MODIFIED MESO-DIAMINOPIMELATE DEHYDROGENASE POLYPEPTIDE AND PROCESS FOR THE PRODUCTION OF L-THREONINE USING THE SAME

Abstract

This disclosure relates to a modified polypeptide, in which the activity of meso-diaminopimelate is weakened, and to a process for producing L-threonine using the same.

Description

MODIFIED MESO-DIAMINOPIMELATE DEHYDROGENASE POLYPEPTIDE AND PROCESS FOR THE PRODUCTION OF L-THREONINE BY USING THE SAME FIELD OF INVENTION This disclosure relates to a modified polypeptide in which the activity of meso-diaminopimelate dehydrogenase is weakened, and to a process for producing L-threonine using the same. BACKGROUND OF THE INVENTION A microorganism of the genus Corynebacterium, particularly Corynebacterium glutamicum, is a Gram-positive microorganism widely used in the production of L-amino acids and other useful materials. To produce L-amino acids and other useful materials, several studies are underway to develop fermentation process technologies and microorganisms capable of producing these materials with high efficiency. For example, approaches targeting specific materials are primarily used (e.g., a procedure to increase the expression of a gene encoding an enzyme involved in L-lysine biosynthesis, a procedure to eliminate a gene unnecessary for L-lysine biosynthesis, etc.) (U.S. Patent No. 8,048,650). Meanwhile, among the L-amino acids, L-lysine, L-threonine, L-methionine, L-isoleucine, and L-glycine are amino acids derived from aspartate, and the level of oxaloacetate synthesis (i.e., a precursor of aspartate) can affect the synthesis levels of these L-amino acids. Meso-diaminopimelate dehydrogenase is an important enzyme that converts piperodeine 2,6-dicarboxylate, which is produced during lysine production in a microorganism, into meso-2,6-diaminopimelate, and fixes a nitrogen source in the lysine production pathway. Details regarding the phenotypic changes in an L-threonine-producing strain due to deletion of the ddh gene (i.e., a gene encoding mesodiaminopimelate dehydrogenase) and the lysE gene (i.e., an L-lysine exporter gene) have been reported in previous literature (X Dong, Y Zhao, J Hu, YL1, X Wang: Enzyme and microbial technology, 2016). However, since deletion of the lysE gene has the negative effect of slowing the strain's growth rate and reducing the amount of threonine produced, and since deletion of the ddh gene inhibits strain growth, further studies focusing on both increasing the strain's capacity for efficient L-amino acid production and its growth are still needed. IV l OO4U BRIEF DESCRIPTION OF THE INVENTION Technical Problem The present inventors have made considerable efforts to increase L-threonine production while decreasing L-lysine production without slowing the growth rate of a strain. As a result, they have discovered that when a novel modified polypeptide is used in which the activity of meso-diaminopimelate dehydrogenase is weakened to a certain level, it is not only possible to maintain the growth of a microorganism, but it is also possible to increase the amount of L-threonine produced, thus completing the present disclosure. Technical solution One object of this disclosure is to provide a modified meso-diaminopimelate dehydrogenase polypeptide derived from Corynebacterium glutamicum. Another objective of this disclosure is to provide a polynucleotide that encodes the modified polypeptide. Another additional object of this disclosure is to provide a microorganism of the genus Corynebacterium, comprising the modified meso-diaminopimelate dehydrogenase polypeptide or a polynucleotide encoding it. Another additional objective of this disclosure is to provide a process for producing L-threonine comprising a step of culturing the microorganism in a medium. Another additional objective of this disclosure is to provide a use of the microorganism for the production of L-threonine. Advantageous effects When using the novel modified polypeptide described herein, which weakens the activity of meso-diaminopimelate dehydrogenase, it is possible to further improve the L-threonine production rate. In this respect, high yield and industrial convenience can be expected. Best way to carry out the invention The present disclosure is described in detail below. Meanwhile, the respective descriptions and embodiments disclosed herein may also apply to other descriptions and embodiments. That is, all combinations of various elements disclosed herein fall within the scope of this disclosure. IV l OO4U disclosure. Furthermore, the scope of this disclosure cannot be considered limited by the specific description below. To achieve the above objectives, one aspect of this disclosure provides a modified meso-diaminopimelate dehydrogenase polypeptide derived from Corynebacterium glutamicum. Specifically, this disclosure provides a modified meso-diaminopimelate dehydrogenase polypeptide, wherein amino acid 169 in the amino acid sequence of SEQ ID NO: 1 is substituted with a different amino acid, and more specifically provides a modified meso-diaminopimelate dehydrogenase polypeptide, wherein amino acid 169 of the amino acid sequence of SEQ ID NO: 1 is substituted with leucine, phenylalanine, glutamate, or cysteine. As used in this dissertation, the term meso-diaminopimelate dehydrogenase refers to an NADPH-dependent reductase that catalyzes an intermediate step in lysine biosynthesis. Meso-diaminopimelate dehydrogenase is an important enzyme that converts piperodiene 2,6-dicarboxylate, produced during lysine production in microorganisms, to meso-2,6-diaminopimelate, thus fixing a nitrogen source in the lysine production pathway. Specifically, meso-diaminopimelate dehydrogenase is a meso-2,6-diaminopimelate synthase and functions as a rate regulator in the third step of the lysine production pathway. Furthermore, the enzyme catalyzes the fixation of an ammonium group to piperodiene 2,6-dicarboxylate, thereby forming meso-2,6-diaminopimelate. In this disclosure, the term meso-diaminopimelate dehydrogenase may be used interchangeably with citrate synthase, meso-diaminopimelate dehydrogenase, and DDH. In this disclosure, the meso-diaminopimelate dehydrogenase sequence can be obtained from the NCBI GenBank, a public database. For example, the meso-diaminopimelate dehydrogenase sequence could be that of a mesodiaminopimelate dehydrogenase derived from Corynebacterium sp., and more specifically, a polypeptide / protein comprising the amino acid sequence of SEQ ID NO: 1, but the meso-diaminopimelate dehydrogenase sequence is not limited to this. Furthermore, any sequence having the same activity as the amino acid sequence above may be included without limitation. Additionally, the amino acid sequence of the meso-diaminopimelate dehydrogenase may include the amino acid sequence of SEQ ID NO: 1 or any amino acid sequence having 80% or greater homology or identity with the amino acid sequence of SEQ ID NO: 1, but the amino acid sequence is not limited to it.Specifically, the amino acid sequence may include the amino acid sequence. IV l OO4U of SEQ ID NO: 1 and any amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity to the amino acid sequence of SEQ ID NO: 1. In addition, it is evident that any protein having an amino acid sequence in which part of the amino acid sequence is deleted, modified, substituted, or added may also be included within the scope of this disclosure provided that the amino acid sequence has such homology or identity to that of the above protein and exhibits a corresponding effect to that of the above protein. As used in this document, the term variant refers to a polypeptide in which at least one amino acid in the conservative substitution and / or modification differs from that of the specified sequence, but the protein's functions or properties are maintained. A variant differs from the identified sequence by various amino acid substitutions, deletions, or additions. Generally, such a variant can be identified by modifying one amino acid in the amino acid sequence of the original polypeptide and evaluating the properties of the modified polypeptide. That is, the capabilities of a variant may be increased, unchanged, or decreased compared to those of its native protein. Furthermore, some variants may include those in which one or more parts are deleted (for example, an N-terminal leader sequence or a transmembrane domain). As used in this document, the term conservative substitution refers to the replacement of one amino acid with a different amino acid that has similar structural and / or chemical properties. The variant may have, for example, one or more conservative substitutions while still retaining one or more biological activities. Such amino acid substitutions can generally occur based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. For example, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; aromatic amino acids include phenylalanine, tryptophan, and tyrosine; and hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, proline, glycine, and tryptophan.Typically, conservative substitution has little or no effect on the activity of the generated polypeptide. Furthermore, a variant may include the deletion or addition of amino acids that have minimal influence on the properties and secondary structure of a polypeptide. For example, a polypeptide may be conjugated with a signal (or leader) sequence at the N-terminus of a protein, which co-translationally or post-translationally directs protein transfer. Additionally, the polypeptide may also be conjugated with another sequence or a linker. IVIA / a / ¿U¿ I 3O4U for the identification, purification or synthesis of the polypeptide. As used in the present memory, the term mesodiaminopimelate dehydrogenase modified polypeptide refers to a mesodiaminopimelate dehydrogenase modified polypeptide, which includes one or more amino acid substitutions in the amino acid sequence of a polypeptide having the activity of a mesodiaminopimelate dehydrogenase protein, and the amino acid substitutions include a substitution in which the N-terminal amino acid 169 is substituted with a different amino acid. Specifically, the modified polypeptide includes a modified polypeptide in which the amino acid corresponding to amino acid 169 in the amino acid sequence of the polypeptide having meso-diaminopimelate dehydrogenase protein activity is substituted with a different amino acid. For example, the modified polypeptide includes a modified polypeptide in which a mutation has occurred at the amino acid at position 169 of the N-terminus in the amino acid sequence of SEQ ID NO: 1. More specifically, the modified polypeptide may be a protein in which the amino acid corresponding to amino acid 169 of SEQ ID NO: 1 is substituted with a different amino acid. The term "substitution with a different amino acid" is not limited to any amino acid that is substituted with a different amino acid than the one preceding the substitution. Specifically, the substitution may be one in which the amino acid is substituted with any amino acid selected from the group consisting of L-lysine, L-histidine, L-glutamate, L-aspartic acid, L-glycine, L-alanine, L-valine, L-leucine, L-isoleucine, L-methionine, L-phenylalanine, L-tryptophan, L-proline, L-serine, L-cysteine, L-tyrosine, L-asparagine, and L-glutamine. More specifically, the modified polypeptide may be one in which the 169th amino acid in the amino acid sequence of SEQ ID NO: 1 is any amino acid selected from the group consisting of L-leucine, L-phenylalanine, L-glutamate, and L-cysteine, but the modified polypeptide is not limited to these. Furthermore, the substituted amino acid residue can include not only naturally occurring amino acids but also non-natural amino acids. Non-natural amino acids can be, for example, D-amino acids, homo-amino acids, beta-homo-amino acids, N-methylamino acids, alpha-methylamino acids, and rare amino acids (e.g., citrulline, naphthylalanine, etc.), but these are not the only examples of non-natural amino acids. Meanwhile, when it is stated in this