Collagen production inhibition device using alternating electric field

Abstract

The present specification discloses a method, system, and apparatus for inhibiting collagen production in fibroblasts using an alternating electric field. In one aspect, the present invention can effectively regulate ECM homeostasis by inhibiting the production of type I procollagen and increasing MMP-1 expression using a low-frequency and low-intensity alternating electric field, thereby effectively regulating (inhibiting) collagen production in fibroblasts. In another aspect, it has the advantage of being applicable not only to the treatment of fibroproliferative skin diseases such as hypertrophic scars and keloids, but also to the prevention and treatment of general surgical wounds that occur after surgery.

Description

Technology Field

[0001] In this specification, a method, system, and apparatus for inhibiting collagen production in fibroblasts using an alternating electric field are disclosed.

[0002] Meanwhile, the present invention was made possible through the support of the following in-hospital research project under the supervision of Seoul National University Bundang Hospital.

[0003] [Research and development projects that supported this invention]

[0004] [Project No.] 02-2024-0016

[0005] [Department Name] Bundang Seoul National University Hospital

[0006] [Name of Project Management (Specialized) Agency] Bundang Seoul National University Hospital

[0007] [Research Project Name] In-house Project

[0008] [Research Project Title] Regulation of Collagen Production in Fibroblasts Using Microalgae and Its Application to the Treatment of Keloids and Scars

[0009] [Name of Project Performing Organization] Department of Dermatology, Bundang Seoul National University Hospital

[0010] [Research Period] 2024.07.01 ~ 2025.06.30

[0012] In addition, this application was supported by the following research project.

[0013] [Research and development projects that supported this invention]

[0014] [Assignment No.] 800-20210284

[0015] [Department Name] Seoul National University

[0016] [Name of Project Management (Specialized) Agency] Seoul National University Research Office

[0017] [Research Project Name] Seoul National University New Professor Research Settlement Fund Support

[0018] [Research Project Title] Study on the Physiological and Pathological Mechanisms of Skin in Artificial Skin Models Fabricated Using 3D Culture Techniques

[0019] [Research Period] April 1, 2024 ~ March 31, 2024 Background Technology

[0020] Over the past few decades, researchers have attempted to use electrical stimulation to influence cellular behaviors such as proliferation, differentiation, and migration. Electrical stimulation has been reported to induce the proliferation and differentiation of preosteoblasts, the differentiation of neural stem cells into neurons, and morphological changes in myoblasts. Furthermore, electrical stimulation has demonstrated beneficial effects in the treatment of diabetic foot ulcers and has been proven effective in the management of various chronic skin ulcers.

[0021] Some studies have focused on how electrical stimulation improves the proliferation of fibroblasts and keratinocytes in the skin, promotes the production of extracellular matrix (ECM) by fibroblasts, and facilitates wound healing by remodeling collagen fibers. While fibroblasts contribute to skin wound healing by producing collagen, excessive collagen production can lead to hypertrophic scars or keloids. Hypertrophic scars and keloids are fibroproliferative skin diseases resulting from dysregulation of the wound healing process; existing research has shown that fibroblasts in hypertrophic scars and keloids increase collagen levels responsible for fibrotic tissue within the dermis. Therefore, while collagen synthesis is essential for wound healing, scar management requires an approach that inhibits collagen synthesis; thus, it is important to explore novel electrical stimulation conditions that can effectively suppress collagen synthesis within pathologically increased scar tissue.

[0022] Previous studies have demonstrated the importance of tensile force in the pathogenesis of hypertrophic scars and keloids. This aligns with observations that keloids occurring on the anterior chest form parallel to skin tension lines. Furthermore, the role of tensile force in scar formation has been further verified through animal experiments. African spiny mice, which have loose skin, were shown not to form scars and to regenerate damaged areas almost completely. Moreover, tensile force applied to the wound site in animal models was shown to increase the expression of α-smooth muscle actin, which is associated with the development of scar tissue. In addition to tensile force, recent studies have revealed that increased tissue stiffness promotes the overproduction of extracellular matrix (ECM) by myofibroblasts, creating a vicious cycle that further hardens the tissue and can ultimately lead to the development of hypertrophic scars or keloids.

[0023] To date, various treatments such as triamcinolone injections into hypertrophic scars and keloid lesions, pulsed dye lasers, fractional lasers, and cryotherapy have been attempted; however, even when applying all existing conservative treatment techniques, the cure rate remains below 50%, and the therapeutic effect is limited. Accordingly, there is a need to develop a new therapeutic approach that can effectively inhibit the excessive production of collagen by fibroblasts.

[0024] Meanwhile, electrical stimulation has recently been utilized as a strategy to inhibit various cellular functions for cancer treatment. Electrical stimulation using alternating current (AC) at intermediate frequencies (100-300 kHz) and low intensity (1-3 V / cm) has shown inhibitory effects on cell growth in gliomas, lung cancer, and mesotheliomas. Based on these effects, the Food and Drug Administration (FDA) approved the use of electrical stimulation as a non-invasive physical therapy for the treatment of gliomas. Although the mechanism of action has been proposed as inhibiting cell division by regulating cell and nuclear membrane permeability, the exact mechanism of electrical stimulation using intermediate frequencies and low intensity AC in malignant tumors remains unclear.

[0025] Accordingly, the inventors completed the present invention by confirming the effect of electrical stimulation using low frequency and low intensity AC on collagen production in human skin fibroblasts. The problem to be solved

[0026] One objective of the present invention is to provide a method, system, and apparatus for inhibiting collagen production in fibroblasts.

[0027] Another objective of the present invention is to provide a system or device for preventing or treating skin diseases (e.g., fibroproliferative skin diseases).

[0028] In another aspect, the present invention provides a biomarker composition for diagnosing skin diseases (e.g., fibroproliferative skin diseases) or predicting the prognosis of treatment. means of solving the problem

[0029] To achieve the above objective, the present invention provides, in one aspect, a method for inhibiting collagen production comprising the step of applying an alternating electric field of 200 Hz to 200 kHz to the skin of a subject.

[0030] In another aspect, the present invention relates to a collagen production inhibition system or device comprising a processing unit that applies an alternating electric field of 200 Hz to 200 kHz to the skin of a target.

[0031] In an exemplary embodiment, the alternating electric field may have an intensity of 1 V / cm to 5 V / cm.

[0032] In an exemplary embodiment, the alternating electric field may be processed for 12 to 36 hours.

[0033] In an exemplary embodiment, the method, system, or device may be for the prevention or treatment of a skin disease (e.g., fibroproliferative skin disease).

[0034] In an exemplary embodiment, the object in the method may be an animal other than a human.

[0035] In another aspect, the present invention provides a biomarker composition for diagnosing or predicting the treatment prognosis of a skin disease (e.g., fibroproliferative skin disease) comprising PIEZO2 and / or CAVIN2; or a gene encoding the same as an active ingredient.

[0036] In another aspect, the present invention provides a composition for diagnosing skin diseases or predicting treatment prognosis comprising, as an active ingredient, a preparation capable of measuring the expression level of PIEZO2 and / or CAVIN2; or a gene encoding therefrom.

[0037] In an exemplary embodiment, if the expression level of the protein or the gene is higher than that of a normal control sample, it can be determined to be a skin disease.

[0038] In an exemplary embodiment, if the expression level of the protein or the gene is lower than before treatment, it can be determined that there is a therapeutic effect on the skin disease. Effects of the invention

[0039] In one aspect, the present invention can effectively regulate ECM homeostasis by using a low-frequency and low-intensity alternating electric field to inhibit the production of type I procollagen and increase MMP-1 expression, thereby effectively regulating (inhibiting) collagen production in fibroblasts.

[0040] In another aspect, the present invention utilizes an alternating electric field, which is harmless to the human body and has the advantage of being able to regulate collagen production in fibroblasts without side effects, as there is no irritation or pain.

[0041] In another aspect, the present invention can be applied not only to the treatment of fibroproliferative skin diseases such as hypertrophic scars and keloids, but also to the prevention and treatment of general surgical wounds that occur after surgery.

[0042] In another aspect, the present invention can predict the diagnosis or treatment prognosis of skin diseases by measuring the expression levels of PIEZO2 and CAVIN2, and based on this, can establish personalized treatment strategies or utilize them in new drug development. Brief explanation of the drawing

[0043] Figure 1 shows the effect of electrical stimulation on ECM protein synthesis. Figure 1A shows a diagram of the device for electrical stimulation, Figures 1B to 1D show the results of real-time PCR analysis of ECM in primary skin fibroblasts after electrical stimulation, and Figures 1E to 1G show the results of Western blot analysis of type I procollagen and matrix metalloproteinase-1 (MMP-1) using culture medium. Figure 2 relates to transcriptome analysis. Figure 2A shows the results of cluster analysis of Differentially Expressed Genes (DEGs). The colors of the heatmap represent relative gene expression, with brighter yellow and darker blue indicating higher and lower gene expression, respectively. Figure 2B shows the results of a comparison of upregulated and downregulated genes (yellow, upregulated; blue, downregulated). Figure 2C shows the results of KEGG (Kyoto Encyclopedia of Genes and Genomes) enrichment analysis of upregulated DEGs. Figure 2D shows the smear plot of upregulated and downregulated genes. Figure 2E shows the results of GO function analysis of cellular components. Figure 2F shows the scatter plot of upregulated and downregulated genes. Figure 3 relates to the verification of differentially expressed genes using quantitative real-time PCR. Figure 4 shows that electrical stimulation of human skin fibroblasts using low frequency and low intensity AC effectively regulates ECM homeostasis by altering the cell membrane structure and function. Figure 5 shows the viability of primary human skin fibroblasts measured using Annexin V and PI staining after electrical stimulation. Specific details for implementing the invention

[0044] The present invention will be described in detail below.

