vaccines on the eel larvae, and we have been able to complete a vaccine for eel larvae (particularly a vaccine whose effectiveness has been confirmed). Therefore, the present invention provides a vaccine for eel larvae (particularly a vaccine whose effectiveness has been confirmed).

[0029] Eel larvae and fry weighing less than 0.5 g are suitable for immersion administration. A large number of larvae and fry can be treated in bulk at once. Examples of eel larvae and fry weighing less than 0.5 g include glass eels and black eels.

[0030] Thus, the present invention provides a vaccine for use in inducing immunity against Edwardsiella tarda (i.e., Edwardsiella pissicida) and / or Edwardsiella anguillarum in glass eels or Japanese black eels, or eel larvae weighing less than 0.5 g. In this aspect, the vaccine contains Edwardsiella tarda cells or an immunogenic portion thereof (e.g., an antigen). The Edwardsiella tarda (i.e., Edwardsiella pissicida) and / or Edwardsiella anguillarum cells (which may be a mixture of the two) may be attenuated or, preferably, inactivated cells. Administration of the vaccine to glass eels or Japanese black eels, or eel larvae weighing less than 0.5 g, is preferably carried out by immersion. Immersion conditions can be appropriately determined by those skilled in the art and are not particularly limited. For example, the larvae and fry can be immersed for 30 minutes to 24 hours while aerating the water temperature in the range of 4 to 25°C. Immersion is carried out under conditions suitable for the survival of the larvae and fry (particularly, conditions suitable for vaccine administration). In one aspect, the vaccine is not administered orally via feed or the like. In one aspect, the vaccine treatment is carried out under conditions where the larvae and fry are not fed.

[0031] The efficacy of the vaccine can be confirmed in glass eels or black eels, or in eel larvae and fry weighing less than 0.5 g. Of course, the efficacy of the vaccine can also be confirmed in eel fry or adult fish at later developmental stages. In order to rapidly evaluate the efficacy of the vaccine, it is desirable to confirm the efficacy in glass eels or black eels, or in eel larvae and fry weighing less than 0.5 g.

[0032] In testing vaccine effectiveness, infection is typically forced and the vaccine's effect on infectious diseases is confirmed. Confirmation can be achieved by observing whether a statistically significant difference in vaccine effectiveness is observed between vaccinated and unvaccinated groups. In testing vaccine effectiveness, subjects must be infected with the pathogen that causes the disease and develop the disease. Methods have been developed to date in which pathogens are injected into subjects to cause disease. As such, testing vaccine effectiveness does not necessarily require the same infection pattern as occurs in the wild. For fish sizes that cannot be injected, alternative infection routes must be considered. For fish sizes that cannot be injected, methods such as infecting the subject with pathogens by oral administration or immersion are appropriate.

[0033] However, in some fish species or their developmental stages, disease symptoms may not fully develop despite contact with or administration of pathogens. For example, glass eels, black eels, or eel larvae weighing less than 0.5 g do not develop disease even when immersed in an aqueous solution containing pathogens. Therefore, it has been difficult to verify the effectiveness of vaccines in these eel larvae. This has also prevented the development of vaccines. However, if a vaccine could be developed for these larvae and larvae and immunity could be induced, it would be possible to vaccinate fish (especially eels) at subsequent developmental stages when they are susceptible to infection.

[0034] When glass eel larvae are immersed in the vaccine and then challenged with Edwardsiella tarda at the black eel stage, the vaccine effect (preferably, an improvement in survival rate) is confirmed. This result suggests that glass eels establish (induce) immune memory against Edwardsiella tarda. Thus, the vaccine of the present invention can induce immune memory in larvae. In particular, the vaccine of the present invention can induce immune memory (e.g., immune memory against Edwardsiella tarda) in eel larvae. The immune memory is maintained in individuals for a long period of time.