disclosure that a specific amino acid is substituted, it is evident that the amino acid is substituted with a different amino acid than the amino acid before the substitution, even if it is not separately stated that it is substituted with a different amino acid. As used herein, the term "corresponds to" refers to an amino acid residue at the indicated position in a protein or peptide, or an amino acid residue that is identical to or corresponds to the indicated residue in a protein or peptide. As used herein, the term "corresponding region" generally refers to a similar position in a related protein or reference protein. In this disclosure, a specific numbering system may be used for the positions of the amino acid residues in the polypeptide used herein. For example, it is possible to renumber the positions corresponding to the amino acid residues in the polypeptide of this disclosure by aligning the subject polypeptide to compare it with the polypeptide sequence of this disclosure. The variant of meso-diaminopimelate dehydrogenase provided in this disclosure is such that the amino acid at a specific position in the meso-diaminopimelate dehydrogenase described above is substituted, and therefore the L-threonine production capacity can be increased compared to the polypeptide before the modification. The modified polypeptide may be one in which the N-terminal amino acid 169 in the amino acid sequence of SEQ ID NO: 1 described above and / or an amino acid sequence having homology or identity of at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more of the amino acid sequence of SEQ ID NO: 1 is modified. In addition, the modified polypeptide may be one in which the N-terminal amino acid 169 in the amino acid sequence of SEQ ID NO: 1 described above and / or an amino acid sequence having homology or identity of at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more with the amino acid sequence of SEQ ID NO: 1 is modified; having sequence homology of at least 80%, 90%, 95%, 96%, 97%, 98%, 99% or more and less than 100% with the amino acid sequence of SEQ ID NO: 1; and having meso-diaminopimelate dehydrogenase activity. The meso-diaminopimelate dehydrogenase activity of the modified polypeptide may be weaker than that of the meso-diaminopimelate dehydrogenase having the amino acid sequence SEQ ID NO: 1, which is wild type. For the purposes of this disclosure, the microorganism comprising the modified meso-diaminopimelate dehydrogenase polypeptide is characterized in that the amount of L-amino acid production is increased compared to a microorganism in which the modified meso-diaminopimelate dehydrogenase polypeptide is not present. The modified meso-diaminopimelate dehydrogenase polypeptide is characterized in that it has gene-controlling activity to increase the production capacity of an L-amino acid compared to wild-type or unmodified meso-diaminopimelate dehydrogenase. It is significant that the amount of L-amino acid production can be increased in a microorganism into which the modified meso-diaminopimelate dehydrogenase polypeptide is introduced.Specifically, the L-amino acid may be L-threonine or an amino acid derived from L-threonine, but any L-amino acid that can be produced by introducing the modified mesodiaminopimelate dehydrogenase polypeptide or including the modified mesodiaminopimelate dehydrogenase polypeptide may be included without limitation. An L-threonine-derived amino acid refers to an amino acid that can be biosynthesized using L-threonine as a precursor, and an L-threonine-derived amino acid is not limited as long as it can be biosynthesized from L-threonine. The modified meso-diaminopimelate dehydrogenase polypeptide may be, for example, a modified polypeptide that includes an amino acid sequence, in which the amino acid corresponding to amino acid 169 in the amino acid sequence of SEQ ID NO: 1 is substituted with a different amino acid, and may be one consisting of the amino acid sequence of SEQ ID NO: 3. The variant, in which the amino acid corresponding to amino acid 169 in the amino acid sequence of SEQ ID NO: 1 is substituted with leucine, may be one consisting of the amino acid sequence of SEQ ID NO: 3, but the variant is not limited to it.Furthermore, the modified mesodiaminopimelate dehydrogenase polypeptide may include the amino acid sequence of SEQ ID NO: 3 or an amino acid sequence that has 80% or more homology or identity with the amino acid sequence of SEQ ID NO: 3, but the modified mesodiaminopimelate dehydrogenase polypeptide is not limited to it. Specifically, the modified meso-diaminopimelate dehydrogenase polypeptide of this disclosure may include a protein that has the amino acid sequence of SEQ ID NO: 3 or a protein that has at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity to the amino acid sequence of SEQ ID NO: 3.Furthermore, it is evident that any protein having an amino acid sequence with deletion, modification, substitution, or addition of some amino acids from the same may also fall within the scope of this disclosure in addition to the amino acid corresponding to amino acid 169 of SEQ ID NO: 1, provided that the protein has an amino acid sequence with such homologies or identities and exhibits an effect corresponding to the above protein. In other words, even if described herein as a protein having an amino acid sequence of a non-specific SEQ ID, it is clear that a protein having an amino acid sequence with a deletion, modification, substitution, conservative substitution, or partial addition of the sequence may also be used herein, provided that the protein has the same or a corresponding effect as the protein consisting of the amino acid sequence of the non-specific SEQ ID. For example, provided the protein has the same or a corresponding activity as the modified protein, an addition of a sequence that does not alter the protein's function upstream or downstream of the amino acid sequence, natural mutations, silent mutations, or conservative substitutions are not excluded.It is evident that even if the protein has such an addition or sequence mutation, it falls within the scope of this disclosure. As used in this memory, the term homology or identity refers to a degree of relevance between any two given amino acid sequences or nucleotide sequences, and can be expressed as a percentage. These terms homology and identity can often be used interchangeably. Sequence homology or identity of conserved polynucleotides or polypeptides can be determined using a standard alignment algorithm, and default spacing penalties set by the program being used can be applied in conjunction with it. In reality, homologous or identical sequences can hybridize with each other along their entire length, or at least approximately 50%, 60%, 70%, 80%, or 90% or more of the complete sequence under moderate or high-stricity conditions. Polynucleotides containing a degenerate codon instead of a regular codon are also considered in hybridization. It is possible to determine whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity using computer algorithms known in the technique, for example, the FASTA program using predetermined parameters introduced by Pearson et al. (1988) [Proc. Nati. Acad. Sci. USA 85: 2444]. Alternatively, the Needleman-Wunsch algorithm (1970, J. Mol. Biol. 48: 443-453) implemented in a Needleman program from the EMBOSS package of the European Molecular Biology Open Software Suite (Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) can be used to determine the same (including the GCG program package (Devereux, J., et al., Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL., J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994 and [CARILLO ET AL.] (1988) SIAM J Applied Math 48: 1073) For example, homology, similarity or identity can be determined using BLAST from the database of the. National Center for Biotechnology Information or ClustalW. Homology, similarity, or identity between polynucleotides or polypeptides can be determined, for example, by comparing given sequence information using a GAP computer program, such as one introduced by Needleman et al. (J Mol Biol. 48: 443 (1970)), as described by Smith and Waterman (Adv. Appl. Math (1981) 2: 482). In short, the GAP program defines homology, similarity, or identity as the number of similar aligned symbols (i.e., nucleotides or amino acids) divided by the total number of symbols in the shorter of the two sequences. Default parameters for the GAP program may include: (1) a one-to-one comparison matrix (which includes a value of 1 for identity and a value of 0 for non-identity) and the weighted comparison matrix of Gribskov et al. (Nuci. Acids Res 14: 6745 (1986)), as described by Schwartz and Dayhoff, eds. (Atlas of Protein Sequence and Structure, National Biomedical Research Foundation, pp.353-358 (1979) or EDNAFULL substitution matrix (NCBI NUC4.4 EMBOSS version); (2) a penalty of 3.0 for each space and an additional penalty of 0.10 for each symbol in each space (or a space opening penalty of 10 and a space extension penalty of 0.5); and (3) no penalty for end spaces. Therefore, as used in this dissertation, the term homology or identity represents relevance between sequences. Another additional aspect of this disclosure provides a polynucleotide, which encodes the modified meso-diaminopimelate dehydrogenase polypeptide. As used in the present memory, the term polynucleotide refers to a chain of DNA or RNA that is more than a certain length as a polymer of nucleotides, which is a long chain of nucleotide monomers connected by a covalent bond, and more specifically refers to a polynucleotide fragment that encodes the modified protein described above. The polynucleotide encoding the modified meso-diaminopimelate dehydrogenase polypeptide of this disclosure may include, without limitation, any polynucleotide sequence encoding the modified meso-diaminopimelate dehydrogenase polypeptide of this disclosure. The polynucleotide encoding the modified meso-diaminopimelate dehydrogenase polypeptide of this disclosure may also include, without limitation, any polynucleotide sequence encoding a modified protein in which amino acid 169 in the amino acid sequence of SEQ ID NO: 1 is substituted with a different amino acid. Specifically, the polynucleotide may include a polynucleotide sequence encoding a variant in which amino acid 169 in the amino acid sequence of SEQ ID NO: 1 is substituted with leucine.For example, the polynucleotide encoding the modified meso-diaminopimelate dehydrogenase polypeptide of this disclosure may be a polynucleotide sequence encoding the amino acid sequence SEQ ID NO: 3, but the polynucleotide is not limited to it. More specifically, the polynucleotide may be one consisting of a polynucleotide sequence consisting of SEQ ID NO: 4, but the polynucleotide is not limited to it. Considering codon degeneracy and the preferred codons in a bio-organism in which the protein is to be expressed, various modifications can be made to the coding region of the polynucleotide without altering the amino acid sequence of the protein.Therefore, it is evident that any polynucleotide that can be translated into a polypeptide consisting of the amino acid sequence of SEQ ID NO: 3 or into a polypeptide having homology or identity with the amino acid sequence of SEQ ID NO: 3, may also be included in this disclosure. In addition, any sequence encoding a modified meso-diaminopimelate dehydrogenase polypeptide, wherein amino acid 169 in the amino acid sequence of SEQ ID NO: 1 is substituted with a different amino acid, hybridizing with any probe that can be prepared from known gene sequences (e.g., sequences complementary to all or part of the above nucleotide sequence) under rigorous conditions, may be included without limitation. The term stringency conditions refers to conditions that allow specific hybridization between polynucleotides. Such conditions are specifically described in references (e.g., J Sambrook et al., supra). For example, stringency conditions may include conditions