[0045] In one aspect, the present invention relates to a method for inhibiting collagen production, comprising the step of applying an alternating electric field to the skin of a subject.

[0046] In another aspect, the present invention relates to a collagen production inhibition system or device comprising a processing unit that applies an alternating electric field to the skin of a subject.

[0047] In an exemplary embodiment, the system or device may further include a power supply unit that supplies power to the system. The power supply unit may be a wired type using an external power source or a wireless type including a battery. Additionally, it may include a voltage regulator and a protection circuit to ensure the stability of the power supply.

[0048] In an exemplary embodiment, the system or device may further include a generating unit that generates an alternating electric field. The generating unit may include a signal generator and a transformer to generate alternating electric fields of various frequencies and intensities, and may include a filter circuit and an amplifier for stable electrical signal output.

[0049] In an exemplary embodiment, the system or device may further include a control unit for controlling the frequency, intensity, and / or duration of an alternating electric field. The control unit may include a microcontroller (MCU) or a digital signal processor (DSP) and may automatically adjust the characteristics of the electric field according to user input or a pre-programmed algorithm. Additionally, the user may be able to directly change the settings through a touchscreen or button-based interface.

[0050] In an exemplary embodiment, the system may additionally include a sensor unit capable of monitoring skin conditions or detecting electric field transmission states. The sensor unit may measure skin resistance, temperature, humidity, or bioimpedance, and transmit the measured data to a control unit to adjust the electric field output or provide feedback to the user. Additionally, the system may be designed to enable more precise measurements by utilizing a non-contact sensor.

[0051] In an exemplary embodiment, the collagen is produced by fibroblasts present in the dermal layer of the skin and is appropriately synthesized during normal tissue maintenance and wound healing processes. However, collagen may be overproduced under certain pathological conditions. For example, if the wound healing process is overactivated, the proliferation of fibroblasts and collagen synthesis increase abnormally, which may lead to the formation of hypertrophic scars or keloids. Furthermore, the overproduction of collagen is associated with the process of fibrosis and can occur in various diseases such as liver cirrhosis, pulmonary fibrosis, and myocardial fibrosis. In such cases, there is a risk of increased tissue stiffness and functional deterioration due to the excessive accumulation of collagen. Therefore, mechanisms for regulating collagen synthesis and strategies for inhibiting fibrosis are important in tissue regeneration and treatment.

[0052] In an exemplary embodiment, the alternating electric field may have a frequency of 200 Hz to 200,000 Hz (200 kHz), and more specifically, may have a frequency of 200 Hz or higher, 300 Hz or higher, 400 Hz or higher, 500 Hz or higher, 600 Hz or higher, 700 Hz or higher, 800 Hz or higher, 900 Hz or higher, 1,000 Hz or higher, 1,100 Hz or higher, 1,200 Hz or higher, 1,300 Hz or higher, 1,400 Hz or higher, 1,500 Hz or higher, 1,600 Hz or higher, 1,700 Hz or higher, 1,800 Hz or higher, 1,900 Hz or higher, or 2,000 Hz or higher, or 200 kHz or lower, 190 kHz or lower, 180 It may be characterized by having a frequency of kHz or less, 170 kHz or less, 160 kHz or less, 150 kHz or less, 140 kHz or less, 130 kHz or less, 120 kHz or less, 110 kHz or less, 100 kHz or less, 90 kHz or less, 80 kHz or less, 70 kHz or less, 60 kHz or less, 50 kHz or less, 40 kHz or less, 30 kHz or less, or 20 kHz or less. For example, it may have a frequency of 2 to 20 kHz, and when an alternating electric field within the above frequency range is applied, collagen production by fibroblasts in the skin can be effectively inhibited.

[0053] In an exemplary embodiment, the alternating electric field has an intensity of 0.1 V / cm to 5 V / cm, more specifically, an intensity of 0.1 V / cm or more, 0.2 V / cm or more, 0.3 V / cm or more, 0.4 V / cm or more, 0.5 V / cm or more, 0.6 V / cm or more, 0.7 V / cm or more, 0.8 V / cm or more, 0.9 V / cm or more, 1.0 V / cm or more, or 5.0 V / cm or less, 4.9 V / cm or less, 4.8 V / cm or less, 4.7 V / cm or less, 4.6 V / cm or less, 4.5 V / cm or less, 4.4 V / cm or less, 4.3 V / cm or less, 4.2 V / cm or less, 4.1 V / cm or less, 4.0 V / cm or less, 3.9 V / cm or less, 3.8 V / cm or less, 3.7 It may be characterized by having an intensity of V / cm or less, 3.6 V / cm or less, 3.5 V / cm or less, 3.4 V / cm or less, 3.3 V / cm or less, 3.2 V / cm or less, 3.1 V / cm or less, or 3.0 V / cm or less. For example, it may have an intensity of 1-3 V / cm, and when an alternating electric field of the above intensity is applied, collagen production by fibroblasts in the skin can be effectively inhibited.

[0054] In an exemplary embodiment, the alternating electric field may be processed for 12 to 36 hours, 16 to 32 hours, 20 to 28 hours, or 24 hours, but is not limited thereto.

[0055] In an exemplary embodiment, the method, system, or device may be for the prevention or treatment of skin diseases. The skin disease may be a fibroproliferative skin disease, which means a disease in which excessive fibroblast proliferation and abnormal accumulation of extracellular matrix (ECM) occur due to dysregulation of the wound healing process. Examples may include, but are not limited to, hypertrophic scars, keloids, radiation scars, systemic fibrotic diseases such as fibrosis and scleroderma.

[0056] In an exemplary embodiment, the object in the method may be an animal other than a human. The animal may include mammals, birds, reptiles, amphibians, or fish, and more specifically may include rodents such as mice and rats, dogs, cats, rabbits, pigs, monkeys, cows, horses, etc., but is not limited thereto.

[0057] In this specification, the term "diagnosis" means evaluating whether a subject possesses a specific disease or disorder, and for this purpose, methods such as biomarker analysis, measurement of gene expression levels, analysis of protein expression patterns, tissue examination, and imaging diagnosis may be used.

[0058] In this specification, the term "prediction of treatment prognosis" means predicting future changes in symptoms or the course of progression of a specific disease or condition during the course of treatment, and to this end, may include analysis of changes in biomarkers before and after treatment, comparison of gene or protein expression levels, evaluation of the patient's clinical response, and monitoring of long-term treatment effects.

[0059] In another aspect, the present invention relates to a biomarker composition for diagnosing or predicting the therapeutic prognosis of a skin disease (e.g., fibroproliferative skin disease) comprising PIEZO2 (piezo type mechanosensitive ion channel component 2) and / or CAVIN2 (caveolae associated protein 2); or a gene encoding the same as an active ingredient.

[0060] In another aspect, the present invention relates to a composition for diagnosing skin diseases or predicting treatment prognosis comprising, as an active ingredient, a preparation capable of measuring the expression level of PIEZO2 (piezo type mechanosensitive ion channel component 2) and / or CAVIN2 (caveolae associated protein 2); or a gene encoding the same.

[0061] In an exemplary embodiment, the PIEZO2 may be characterized by comprising an amino acid sequence represented by SEQ ID NO. 1. Alternatively, the gene encoding the PIEZO2 may be characterized by comprising a nucleotide sequence represented by SEQ ID NO. 3, but is not limited thereto.

[0062] In an exemplary embodiment, the CAVIN2 may be characterized by comprising an amino acid sequence represented by SEQ ID NO. 2. Alternatively, the gene encoding the CAVIN2 may be characterized by comprising a nucleotide sequence represented by SEQ ID NO. 4, but is not limited thereto.

[0063] In an exemplary embodiment, the agent capable of measuring the expression level of the PIEZO2 and / or CAVIN2 proteins may be, but is not limited to, a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a ligand, a PNA (Peptide nucleic acid), an aptamer, or a nanoparticle that specifically binds to said protein. Analysis methods for this include, but are not limited to, Western blotting, ELISA (enzyme-linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, immunoprecipitation assay, immunohistochemical analysis, Complement Fixation Assay, FACS (Fluorescence activated cell sorter), or protein chip.

[0064] In an exemplary embodiment, the agent capable of measuring the expression level of the gene encoding PIEZO2 and / or CAVIN2 may be, but is not limited to, a primer pair, a probe, or an antisense nucleotide that specifically binds to the gene. Analytical methods for this include, but are not limited to, reverse transcriptase-polymerase chain reaction (RTPCR), real-time polymerase chain reaction (real-time polymerase chain reaction), RNase protection assay (RPA), Northern blotting, and DNA chips.