[0035] According to the present invention, the vaccine may further contain an adjuvant. Adjuvants are not particularly limited as long as they enhance vaccine efficacy, but examples include type I interferon, interferon-γ, polysaccharide adjuvants, and oil-based adjuvants. Examples of polysaccharide adjuvants include fucoidan. Fucoidan is a component found in seaweed (particularly brown algae, specifically kelp, wakame (mekabu), and mozuku) and is a type of water-soluble dietary fiber. Fucoidan is known as a polymeric polysaccharide containing sulfated fucose. Examples of oil-based adjuvants include complete Freund's adjuvant and incomplete Freund's adjuvant. Furthermore, brown algae extracts such as mozuku extract can be used as adjuvants. Brown algae extracts such as mozuku extract contain fucoidan (e.g., 60% by weight or more, preferably 70% by weight or more, and more preferably 80% by weight or more) and exhibit adjuvant effects. The adjuvant does not necessarily have the function of stimulating immunity by itself, but may have the function of stimulating immunity by itself.

[0036] The vaccine of the present invention has been confirmed to be effective in larvae and fry, particularly glass eels or Japanese knotweeds, or eel larvae and fry weighing less than 0.5g. For example, the vaccine of the present invention has been confirmed to reduce mortality to the challenge strain in larvae and fry, particularly glass eels or Japanese knotweeds, or eel larvae and fry weighing less than 0.5g, by 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 100%. Thus, the present invention provides a vaccine that has been confirmed to reduce mortality to the challenge strain in larvae and fry, particularly glass eels or Japanese knotweeds, or eel larvae and fry weighing less than 0.5g, by 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or 100%.

[0037] <Method of Inducing Infectious Disease in the Present Invention> The present invention provides a method for inducing pathogen infection, and preferably disease onset, by subjecting larvae and fry, particularly glass eels or black eels, or eel larvae and fry weighing less than 0.5 g, to a specific pretreatment. The pretreatment increases the susceptibility of eel larvae and fry to infection with pathogens (or decreases their resistance to infection). Promotion of infection in larvae and fry is important in vaccine development, particularly in evaluating vaccine efficacy. Promotion of infection in larvae and fry is also thought to be essential for developing vaccines with high vaccine efficacy.

[0038] According to the examples described below, immersion of larvae and fry in an aqueous solution (breeding water) containing an effective amount of a surfactant can reduce the resistance of the larvae and fry to subsequent pathogen exposure. This reduction in resistance to pathogens was believed to be due to the removal of mucus from the gills and / or body surface of the larvae and fry. Mucus is an important tissue for preventing infection, and in the larvae and fry treated with a surfactant, mucus was removed (e.g., the mucus was removed sufficiently to destroy the mucus's barrier function or to destroy the mucus's tissue protective function). Therefore, in one aspect, the pretreatment can be the removal of mucus from the gills and / or body surface of the larvae and fry. A suitable treatment for removing mucus can be, for example, immersion of the larvae and fry in an aqueous solution (breeding water) containing an effective amount of a surfactant. Mucus removal can be, for example, sufficient to destroy the mucus's barrier function or to destroy the mucus' tissue protective function. Those skilled in the art would be able to use surfactants at concentrations lower than those at which unacceptable toxicity (e.g., lethality) to the larvae and fry is observed. Such concentrations can be determined appropriately by those skilled in the art.

[0039] The surfactant can be used without any particular limitation, as long as it does not have unacceptable toxicity to larval fish. Examples of surfactants include ionic surfactants and nonionic surfactants. Ionic surfactants include anionic surfactants, cationic surfactants, and amphoteric surfactants. Representative anionic surfactants include fatty acid salts (e.g., carboxylate salts), alkylbenzene sulfonates, α-olefin sulfonates, higher alcohol sulfates, polyoxyethylene alkyl ether sulfates, alkyl phosphates, and polyoxyethylene alkyl ether phosphates. Representative cationic surfactants include aliphatic quaternary ammonium salts and alkylbenzyl ammonium salts. Representative nonionic surfactants include polyoxyethylene alkyl ethers and polyethylene glycol fatty acid esters. Amphoteric surfactants include alkyl carboxybetaines and alkylamino fatty acid salts. In some embodiments, the surfactant includes a neutral detergent. In some embodiments, the surfactant includes sodium alkyl ether sulfate. In some embodiments, the surfactant includes fatty acid alkanolamide. In some embodiments, the surfactant includes sodium alkyl ether sulfate and fatty acid alkanolamide. The surfactant may further include an alcohol such as ethanol.