under which genes that have high homology or identity (e.g., 80% or more, 85% or more, specifically 90% or more, more specifically 95% or more, even more specifically 97% or more, and even more specifically 99% or more) hybridize with each other, while genes that have lower homology or identity do not hybridize with each other. or conventional washing conditions for Southern hybridization (i.e., conditions for washing once, and specifically two or three times under a salt concentration and temperature corresponding to 60 °C, 1 χ SSC and 0.1% SDS; specifically 60 °C, 0.1 χ SSC and 0.1% SDS; and more specifically 68 °C, 0.1 χ SSC and 0.1% SDS). Although nucleotide mismatches can occur due to the strictness of hybridization, the two nucleic acids are required to have a complementary sequence. The term complementary describes the relationship between nucleotide bases that can hybridize with each other. For example, in DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Therefore, this disclosure may include not only substantially similar nucleic acid sequences but also isolated nucleic acid fragments that are complementary to the complete sequence. Specifically, the polynucleotide that has homology or identity can be detected using hybridization conditions that include the hybridization step at a Tm value of 55 °C and the conditions described above. Furthermore, the Tm value can be 60 °C, 63 °C, or 65 °C, but is not limited to these, and can be appropriately adjusted by a person skilled in the art according to the purpose. The appropriate rigor for polynucleotide hybridization depends on the length and degree of complementarity of the polynucleotides, and the variables are well known in the technique (see Sambrook et al., supra, 9.50-9.51 and 11.7-11.8). As used in this dissertation, the term vector refers to a DNA construct that includes a polynucleotide sequence encoding a modified target protein operatively linked to an appropriate control sequence to enable the expression of the modified target protein in a suitable host cell. The control sequence may include a promoter capable of initiating transcription, any operator sequence for the control of such transcription, a sequence encoding an appropriate mRNA ribosome-binding domain, and a sequence that controls the termination of transcription and translation. Once the vector is transformed in the appropriate host cell, it can replicate or function independently of the host genome and can integrate into the genome itself. The vector used in this disclosure is not particularly limited, provided it is capable of replicating in the host cell, and any vector known in the technique may be used. Examples of commonly used vectors may include plasmids, cosmids, viruses, and natural or recombinant bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc., may be used as phage vectors or cosmid vectors; and those based on pBR, pUC, pBluescriptlI, pGEM, pTZ, pCL, pET, etc., may be used as plasmid vectors. Specifically, vectors such as pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCCIBAC, etc., may be used. For example, the polynucleotide encoding a modified target protein on the chromosome can be replaced with a modified polynucleotide via a vector for intracellular chromosomal insertion. The insertion of a polynucleotide into the chromosome can be performed using any known procedure in the technique (e.g., homologous recombination), but the procedure is not limited to this. The vector may also include a selection marker to confirm its successful insertion into the chromosome. The selection marker is used for the selection of cells transformed with the vector, i.e., to confirm whether the target nucleic acid molecule has been inserted, and markers that confer selectable phenotypes (e.g., drug resistance, auxotrophy, resistance to cytotoxic agents, expression of surface proteins, etc.).Under the circumstances in which selective agents are treated, only cells capable of expressing the selection markers can survive or express other phenotypic traits, and therefore the transformed cells can be selected. Another aspect of this disclosure provides a microorganism comprising the modified protein or a polynucleotide encoding the modified protein and thus capable of producing L-threonine. Specifically, the microorganism comprising the variant protein or a polynucleotide encoding the modified protein may be, but is not limited to, a microorganism prepared by transformation with a vector comprising a polynucleotide encoding the modified protein. As used in this dissertation, the term transformation refers to the introduction of a vector, comprising a polynucleotide encoding a target protein, into a host cell such that the protein encoded by the polynucleotide is expressed in the host cell. Provided the transformed polynucleotide can be expressed in the host cell, it may be integrated into and placed on the host cell's chromosome, or it may be placed extrachromosomally, or independently of the chromosome. Furthermore, the polynucleotide includes DNA and RNA encoding the target protein. The polynucleotide may be introduced in any form, as long as it can be introduced into the host cell and expressed therein. For example, the polynucleotide may be introduced into the host cell as an expression cassette, which is a gene construct that includes all the elements necessary for its autonomous expression.In general, the expression cassette may include a promoter operatively linked to the polynucleotide, transcription termination signals, ribosome binding sites, and translation termination signals. The expression cassette may be in the form of a self-replicating expression vector. Furthermore, the polynucleotide may be one that has been introduced into the host cell as is and operatively linked to a sequence required for expression in the host cell, but the polynucleotide is not limited to this. As used in this disclosure, the term operationally linked means that a promoter sequence, which initiates and mediates transcription of the polynucleotide encoding the modified target protein of this disclosure, is functionally linked to the above gene sequence. Another additional aspect of this disclosure provides a microorganism of the genus Corynebacterium, comprising the modified meso-diaminopimelate dehydrogenase polypeptide or a polynucleotide encoding the same. As used herein, the term "microorganism comprising a modified meso-diaminopimelate dehydrogenase polypeptide or a polynucleotide encoding the same" may refer to a recombinant microorganism prepared such that the modified meso-diaminopimelate dehydrogenase polypeptide of this disclosure is expressed. For example, it may refer to a host cell or microorganism comprising a polynucleotide encoding a modified meso-diaminopimelate dehydrogenase polypeptide or transformed with a vector comprising a polynucleotide encoding the modified meso-diaminopimelate dehydrogenase polypeptide and is therefore capable of expressing the variant.For the purpose of this disclosure, specifically, the microorganism is a microorganism expressing a modified meso-diaminopimelate dehydrogenase polypeptide, which includes one or more amino acid substitutions within the amino acid sequence of SEQ ID NO: 1, and the microorganism may be a microorganism expressing a modified protein in which the N-terminus amino acid 169 in the amino acid sequence of SEQ ID NO: 1 is substituted with leucine and thus has modified meso-diaminopimelate dehydrogenase polypeptide activity, but the microorganism is not limited to this. The microorganism, comprising the modified meso-diaminopimelate dehydrogenase polypeptide or a polynucleotide encoding the same, may possibly be any microorganism comprising the modified meso-diaminopimelate dehydrogenase polypeptide or a polynucleotide encoding the same and is therefore capable of producing an L-amino acid (e.g., L-threonine), but the microorganism is not limited to it.For example, the microorganism comprising the modified mesodiaminopimelate dehydrogenase polypeptide or a polynucleotide encoding it may be a recombinant microorganism, prepared by introducing a polynucleotide encoding a modified mesodiaminopimelate dehydrogenase polypeptide into a wild-type microorganism, or a microorganism that produces an L-amino acid and is therefore capable of expressing the modified mesodiaminopimelate dehydrogenase polypeptide and has an enhanced capacity to produce an L-amino acid. The recombinant microorganism with an enhanced capacity to produce an L-amino acid may be a microorganism that has an improved capacity to produce an L-amino acid compared to the wild-type microorganism or an unmodified microorganism, and the L-amino acid may be L-threonine, but is not limited to this. As used in the present memory, the term microorganism that produces an L14 amino acid includes both a wild-type microorganism and a microorganism in which a natural or artificial genetic modification has occurred, and may be a microorganism, in which a particular mechanism is weakened or enhanced due to the insertion of a foreign gene, due to the enhancement or inactivation of the activity of an endogenous gene, etc., in which a genetic variation has occurred or the production activity of a desired L-amino acid is enhanced.The subject microorganism may be a microorganism that is genetically modified through one or more selected from the group consisting of the modified polypeptide, a polynucleotide encoding the modified polypeptide, and a vector comprising the polynucleotide; a microorganism that is modified to express the modified polypeptide or a polynucleotide encoding the modified polypeptide; a recombinant microorganism that expresses the modified polypeptide or a polynucleotide encoding the modified polypeptide; or a recombinant microorganism that has activity of the modified polypeptide, but the microorganism is not limited to it. The microorganism that produces an L-amino acid may be one comprising the modified polypeptide or a polynucleotide encoding the modified polypeptide, or one into which a vector comprising the polynucleotide is introduced to have an enhanced capacity to produce a desired L-amino acid. Specifically, the introduction may be achieved by transformation, but is not limited to this. Furthermore, in this disclosure, the microorganism that produces an L-amino acid or a microorganism that has the ability to produce an L-amino acid may be a microorganism in which part of the gene or genes involved in the biosynthesis of L-amino acid is enhanced or weakened, or a microorganism in which part of the gene or genes involved in the degradation pathway of L-amino acids is enhanced or weakened. For the purposes of this disclosure, the microorganism may include any microorganism that comprises the modified polypeptide and is therefore capable of producing L-threonine or an amino acid derived from L-threonine. The term unmodified microorganism refers to a naturally occurring strain; a microorganism that does not contain the modified meso-diaminopimelate dehydrogenase polypeptide; or a microorganism that is not transformed with a vector containing the polynucleotide encoding the modified meso-diaminopimelate dehydrogenase polypeptide. The microorganism may be a prokaryotic or eukaryotic microorganism, provided that the microorganism can produce an L-amino acid. For example, the microorganism may include microorganisms from the genera Escherichia, Erwinia, Serratia, Providencia, Corynebacterium, and Brevibacterium. Specifically, the microorganism may be a microorganism from the genus Corynebacterium, and more specifically Corynebacterium glutamicum, but the microorganism is not limited to them. Specifically, to improve the L-threonine biosynthesis pathway in the microorganism of the genus Corynebacterium, for example, the expression of a thrC gene that encodes threonine synthase; a ppc gene that encodes phosphoenolpyruvate carboxykinase; a galP gene that participates in glucose uptake; a lysC gene that encodes lysine-sensitive aspartokinase 3; a hom gene