[0065] In another aspect, the present invention relates to a kit for diagnosing skin diseases or predicting treatment prognosis comprising the above-mentioned biomarker composition.

[0066] In another aspect, the present invention relates to a method for providing information necessary for the diagnosis of a skin disease or the prediction of a treatment prognosis, comprising the step of measuring the expression level of PIEZO2 and / or CAVIN2; or a gene encoding them, in a sample isolated from an individual.

[0067] In an exemplary embodiment, the method may include a step of determining that it is a skin disease if the expression level of the protein or the gene is higher than that of a normal control sample.

[0068] In an exemplary embodiment, the method may include a step of determining that there is a therapeutic effect on the skin disease when the expression level of the protein or the gene is lower than before treatment.

[0069] In an exemplary embodiment, the sample may be, but is not limited to, blood, plasma, serum, urine, saliva, sputum, cerebrospinal fluid, cell culture medium, tissue extract, or tumor tissue, and the sample may be prepared by processing in a manner commonly used in the art.

[0071] The present invention will be described in more detail below through examples and the like. These examples are solely for illustrating the present invention, and it will be obvious to those skilled in the art that the scope of the present invention is not to be interpreted as being limited by these examples.

[0073] [Example]

[0074] Experimental Materials and Methods

[0075] (1-1) cell culture

[0076] Primary human skin fibroblasts were cultured in Dulbecco’s modified Eagle medium (Welgene, Daegu, South Korea) containing 10% fetal bovine serum (FBS) (Gibco, Rockville, MD, USA) and 1% penicillin (Gibco) in a humidified incubator containing 37°C and 5% CO2. This study was conducted in accordance with the principles of the Helsinki Declaration, and all experiments were approved by the Institutional Review Board of Seoul National University Hospital (IRB No: H-1101-116-353).

[0078] (1-2) Electrical stimulation of human skin fibroblasts

[0079] To apply electrical stimulation to the cells, electrodes and an electrical stimulation system were designed as shown in Fig. 1A. Stainless steel was used for the electrodes to prevent chemical reactions with the cell culture medium. The electrodes were placed at 1 cm intervals, and both ends were monitored using an oscilloscope (SDS1204X-E; Siglent Technologies, USA). A Koolertron DDS signal generator (Karson Technology, Hong Kong) was used to generate the necessary amplitude and frequency, and connected to an amplifier and power supply to maintain a constant current and voltage. The voltage was adjusted to deliver a 1 V, 20 kHz sine wave across the electrodes. The electrodes were positioned directly above the cell surface to ensure close contact with the cells.

[0081] (1-3) Quantitative RT-PCR

[0082] Total RNA was isolated from primary human skin fibroblasts using Trizol reagent (Invitrogen, MA, USA) according to the manufacturer's instructions. Subsequently, 3.0 μg of the extracted total RNA was used for cDNA synthesis using the First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). mRNA expression levels were evaluated using the 7500 Real Time PCR System (Applied Biosystems, Foster City, CA, USA) and AccuPower®2X GreenStar™ qPCR Master Mix (Bioneer, Korea). 2 -ΔΔCt Using a method, the relative change in the expression of target genes normalized with respect to GAPDH expression was confirmed.

[0084] (1-4) Western blotting

[0085] After electrical stimulation, human skin fibroblast control medium and total cell lysates were harvested. Equal aliquots of the control culture medium were separated using 8% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to a polyvinylidene fluoride membrane. Blocked with 5% skim milk (Difco™ Skim Milk; 232100; BD, Franklin Lakes, NJ, USA) in 0.1% Tween 20 1× phosphate buffer, and irradiated with monoclonal anti-procollagen type I amino-terminal elongation peptide (SP1.D8) (Developmental Studies, Hybridoma Bank, Iowa City, IA, USA), anti-MMP1 (ab137332; Abcam, MA, USA; 1 / 1000 dilution), and anti-β-actin (13E5; Cell Signaling Technology, Danvers, MA, USA; 1:1000) antibodies. Horseradish peroxidase-conjugated goat anti-rabbit antibody was used as the secondary antibody (32460; Invitrogen; 1:10000).

[0087] (1-5) RNA sequencing (RNAseq) analysis

[0088] After electrical stimulation, human skin fibroblasts were placed in RNAlater solution (Thermo Fisher Scientific). RNA extraction, sequencing, and statistical analysis were performed by Macrogen Inc. (Seoul, Korea).

[0090] (1-6) Statistical analysis

[0091] GraphPad Prism (version 8.0; GraphPad Software Inc., La Jolla, CA, USA) was used for statistical analysis. Differences between two groups and differences among multiple groups were compared using the Mann-Whitney test and Tukey's post-hoc test following one-way ANOVA. Statistical significance was set at P-value < 0.05, and individual values ​​(***P < 0.001, **P < 0.01, *P < 0.05) were indicated.

[0093] Results of analysis of the effects of electrical stimulation on primary human skin fibroblasts

[0094] Electrical stimulation reduced type 1 procollagen production and increased MMP-1 expression in primary human skin fibroblasts.

[0095] Specifically, the effects of electrical stimulation on the synthesis of type 1 procollagen and MMP-1 in skin fibroblasts were investigated. After 12 hours of starvation, cells were electrically stimulated using low-frequency and low-intensity AC (20 kHz, 1 V / cm). When electrical stimulation was applied for 24 hours, mRNA levels of type 1 procollagen and elastin significantly decreased and MMP-1 levels increased in primary human skin fibroblasts (Figs. 1B to 1D). Furthermore, Western blot analysis using culture media showed significant changes after electrical stimulation. While type 1 procollagen levels in the culture media were significantly decreased, electrical stimulation increased MMP-1 production (Figs. 1E to 1G). These results strongly suggest that electrical stimulation effectively inhibits type 1 procollagen production while upregulating MMP-1 expression in skin fibroblasts. Meanwhile, cell viability measured by Annexin V and PI staining was not affected by electrical stimulation of primary human skin fibroblasts (Fig. 5).

[0097] Transcriptome analysis results

[0098] Transcriptome analysis suggests the regulatory mechanisms of type I procollagen production and MMP-1 expression in skin fibroblasts.

[0099] We investigated the mechanism by which electrical stimulation regulates type I procollagen production and MMP-1 expression in skin fibroblasts. mRNA transcriptome analysis using RNAseq revealed that electrical stimulation using low frequency and low intensity AC generated 464 DEGs (all |Fold change|≥2; p < 0.05; Figs. 2A and 2B). According to KEGG (Kyoto Encyclopedia of Genes and Genomes) analysis, electrical stimulation of skin fibroblasts affected genes associated with the collagen-containing ECM, monatomic ion channel complexes, and apical plasma membrane (Figs. 2C and 2D). Other signaling pathways of interest affected by electrical stimulation were membrane-penetrating transporter complexes, membrane rafts, and voltage-gated potassium channel complexes. Additionally, Gene Ontology (GO) functional analysis was performed to identify potential targets of electrical stimulation in primary human fibroblasts. Electrical stimulation altered the collagen-containing ECM in cellular components (Figs. 2E and F). Furthermore, the results suggest that various ion channel complexes, including cell membranes, and fibroblast membranes are affected by electrical stimulation. The 40 most important DEGs after electrical stimulation of primary human fibroblasts are summarized in Tables 1 and 2. These results suggest that the regulation of type I procollagen production and MMP-1 expression in skin fibroblasts is associated with functional changes in membranes and ion channels induced by electrical stimulation.