[0040] When glass eels actually migrate from the sea to rivers, they are thought to travel through wastewater containing household detergents, and it is possible that these detergents destroy the barrier function of the mucus on their body surface, reducing their resistance to infection.Although eel larvae have a naturally strong resistance to infection, infectious diseases have been confirmed in eel larvae in eel farms, and one possible reason for this is that the detergents contained in domestic wastewater from rivers reduce the eels' resistance to infection.

[0041] Treatment of larvae and fry with a surfactant can be carried out, for example, by immersing the larvae and fry in rearing water containing an effective amount of surfactant. The treatment can be performed to the extent that the mucus on the larvae's surface is removed or the barrier function of the mucus on the surface is destroyed. After treatment, the removal of mucus from the gills or the destruction of the barrier function of the mucus on the surface may be observed. Considering that the larvae and fry cannot survive if the surfactant concentration is too high, those skilled in the art can appropriately set the surfactant concentration. For example, when sodium alkyl ether sulfate and fatty acid alkanolamide are used for treatment, the larvae and fry can be treated for 60 seconds at a concentration of approximately 0.05% by volume, respectively. Removal or destruction of the mucus does not need to be complete. This is because even partial removal or destruction of the mucus will cause the mucus to lose its resistance to pathogens. Larvae and fry can be washed before the infection test. Washing can be performed by immersion in rearing water or by running water.

[0042] The pretreated larvae and fry can be subjected to a pathogen infection test. The pretreated larvae and fry can be immersed in rearing water containing a pathogen, thereby allowing them to become infected with the pathogen. Infection conditions can be determined appropriately by those skilled in the art, but for example, infection can be established by immersing the larvae and fry in rearing water containing a sufficient amount of the pathogen. A sufficient amount of the pathogen can be, for example, an amount that kills more than half, more than 60%, more than 70%, more than 80%, more than 90%, or even 100% of the infected fish. In a preferred embodiment, the mortality rate or infection rate of individuals caused by the challenge bacteria is 60% or more, more preferably 80% or more. If the mortality rate or the incidence rate of infection reaches 100%, it becomes easy to establish an evaluation system for vaccine effectiveness. Therefore, in a more preferred embodiment, the mortality rate of individuals caused by the challenge bacteria is 100%. A sufficient amount of the pathogen can be determined appropriately by those skilled in the art, but for example, it is about 10 5 CFU / mL ~ approx. 10 9 CFU / mL, preferably in the range of about 10 6 CFU / mL or more, more preferably about 10 8 CFU / mL or more, more preferably about 10 9The pathogen may contain an amount of 100 CFU / mL or more. The immersion of the larvae and juveniles in the rearing water containing the pathogen is not particularly limited, and can be carried out for, for example, 10 to 24 hours. The rearing water temperature at the time of infection is preferably in the range of about 28°C to about 32°C, more preferably in the range of about 30°C to about 32°C. The rearing water can be kept immersed throughout the entire period. In one aspect, the challenge does not involve oral administration of the challenge bacteria. In one aspect, the challenge is carried out under feed-free conditions.

[0043] After infection, the eels can be reared in rearing water, to which surfactants such as sodium alkyl ether sulfate and fatty acid alkanolamide may be added at concentrations lower than those used in the pretreatment, for example, 10% or less, 5% or less, 4% or less, 3% or less, 2% or less, or 1% or less of the concentration used in the pretreatment.