that encodes homoserine dehydrogenase; a pyc gene that induces increased oxaloacetate storage, etc., can be improved or increased within the microorganism. In order to release feedback inhibition with respect to L-threonine, for example, a genetic modification can be introduced in the lysC gene, hom gene, thrA gene (which has a bifunctional property of aspartokinase / homoserine dehydrogenase 1), etc. In order to inactivate genes that weaken the L-threonine biosynthesis pathway, for example, the expression of a pckA gene involved in the conversion of oxaloacetate (OAA) (i.e., an intermediate of L-threonine biosynthesis) to phosphoenolpyruvate (PEP); the expression of a tyrR gene that inhibits the expression of the lysC- gene; the expression of a gaIR gene that inhibits the expression of a galP gene involved in glucose uptake; the expression of a mcbR gene (i.e., a dual transcriptional regulator of DNA binding); etc., these genes can be weakened or inactivated within the microorganism. In order to increase the activity of the L-threonine operon, a plasmid comprising a threonine operon, consisting of genes encoding aspartokinase, homoserine dehydrogenase, homoserine kinase, and threonine synthase (Japanese Patent Application Publication No. 2005-227977), a threonine operon derived from E. coli, etc., can be introduced into a microorganism (TURBA E, et al., Agrie. Biol. Chem. 53: 2269-2271, 1989), and thereby the expression of the threonine operon can be increased within the microorganism. In addition, resistance to L-threonine analogues (e.g., alpha-amino-p-hydroxyvaleric acid, D-hydroxamate, L-threonine, etc.) can be conferred. In addition, genes that act on the L-lysine biosynthesis pathway and have a common precursor of L-threonine (e.g., dihydrodipicolinate synthase (dapA) (i.e., 4-hydroxy-tetrahydrodipicolinate reductase), diaminopimelate decarboxylase UysA) and diaminopimelate dehydrogenase (ddh)) may be weakened. However, gene expression procedures are not limited to these, and the ability to produce L-threonine can be improved by a gene expression control procedure known in the technique. As used in this dissertation, the term enhancement / increase is a concept that includes all increases in the activity of a gene compared to its activity IV l OO4U endogenous. Such enhancement or enhancement of gene activity can be achieved by applying several well-known procedures. Enhancement or enhancement of gene activity can be achieved by one or more procedures selected from the group consisting of a procedure for increasing the number of copies of a gene in a cell; a procedure for introducing a modification to the expression control sequence of a gene; a procedure for replacing the expression control sequence of a gene with a sequence that has stronger activity; a procedure for introducing a further modification to the corresponding gene to enhance its activity; and a procedure for introducing a foreign gene into a microorganism. It can also be achieved by a combination of these procedures, but the procedures are not specifically limited to them. As used in this dissertation, the term inactivation is a concept that includes a case in which the activity of a gene is weakened compared to an endogenous activity of the same and a case in which a gene has no activity. Such inactivation or weakening of the activity of a gene can be achieved by applying several procedures well known in the technique.Examples of these procedures include: a procedure to delete all or part of a gene on the chromosome, including a case where gene activity is eliminated; a procedure to replace a gene encoding a corresponding protein on the chromosome with a mutated gene to reduce the activity of the corresponding protein; a procedure to introduce a modification to the expression control sequence of a gene on the chromosome that encodes the protein; a procedure to replace the expression control sequence of a protein-encoding gene with a sequence having weaker activity or no activity (e.g., a procedure to replace the gene promoter with a promoter that has weaker activity compared to its endogenous promoter); a procedure to delete all or part of a protein-encoding gene on the chromosome; a procedure to introduce an antisense oligonucleotide (e.g.(antisense RNA), which binds complementaryly to a transcript of the gene on the chromosome that encodes the protein, thereby inhibiting the translation of the mRNA into a protein; a procedure for artificially adding a sequence, complementary to the Shine-Dalgarno (SD) sequence, to a region upstream of the SD sequence of a gene on the chromosome that encodes the protein, forming a secondary structure and thus preventing ribosome binding; a reverse transcription engineering (RTE) procedure in which a promoter is added to the 3' end of the open reading frame (ORE) of the sequence to be reverse transcribed; etc. Furthermore, the inactivation or weakening of gene activity can be achieved by a combination of these procedures, but the procedures are not particularly limited to them. For example, the improvement of the activities of the lysC, hom, and pyc genes can be achieved by a procedure to increase the number of copies of a gene in a cell; a procedure to introduce a modification in the expression control sequence of a gene; a procedure to replace the expression control sequence of a gene with a sequence that has stronger activity; a procedure to introduce an additional modification in the corresponding gene to improve the gene's activity; a procedure to introduce a foreign gene into a microorganism; etc., but the procedures are not particularly limited to them and any known procedure to improve or increase the activity of a gene can be used without limitation. For example, weakening the activities of the dapA, ddh, and lysA genes can be achieved by a procedure involving total or partial deletion of a gene on the chromosome, including a case where gene activity is eliminated; a procedure to replace a gene encoding a corresponding protein on the chromosome with a mutated gene to reduce the activity of the corresponding protein; a procedure to introduce a modification in the expression control sequence of a gene on the chromosome that encodes the protein; a procedure to replace the expression control sequence of a gene encoding the protein with a sequence having weaker activity or no activity (for example, a procedure to replace the gene promoter with a promoter that has weaker activity compared to its endogenous promoter); a procedure to delete all or part of a gene on the chromosome that encodes the protein; and so on.However, the procedures are not limited to them and any known procedure to weaken the activity of a gene can be used without limitation. In addition, in this disclosure, the microorganism that includes the modified meso-diaminopimelate dehydrogenase polypeptide may also include one or more selected from the following modified polypeptides, or one or more selected from the polynucleotides encoding the following modified polypeptides. The modified polypeptide to be additionally included may be one or more selected from a modified dihydrodipicolinate reductase (dapB) polypeptide (i.e., 4-hydroxy-tetrahydrodipicolinate reductase), wherein amino acid 13 of the amino acid sequence of SEQ ID NO: 81, arginine, is substituted with asparagine; a modified diaminopimelate decarboxylase (lysA) polypeptide, wherein amino acid 408 in the amino acid sequence of SEQ ID NO: 82, methionine, is substituted with alanine; and a modified dihydrodipicolinate synthase (dapA) polypeptide, wherein amino acid 119 in the amino acid sequence of SEQ ID NO: 83, tyrosine, is substituted with phenylalanine. The amino acid sequence of the modified dihydrodipicolinate reductase polypeptide, in which amino acid 13 of the amino acid sequence SEQ ID NO: 81, arginine, is substituted with asparagine, may be SEQ ID NO: 66, but the amino acid sequence is not limited to it. In this disclosure, the introduction of the modified polypeptide or a polynucleotide encoding it may reduce the amount of lysine production while increasing the amount of threonine production. The amino acid sequence of the modified diaminopimelate decarboxylase polypeptide, in which amino acid 408 in the amino acid sequence of SEQ ID NO: 82, methionine, is substituted with alanine, may be SEQ ID NO: 71, but the amino acid sequence is not limited to it. Diaminopimelate decarboxylase is the final enzyme acting on lysine biosynthesis, and the substitution of amino acid 408 from methionine to alanine can reduce the amount of lysine produced while increasing the amount of threonine. The amino acid sequence of the modified dihydrodipicolinate synthase polypeptide, in which amino acid 119 in the amino acid sequence of SEQ ID NO: 83, tyrosine, is substituted with phenylalanine, may be SEQ ID NO: 76, but the amino acid sequence is not limited to it. Dihydrodipicolinate synthase is an enzyme for the biosynthesis of lysine from aspartyl semialdehyde (i.e., a common precursor of lysine and threonine), and the substitution of amino acid 119 of tyrosine with phenylalanine can reduce the amount of lysine produced while increasing the amount of threonine produced. Another additional aspect of this disclosure provides a process for preparing threonine or an L-amino acid derived from threonine, comprising a culture step in a medium of a microorganism of the genus Corynebacterium comprising a polypeptide modified with meso-diaminopimelate dehydrogenase activity. The L-amino acid derived from threonine can include not only L-amino acids derived from threonine, but also their derivatives. For example, L-amino acids derived from threonine can be L-threonine, L-isoleucine, O-acetyl-L-homoserine, O-succinyl-L-homoserine, O-phospho-L-homoserine, L-methionine, and / or L-glycine, but the L-amino acid derived from threonine is not limited to these. More specifically, L-amino acids derived from threonine can be L-threonine, L-isoleucine, O-acetyl-L-homoserine, O-succinyl-L-homoserine, and / or L-methionine, but the L-amino acid derived from threonine is not limited to these. In the above procedure, the stage of culturing the microorganism is not particularly limited, but can be carried out in batch culture, continuous culture, or culture IV l OO4U semi-continuous, etc., known in the art. In particular, the culture conditions are not particularly limited, but an optimum pH (e.g., pH 5 to 9, specifically pH 6 to 8, and more specifically pH 6.8) can be adjusted using a basic compound (e.g., sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (e.g., phosphoric acid or sulfuric acid), and an aerobic state can be maintained by introducing oxygen or an oxygen-containing gas mixture into a culture, but the culture conditions are not limited to this. The culture temperature can be maintained between 20 °C and 45 °C, and specifically between 25 °C and 40 °C, and the culture can be carried out for approximately 10 hours to approximately 160 hours, but this is not limited to this. Furthermore, the L-amino acid produced by the culture can be secreted into the medium or remain in the cells. In addition, as a carbon source for use in the culture medium, saccharides and carbohydrates (e.g. glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose), oils and fats (e.g. soybean oil, sunflower oil, peanut oil and coconut oil), fatty acids (e.g. palmitic acid, stearic acid and linoleic acid), alcohols (e.g. glycerol and ethanol), organic acids (e.g. acetic acid), etc. in combination, but the carbon source is not limited to these. As a nitrogen source, an organic compound containing nitrogen (e.g., peptone, yeast extract, gravy, malt extract, corn mash liquor, bean meal, and urea) and an inorganic compound (e.g., ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate), etc., can be used alone or in combination, but the nitrogen source is not limited to them.Potassium dihydrogen phosphate, dipotassium hydrogen phosphate, corresponding sodium-containing salts, etc., can be used as a phosphorus source, alone