[0100] Top 40 Genes Downregulated in Fibroblasts After Electrical Stimulation Gene_ID Gene name Gene description Log2|FC| p -value Adjusted p-value Top-down regulated genes 142910 LIPJ lipase family member J -23.024334 0.001782286 0.706148979 9865 TRIL TLR4 interactor with leucine rich repeats -22.374811 6.452E-05 0.096353188 267004 PGBD3 piggyBac transposable element derived 3 -22.143039 0.002116575 0.775305577 4072 EPCAM epithelial cell adhesion molecule -17.166666 0.000467231 0.335956629 115572 TENT5B terminal nucleotidyltransferase 5B -14.914450 0.000345488 0.279471121 55799 CACNA2D3 calcium voltage-gated channel auxiliary subunit alpha2delta 3 -14.518743 0.002516721 0.790569057 4129 MAOB monoamine oxidase B -13.450035 0.000430265 0.321275593 4232 MEST mesoderm specific transcript -12.522595 0.000210974 0.204792663 100499483 CCDC180 coiled-coil domain containing 180 -12.400525 0.000862769 0.495053091 338811 TAFA2 TAFA chemokine like family member 2 -11.803153 0.001601365 0.647685392 100631383 FAM47E-STBD1 FAM47E-STBD1 readthrough -11.491570 0.000198529 0.20285525 51384 WNT16 Wnt family member 16 -11.457720 0.003112808 0.934306823 101927655 ZASP ZO-2 associated speckle protein -11.253543 0.007434817 1 2255 FGF10 fibroblast growth factor 10 -10.837236 0.000263326 0.243031891 1141 CHRNB2 cholinergic receptor nicotinic beta 2 subunit -10.506228 0.004547753 1 8436 CAVIN2 caveolae associated protein 2 -10.423505 0.000492385 0.34139891 100526693 ARPC4-TTLL3 ARPC4-TTLL3 readthrough -10.400079 0.00032277 0.272446084 124 ADH1A alcohol dehydrogenase 1A (class I), alpha polypeptide -9.387715 0.015150304 1 100133941 CD24 CD24 molecule -9.237573 0.007826126 1 8743 TNFSF10 TNF superfamily member 10 -9.079592 0.000606692 0.392610455 643338 C15orf62 chromosome 15 open reading frame 62 -8.919707 0.003998158 1 6357 CCL13 C-C motif chemokine ligand 13 -8.679708 0.006319303 1 11170 FAM107A family with sequence similarity 107 member A -8.675357 0.002436393 0.790569057 29841 GRHL1 grainyhead like transcription factor 1 -8.496681 0.001185659 0.590214826 4675 NAP1L3 nucleosome assembly protein 1 like 3 -8.365846 0.001550925 0.640630951 125 ADH1B alcohol dehydrogenase 1B (class I), beta polypeptide -8.296212 0.000889987 0.495053091 64919 BCL11B BAF chromatin remodeling complex subunit BCL11B -8.286082 0.012140675 1 7730 ZNF177 zinc finger protein 177 -8.187467 0.003181985 0.935985829 284040 CDRT4 CMT1A duplicated region transcript 4 -8.163663 0.000892493 0.495053091 79656 BEND5 BEN domain containing 5 -8.110509 0.00472768 1 6356 CCL11 C-C motif chemokine ligand 11 -8.056228 0.001422409 0.615661579 7472 WNT2 Wnt family member 2 -8.017266 0.00084909 0.495053091 653567 TMEM236 transmembrane protein 236 -7.988343 0.027322057 1 54821 ERCC6L ERCC excision repair 6 like, spindle assembly checkpoint helicase -7.521886 0.033664757 1 389125 MUSTN1 musculoskeletal, embryonic nuclear protein 1 -7.521886 0.033664757 1 338382 RAB7B RAB7B, member RAS oncogene family -7.405789 0.001300185 0.615661579 3627 CXCL10 C-X-C motif chemokine ligand 10 -7.389110 0.00139584 0.615661579 150590 C2orf15 chromosome 2 open reading frame 15 -7.334591 0.019434951 1 63895 PIEZO2 piezo type mechanosensitive ion channel component 2 -7.250286 0.006383312 1

[0101] 전기 자극 후 섬유아세포에서 상향 조절된 상위 40개 유전자 Gene_ID Gene name Gene description Log2|FC| p -value Adjustedp-value Top up regulated genes 341405 ANKRD33 ankyrin repeat domain 33 24.735333 4.14846E-05 0.094067798 4071 TM4SF1 transmembrane 4 L six family member 1 18.610142 9.0973E-06 0.090076451 164684 WBP2NL WBP2 N-terminal like 18.099802 0.000997265 0.537803029 6863 TAC1 tachykinin precursor 1 17.783615 1.7624E-05 0.090076451 100302652 GPR75-ASB3 GPR75-ASB3 readthrough 17.145979 0.006635587 1 9956 HS3ST2 heparan sulfate-glucosamine 3-sulfotransferase 2 16.512378 2.78044E-05 0.090076451 3589 IL11 interleukin 11 15.679315 2.29558E-05 0.090076451 6781 STC1 stanniocalcin 1 15.078708 2.78386E-05 0.090076451 100533496 TVP23C-CDRT4 TVP23C-CDRT4 readthrough 14.787845 4.32441E-05 0.094067798 5097 PCDH1 protocadherin 1 14.363610 0.000160663 0.190391369 9132 KCNQ4 potassium voltage-gated channel subfamily Q member 4 13.826998 0.003367649 0.943798303 9518 GDF15 growth differentiation factor 15 13.606276 4.91881E-05 0.095493868 9241 NOG noggin 13.556377 6.34572E-05 0.096353188 1440 CSF3 colony stimulating factor 3 12.750106 7.31462E-05 0.101432911 11009 IL24 interleukin 24 12.444253 0.000111668 0.144528797 645369 TMEM200C transmembrane protein 200C 11.927974 0.006295194 1 145741 C2CD4A C2 calcium dependent domain containing 4A 11.541936 0.0003789 0.294238492 7056 THBD thrombomodulin 11.463245 0.000176524 0.190391369 26049 FAM169A family with sequence similarity 169 member A 10.870140 0.034780972 1 91156 IGFN1 immunoglobulin like and fibronectin type III domain containing 1 10.439082 0.000589658 0.392610455 11211 FZD10 frizzled class receptor 10 9.950769 0.00138752 0.615661579 3976 LIF LIF interleukin 6 family cytokine 9.899971 0.000275404 0.243031891 390928 ACP7 acid phosphatase 7, tartrate resistant (putative) 9.625839 0.001144039 0.584483548 3456 IFNB1 interferon beta 1 9.554194 0.015150304 1 123722 FSD2 fibronectin type III and SPRY domain containing 2 9.554194 0.015150304 1 2827 GPR3 G protein-coupled receptor 3 9.146792 0.000698429 0.437396554 50614 GALNT9 polypeptide N-acetylgalactosaminyltransferase 9 8.749759 0.00222885 0.785690355 55607 PPP1R9A protein phosphatase 1 regulatory subunit 9A 8.591539 0.007116069 1 80201 HKDC1 hexokinase domain containing 1 8.580175 0.001138873 0.584483548 5029 P2RY2 purinergic receptor P2Y2 7.763279 0.006191067 1 388125 C2CD4B C2 calcium dependent domain containing 4B 7.763279 0.006191067 1 114 ADCY8 adenylate cyclase 8 7.373580 0.002042223 0.775305577 23025 UNC13A unc-13 homolog A 7.068924 0.002091116 0.775305577 3748 KCNC3 potassium voltage-gated channel subfamily C member 3 6.879319 0.017459041 1 27237 ARHGEF16 Rho guanine nucleotide exchange factor 16 6.879319 0.017459041 1 9507 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif 4 6.839064 0.00190183 0.738442613 100507747 C13orf46 chromosome 13 open reading frame 46 6.673782 0.009812054 1 5026 P2RX5 purinergic receptor P2X 5 6.473408 0.009676606 1 6517 SLC2A4 solute carrier family 2 member 4 6.445359 0.01348744 1

[0103] Verification of DEGs using RT-PCR

[0104] To verify DEGs identified via RNA-Seq PIEZO2 and CAVIN2 We selected two genes and performed qRT-PCR analysis (Fig. 3). coding for piezo-type mechanosensitive ion channel component 2 PIEZO2 It is a mechano-sensing cation channel that responds to various types of external forces. In one study Piezo2 Studies have reported that fibroblasts play a crucial role in sensing tissue stiffness in lung tissue, through which they differentiate into profibrotic myofibroblasts and induce ECM overproduction, thereby causing fibrosis in lung tissue. Coded for Cavin-2 Cavin-2 It has been reported to regulate the morphology and function of caveolas, and recent studies in fibroblasts Cavin-2 It has been revealed that it is associated with cardiac fibrosis.

[0105] Quantitative RT-PCR analysis results showed that electrical stimulation in skin fibroblasts PIEZO2 and CAVIN2 We confirmed that it significantly downregulated expression. Based on this, electrical stimulation in skin fibroblasts PIEZO2 It regulates ECM production by inhibiting the expression of, and CAVIN2 It can be inferred that reduced expression induces changes in the cell membrane, thereby affecting the intracellular signaling mechanisms that regulate type I procollagen production and MMP-1 expression.

[0107] In summary, an analysis of the effects of low-frequency and low-intensity electrical stimulation on human skin fibroblasts confirmed that electrical stimulation effectively inhibits type I procollagen production and increases MMP-1 expression, while transcriptome analysis confirmed that electrical stimulation regulates the activity of various ion channels. Furthermore, GO function analysis confirmed that the cell membrane is affected by electrical stimulation, and mechanosensory ion channels induced by electrical stimulation ( PIEZO2 ) and membrane-bound proteins that organize caveolas ( CAVIN2 We verified changes in the expression of ) and confirmed that electrical stimulation significantly reduces the expression of both genes. These results suggest that electrical stimulation of human skin fibroblasts alters the membrane structure and function of human skin fibroblasts, playing a role in regulating type I collagen production, MMP-1 expression, and ECM homeostasis, indicating that manipulating fibroblast function using electrical stimulation could be a promising approach for the treatment of skin diseases such as keloids and hypertrophic scars.