[0044] When the larvae and fry are eel larvae and fry, the larvae and fry can be infected with Edwardsiella tarda (i.e., Edwardsiella pissicida) or Edwardsiella anguillarum, for example, by immersing the pretreated larvae and fry in rearing water containing Edwardsiella tarda (i.e., Edwardsiella pissicida) or Edwardsiella anguillarum. In the present invention, the ability to infect eel larvae and fry makes it easier to evaluate the induction of immunity and immunological memory by a vaccine.

[0045] All operations are carried out under conditions suitable for farmed fish.

[0046] The infection method of the present invention used Edwardsiella tarda. Specifically, the Edwardsiella tarda strain used was the eel-derived strain KG-8401 G-10 obtained by passing through fish bodies or a fresh eel-derived field isolate. Furthermore, as a pretreatment before infection, the rearing water was supplemented with a surfactant (here, sodium alkyl ether sulfate and fatty acid alkanolamide (abbreviated as SDOP / FAA)), and the larval fish were immersed in the surfactant. The strains used are not limited to the KG-8401 G-10 strain or the eel-derived field isolate; they may also be fresh isolates from infected fish such as eels or flounders, or previously isolated and preserved strains.

[0047] The infection test method mimics the testing method for ayu vibriosis vaccines. Pretreated larval eels can be infected with Edwardsiella tarda by immersing them in an aerated infection solution. Subsequently, during the observation period, the eels can be reared in rearing water containing 0.1% to 3.5% by weight of sodium chloride. Alternatively, the eels can be continuously stressed by further adding 0.001% to 0.005% by volume of SDOP / FAA to the rearing water.

[0048] The bacteria required for infection were prepared by spreading an appropriate strain, such as KG-8401 G-10, onto an appropriate medium, such as 1.5% sodium chloride-supplemented brain heart broth (BHI) agar medium, using a platinum loop. After 48 hours of incubation at 25°C, bacteria were picked from the colonies formed and suspended in 0.1 mL of phosphate-buffered saline. This suspension was then dropped onto a new 1.5% sodium chloride-supplemented agar medium and smeared over the entire surface with a conical rod. After 24-48 hours of incubation at 25°C, the entire surface was scraped off and suspended in 5 mL of phosphate-buffered saline. This bacterial suspension was diluted 10-1000 times with 1% sodium chloride-supplemented rearing water to prepare a concentrated bacterial suspension. Alternatively, the inoculum was cultured in 1.5% sodium chloride-supplemented liquid medium at 25°C for 24 hours to prepare a concentrated bacterial suspension. The rearing water temperature during infection was 30-32°C.

[0049] Vaccine Preparation Edwardsiella tarda KG-8401G-10 strain, the causative bacterium of parachoroblast disease, was cultured in 1.5% sodium chloride-added trypticase soy broth (TSB) liquid medium at 25°C for 24 to 48 hours, and then inactivated with 0.3% formalin to prepare the vaccine. The viable cell count before preparation was 10 9The CFU / mL was used. Fucoidan was used as an adjuvant in a range of 0.1% to less than 3%, preferably 0.2% or more, and more preferably 0.5% or more. Fucoidan was extracted from mozuku seaweed (Celtic seaweed) according to conventional methods. Fucoidan was obtained by extracting mozuku seaweed with ethanol, treating the residue with citric acid, centrifuging the supernatant, and then ultrafiltrating the filtrate. The fucoidan content in the mozuku seaweed extract was 85% or more. Adjuvants are not limited to fucoidan; naturally occurring immunostimulatory substances can also be used.

[0050] The vaccine was diluted with rearing water to a concentration of 0.1 to 10%, and the test fish were immersed in the water for 30 minutes to 24 hours with aeration at a temperature of 4 to 25°C. The eels used weighed 0.1 to 0.2 g per eel, and were fed in a range of 5,000 to 7,000 eels per kg.