or in combination, but the phosphorus source is not limited to these. In addition, the medium may include essential growth-promoting materials such as metallic salts (e.g., magnesium sulfate or ferrous sulfate), amino acids, and vitamins. The microorganism cultivation step described in this disclosure may also include a step of recovering L-threonine or L-threonine-derived L-amino acids from the culture medium and the microorganism. Regarding the recovery procedure for L-threonine or L-threonine-derived L-amino acids produced during the culture stage, the desired L-threonine or L-threonine-derived L-amino acids can be collected from the culture solution using an appropriate procedure known in the art, depending on the culture procedure. For example, centrifugation, filtration, anion-exchange chromatography, crystallization, HPLC, etc., can be used, and the desired L-threonine or L-threonine-derived L-amino acids can be recovered from the culture medium or microorganism using a procedure known in the art. The recovery step may include a purification step, which can be carried out using an appropriate procedure known in the art. Therefore, the recovered L-threonine or the L-amino acids derived from L-threonine may be in purified form or in a fermentation liquid of the microorganism, including the L-amino acid (Introduction to Biotechnology and Genetic Engineering, AJ Nair., 2008). Another additional aspect of this disclosure provides a composition for the production of L-threonine, comprising: a microorganism comprising the modified polypeptide of this disclosure having meso-diaminopimelate dehydrogenase activity, a polynucleotide encoding the modified polypeptide, and a vector comprising the polynucleotide, or any of these; or a culture solution containing the microorganism. The meso-diaminopimelate dehydrogenase, the modified polypeptide thereof, the polynucleotide, the vector, and the microorganism are the same as those described above. The microorganism may be a microorganism of the genus Corynebacterium, and specifically Corynebacterium glutamicum, but the microorganism is not limited to it. This is the same as described previously. The composition for L-threonine production may refer to a composition capable of producing L-threonine using a modified polypeptide having mesodiaminopimelate dehydrogenase activity. The composition may include, without limitation, a modified polypeptide having mesodiaminopimelate dehydrogenase activity or a constitution capable of operating the modified polypeptide having mesodiaminopimelate dehydrogenase activity. The modified polypeptide having mesodiaminopimelate dehydrogenase activity may be in a form where it is incorporated into a vector to express the gene operatively linked to it in a host cell into which it is introduced. The composition may further comprise a lyoprotectant or an excipient. The lyoprotectant or excipient may be a material of non-natural origin or a material of natural origin, but is not limited to these. In another specific embodiment, the lyoprotectant or excipient may be a material with which the microorganism does not naturally come into contact, or a material that is not naturally contained simultaneously with the microorganism, but is not limited to it. Another additional aspect of this disclosure provides for the use of a microorganism, comprising the modified meso-diaminopimelate dehydrogenase polypeptide of this disclosure, a polynucleotide encoding the modified polypeptide, a vector comprising the polynucleotide, or any of these, for the production of L-threonine or L-threonine-derived L-amino acids. DETAILED DESCRIPTION OF THE INVENTION The present disclosure will now be described in greater detail with reference to the following examples. However, these examples are for illustrative purposes only, and the scope of the invention is not limited by them. Example 1: Preparation of the vector library for the introduction of modifications within the ORF of the ddh gene In order to discover variants in which the expression level of the Corynebacterium glutamicum ddh gene or its activity is reduced, a library was prepared using the procedure shown below. First, in order to introduce 0 to 4.5 modifications per 1 kb of a DNA fragment (963 bp) consisting of the ddh gene (963 bp), a Genemorph II Random Mutagenesis Kit (Stratagene) was used. Error-prone PCR was performed using chromosomal DNA from Corynebacterium glutamicum ATCC13032 (WT) as a template along with primers from SEQ IDs 5 and 6. Specifically, the reaction solution, containing chromosomal DNA from the WT strain (500 ng), primers from SEQ IDs 5 and 6 (125 ng each), Mutazyme II reaction buffer (1X), dNTP mixture (40 mM), and Mutazyme II DNA polymerase (2.5 U), was subjected to the following conditions: denaturation at 94 °C for 2 minutes; 25 cycles of denaturation at 94 °C for 1 minute, annealing at 56 °C for 1 minute and polymerization at 72 °C for 3 minutes; and polymerization at 72 °C for 10 minutes. The amplified gene fragment was ligated to the pCRI1 vector using a TOPO TA cloning kit (Invitrogen), and the resulting vector was transformed into E. coli DH5a. The transformants were then plated on LB solid medium containing kanamycin (25 mg / L). After selecting 20 types of transformed colonies, a plasmid was obtained from each. Nucleotide sequence analysis revealed modifications introduced at mutually distinct locations with a frequency of 0.5 mutations / kb. Finally, approximately 10,000 transformed E. coli colonies were collected, and the plasmid was extracted from them. The resulting library was named pTOPO-aW / 7(mt). ML / a / ZUZ 1 DO4U Example 2: Preparation of the ddh deletion strain and selection from the random mutagenesis library To confirm the effect of ddh deletion on L-lysine production, the Corynebacterium glutamicum strain KCCM11016P (Korean Patent No. 100159812) was used. To prepare the Corynebacterium glutamicum strain KCCM11016P (in which the ddh gene is deleted), a pDZ-AoWh vector (in which the ddh gene is deleted) was prepared as follows. Specifically, the vector was prepared such that the DNA fragments (600 bp each) located at the 5' and 3' ends of the ddh gene were each ligated to the pDZ vector (Korean Patent Application Publication No. 2009-0094433). Based on the reported ddh gene nucleotide sequence (SEQ ID NO: 2), primers SEQ ID NO: 7 and 8 (in which the Xba restriction enzyme recognition site was inserted in the 5' and 3' fragments, respectively) and primers SEQ ID NO: 9 and 10 (which are separated from SEQ ID NO: 7 and 8 by 663 bp, respectively) were synthesized (Table 1). The 5' end gene fragment was prepared by PCR using chromosomal DNA from Corynebacterium glutamicum ATCC13032 as a template along with primers from SEQ ID NO: 7 and 9. Similarly, the gene fragment located at the 3' end of the ddh gene was prepared by PCR using primers from SEQ ID NO: 8 and 10.The PCR was performed as follows: denaturation at 94 °C for 2 minutes; 30 cycles of denaturation at 94 °C for 1 minute, annealing at 56 °C for 1 minute and polymerization at 72 °C for 40 seconds; and polymerization at 72 °C for 10 minutes. Meanwhile, the pDZ vector (digested with the restriction enzyme Xba and then heat-treated at 65 °C for 20 minutes) was ligated to the PCR-amplified insertion DNA fragment using the Infusion Cloning kit. The resulting colonies were transformed into E. coli DH5a, and the transformants were plated on LB solid medium containing kanamycin (25 mg / L). After selecting colonies transformed with the vector, into which the desired gene was inserted by PCR using the primers from SEQ ID NO: 7 and 8, the plasmid was obtained using a standard plasmid extraction procedure, and the resulting plasmid was named pDZ-Addh. Table 1 SEQ ID NO Sequence (5'->3j SEQ ID NO: 7 CGGGGATCCTCTAGATGACCAACATCCGCG SEQ ID NO: 8 CAGGTCGACTCTAGATTAGACGTCGCGTGCG SEQ ID NO: 9 CGGTGAAATCGGCGACATCAAAGACTG SEQ ID NO: 10 GATGTCGCCGATTTCACGCTTCCTC The prepared pDZ-AoWh vector was transformed into the Corynebacterium glutamicum KCCM11016P strain by electroporation (Van der Rest et al., Appl. Microbiol. Biotecnol. 52:541-545, 1999), and then a strain was prepared in which the ddh gene was deleted by homologous chromosomal recombination. The strain prepared in which the ddh gene was deleted was named Corynebacterium glutamicum WT:.Addh. In addition, the pTOPO-oW / 7(mt) library, which was prepared in Example 1 above, was transformed into the KCCM11016P::Zldd / ) strain by electroporation, and the transformants were plated on a complex plate medium containing kanamycin (25 mg / L), yielding approximately 20,000 colonies. Each colony was inoculated onto the following selection medium (300 µL) and then cultured in a 96-well plate at 1,000 rpm at 32°F for approximately 24 hours. <Medio de selección (pH 8.0)> g glucose, 5.5 g ammonium sulfate, 1.2 g MgSO4-7H2O, 0.8 g KH2PO4, 16.4 g K2HPO4, 100 pg biotin, 1 mg thiamine HCl, 2 mg calcium pantothenate, 2 mg nicotinamide (per 1 L distilled water) The amount of L-lysine produced in the culture solution was analyzed using the ninhydrin procedure (Moore, S., Stein, WH, Photometric ninhydrin method for use in the chromatography of amino acids. J. Biol. Chem. 1948, 176, 367-388). Once the culture was complete, the culture supernatant (10 pL) and the ninhydrin reaction solution (190 pL) were reacted at 65 pL for 30 minutes, and the absorbance was measured at a wavelength of 570 nm using a spectrophotometer. The WT strain and the WT.-Addh strain were used as control groups. Sixty strain types were selected that showed lower absorbance compared to the WT strain (i.e., the wild type) while showing higher absorbance compared to the WT-.-Addh strain. The 60 selected strain types were re-cultured in the same manner as described above, and the ninhydrin reaction was performed repeatedly. As a result, the 5 main mutant strain types were selected, which showed an improved L-lysine production capacity compared to strain KCCM11016P::2lc / c / / 7 but a reduced L-lysine production capacity compared to strain KCCM11016P. The 5 selected strain types were designated KCCM11016P::dcy / 7(mt)-1 to KCCM11016P::oWh(mt)-5 (Table 2), respectively. Table 2. L-lysine production concentration by 5 types of randomly selected mutant strains Strain Absorbance (572 nm) Lot 1 Lot 2 Lot 3 Average Control Group KCCM11016P 0.228 0.205 0.216 0.215 1 KCCM11016P::c / d / 7(mt)-1 0.214 0.193 0.205 0.204 2 KCCM11016P::dd / 7(mt)-2 0.185 0.181 0.179 0.182 3 KCCM11016P::oWh(mt)-3 0.164 0.163 0.145 0.157 4 KCCM11016P::ddh(mt)-4 0.135 0.141 0.128 0.135 5 KCCM11016P::ot / / 7(mt)-5 0.198 0.201 0.189 0.196 Control Group KCCM11016P::ZlcWh 0.106 0.112 0.098 0.105 Example 3: Confirmation of nucleotide sequences of 5 types of modified ddh strains In order to confirm the nucleotide sequences of the ddh gene in the 5 selected strain types (i.e., KCCM11016P::oWh(mt)-1 to KCCM11016P::c / c / / 7(mt)-5), DNA fragments containing the ddh gene on the chromosome were amplified by PCR using the primers shown in Example 1 (SEQ ID NO: 5 and 6). The PCR was performed as follows: denaturation at 94 °C for 2 minutes; 30 cycles of denaturation at 94 °C for 1 minute, annealing at 56 °C for 1 minute, and polymerization at 72 °C for 40 seconds; and polymerization at 72 °C for 10 minutes. Table 3 SEQ ID NO Sequence (5'->3j SEQ ID NO: 5 ATGACCAACATCCGCGTAGC SEQ ID NO: 6 TTAGACGTCGCGTGCGATCAG As a result of the analysis of the nucleotide sequences of the amplified gene, the 5 strain types were found to be: 1) a variant, in which a modification is introduced in the nucleotide sequence located at position 37 chain down the ORF start codon of the ddh gene and, therefore, the original sequence 'AAC' becomes 'GAC' (i.e., the N-terminal amino acid 13 (i.e., asparagine) is replaced with aspartic acid); ii) a variant, in which three modifications are introduced in the nucleotide sequence, including nucleotides 106 to 108 chain down the ORF start codon of the ddh gene and, therefore, the original sequence 'CGC' becomes 'ATG' (i.e., the N-terminal