[0109] குற்றுமுக்கு

[0110] 1. PIEZO2 amino acid sequence

[0111] 1 masevvcgli frlllpicla vacafryngl sfvyliylll iplfseptkt tmqghtgrll

[0112] 61 kslcfislsf lllhiifhit lvsleaqhri apgyncstwe ktfrqigfes lkgadagngi

[0113] 121 rvfvpdigmf iasltiwllc rnivqkpvtd eaaqsnpefe neelegeki dseealiyee

[0114] 181 dfnggdgveg eleestklkm frrlasvask lkefignmit tagkvvvtil lgssgmmlps

[0115] 241 ltssvyffvf lglctwwswc rtfdpllfsc lcvllaifta ghliglylyq fqffqeavpp

[0116] 301 ndyyarlfgi ksviqtdcss twkiivnpdl swyhhanpil llvmyytlat liriwlqepl

[0117] 361 vqdegtkeed kalacspiqi tagrrrslwy athyptderk llsmtqddyk psdgllvtvn

[0118] 421 gnpvdyhtih pslpmengpg kadlystpqy rwepsdesse kreeeeeeke efeeersree

[0119] 481 krsikvhamv svfqfimkqs yicaliamma wsityhswlt fvlliwsctl wmirnrrkya

[0120] 541 misspfmvvy gnlllilqyi wsfelpeikk vpgflekkep gelaskilft itfwlllrqh

[0121] 601 lteqkalqek eallsevkig sqeneekdee lqdiqvegep keeeeeeake ekqerkkveq

[0122] 661 eeaeeedeqd imkvlgnlvv amfikywiyv cggmfffvsf egkivmykii ymvlflfcva

[0123] 721 lyqvhyewwr kilkyfwmsv viytmlvlif iytyqfenfp glwqnmtglk kekledlglk

[0124] 781 qftvaelftr ifiptsfllv cilhlhyfhd rfleltdlks ipskedntiy shakvngrvy

[0125] 841 liinsikkkl pihqnelahp egslpdltmm hltaslekpe vrklaepgee klegysekaq

[0126] 901 kgdlgkdsee seedgeeeee seeeeetsdl rnkwhlvidr ltvlflkfle yfhklqvfmw

[0127] 961 wilelhiiki vssyiiwvsv kevslfnyvf liswafalpy aklrrlassv ctvwtcviiv

[0128] 1021 ckmlyqlqti kpenfsvncs lpnenqtnip fnelnkslly sapidptewv glrksspllv

[0129] 1081 ylrnnllmla ilafevtiyr hqeyyrgrnn ltapvsrtif hditrlhldd glincakyfi

[0130] 1141 nyffykfgle tcflmsvnvi gqrmdfyami hacwliavly rrrrkaiaei wpkyccflac

[0131] 1201 iitfqyfici gippapcrdy pwrfkgasfn dniikwlyfp dfivrpnpvf lvydfmlllc

[0132] 1261 aslqrqifed enkaavrima gdnveicmnl daasfsqhnp vpdfihcrsy ldmskviifs

[0133] 1321 ylfwfvltii fitgttrisi fcmgylvacf yfllfggdll lkpiksilry wdwliaynvf

[0134] 1381 vitmknilsi gacgyigtlv hnscwliqaf slactvkgyq mpaanspctl psgeagiiwd

[0135] 1441 sicfaflllq rrvfmsyyfl hvvadikasq ilasrgaelf qativkavka rieeekksmd

[0136] 1501 qlkrqmdrik arqqkykkgk ermlsltqep gegqdmqkls eeddereadk qkakgkkkqw

[0137] 1561 wrpwvdhasm vrsgdyylfe tdseeeeeee lkkedeeppr rsafqraigg fasailalpk

[0138] 1621 sviklpktil qyliraakfv yqawitdpkt alrqrhkekk rsareerkrr rkgskegpve

[0139] 1681 wedredepik kksdgpdnii krifnilkft wvlflatvds fttwlnsisr ehidistvlr

[0140] 1741 iercmltrei kkgnvptres ihmyyqnhim nlsresgldt idehpgaasg aqtahrmdsl

[0141] 1801 dshdsisscy teatmlfsrq stlddldgqe ipktserarp rlrkmlsmdm ssssadsgsl

[0142] 1861 asseptqctm lysrqgttet ieeveaeqee eagstapepr eakeyeatgy dvgamgaeea

[0143] 1921 sltpeeeltq fstldgdvea ppsyskavsf ehlsfgsqdd sagknrmavs pddsrtdklg

[0144] 1981 ssilpplthe ltaselllkk mfhddelees ekfyvgqprf lllfyamynt lvarsemvcy

[0145] 2041 fviilnhmvs asmitlllpi liflwamlsv prpsrrfwmm aivytevaiv vkyffqfgff

[0146] 2101 pwnknvevnk dkpyhppnii gvekkegyvl ydliqllalf fhrsilkchg lwdeddmtes

[0147] 2161 gmareesdde lslghgrrds sdslksinla asvesvhvtf peqqtavrrk rsgsssepsq

[0148] 2221 rssfssnrsq rgststrnss qkgssvlsik qkgkrelyme klqehlikak aftikktlei

[0149] 2281 yvpikqffyn lihpeysavt dvyvlmflad tvdfiiivfg fwafgkhsaa aditsslsed

[0150] 2341 qvpgpflvmv liqfgtmvvd ralylrktvl gkvifqvilv fgihfwmffi lpgvterkfs

[0151] 2401 qnlvaqlwyf vkcvyfglsa yqircgyptr vlgnfltksy nyvnlflfqg frlvpfltel

[0152] 2461 ravmdwvwtd ttlslsswic vediyahifi lkcwresekr ypqprgqkkk kvvkygmggm

[0153] 2521 iivllicivw fpllfmslik svagvinqpl dvsvtitlgg yqpiftmsaq qsqlkvmdqq

[0154] 2581 sfnkfiqafs rdtgamqfle nyekeditva elegnsnslw tisppskqkm ihelldpnss

[0155] 2641 fsvvfswsiq rnlslgakse iatdklsfpl knitrkniak miagnstess ktpvtiekiy

[0156] 2701 pyyvkapsds nskpikqlls ennfmditii lsrdnttkyn sewwvlnltg nriynpnsqa

[0157] 2761 lelvvfndkv sppslgflag ygimglyasv vlvigkfvre ffsgishsim feelpnvdri

[0158] 2821 lklctdiflv retgelelee dlyaklifly rspetmikwt rektn

[0160] 2. CAVIN2 아미노산 서열

[0161] 1 mgedaaqaek fqhpgsdmrq ekpsspspmp sstpspslnl gnteeairdn sqvnavtvlt

[0162] 61 lldklvnmld avqenqhkme qrqislegsv kgiqndltkl skyqastsnt vsklleksrk

[0163] 121 vsahtravke rmdrqcaqvk rlennhaqll rrnhfkvlif qeeneipasv fvkqpvsgav

[0164] 181 egkeelpden ksleetlhtv dlssdddlph deealedsae ekveesraek ikrsslkkvd

[0165] 241 slkkafsrqn iekkmnklgt kivsverrek ikksltsnhq kissgksspf kvspltfgrk

[0166] 301 kvregeshae netksedlps seqmpndqee esfaeghsea slasalvege iaeeaaekat

[0167] 361 srgsnsgmds nidltivede eeesvaleqa qkvryegsya ltseeaersd gdpvqpavlq

[0168] 421 vhqts

[0170] 3. PIEZO2 염기 서열

[0171] 1 attgaaggtg gagaagcgcg cgccgccggg gagccccggc tgcgccgcga gggcgaggct

[0172] 61 gcaaggcggc aggcggtggt cgcgctgggc gacgggacgg cgctggtttt tctcttgagt

[0173] 121 tttaaattga ggcggtggag gagggagtgg gagacccact cacccgatat gcgctctggt

[0174] 181 ctccatttct ccccacgctc gcgccgttcc ttcgagtgag ggagggactc gcagcgccgc

[0175] 241 ccgcgcaccg gacccacaag gcgagccccg tggtggcggg gatggttctg cgcgcctggc

[0176] 301 agctcccacc ccggtctctc cggcccgaag ctggggggcg caggggctga gctcgctgc

[0177] 361 ctctcgggga tccgccggggg gccgcctggg ggctggaggg cgagacccgg agcccgccgg

[0178] 421 gcagctccga gagccggggc cgaggccaga gcgcggcagc ctgcgtgggc agcggagacg

[0179] 481 aggccgggca aaggagacgc ggtggcttca gagggggcttc caagtagaa actccccccgg

[0180] 541 cgcccccaaa cgacgccccg ggagccaggc gggagcacag cacgcccttc ttgccccctt

[0181] 601 tgctcgccgc gccgcctccc aggaccctcc caaagcgtcc ctctccaagg ccccggcatc

[0182] 661 agctacccct gaaagccg ccgccgctgc cggatccagg attcacacta aatgggccgg

[0183] 721 ccgcagggg ccgggcgccg ggctaggtgg ccgccaagag cctggtgagg ggctacccag

[0184] 781 agcccggtgg gcgaggggcg gccaagagcc ccgggagcgt gccctcgggg cggagagcgt

[0185] 841 cgcggcccgc gccgaggcga tgctcgggtg gctcgagct gccggcggcg agaggccata

[0186] 901 gacgggcatg ggccttgcgt cccaccaccc ctagggaccc tcgagcctcg cccctctgct

[0187] 961 ccgactcgcc ggaccgacgc gatggcctca gaagtggtgt gcgggctcat cttcaggctg

[0188] 1021 ctgctgccca tctgcctggc agtagcatgt gcattccgat acaatgggct ctcctttgtc

[0189] 1081 taccttatct acctcttgct cattcctctg ttctcagaac caacaaaaac gacgatgcaa

[0190] 1141 ggacatacgg gacggttatt aaagtctctg tgcttcatca gtctttcctt cctgttgctg

[0191] 1201 cacatcattt tccacatcac gttggtgagc cttgaagctc aacatcgtat tgcacctggc