[0051] Test 1: Infection test Three small 1 L tanks containing 10 glass eels (average fish weight 0.14 g) caught at the same time were used. As a pretreatment, the glass eels (10 eels) were immersed in a 0.05% by volume SDOP / 0.05% by volume FAA solution (hereinafter simply referred to as "0.05% SDOP / FAA") for 60 seconds, and then the drug was washed off under running water. Next, the infection bacterial solution (10 9 Pretreated glass eels were transferred to water containing 0.001% by volume SDOP and 0.001% by volume FAA (hereinafter simply referred to as "0.001% SDOP / FAA") at a temperature of 30°C with aeration and immersed for 3 hours. Pretreated glass eels were immersed in phosphate-buffered saline for 3 hours as a non-inoculated control. Each eel was reared in rearing water containing 0.001% by volume SDOP and 0.001% by volume FAA (hereinafter simply referred to as "0.001% SDOP / FAA") at a temperature of 30°C with aeration for 2 weeks. No food was provided during rearing. The number of eels that died during the rearing period after infection was counted and bacteria were isolated.

[0052] From the results of Figure 1A, 9 The CFU / mL bacterial count confirmed that all pre-treated eels died, whereas no deaths were observed in uninoculated controls. Furthermore, further Edwardsiella tarda was isolated from all dead fish. Furthermore, in 10 eels infected with the same method as above without the pre-treatment,9 In glass eels treated with an infection solution containing Edwardsiella tarda at 10 CFU / mL, no infection or death was observed (see Figure 1B). This experiment was conducted using various concentrations of sodium chloride and sodium sulfate in the infection solution, but in all cases, no infection or death was observed in glass eels. Thus, without pretreatment, larval eels have extremely strong resistance to infection.

[0053] Test 2: Evaluation test of vaccine effectiveness Four small 1 L tanks containing 10 eels (average fish weight 0.14 g) caught at the same time were used. Ten glass eels in each test group were pretreated by immersing them in a 0.05% SDOP / FAA solution for 60 seconds, after which the drug was washed off under running water. Next, the infected bacterial solution (10%) diluted with 1% saline water was added to the tank. 7 , 10 8 , or 10 9 Pretreated glass eels were transferred to water containing 0.001% SDOP and FAA at a temperature of 30°C and aerated for 3 hours. Pretreated glass eels were also immersed in phosphate-buffered saline for 3 hours as non-inoculated controls. Each glass eel was reared for 2 weeks in rearing water containing 0.001% SDOP and FAA at a temperature of 30°C and aerated. The eels were not fed during the rearing period. The number of eels that died during the rearing period after infection was counted, and bacteria were isolated.

[0054] From the results in Figure 2, 9 CFU / mL: 100%, 10 8 CFU / mL: 20%, 10 7 CFU / mL and 0% mortality was confirmed in the control eels. Edwardsiella tarda was isolated from the dead fish. Thus, the challenge of larval fish with Edwardsiella tarda showed a dose-dependent effect.

[0055] Test 3: Test of the protective effect of fucoidan Two small 1 L tanks were used, each containing 10 glass eels (average fish weight 0.14 g) caught during the same period. A solution containing 1% fucoidan was introduced into one of the tanks, and 100-fold diluted PBS was introduced into the other, and 10 glass eels were placed in each tank. The glass eels were immersed in water at a temperature of 20°C for 5 hours. Two weeks after the fucoidan treatment, the treated glass eels were immersed in a 0.05% SDOP / FAA solution for 60 seconds as a pretreatment, and the drug was then washed off under running water. The glass eels were then placed in an infection solution (10%) diluted with 1% saline-added breeding water. 9 CFU / mL), and then immersed for 3 hours at 30°C with aeration, and challenged with Edwardsiella tarda. Each glass eel was reared in rearing water containing 0.001% SDOP and FAA at 30°C with aeration for 2 weeks.

[0056] The safety of 1% fucoidan solution was confirmed because no abnormalities were observed in any eels during the two-week immunization period with the fucoidan solution.Furthermore, as shown in Figure 3, it was confirmed that fucoidan has a protective effect against paracoccosis.