amino acid 36 (i.e., arginine) is replaced with methionine);(ii) a variant, wherein two modifications are introduced in the nucleotide sequence, including nucleotides 448 to 449 downstream of the ORF start codon of the ddh gene, and the original sequence 'CAG' is thus converted to 'ATG' (i.e., the N-terminus amino acid 150 (i.e., glutamine) is substituted with methionine); (iv) a variant, wherein two modifications are introduced in the nucleotide sequence, including nucleotides 505 to 506 downstream of the ORF start codon of the ddh gene, and the original sequence 'ACO' is thus converted to 'CTC' (i.e., the N-terminus amino acid 169 (i.e., threonine) is substituted with leucine);(yv) a variant, wherein two modifications are introduced in the nucleotide sequence, including nucleotides 584 to 585 chain down the ORF start codon of the ddh gene, and thus the original sequence 'CGC' becomes 'CAA' (i.e., the N-terminal amino acid 195 (i.e., arginine) is substituted with glutamine). Example 4: Preparation of ATCC13032 strains in which 5 types of ddh modifications are introduced and evaluation of their threonine and lysine production capacities With regard to the 5 types of modifications confirmed in Example 3 above, in order to finally select the strains in which the L-lysine production capacity is reproducibly reduced while the L-threonine production capacity is increased, wild-type derived strains were prepared in which a modification is introduced. In order to prepare strains in which a modified ddh gene is introduced into the ATCC13032 strain of Corynebacterium glutamicum, 5 types of vectors, in which the modified ddh gene can be introduced (i.e., pDZddh m1 to pDZ:\ddh m5), were prepared as follows. Specifically, the vector was prepared such that the DNA fragments (963 bp each) located at the 5' and 3' ends of the ddh gene were each ligated to the pDZ vector (Korean Patent No. 2009-0094433). Based on the reported ddh gene nucleotide sequence (SEQ ID NO: 2), a primer SEQ ID NO: 11 (in which the Xbal restriction enzyme recognition site was inserted at the 5' and 3' fragments, respectively) and a primer SEQ ID NO: 12 (which is separated from SEQ ID NO: 11 by 931 bp, respectively) were synthesized. The modified DNA fragments were prepared by PCR using the chromosomal DNA from KCCM11016P::oWh(mt)-1 to KCCM11016P::áíf / 7(mt)-5 confirmed in Example 3 above along with the primers from SEQ ID NO: 11 and 12. The PCR was performed as follows: denaturation at 94 °C for 2 minutes; 30 cycles of denaturation at 94 °C for 1 minute, annealing at 56 °C for 1 minute and polymerization at 72 °C for 10 seconds; and polymerization at 72 °C for 10 minutes. Meanwhile, the pDZ vector (digested with the restriction enzyme Xba and then heat-treated at 65 °C for 20 minutes) was ligated to the PCR-amplified modified DNA fragments using the Infusion Cloning kit. The resulting colonies were transformed into E. coli DH5a, and the transformants were seeded on LB solid medium containing kanamycin (25 mg / L). After selecting colonies transformed with the vector, into which the desired gene was inserted by PCR using the primers from SEQ ID NO: 11 and 12, plasmids were obtained using a standard plasmid extraction procedure. The resulting plasmids were named pDZ::cfc( / 7(mt)1 to pDZ::dd / 7(mt)5, respectively. The prepared vectors (i.e., pDZ::ddí?(mt)1 to pDZ::cWÍ7(mt)5) were each transformed into the Corynebacterium glutamicum ATCC13032 strain by electroporation, and then subjected to a second crossing process, thus yielding strains in each of which part of the ddh gene nucleotide sequence is substituted with one or more modified nucleotides on the chromosome. Whether the substitution was appropriate was determined by mutant allele-specific amplification (MASA) PCR technology (Takeda et al., Hum.Mutation, 2, 112-117 (1993)) using the following primer pairs, in which in the primer pair SEQ ID NO: 13 and SEQ ID NO: 14, which agrees with the modified sequences, the suitability of the substitution was first determined by selecting the strain to be amplified, and the sequence analysis of the ddh gene of the selected strain was secondarily confirmed by analyzing the modified sequences using the primer pair SEQ ID NO: 13 and SEQ ID NO: 15. The prepared strains, in each of which a modified ddh gene is introduced, were named Corynebacterium glutamicum ATCC 13032 -.-.ddh (mt)1 to Corynebacterium glutamicum ATCC13032::cfcy / 7(mt)5, respectively. IV l OO4U Table 4 SEQ ID NO Sequence (5'->3j SEQ ID NO: 11 CGGGGATCCTCTAGATGACCAACATCCGCG SEQ ID NO: 12 CAGGTCGACTCTAGATTAGACGTCGCGTGCG SEQ ID NO: 13 CACAA lili GGAGGATTAC SEQ ID NO: 14 TGGGTGACCACGATCAGAT SEQ ID NO: 15 GGAAACCACACTGTTTCC Regarding the five strain types into which five modifications were introduced, in order to ultimately select the strains in which L-lysine production capacity was reproducibly reduced while L-threonine production capacity was increased, a culture was performed in flasks using the following media. Once the culture was complete, the concentrations of L-lysine and threonine in the culture solution were analyzed using HPLC, and the concentrations of L-lysine and threonine produced in each mutant strain are shown in Tables 5 and 6 below. <Medio de siembra (pH 7.0)> g glucose, 10 g peptone, 5 g yeast extract, 1.5 g urea, 4 g KH2PO4, 8 g K2HPO4, 0.5 g MgSO4-7H2O, 100 pg biotin, 1 mg thiamine HCl, 2 mg calcium pantothenate, 2 mg nicotinamide (per 1 L distilled water)<Medio de producción (pH 7.0)> 100 g glucose, 40 g (NH4)2SO4, 2.5 g soy protein, 5 g corn soaked solids, 3 g urea, 1 g KH2PO4, 0.5 g MgSO4-7H2O, 100 pg biotin, 1 mg HCI calcium pantothenate, 3 mg nicotinamide, 30 g CaCOs (per 1 L distilled water) MA / a / JUDGE 3O4U Table 5. Concentrations of L-lysine Produced by 5 Types of Selected Random Mutant Strains Strain L-lysine (g / L) Glucose Consumption Rate (g / h) Batch 1 Batch 2 Batch 3 Average Control Group ATCC13032 1.25 1.20 1.19 1.21 4.33 1 ATCC13032::dd / 7(mt / 7) 1.18 4.30 2 ATCC13032::ddh (mt)2 1.05 1.10 1.02 1.06 4.21 3 ATCC13032::dd / 7(mt)3 0.85 0.88 0.90 0.88 3.79 4 ATCC13032::dd / ?(mt)4 0.75 0.79 0.76 0.77 3.71 5 ATCC13032::dd / ?(mt)5 1.11 1.08 1.13 1.11 4.12 Control Group ATCC: 13 / ? 0.68 0.71 0.70 3.56 Table 6. L-threonine Concentrations Produced by 5 Types of Selected Random Mutant Strains Strain L-threonine (g / L) Batch 1 Batch 2 Batch 3 Average Control Group ATCC13032 0.35 0.37 0.36 0.36 1 ATCC13032::ddh(mt)1 0.38 0.37 0.35 0.37 2 ATCC13032::ddh(mt)2 0.39 0.39 0.37 0.38 3 ATCC13032::dd / 7 (mt)3 0.40 0.39 0.41 0.40 4 ATCC13032::dd / i (mt)4 0.42 0.43 0.42 0.42 5 ATCC13032::dd / ?(mt)5 0.37 0.38 0.37 0.37 Control Group ATCC13032::úddh 0.45 0.41 0.42 0.43 Among the 5 selected types of mutant strains, given that a strain in which the capacity to produce L-lysine is significantly reduced while the capacity to produce L-threonine is improved, the ATCC13032::dó / 7 (mt)4 strain was selected. Example 5: Preparation of ATCC13869 strains in which 5 types of ddh modifications are introduced and evaluation of their threonine and lysine production capacities With regard to the 5 types of modifications confirmed in Example 3 above, in order to finally select the strains in which the L-lysine production capacity is reproducibly reduced while the L-threonine production capacity is increased, wild-type derived strains were prepared in which a modification is introduced. In order to prepare strains in each of which a modified ddh gene is introduced into the ATCC13869 strain of Corynebacterium glutamicum, the vectors prepared in Example 4 (i.e., pDZ::c / d / 7(mt)1 to pDZ::oW / 7(mt)5) were transformed into the Corynebacterium glutamicum ATCC13869 strain by electroporation, and the transformants were subjected to a second cross, and thus strains were obtained in each of which part of the nucleotide sequence of the ddh gene is replaced with one or more modified nucleotides on the chromosome. Whether the substitution was appropriate was determined by mutant allele-specific amplification (MASA) PCR technology (Takeda et al., Hum.Mutation, 2, 112-117 (1993)) using the following primer pairs, wherein in the primer pair SEQ ID NO: 13 and SEQ ID NO: 14, which agrees with the modified sequences, the suitability of the substitution was first determined by selecting the strain to be amplified, and the sequence analysis of the ddh gene of the selected strain was secondarily confirmed by analyzing the modified sequences using the primer pair SEQ ID NO: 13 and SEQ ID NO: 15. The prepared strains, in each of which a modified ddh gene is introduced, were named Corynebacterium glutamicum ATCC13869::oW / 7 (mt)1 for Corynebacterium glutamicum ATO013869 ::ddh (mt)5, respectively. With regard to the five strain types into which five modifications were introduced, in order to ultimately select the strains in which L-lysine production capacity was reproducibly reduced while L-threonine production capacity was increased, a flask culture was performed using the following media. Once the culture was complete, the concentrations of L-lysine and threonine in the culture solution were analyzed using HPLC, and the concentrations of L-lysine and threonine produced in the mutant strains are shown in Tables 7 and 8 below. <Medio de siembra (pH 7.0)> g glucose, 10 g peptone, 5 g yeast extract, 1.5 g urea, 4 g KH2PO4, 8 g K2HPO4, 0.5 g MgSO4-7H2O, 100 pg biotin, 1 mg thiamine HCl, 2 mg calcium pantothenate, 2 mg nicotinamide (per 1 L distilled water)<Medio de producción (pH 7.0)> 100 g glucose, 40 g (NH4)2SO4, 2.5 g soy protein, 5 g corn soaked solids, 3 g urea, 1 g KH2PO4, 0.5 g MgSO4-7H2O, 100 pg biotin, 1 mg thiamine HCl, 2 mg calcium pantothenate, 3 mg nicotinamide, 30 g of CaCOs (per 1 L of distilled water) Table 7. L-lysine concentrations produced by 5 types of randomly selected mutant strains iv 1 oo+u Strain L-lysine (g / L) Glucose Consumption Rate (g / h) Batch 1 Batch 2 Batch 3 Average Control Group ATCC13869 1.21 1.22 1.22 1.22 4.03 1 ATCC13869::00 / 7 (mt)1 1.19 1.19 1.20 1.19 3.98 2 ATCC13869::dd / 7 (mt)2 1.08 1.07 1.10 1.08 3.89 3 ATCC13869::00 / 7 (mt)3 0.88 0.87 0.85 0.87 3.75 4 ATCC13869::00 / 7 (mt)4 0.73 0.77 0.76 0.75 3.68 5 ATCC13869::00 / 7 (mt)5 1.09 1.11 1.12 1.11 3.89 Control Group ATCC13032::4dd / 7 0.71 0.69 0.71 0.70 3.47 Table 8. L-threonine concentrations produced by 5 types of randomly selected mutant strains Strain L-threonine (g / L) Batch 1 Batch 2 Batch 3 Average Control Group ATCC13869 0.25 0.27 0.28 0.27 1 ATCC13869::ddh (mt)1 0.27 0.29 0.27 0.28 2 ATCC13869::ddh(mt)2 0.30 0.31 0.31 0.31 3 ATCC13869::ddh (mt)3 0.35 0.33 0.36 0.35 4 ATCC13869::ddh (mt)4 0.38 0.39 0.38 0.38 5 ATCC13869::ddh(mt)5 0.31 0.29 0.32 0.31 Control Group ATCC13869::2lddh 0.40 0.41 0.39 0.40 Regarding the ATCC13869::2laW / 7 strain, in which ddh is deleted compared to the ATCC13869 strain (i.e., a wild-type strain), it was confirmed that the glucose consumption rate was significantly reduced, thus inhibiting the strain's growth. In contrast, with respect to the five selected strain types, it was confirmed that the amount of L-lysine production was reduced, but the amount of L-threonine production was increased, while the glucose consumption rate remained at a level equivalent to that of the wild-type strain. Among the 5 selected types of mutant strains, given that a strain in which the capacity to produce L-lysine is significantly reduced while the capacity to produce L-threonine is enhanced, the ATCC13032::ddh(mt)4 strain was selected as in Example 4. Example 6: Preparation of strains in which modified ddh is introduced into a microorganism of the genus Corynebacterium that has the capacity to produce L-threonine and evaluation of the capacity to produce L-threonine A strain that produces L-threonine was developed from the wild-type Corynebacterium glutamicum strain ATCC13032. Specifically, to release the feedback inhibition of aspartate kinase (lysC), which acts as the first major enzyme in the L-threonine biosynthesis pathway, amino acid 377 of lysC (i.e., leucine) was substituted