[0192] 1261 tacaactgct caacatggga aaagacattc cggcagatcg gctttgaaag cttaaaggga

[0193] 1321 gctgatgctg gcaatgggat cagagtgttt gtacctgaca tcgggatgtt cattgctagt

[0194] 1381 ctgaccatct ggctcctctg tagaaacatt gttcagaaac ctgtgacaga cgaagcagca

[0195] 1441 cagagtaacc cggagtttga aaatgaagaa ttggctgaag gagaaaaaat tgattcagaa

[0196] 1501 gaggcactga tctatgaaga ggatttcaat ggaggagatg gtgttgaagg cgagttggaa

[0197] 1561 gaaagcacga agttaaaaat gttccgcagg cttgcctctg tggcctctaa gctcaaggag

[0198] 1621 ttcattggca acatgatcac cactgctggg aaagtcgttg ttaccatctt actgggctcc

[0199] 1681 tcgggcatga tgttgccgtc tttgacatca tctgtgtatt tttttgtatt tttgggtctg

[0200] 1741 tgcacctggt ggtcctggtg ccggacgttc gacccattgc tgttcagctg tctctgtgtt

[0201] 1801 ctgctggcta ttttcactgc tggacatttg attggacttt attatacca gttccaattc

[0202] 1861 tttcaagagg cagttccacc caatgactac tatgcaaggt tgtttggtat caagtcagta

[0203] 1921 attcaaacgg actgttcaag tacttggaag atcatagtga acccggacct gtcgtggtac

[0204] 1981 caccacgcca accctatcct cctgctggtg atgtactaca ctctggccac tctgatcgc

[0205] 2041 atctggctgc aagagcccct tgtgcaggat gaggggacca aagaagagga caaagccctg

[0206] 2101 gcttgtagcc ccatccaaat aacagcgggg aggaggcgga gcctgtggta cgcaacccat

[0207] 2161 taccccactg atgagagaaa acttttatcc atgacccagg atgactacaa accatctgat

[0208] 2221 ggcctgctgg tgactgtgaa cggcaacccc gtggattacc acaccatcca cccaagcctg

[0209] 2281 cccatggaga acggccctgg caaagccgac ctctactcca cccctcagta ccggtgggag

[0210] 2341 ccctctgatg aatcctcaga aaagcgagag gaggaagagg aagagaaaga agaatttgaa

[0211] 2401 gaagaaagga gccgtgagga aaaaagaagt atcaaagttc atgccatggt ctccgtattc

[0212] 2461 caatttatta tgaaacaaag ttacatctgt gccctcatag ctatgatggc ctggagcatc

[0213] 2521 acctatcaca gctggctgac cttcgtgctg ctgatctggt cgtgcactct ttggatgatt

[0214] 2581 cgcacagaa gaaaatatgc catgatcagc tctcctca tggtggttta tggaaaccta

[0215] 2641 ttgttgatat tacagtatat atggatttt gaacttcctg aaattaaaa agttccagga

[0216] 2701 ttttagaaa agaagagcc aggagaactt gcttccaaa tccttcac cattacttt

[0217] 2761 tggctactgc tgaggcagca cctcacagag caaaagctc tgcagaaaa ggaagctctt

[0218] 2821 tttcggaag tcaaattgg cagtcaggaa atgaagaa aagatgagga acttcagat

[0219] 2881 atacagtgg yeahgaggcc hhagghagg hahahahagg hahahahaha

[0220] 2941 Gagagagagagagagagagagagagagagagagagagaa catcatgaaa

[0221] 3001 gtcctgggca atctggtggt ggccatgttc atcagtact ggatctacgt ctgcggaggc

[0222] 3061 atgttctct tcgtcagctt cgagggtaaa atcgtaatgt acaaaatcat ctacatggtg

[0223] 3121 ctgttctgt tctgtgtgc cctataccag gtgcactg aatgtggag gaaaattcta

[0224] 3181 aaatatttt ggatgtcagt gttattac actatgctgg tgcttactt tatatacaca

[0225] 3241 tatcagttg agaacttccc aggctgtgg caaattga ctggactgaa aaagaaag

[0226] 3301 cttgaggatc tggcttaaa gcagtttact gtggctgac tattcactcg catattcatc

[0227] 3361 caccctcct ttctgctgt gtgcatttta cacctgcact acttccatga ccggttcctt

[0228] 3421 gaactcacag acctcaagtc cattcccagc aaaagaaca acaccatcta cagccatgcc

[0229] 3481 aaagtcaatg gtcgcgtata tctaataata aatagcatca agaaaaaatt accaatccac

[0230] 3541 caaaatgaac tggcccaccc ggaggaagc ctcccggacc tcaccatgat gcatctgact

[0231] 3601 gccagcctgg agaagccgga ggtgaggaag ttggctgagc ctgggggaga gaagcttgag

[0232] 3661 ggctactctg aaaaagccca gaagggtgat cttgggaaag acagcgagga gtcagaggag

[0233] 3721 gacggagagg aagaggaga atccgaggag gaggaagaaa catcagactt aaggaacaaa

[0234] 3781 tggcacctgg tgattgaccg cctcactgtg ctctttttaa aattcctgga gtattttcac

[0235] 3841 aagctgcagg tgttcatgtg gtggattttg gagttgcaca tcatcaaaat cgtttcctct

[0236] 3901 tacattatct gggtttctgt gaagaggtg tctctgttca actatgtatt tttgatttct

[0237] 3961 tgggcttttg ctctgccgta cgccaagctg cgccgtctgg cttcaagtgt ctgcacagtc

[0238] 4021 tggacgtgtg tgatcatcgt ctgcaaaatg ttgtaccagc tccaaaccat taagcctgag

[0239] 4081 aacttctctg ttaactgttc cttgccaaat gaaaatcaaa caaacatccc ctttaatgag

[0240] 4141 ttgaacaagt ctctgctcta cagcgctcct atcgatccta cagagtgggt cggcctgcgg

[0241] 4201 aagtcttgc ctctgctagt ctacctgagg aataacctcc tgatgctggc tatcctggcc

[0242] 4261 tttgaagtca ccatttaccg ccatcaggaa tactatcgag gtcgaaataa cctgacggcc

[0243] 4321 cctgtgcta gaactatctt tcatgacatt acaagactac atctagatga tggacttatt

[0244] 4381 aattgtgcca aatatttcat taattacttc ttttacaagt ttggtctgga gacctgtttc

[0245] 4441 ctaatgtcag ttaacgtcat tggccagcga atggatttct atgccatgat ccacgcctgc

[0246] 4501 tggctgatcg ctgtcttata tagacgcaga aggaaagcca tcgcagagat ctggcccaag

[0247] 4561 tactgctgct tcctggcatg catcatcacc ttccagtatt tcatctgcat tggcatccca

[0248] 4621 cctgctcctt gccgagatta cccgtggaga ttcaagggtg ccagcttcaa tgacaacatc

[0249] 4681 ataaagtggc tgtacttccc agatttcatt gtgcggccca accctgtgtt tctcgtctat

[0250] 4741 gacttcatgc tgcttctgtg tgcctcctta caacggcaga ttttgagga tgagaacaag

[0251] 4801 gctgcagtgc gaatcatggc aggtgacaat gtcgagatct gcatgaacct tgatgcggcc

[0252] 4861 tccttcagcc aacataaccc tgtgccagat tttattcact gcagatctta cttagacatg

[0253] 4921 tccaaagtga tcatcttcag ctacctcttc tggtttgtgc tcaccatcat cttcatcact

[0254] 4981 gggaccacca ggatcagcat cttttgcatg gggtacctgg tggcctgttt ctacttcctg

[0255] 5041 ctctttgggg gcgatttgct gttgaaaccc atcaagagca tcctgcgcta ctgggactgg

[0256] 5101 ctgatcgcat acaacgtttt tgtgattacg atgaaaaata tcctgtcaat aggagcatgt

[0257] 5161 ggatacattg gaacattggt gcacaatagt tgttggttga tccaggcttt cagcctggcc

[0258] 5221 tgcacagtca aaggctatca aatgcctgct gctaattcac cctgtacact tcccagtggg

[0259] 5281 gaagcaggaa tcatttggga cagcatatgt tttgccttcc tcctgctgca aagaagagtt

[0260] 5341 ttcatgagtt attatttct acatgttgtg gctgatataa aagcttccca gattctggca

[0261] 5401 tcaagaggag ctgaactttt ccaggccaca attgtaaaag ctgtaaaggc aagaattgag

[0262] 5461 gaagagaaga agtccatgga ccagctgaag cgacagatgg atcgcatcaa ggccaggcaa

[0263] 5521 cagaaaatata aaaagggtaa ggagaggatg ctgagcttga cccaggagcc aggggaaggc

[0264] 5581 caggacatgc aaaaactctc tgaagaggat gatgaaagag aagcagacaa acagaaagcc

[0265] 5641 aagggcaaaa aaaagcagtg gtggcggcct tgggttgatc atgcttccat ggtcaggagt

[0266] 5701 ggagattatt atttgtttga aacggatagt gaagaggagg aagaggaaga attaaagaag

[0267] 5761 gaagatgaag aacctccacg aaggtcagca ttccagagag ctattgggaa gtttgcatca

[0268] 5821 gccatttag ccttgccaaa gtctgtcatt aaacttccca aaactattct tcagtatta