[0057] Test 4: Test of the adjuvant effect of fucoidan Three small 1 L tanks were prepared to accommodate 10 glass eels (average fish weight 0.14 g) caught at the same time. The first tank contained a vaccine solution (1 x 10 8 CFU / mL seawater, the same applies to all vaccine solutions below). 1% fucoidan-added vaccine solution was added to the second tank, and diluted PBS was added to the third tank. Ten glass eels were placed in each tank. In each tank, the glass eels were immersed for 5 hours at a water temperature of 20°C. Two weeks after immunization, the glass eels were immersed in a 0.05% SDOP / FAA solution for 60 seconds as a pretreatment, after which the drug was washed off under running water, and the challenge bacteria solution was added to 1% saline-added rearing water (10 9 CFU / mL) and challenged by immersion for 3 hours at 30°C with aeration. The eels were then reared in rearing water containing 0.001% SDOP and FAA at 30°C with aeration for 2 weeks. Two weeks after immunization, the glass eels had grown into black eels.

[0058] As shown in Figure 4A, the vaccine improved the survival rate of eels against challenge bacteria, but adding fucoidan to the vaccine further improved the survival rate of eels. These results confirmed the adjuvant effect of fucoidan.

[0059] In the above study, glass eels were vaccinated, and then the eels were challenged with pretreatment and challenge bacteria. Similarly, glass eels were vaccinated, and one week later, the eels were challenged with pretreatment and challenge bacteria. As a result, as shown in Figure 4B, it was revealed that the vaccine effect in glass eels was already exerted at the glass eel stage. Furthermore, the eels were vaccinated, and one week later, the eels were challenged with pretreatment and challenge bacteria. As a result, as shown in Figure 4C, the vaccine treatment of the eels was also sufficient to stimulate the immune system of the eels, and the vaccine effect was observed in the eels. Note that when the glass eels were maintained as glass eels, they were not fed. For example, in Figure 4B, the glass eels were not fed during the test period. In contrast, in Figure 4A, glass eels were fed, and they quickly transformed into black eels after feeding. Note that in all cases except Figure 4B, the tests were conducted under feeding conditions.

[0060] Larval and juvenile eels have an extremely strong resistance to infection, but pretreatment that allows infection makes it possible to test the effectiveness of vaccines in these fish. This means that it is now possible to develop vaccines for these fish, and to determine the effectiveness of vaccine candidates using these fish.

[0061] Test 4: Selection of challenge strain Three small 1 L tanks containing 10 glass eels (average fish weight 0.14 g) caught at the same time were used. As a pretreatment, the glass eels (10) were immersed in a 0.05% by volume SDOP and 0.05% by volume FAA solution (hereinafter simply referred to as "0.05% SDOP / FAA") for 60 seconds, and then the chemicals were washed off under running water. Next, the infection solution (109 Pretreated glass eels were transferred to water containing 0.001% SDOP and 0.001% FAA (hereinafter simply referred to as "0.001% SDOP and FAA") at a temperature of 30°C with aeration and immersed for 3 hours. Pretreated glass eels were immersed in phosphate-buffered saline for 3 hours as a non-inoculated control. Each eel was reared in rearing water containing 0.001% by volume SDOP and 0.001% by volume FAA (hereinafter simply referred to as "0.001% SDOP and FAA") at a temperature of 30°C with aeration for 2 weeks. No food was provided during the rearing period.

[0062] To prepare the bacteria for infection, appropriate strains such as KG-8401 G-10, BSET22001, and BSET23001 were applied to an appropriate medium, such as 1.5% sodium chloride-supplemented brain heart infusion (BHI) agar, using a platinum loop. After 48 hours of incubation at 25°C, bacteria were picked from the colonies that formed and suspended in 0.1 mL of phosphate-buffered saline. This suspension was then dropped onto a fresh 1.5% sodium chloride-supplemented agar medium and smeared over the entire surface with a cone-like stick. After 24-48 hours of incubation at 25°C, the entire surface was scraped and suspended in 5 mL of phosphate-buffered saline. This bacterial suspension was diluted 10-1000 times with 1% sodium chloride-supplemented water to prepare the adjusted bacterial solution. Alternatively, the inoculum was cultured in 1.5% sodium chloride-supplemented liquid medium for 24 hours at 25°C, resulting in a bacterial solution. The concentration of the adjusted bacterial solution to be used is 0.5 x 10 9 ~9.9×10 9 CFU / mL range.