with lysine (SEQ ID NO: 16). More specifically, in order to prepare strains in each of which a lysC modification (L377K) was introduced, PCR was performed using chromosomal DNA from Corynebacterium glutamicum ATCC13032 as a template along with a primer pair from SEQ IDs 17 and 18 or a primer pair from SEQ IDs 19 and 20, respectively. PfuUltra™ high-fidelity DNA polymerase (Stratagene) was used as the polymerase for a polymerase reaction (POR). The POR was performed as follows: 28 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 1 minute. As a result of the lysC gene modification, a 515 bp DNA fragment was obtained in the 5' upstream region and a 538 bp DNA fragment in the 3' downstream region, respectively. The polymerase chain reaction (PCR) was performed using the two amplified DNA fragments as templates along with primers SEQ ID NO: 17 and SEQ ID NO: 20. The PCR was performed as follows: denaturation at 95 °C for 5 minutes; 28 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 2 minutes; and polymerization at 72 °C for 5 minutes. IV l OO4U Table 9 SEQ ID NO Sequence (5'->3j SEQ ID NO: 17 TCGAGCTCGGTACCCGCTGCGCAGTGTTGAATAC SEQ ID NO: 18 TGGAAATC lili CGATGTTCACGTTGACAT SEQ ID NO: 19 ATGTCAACGTGAACATCGAAAAGATTTCCA SEQ ID NO: 20 CTCTAGAGGATCCCCGTTCACCTCAGAGACGATT As a result, a 1,023 bp DNA fragment was amplified, which includes a modification of the lysC gene encoding an aspartokinase variant in which amino acid 377 (i.e., leucine) is substituted with lysine. The amplified product was purified using a PCR purification kit (QIAGEN) and used as an insertion DNA fragment for vector preparation. Meanwhile, a pDZ-L377K vector was prepared for the introduction of an L377K modification into the chromosome as follows: the pDZ vector (digested with a Smal restriction enzyme and then heat-treated at 65 °C for 20 minutes) and the insertion DNA fragment (previously amplified by PCR) were combined at a molar (M) ratio of 1:2, and cloning was performed using an infusion cloning kit (TaKaRa) according to the provided manual. The prepared vector was transformed into the ATCC13032 strain by electroporation, and the transformed strain was subjected to a second cross, resulting in a strain in which each nucleotide is substituted with a modified nucleotide on the chromosome. This strain was named CJP1. CJP1 was designated CA01-2307 and deposited at the Korean Center for Culture of Microorganisms (KCCM), which is an international depository authority under the Budapest Treaty, on March 29, 2017, and was assigned accession number KCCM12000P. In order to release the feedback inhibition of homoserine dehydrogenase (hom), which acts as the second major enzyme in the production of L-threonine, amino acid 407 of hom (i.e., arginine) was substituted with histidine (SEQ ID NO: 21). More specifically, in order to prepare strains in each of which a hom modification (R407H) was introduced, PCR was performed using chromosomal DNA from Corynebacterium glutamicum ATCC13032 as a template along with a primer pair from SEQ IDs 22 and 23 or a primer pair from SEQ IDs 24 and 25, respectively. PfuUltra™ high-fidelity DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction. The PCR was performed as follows: 28 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 1 minute. wiA / ai¿v¿i iv i oo+u Table 10 SEQ ID NO Sequence (5'->3j SEQ ID NO: 22 TCGAGCTCGGTACCCCGGATGATGTGTACTGCG SEQ ID NO: 23 GACCACGATCAGATGTGCATCATCATCGCGC SEQ ID NO: 24 GATGATGATGCACATCTGATCGTGGTCACCC SEQ ID NO: 25 CTCTAGAGGATCCCCGAGTCAGCGGGAAATCCG As a result of the hom gene modification, a 533 bp DNA fragment was obtained in the 5' upstream region and a 512 bp DNA fragment in the 3' downstream region, respectively. PCR was performed using the two amplified DNA fragments as templates along with primers SEQ ID NO: 22 and SEQ ID NO: 25. The PCR was performed as follows: denaturation at 95 °C for 5 minutes; 28 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 2 minutes; and polymerization at 72 °C for 5 minutes. As a result, a 1,018 bp DNA fragment was amplified, which includes a modification of the hom gene encoding an aspartokinase variant in which amino acid 407 (i.e., arginine) is substituted with histidine. The amplified product was purified using a PCR purification kit (QIAGEN) and used as an insertion DNA fragment for vector preparation. Meanwhile, a pDZ-R407H vector was prepared for the introduction of an R407H modification into the chromosome as follows: the pDZ vector (digested with Sma restriction enzyme and then heat-treated at 65 °C for 20 minutes) and the insertion DNA fragment (previously amplified by PCR) were combined at a molar (M) ratio of 1:2, and cloning was performed using an infusion cloning kit (TaKaRa) according to the provided manual. The prepared vector was transformed into the CJP1 strain by electroporation, and the transformed strain was subjected to a second cross, resulting in a strain in which each nucleotide is substituted with a modified nucleotide on the chromosome. The strain was designated CA09-0900 (Accession No. KCCM12418P). To clearly confirm the changes in L-threonine and L-lysine production in the previous strain, a T169L modification, which showed the greatest L-threonine production and the greatest reduction in L-lysine production in Examples 5 and 6 with respect to the gene encoding meso-diaminopimelate dehydrogenase (DDH), was introduced. Specifically, to introduce the T169L modification into strain CA09-0900, the pDZ::oW / 7(mt)4 vector prepared in Example 5 was transformed into strain CA09-0900 by electroporation, and the transformed strain was subjected to a second cross in the same manner as in Example 4, thus obtaining a strain in which one nucleotide is substituted with a modified nucleotide on the chromosome. The resulting strain was designated CA09-0904. Strain CA09-0904 was deposited with the Korean Center for Microorganism Culture (KCCM), which is an international deposit authority under the Budapest Treaty, on April 25, 2019, and was assigned accession number KCCM12503P. Table 11. Confirmation of the capabilities of the prepared strains for the production of L-threonine and L-lysine Strain Amino acid (g / L) Thr Lys CA09-0900 1.50 2.67 CA09-0904 2.35 1.58 As a result, the modified strain showed a decrease in L-lysine production of 1.09 g / L and an increase in L-threonine production of 0.85 g / L compared to strain CA09-0900 (control group) (Table 11). Therefore, it was confirmed that Ddh activity was significantly reduced and that the weakening of the L-lysine production pathway was beneficial for L-threonine production. Example 7: Preparation of several strains in which amino acid 169 (i.e., asparagine) of the ddhse gene is replaced with a different amino acid Using the CA09-0904 strain prepared in Example 6, it was confirmed that the strain that reduced L-lysine production has a positive effect on L-threonine production. An attempt was made to confirm whether any substitution of amino acid 169 (i.e., threonine) in the ddh gene with a proteogenic amino acid other than wild-type threonine could increase threonine production. In order to introduce 19 types of heterogeneous nucleotide substitution modifications, including the T169L modification confirmed in Example 6, each recombinant vector was prepared as follows. First, primers (SEQ ID NO: 26 and 27), in which a restriction enzyme recognition site (Xba) was inserted in the 5' and 3' fragments, separated by approximately 600 bp downstream and upstream of nucleotide positions 505 to 506 of the ddh gene, respectively, were synthesized using genomic DNA extracted from the WT strain as a template. To introduce the 19 types of heterogeneous substituted nucleotide modifications, primers (SEQ ID NO: 28 to 65) were synthesized to substitute nucleotides 505 to 506 in the nucleotide sequences of the ddh gene (Table 12). Specifically, the pDZ-cty / 7(T169A) plasmid was prepared such that the DNA fragments (600 bp each) located at the 5' and 3' ends of the ddh gene were ligated to the pDZ vector (Korean Patent No. 2009-0094433). The 5' end gene fragment of the ddh gene was prepared by PCR using chromosomal DNA from the WT strain as a template along with primers from SEQ ID Nos. 26 and 28. The PCR was performed as follows: denaturation at 94 °C for 2 minutes; 30 cycles of denaturation at 94 °C for 1 minute, annealing at 56 °C for 1 minute, and polymerization at 72 °C for 40 seconds; and polymerization at 72 °C for 10 minutes. Additionally, the 3' end gene fragment of the ddh gene was prepared by PCR using primers from SEQ ID NO: 27 and 29. The amplified DNA fragments were purified using a PCR purification kit (Qiagen) and used as insertion DNA fragments for vector preparation. Meanwhile, the PCR-amplified insertion DNA fragments and the pDZ vector, which was digested with a restriction enzyme (Xbal) and then heat-treated at 65 °C for 20 minutes, were ligated using the Infusion Cloning Kit and then transformed into E. coli DH5a. The resulting strain was plated on solid LB medium containing kanamycin (25 mg / L). Transformed colonies in which the target gene was inserted into the vector were selected by PCR using the primers from SEQ ID NO: 26 and 27, and the plasmid was obtained using a conventionally known plasmid extraction procedure and named pDZ-tic / ñ(T169A). Likewise, the plasmids were prepared as follows: the pDZ-cfc / / 7(T169V) using primers (SEQ ID NO: 26 and 30 and SEQ ID NO: 27 and 31); the pDZ-oW / 7(T169Q) using primers (SEQ ID NO: 26 and 32 and SEQ ID NO: 27 and 33); the pDZ-cWñ(T169H) using primers (SEQ ID NO: 26 and 34 and SEQ ID NO: 27 and 35); the pDZ-oW / 7(T169R) using primers (SEQ ID NO: 26 and 36 and SEQ ID NO: 27 and 37); the pDZ-cídñ(T169P) using primers (SEQ ID NO: 26 and 38 and SEQ ID NO: 27 and 39); the pDZ-oWñ(T169L) using primers (SEQ ID NO: 26 and 40 and SEQ ID NO: 27 and 41); the pDZ-oW / 7(T169Y) using primers (SEQ ID NO: 26 and 42 and SEQ ID NO: 27 and 43); the pDZ-cfc / ñ(T169S) using primers (SEQ ID NO: 26 and 44 and SEQ ID NO: 27 and 45); the pDZ-oWñ(T169K) using primers (SEQ ID NO: 26 and 46 and SEQ ID NO: 27 and 47); the pDZ-cW / ?(T169M) using primers (SEQ ID NO: 26 and 48 and SEQ ID NO: 27 and 49); the pDZoWñ(T169l) using primers (SEQ ID NO: 26 and 50 and SEQ ID NO: 27 and 51);the pDZoW / 7(T169E) using primers (SEQ ID NO: 26 and 52 and SEQ ID NO: 27 and 53); the pDZc / c( / 7(T169D) using primers (SEQ ID NO: 26 and 54 and SEQ ID NO: 27 and 55); the pDZddhfjl 69G) using primers (SEQ ID NO: 26 and 56 and SEQ ID NO: 27 and 57); the pDZcfcfñ(T169W) using primers (SEQ ID NO: 26 and 58 and SEQ ID NO: 27 and 59); the pDZddh(T169C) using primers (SEQ ID NO: 26 and 60 and SEQ ID NO: 27 and 61); the pDZddhiyWQF) using primers (SEQ ID NO: 26 and 62 and SEQ ID NO: 27 and 63); and the pDZddhiyi 69N) using primers (SEQ ID NO: 26 and 64 and SEQ ID NO: 27 and 65).; Table 12 SEQ ID NO Sequence (5'->3') SEQ ID NO: 26 CGGGGATCCTCTAGAATGACCAACATCCGCGTAG SEQ ID NO: 27 CAGGTCGACTCTAGATTAGACGTCGCGTGCGATC SEQ ID NO: 28 TCCAGTACGCTCTCCCATCCG AAG ACG CCC SEQ ID NO: 29 GGATGGGAGAGCGTACTGGACTGCCI II IG SEQ ID NO: 30 TCCAGTACGTCCTCCCATCCG AAG ACG CCC SEQ ID NO: 31 GGATGGGAGGACGTACTGGACTGCCI II IG SEQ ID NO: 32 TCCAGTACCAGCTCCCATCCGAAGACGCCC SEQ ID NO: 33 GGATGGGAGCTGGTACTGGACTGCCI II IG SEQ ID NO: 34 TCCAGTACC ACCTCCCATCCG AAG ACG CCC SEQ ID NO: 35 GGATGGGAGGTGGTACTGGACTGCCI II IG SEQ ID NO: 36 TCCAGTACCGACTCCCATCCGAAGACG CCC SEQ ID NO: 37 GGATGGGAGTCGGTACTGGACTGCCI II IG SEQ ID NO: 38 TCCAGTACCCTCTCCCATCCG AAG ACG CCC SEQ ID NO Sequence (5'->3j) SEQ ID NO: 39 GGATGGGAGAGGGTACTGGACTGCCI II IG SEQ ID NO: 40 TCCAGTACTTACTCCC ATCCG AAG ACG CCC SEQ ID NO: 41 GGATGGGAGTAAGTACTGGACTGCCI II IG SEQ ID NO: 42 TCCAGTACTACCTCCCATCCG AAG ACG CCC SEQ ID NO: 43 GGATGGGAGGTAGTACTGGACTGCCI II IG SEQ ID NO: 44 TCCAGTACTCCCTCCCATCCG AAG ACG CCC SEQ ID NO: 45 GGATGGGAGGGAGTACTGGACTGCCI II IG SEQ ID NO: 46 TCCAGTACAAGCTCCCATCCGAAGACGCCC SEQ ID NO: 47 GGATGGGAGCTTGTACTGGACTGCCI II IG SEQ ID NO: 48 TCCAGTACATGCTCCCATCCGAAGACGCCC SEQ ID NO: 49 GGATGGGAGCATGTACTGGACTGCCI II AAG ACG CCC SEQ ID NO: 53 GGATGGGAGTTCGTACTGGACTGCC IIIIG SEQ ID NO: 54 TCCAGTACGATCTCCCATCCG GGATGGGAGACCGTACTGGACTGCC III IG SEQ ID NO: 58 TCCAGTACTGGCTCCCATCCGAAGACGCCC SEQ ID NO: 59GGATGGGAGCCAGTACTGGACTGCCI II IG SEQ ID NO: 60 TCCAGTACTGCCTCCCATCCGAAGACGCCC SEQ ID NO: 61 GGATGGGAGGGAGTACTGGACTGCC III IG SEQ ID NO: 62 TCCAGTACTTCCTCCCATCCG AAG ACG CCC SEQ ID NO: 63 GGATGGGAGGAAGTACTGGACTGCCI II IG SEQ ID NO: 64 TCCAGTACAAGCTCCCATCCGAAGACGCCC SEQ ID NO: 65 GGATGGGAGGTTGTACTGGACTGCCI II IG IV l OO4U Some of the vectors have previously been transformed into the CEPA CA09-0901 mediate electroporation. Last 19 days, some of the other devices that introduce us to the modification of the nuclear heterogenous system in the generation of DDH se denominaron of the siguiente manera: 5 CA09-0900::ód / 7(T169A), CA09-0900::oW?