[0269] 5881 atcagagctg caaagtttgt ttatcaagcc tggattactg atcctaaaac agcactccga

[0270] 5941 CAAAGACAAAAAAAAGTACTGCA AGGAGAAC GAACGAAG GCAGAAAGA

[0271] 6001 tccaggagg gtcctgtgga atgggagc cgggaggtg aaccaatca aaagaatcc

[0272] 6061 gatgaccag atatatcat caagatta ttatatattt tgaaatttac ctgggtccta

[0273] 6121 tttctgcag cagtggacag tttcactact tggcttact ccatttcag ggagcatatt

[0274] 6181 gatatacta cagttctgag aattgaacga tgcatgctga ccagagaat taagaagggc

[0275] 6241 aatgttccaa ctcgggag catccacatg tactatcaga accacat gaacctttcc

[0276] 6301 agagagtcgg gactggacac cattgacgag catcccggag ctgcttcagg tgcacagaca

[0277] 6361 gcccacagga tggatagttt agatcacat gatactct ccagctgcta cactgaagca

[0278] 6421 accatgctgt tctcaggca gtccacct gatgatttag atggacaaga aattcctaaa

[0279] 6481 acagcgagc gtgctcggcc taggctccgt aaatgctca gcatggatat gtcctcctca

[0280] 6541 tcagctgaca gtggcagtttt agcatcaagc gagcccacgc agtgtaccat gctgtactca

[0281] 6601 cgccaggga ccactgagac catcgaggag gtggaggctg agcaggagga ggagggagg

[0282] 6661 agcacggcgc ctgagcccag ggaggccaag gagtacgagg ccactgggta cgatgtggga

[0283] 6721 gccatgggtg ccgaggaggc cagcctcacc ccagaggaag agctgacaca gttctcacc

[0284] 6781 ttggacgggg atgtggaggc cccaccctcc tacagcaagg ctgtgagctt cgagcatctg

[0285] 6841 tccttcggct cgcaggacga ctctgcaggc aagaaccgta tggcagtcag cccggacgac

[0286] 6901 agccgcaccg acaagctggg gtccagcatc ttacctcccc tgacccatga gctgacggcc

[0287] 6961 agcgagctgc tgctgaaaaa gatgtttcac gacgatgagc ttgaagagtc agagaaattc

[0288] 7021 tacgtggggc agccccgatt tctgctgctc ttctatgcca tgtacaatac cctggtggcc

[0289] 7081 cgctcggaga tggtgtgcta cttcgtgatc atcctcaacc acatggtctc tgcctccatg

[0290] 7141 atcacgctcc tgcttcccat cctcatcttc ctctgggcca tgttgtccgt ccccaggccc

[0291] 7201 agccgccggt tctggatgat ggccatcgtc tatactgagg tggcaattgt agtcaagtat

[0292] 7261 ttcttccaat ttgggttctt tccctggaat aagaatgtgg aggtgaacaa agataaaccg

[0293] 7321 tatcaccccc caaacatcat aggagtggaa aagaaggaag gttatgttct ctatgacctc

[0294] 7381 atccagctcc tggctctgtt cttcatcga tcaattttga agtgccatgg cttatgggat

[0295] 7441 gaagatgaca tgactgaaag tggcatggcc agggaggaat cagatgatga gctctccctc

[0296] 7501 ggtcatggca ggagggactc ctccgattct ctcaagtcca tcaacctggc cgcgtctg

[0297] 7561 gagtcagtgc atgtgacctt cccggagcag cagacagctg tccggaggaa gcgctccggc

[0298] 7621 agcagctccg agccatccca gagatccagc ttttcttcaa acagatccca aagaggcagc

[0299] 7681 acaagcaccc gaacagcag tcaaaaagga agcagtgttt tgagtattaa gcaaaaaggc

[0300] 7741 aaaagggaac tttatatgga aaagcttcaa gaacatttaa tcaaagcaaa agcctttacc

[0301] 7801 ataaagaga cgctggagat ctatgtgccc atcaaacagt tcttttacaa cctcatccac

[0302] 7861 ccggagtata gcgccgtgac tgacgtgtat gtactcatgt tcctggctga cactgtggac

[0303] 7921 ttcatcatca ttgtcttcgg cttttgggcc tttgggaaac actcagcagc tgcagacatc

[0304] 7981 acctcttcac tgtcagagga ccaggtcccg gggccgtttt tggtgatggt cctcattcag

[0305] 8041 tttggaacca tggtggtgga ccgagccctc tacctcagga agactgtact gggaaaggtc

[0306] 8101 atcttccagg tcattcttgt gttccggaatt cacttctgga tgttcttcat cttacctggt

[0307] 8161 gtgactgaga ggaattcag ccagaacctg gttgcccagc tttggtactt tgtgaaatgt

[0308] 8221 gtttacttcg ggttgtctgc ttaccagatc cgttgtggct acccaacgcg agtcctgggg

[0309] 8281 aacttctcca ccaagagcta caattacgtc aacctcttct tattccaagg gtttcgctc

[0310] 8341 gtgccctttt tgactgagct gagggcagtg atggactggg tgtggacgga caaactttg

[0311] 8401 agcctgtcca gctggatctg tgtggaggac atctatgctc acatattcat cctgaagtgt

[0312] 8461 tggcgggagt cggagaagag ataccctcag ccacggggcc agaagaagaa gaaagtggtg

[0313] 8521 aagtatggca tgggaggaat gatcatcgtc ctgctcatct gcattgtctg gttcctctt

[0314] 8581 ctcttcatgt cttgatcaa atctgtggct ggggtcatca accagcccct ggacgtctcc

[0315] 8641 gtcacaatta ccctgggagg gtatcagcct atttcacaa tgagtgccca acaaagccag

[0316] 8701 ttgaaagtta tggaccagca gagctttaac aaatttatac aagctttttc tagggacacc

[0317] 8761 ggtgctatgc aatttctgga aaattatgaa aaagaagaca taacagtagc agaactggaa

[0318] 8821 ggaaactcaa attctttgtg gaccatcagc ccacccagta agcagaaaat gatacacgaa

[0319] 8881 ctcctggacc ccaatagtag cttctctgtt gttttttcat ggagtattca gagaaactta

[0320] 8941 agtctgggtg caaaatcgga atagcaaca gataagcttt cttttcctct taaaatatt

[0321] 9001 actcgaaaga atatcgctaa aatgatagca ggcaacagca cagaaagttc aaaacacca

[0322] 9061 gtgaccatag aaaagattta tccatattat gtgaaagcac ctagtgattc taactcaaaa

[0323] 9121 cctataaagc aacttttatc tgaaaataat ttcatggata ttaccatcat tttgtccaga

[0324] 9181 gacaatacaa ctaaatataa cagtgagtgg tgggttctca acctgactgg aaacagaata

[0325] 9241 tacaatccga actctcaggc cctggaactg gtggtcttca atgacaaagt cagtccccca

[0326] 9301 agtctggggt tcctggctgg ctatgttatt atgcttcagt tgtccttgtg

[0327] 9361 attgggaat ttgtccgtga attcttcagt gggatttctc actcatcat gtttgagag

[0328] 9421 cttccaaatg tggatcgaat ttgaagttg tgcacagata ttttttagt tcgagagaca

[0329] 9481 ggagaactgg agctagaga agatcttat gccaattaa tattcctata tcgctcacca

[0330] 9541 gagaactga tcaatggac taggaaaaaaaattgaa acctagaac acagactgca

[0331] 9601 ataatgtta acatttgaat ttttttaa agcacatat tctcataga gctaagcatt

[0332] 9661 tctagttcga cggaatggt ttgttctct tctgataggt agacaaagg agctgatatc

[0333] 9721 cttctgcagt aaagctacc ttgcaagtta agcactgtt gaaatgtta tttgtactc

[0334] 9781 cattctctg aaatcaggggc tacttgctt atgttttgt cacagtgtc tcgcattctg

[0335] 9841 attgatcatg tgaggaatc atttatgggc cccgtcccta agagaacag agaggagtc

[0336] 9901 agaaagaag atgctgtgt tttctctgt ggggcccgtg cactcctgg agagatgcta

[0337] 9961 caatgcaata tacagcgctc catccccact ggggaagctg ctgtgatgag actagatgag

[0338] 10021 ccttcacac actcagaaaa tgcacagca atagggggca gandagctcct acctgtgtttt

[0339] 10081 ctaggagcaa agagaggga actaattgcc cgtgagacg ccagtggaag gatcagccctc

[0340] 10141 attctaagca aaaacatagt attagtgata ctcttactgc cttatcttta ccaaggacta

[0341] 10201 ataggatacc tttccattaa acaccagtga cttctcagga aaaaaaaaa aaaggagcaa

[0342] 10261 aaaaatgat gtgtacacct gctttgttat gtccaccag tgaccagctt caatgagggg

[0343] 10321 aaccattctg gaggggctgcg gtctcctgtg caacaca tgaggcagaa gagtaaaag

[0344] 10381 accaccag tgggacctag atactttgt aactctttaa taactgaggt caggaccgct

[0345] 10441 cttctgcctt cccttccct taacgtgctt ttcccattt ccatgattta aggcaatggt

[0346] 10501 tttccagta tgtgacattt tccttcctgt tttcagta tatcaagag tttacatatt