[0063] The results of the infection experiment are shown in Figure 5. As shown in Figure 5, all challenge bacteria infected eels at the juvenile stage and induced a decrease in the number of survivors. It was observed that the survival period of eels after challenge differed depending on the challenge strain. This suggests that by selecting the strain, it is possible to confirm the vaccine effectiveness over various observation periods.

[0064] Reference Experiment 1: Analysis of the Bacterial Cells Used in Test 4. Colonies of strains KG8401, BSET22001, and BSET23001 were picked after 24 hours of incubation in Tryptic Soy Broth (BD) at 25°C, and DNA was extracted using the DNeasy Blood & Tissue Kit (QIAGEN). Using this DNA as a template, qPCR was performed using primers (EP14529F and EP14659R) and probe (EP14615P) specifically detecting E. piscicida, and primers (EPL1583F and EPL1708R) and probe (EPL1611P) specifically detecting E. anguillarum, both designed by Reichley et al. (2015). Both probes were tagged with 6-FAM at the 5' end and BHQ1 at the 3' end. The qPCR reaction mixture consisted of 1.5 μL (15 ng) of template DNA, 10.0 μL of Probe qPCR Mix (Takara Bio), 0.4 μL each of forward and reverse primers (final concentration: 0.2 μM each), and 0.8 μL of probe (final concentration: 0.4 μM), adjusted to a final volume of 20.0 μL with ultrapure water. qPCR reactions were performed using a MiniOpticon real-time PCR system (Bio-Rad) with an initial heat denaturation at 95°C for 30 seconds, followed by 50 cycles of a two-step cycle (95°C for 5 seconds, 60°C for 30 seconds).

[0065] Strains KG8401 and BSET22001 were classified as E. piscicida because they tested positive with primers specifically detecting E. piscicida and negative with primers specifically detecting E. anguillarum. Strain BSET23001 was classified as E. anguillarum because it tested negative with primers specifically detecting E. piscicida and positive with primers specifically detecting E. anguillarum. The primer sequences used were as follows: Primer sequences for amplification of E. piscicida and probe sequences for detecting the amplified product: EP14529F CTTTGATCATGGTTGCGGAA (SEQ ID NO: 1) EP14659R CGGCGTTTTCTTTTCTCG (SEQ ID NO: 2) EP14615P CCGACTCCGCGCAGATAACG (SEQ ID NO: 3) Primer sequences for amplification of E. anguillarum and probe sequences for detecting the amplified product: EPL1583F GATCGGGTACGCTGTCAT (SEQ ID NO: 4) EPL1708R AATTGCTCTATACGCACGC (SEQ ID NO: 5) EPL1611P CCCGTGGCTAAATAGGACGCG (SEQ ID NO: 6)

[0066]

[0067] Reference Experiment 2: Analysis of agglutination reactions using antisera to E. piscicida and antisera to E. anguillarum Antisera to E. piscicida were prepared as follows. Eels weighing approximately 200 g were intraperitoneally injected with 0.1 mL of a solution containing the E. piscicida KG8401 strain. Three days later, 0.1 mL was injected intraperitoneally again. Two weeks after the second injection, whole blood was collected from the eels. Antisera to the E. anguillarum BSET23001 strain were prepared in the same manner as the antisera to E. piscicida. Agglutination reactions were confirmed by slide agglutination tests using live bacteria and 96-well plate agglutination tests using inactivated bacteria.

[0068] The results are shown in Tables 2 to 4. As shown in Tables 2 to 4, both the antisera against E. piscicida and the antisera against E. anguillarum showed agglutination reactions with both E. piscicida and E. anguillarum. This suggests that both the inactivated E. piscicida vaccine and the inactivated E. anguillarum vaccine are effective against both E. piscicida and E. anguillarum. It is possible that the antigens reacting with the antisera produced using rabbits and eels are different. However, both antisera showed cross-species cross-reactivity, suggesting that although E. piscicida and E. anguillarum are classified as different species due to differences in the sequences of several genes, they are very closely related and cannot be distinguished serologically. None of the antisera showed agglutination with the negative control, V. anguillarum.

[0069]

[0070]

[0071]

[0072] Thus, E. piscicida and E. anguillarum are serologically indistinguishable. Furthermore, it is clear that a vaccine against paracoccosis can be prepared using a vaccine containing inactivated cells of either E. piscicida or E. anguillarum.

[0073] Test 5: Vaccine efficacy test Glass eels were treated as in Test 4, and the challenge strain and vaccine were prepared in the same manner as in Test 4. Test 5 confirmed whether an inactivated vaccine of E. anguillarum (BSET23001) could protect against challenge with E. piscicida (BSET22001 strain), and whether an inactivated vaccine of E. piscicida (BSET22001 strain) could protect against challenge with E. anguillarum (BSET23001).

[0074] The results are shown in Table 5. As shown in Table 5, the inactivated vaccine of E. anguillarum (BSET23001) protected against challenge with E. piscicida (BSET22001 strain), and the inactivated vaccine of E. piscicida (BSET22001 strain) protected against challenge with E. anguillarum (BSET23001).

[0075]

Claims

1. A vaccine for inducing immunity against infectious diseases in fish larvae and juveniles, comprising the causative agent of paracoccosis or an immunogenic part thereof.

2. The vaccine according to claim 1, wherein the subject fish has a body weight of less than 0.5 g.

3. The vaccine according to claim 1 or 2, wherein the fish to be administered (i.e., the larvae and juveniles) are glass eels.

4. The vaccine according to any one of claims 1 to 3, which is administered to fish by the immersion method.

5. The vaccine according to any one of claims 1 to 4, wherein the bacterial cells include inactivated bacterial cells.

6. The vaccine of any one of claims 1 to 5, further comprising an adjuvant.

7. The vaccine of any one of claims 1 to 6, wherein the adjuvant comprises fucoidan.

8. A vaccine according to any one of claims 1 to 7, wherein the bacterial cells are derived from a causative strain isolated from an eel infected with paracolocasia gracilis.

9. A method for testing the effectiveness of an immersion vaccine, comprising: immunizing glass eels or Japanese knotweeds with the immersion vaccine; then removing mucus from the body surface or gills of the glass eels or Japanese knotweeds; and contacting the glass eels or Japanese knotweeds from which the mucus has been removed with a challenge bacteria; wherein the effectiveness of the immersion vaccine is demonstrated when the mortality rate caused by the challenge bacteria is reduced compared to a control that has not been treated with the immersion vaccine.

10. A method for promoting infection of an infectious disease agent in glass eels or black stag beetles, the method comprising removing mucus from the body surface or gills of the glass eels or black stag beetles.

11. The method according to claim 9 or 10, wherein removing the mucus comprises immersing the glass eels or black eels in a solution containing an effective amount of a surfactant and suitable for their survival.

12. A method for producing a vaccine for inducing immunity against a fish infectious disease in fish larvae and juveniles, comprising: confirming the effectiveness of inactivated cells of a causative bacterium of a fish infectious disease or a portion of the immunogenicity of the causative bacterium against an attack strain in larvae and juveniles; and obtaining a vaccine containing the inactivated cells of the causative bacterium of a fish infectious disease or a portion of the immunogenicity of the causative bacterium whose effectiveness has been confirmed and a pharmaceutical acceptable additive.