[0347] 10561 ccaattcaca ttttacatc tgagacggggt ttttaagtt catattatg aaagaaatat

[0348] 10621 gtatattgag cttggggaaaaaaatggc cttttcttta attatta ttggtaatac

[0349] 10681 aacccttca ttaataaca atgtagcatg aaaaatttat gattgaatg tagttttcat

[0350] 10741 tccatattaa gatacagttt ctgagagaa tcattgaatg gactagaata tgtcaaaat

[0351] 10801 tgatcctgtg tagtttggtt tcaggctga cttaaaataa agcacatcct gcaagtca

[0353] 4. CAVIN2 염기 서열

[0354] 1 gatcagcgta gccagttgtt gcctgtctga acctctgcca gtcctggaga ctggtgccct

[0355] 61 gagctccaac cagcgggcct catcctacac cctcaccacc gcaacttctc acccgagcaa

[0356] 121 gaagcagctc ccagagagaa agaacgttcc cacctgccta gccatgggag aggacgctgc

[0357] 181 acaggccgaa aagttccagc accctgggtc tgacatgcgg caggaaaagc cctcgagccc

[0358] 241 cagcccgatg ccttcctcca caccaagccc cagcctgaac ctagggaaca cagaggaggc

[0359] 301 catccgggac aactcacagg tgaacgcagt cacggtgctc acgctcctgg acagctggt

[0360] 361 gaacatgcta gacgctgtgc aggaacca gcacaatg gagcagcgac agatcagtttt

[0361] 421 ggaggctcc gtgaagggca tccagaatga cctcaccaag ctctccaagt accaggcc

[0362] 481 caccagcac acggtgagca agctgctgga gaagtcccgc aggtcagcg cccacacgcg

[0363] 541 cgcggtcaa gagcgcatgg ataggcagtg cgcacaggtg aagcggctgg agacaacca

[0364] 601 cgcccagctc ctccgacgca accattcaa agtgctcatc ctccaggagg aaaatgagat

[0365] 661 ccctgccagc gtgtttgtga aacagccgt ttccggtgcc gtggaaggga aggaggagct

[0366] 721 tccggatgaa aacaatccc tggaggaac cctgcacacc gtggacctct cctcagatga

[0367] 781 tgatttgccc cacgatgagg aggccctgga agacagtgcc gaggaaagg tggagagaag

[0368] 841 taggcagag aaaaaaaa gatccagcct gagaagtg gatagcctca agaaagcatt

[0369] 901 ttctcgccag aacatcgaga aaaagatgaa caagctgggg acaaagatcg tatctgtaga

[0370] 961 gaggagagag aagattaaga aatctctcac gtcaaatcac cagaaaatat cctcaggaa

[0371] 1021 aagctccccc ttcaaggttt ctcccctcac tttcgggcgg aagaaagtcc gagagggaga

[0372] 1081 aagccatgca gaaaatgaga ccaagtcaga agacctgcct agcagtgagc agatgccaaa

[0373] 1141 tgaccagga gaggagtcct ttgcagaggg tcattccga gcgtccctcg ccagcgctct

[0374] 1201 ggtggaaggg gaaattgcag aggaggctgc tgagaaggcg acctccaggg ggagtaactc

[0375] 1261 ggggatggac agcaacatcg acttgactat tgtggaagat gaagaggagg agtcagtggc

[0376] 1321 cctggaacag gcacagaagg tacgctatga gggtagctac gcgctaacat ccgaggaggc

[0377] 1381 ggagcgctcc gatggggacc ccgtgcagcc cgccgtgctc caggtgcacc agacctcctg

[0378] 1441 agcttagc caccgtgcca tcctgtgctg tgctcaagcg ggcagccagg gctgaagaac

[0379] 1501 aactcttgc acatctccag cacgactcac accactcctc gttcctcc aggcagtaat

[0380] 1561 cattgaccat atagtcatag taagacac gagaccaggc tttaccatga aagcgacctg

[0381] 1621 tcacggactc cactttaat tgctcttag gtcttactc tgtagaatgt tchccagat

[0382] 1681 gagagaaa ctgagcagtt gaaaaatgct atatctttg acttagtcag aaaaaacag

[0383] 1741 aggatatta agatactagt catgaaagt gattcattct tttgtcat tccataagct

[0384] 1801 tgctgaatag tgtaccggta atatattgta ttccaccgt actctgtgaa tctattatt

[0385] 1861 attctttaag tgttgatata taatatacat aaatatgtaa gctaacata taactatatg

[0386] 1921 ttttagaag aaacatcta cgaaggtaa aaagagatga tcagttggtt gtttacttgc

[0387] 1981 Tagaaccat TGTTTTG CAACGAAG AAAAATGAAG AGATATAAA AGTCAGCTA

[0388] 2041 tgaagtaag tacgtagta agtcaggact attcaaag tagaagaa atttgaaa

[0389] 2101 atgagagaaaaaaaaaaaaaatgccga aagaatgaaaaagagaaaaatgtagt

[0390] 2161 gcttgaagt aaatactta catagtagc ttaactattt cactctttaa aaaaatac

[0391] 2221 taaagagtt cgtatatcct ggaataacat gtcatctca aaatatttt attttctaat

[0392] 2281 atttttaata aaacattt tatagtgtta aagctgtatt ttcttaata aaaaggac

[0393] 2341 attacaata ttctttaag gaagttcaa aggatgttgt cttgttaca ctggaacgaa

[0394] 2401 tataaatctt caaataca ttatatata ctgttttgtg gaacttagc tcatactatt

[0395] 2461 ctttaatgct cttcaattt aaactaaccc ttacattcca tgtgatgtga tgtaggct

[0396] 2521 taagatgcta aaatctatag gttttggag tgaaagattc tattttct ttttgtac

[0397] 2581 ataatgggaa ttcattcca gattatattt tatttacata ttaatttcac agaatattaa

[0398] 2641 tattcttta cttcttaag catgctagcg tttgtat atgtacacat atattcagac

[0399] 2701 agggtaattt tatctgctgc ctaacattgt actaaaatat tgctttatct gtttttaatt

[0400] 2761 acaaaatgct aatgatttct taaattatag tttaaagaca attggcccag gaagcaaatc

[0401] 2821 ccctgccttt agtatgaacc actataagta accttacaaa tagagttaat ccaagacaat

[0402] 2881 attaacaaac tgtgctttgt ctttaataaa agggatagga ttaacaaaca tattgatggc

[0403] 2941 ataacctatt cagctatgtc cttatttttg caataatgta acctcaaata ttggattgtt

[0404] 3001 gaaccaacaa tggctgtgtt aaagaagatt aaataaaccg aaaaataaaa agca

[0406] 5. PIEZO2 primer forward

[0407] GACGGACACAACTTTGAGCCTG

[0409] 6. PIEZO2 first reverse

[0410] CTGGCTTTGTTGGGCACTCATTG

[0412] 7. CAVIN2 primer forward

[0413] GCGGTCAAAGAGCGCATGGATA

[0415] 8. CAVIN2 first reverse

[0416] AAACACGCTGGCAGGGATCTCA

Claims

Claim 1 A collagen production inhibiting device comprising a processing unit that processes the skin of an object with an alternating current of 200 Hz to 200 kHz. Claim 2 A device according to claim 1, wherein the alternating electric field has an intensity of 1 V / cm to 5 V / cm. Claim 3 In claim 1, the device wherein the alternating electric field is processed for 12 to 36 hours. Claim 4 In paragraph 3, the device is a device for the prevention or treatment of skin diseases. Claim 5 In paragraph 4, the device wherein the skin disease is a fibroproliferative skin disease. Claim 6 A biomarker composition for diagnosing skin diseases or predicting treatment prognosis, comprising PIEZO2 and / or CAVIN2; or a gene encoding the same, as an active ingredient. Claim 7 A composition for diagnosing skin diseases or predicting treatment prognosis comprising, as an active ingredient, a preparation capable of measuring the expression level of PIEZO2 and / or CAVIN2; or the gene encoding them. Claim 8 A composition according to claim 6 or 7, wherein the expression level of the protein or the gene is higher than that of a normal control sample, and is determined to be a skin disease. Claim 9 A composition according to claim 6 or 7, wherein the expression level of the protein or the gene is lower than before treatment, and is determined to have a therapeutic effect on the skin disease. Claim 10 A composition according to claim 6 or 7, wherein the skin disease is a fibroproliferative skin disease.

Images