(T169V), CA09-0900::dóh(T169Q), CA090900::dóh(T169H), CA09-0900::óh(T169R), CA09-0900::cfc / h(T169P), CA090900::dd / 7(T169L), CA09-0900::cW169Y), CA09-0900::aW / t(T169S),CA090900::ddh(T169K), CA09-0900::ddh(T169M), ΟΑΟ9-Ο9ΟΟ::α0Λ(Τ169Ι), CA09-0900::cW / ?(T169E), CA09-0900::ddh(T169D), CA09-0900::c / c / h(T169G), CA09-0900::oW / 7(T169W), CA0937 0900::d¿ / h(T169C), CA09-0900::oW / 7(T169F) and CA09-0900::oWh(T169N). The ddh gene in strain CA09-0900 was deleted using the procedure in Example 2, and the resulting strain was named CA09-0900::Zldd / 7. Strains CA09-0900 and CA09-0900Zlc / d / 7 were used as control groups, and the 19 selected strain types were cultured using the procedure shown below, and lysine and threonine concentrations and their glucose consumption rates were measured. Table 13. Measurements of lysine production capacity, threonine production capacity, and glucose consumption rates IV l OO4U Strain Conc. of Thr (g / L) Conc. of Lys (g / L) Glucose Consumption Rate (g / h) CA09-0901 1.43 2.75 4.53 CA09-0900::AcW / 7 2.67 1.38 2.41 CA09-0900::cW / ?(T169A) CA09-0900::cfc / / 7(T169V) 1.43 2.58 3.89 CA09-0900::ct / / 7(T169Q) 1.38 2.62 3.91 CA09-0900::íW(T169H) 1.67 2.34 .23. CA09-0900::oW / 7(T169R) 1.72 2.41 2.44 CA09-0900::oWh(T169P) 1.81 2.25 3.16 CA09-0900::ddh(T169L) 2.48 1.72 3.92. CA09-0900::dd / ?(T169Y) 1.50 2.66 4.51 CA09-0900::ct / h(T169S) 1.62 2.33 4.28 CA09-0900:: <W169K) 1.91 1.50 2.22 CA09-0900::cW / 7(T169M) 1.02 1.75 2.38 CA09-0900::cW / 7(T169I) 1.97 1.68 3.08 CA09-0900::oWh(T169E) 1.54 1.66 2.59 CA09-0900::cW / 7(T169D) 1.99 1.87 3.65 CA09-0900::dd / ?(T169G) 1.42 2.61 4.07 CA09-0900::ddh(T169W) 1.53 2.58 3.99 CA09-0900::cfc / h(T169C) 1.91 1.74 3.78 CA09-0900::cWh(T169F) 1.80 1.18 4.03 CA09-0900::cW / 7(T169N) 1.44 2.77 4.35 In the strain with the ddh gene deleted, threonine concentration increased by 1.24 g / L and lysine concentration decreased by 1.37 g / L compared to the parental strain. Given that glucose was reduced by 46.1% of the parent strain, in cases where there is no DDH activity due to the ddh gene deletion, strain growth is inhibited, although THR production increases and LYS production decreases, thus hindering the strain's industrial use. In strains containing a modified polypeptide, where amino acid 169 of SEQ ID NO: 1 is substituted with a different amino acid, LYS production decreased and THR production increased, while strain growth remained at a level applicable to industry.In other words, it was confirmed that when the ddh gene is weakened, it helps increase THR production while LYS production decreases, and the ddh gene is weakened due to the change at amino acid 169 of SEQ ID NO: 1 (Table 13). Furthermore, regarding the modification at amino acid 169, the modification in which threonine is replaced with lysine results in a significant reduction in lysine production and an increase in THR production and glucose uptake at a commercially available level, and was therefore determined to be more effective. Example 8: Preparation and evaluation of strains in which modified ddh and modified dapB are introduced into a strain of microorganisms of the genus Corynebacterium that has the capacity to produce L-threonine Starting with the CA09-0904 strain prepared in Example 6, it was confirmed that the strain in which L-lysine production is reduced has a positive effect on L-threonine production. In order to confirm whether L-threonine production capacity can be further enhanced by further weakening of the L-lysine biosynthesis pathway in the above strain, additional strains were developed. Specifically, in order to weaken the activity of the enzyme involved in the second reaction of the L-lysine biosynthesis pathway (i.e., 4-hydroxy-tetrahydrodipicolinate reductase (dapB)), the 13th amino acid of dapB (i.e., arginine) was replaced with asparagine (SEQ ID NO: 66). More specifically, to prepare strains incorporating the dapB(R13N) modification, PCR was performed using chromosomal DNA from strain ATCC13032 as a template, along with a primer pair from SEQ IDs 67 and 68 or a primer pair from SEQ IDs 69 and 70, respectively. PfuUltra™ high-fidelity DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction. The PCR was performed as follows: 28 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 1 minute. As a result of the dapB gene modification, a 512 bp DNA fragment was obtained in the 5' upstream region and a 514 bp DNA fragment in the 3' downstream region, respectively. PCR was performed using the two amplified DNA fragments as templates along with primers SEQ ID NO: 67 and SEQ ID NO: 70. IV l OO4U PCR was performed as follows: denaturation at 95 °C for 5 minutes; 28 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds and polymerization at 72 °C for 2 minutes; and polymerization at 72 °C for 5 minutes. As a result, a 1,001 bp DNA fragment was amplified, which includes a modification of the dapB gene encoding a variant of 4-hydroxytetrahydrodipicolinate reductase in which amino acid 13 (i.e., arginine) is substituted with asparagine. The amplified product was purified using a PCR purification kit (QIAGEN) and used as an insertion DNA fragment for vector preparation. Meanwhile, a pDZ-R13N vector was prepared for the introduction of an R13N modification into the chromosome as follows: the pDZ vector (which was digested with a Sma restriction enzyme and then heat-treated at 65 °C for 20 minutes) and the insertion DNA fragment (which was amplified by PCR above) were combined in a molar concentration (M) ratio of 1:2, and cloning was performed using an infusion cloning kit (TaKaRa) according to the handbook provided. The prepared vector was transformed into strain CA09-0904 by electroporation, and the transformed strain was subjected to a second cross, resulting in a strain in which each nucleotide is substituted with a modified nucleotide on the chromosome. The strain was named CA09-0904-R13N. Table 14. Confirmation of the capabilities of the prepared strains for the production of L-threonine and L-lysine Amino acid strain (g / L) MA / a / ZUZI / U1 DO4U Strain Amino acid (g / L) Thr Lys CA09-0900 1.52 2.70 CA09-0904 2.41 1.53 CA09-0904-R13N 3.03 1.08 As a result, the modified strain showed a decrease in L-lysine production of 1.62 g / L and an increase in L-threonine production of 1.51 g / L compared to strain CA09-0900 (control group), while it showed a decrease in L-lysine production of 0.48 g / L and an increase in L-threonine production of 0.62 g / L compared to strain CA09-0904 (Table 14). Therefore, it was confirmed that weakening the L-lysine production pathway was beneficial for L-threonine production. Example 9: Preparation and evaluation of strains in which modified ddh and modified lysA are introduced into a strain of microorganisms of the genus Corynebacterium that has the capacity to produce L-threonine Starting with the CA09-0904 strain prepared in Example 6, it was confirmed that the strain in which L-lysine production is reduced has a positive effect on L-threonine production. In order to confirm whether L-threonine production capacity can be further enhanced by further weakening of the L-lysine biosynthesis pathway in the above strain, additional strains were developed. Specifically, in order to weaken the activity of the enzyme involved in the final reaction of the L-lysine biosynthesis pathway (i.e., diaminopimelate decarboxylase (lysA)), amino acid 408 of lysA (i.e., methionine) was substituted with alanine (Biochemical and Biophysical Research Communications, Volume 495, Number 2, January 8, 2018) (SEQ ID NO: 71). More specifically, in order to prepare strains into which the / ysA(M408A) modification is introduced, PCR was performed using chromosomal DNA from strain ATCC13032 as a template along with a primer pair from SEQ IDs 72 and 73 or a primer pair from SEQ IDs 74 and 75, respectively. PfuUltra™ high-fidelity DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction. The PCR was performed as follows: 28 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 1 minute. As a result of the lysA gene modification, a 534 bp DNA fragment was obtained in the 5' upstream region and a 527 bp DNA fragment in the 3' downstream region. PCR was performed using the two amplified DNA fragments as templates along with primers SEQ ID NO: 72 and SEQ ID NO: 75. The PCR was performed as follows: denaturation at 95 °C for 5 minutes; 28 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 2 minutes; and polymerization at 72 °C for 5 minutes. Table 15 SEQ ID NO Sequence (5'->3j SEQ ID NO: 72 TCGAGCTCGGTACCCGTTGGGCCTGTACTCACAG SEQ ID NO: 73 TAGCGGGAGCTCGCGGCGTAGCAGTATGCGCC SEQ ID NO: 74 TACTGCTACGCCGCGAGCTCCCGCTACAACGC SEQ ID NO: 75 CTCTAGAGGATCCCGTGCAAGGTGAACCAACTG As a result, a 1,035 bp DNA fragment was amplified, which includes a modification of the lysA gene encoding a diaminopimelate decarboxylase variant in which amino acid 408 (i.e., methionine) is substituted with alanine. The amplified product was purified using a PCR purification kit (QIAGEN) and used as an insertion DNA fragment for vector preparation. Meanwhile, a pDZM408A vector was prepared for the introduction of an M408A modification into the chromosome as follows: the pDZ vector (which was digested with a Sma restriction enzyme and then heat-treated at 65°C for 20 minutes) and the insertion DNA fragment (which was amplified by PCR above) were combined in a molar concentration (M) ratio of 1:2, and cloning was performed using an infusion cloning kit (TaKaRa) according to the handbook provided. The prepared vector was transformed into strain CA09-0904 by electroporation, and the transformed strain was subjected to a second cross, resulting in a strain in which each nucleotide is substituted with a modified nucleotide on the chromosome. The strain was named CA09-0904-M408A. Table 16. Confirmation of the capabilities of the prepared strains for the production of L-threonine and L-lysine / U1 004U Strain Amino acid (g / L) Thr Lys CA09-0900 1.61 2.51 CA09-0904 2.63 1.52 CA09-0904-M408A 3.08 1.10 As a result, the modified strain showed a decrease in L-lysine production of 1.41 g / L and an increase in L-threonine production of 1.33 g / L compared to strain CA09-0900 (control group), while it showed a decrease in L-lysine production of 0.42 g / L and an increase in L-threonine production of 0.35 g / L compared to strain CA09-0904 (Table 16). Therefore, it was confirmed that weakening the L-lysine production pathway was beneficial for L-threonine production. Example 10: Preparation and evaluation of strains in which modified ddh and modified dapA are introduced into a strain of microorganisms of the genus Corynebacterium that has the capacity to produce L-threonine Starting with the CA09-0904 strain prepared in Example 6, it was confirmed that the strain in which L-lysine production is reduced has a positive effect on L-threonine production. To confirm whether L-threonine production capacity can be further enhanced by further weakening of the L-lysine biosynthesis pathway in the above strain, additional strains were developed. Specifically, in order to weaken the activity of the enzyme involved in the second reaction of the L-lysine biosynthesis pathway (i.e., 4-hydroxy-tetrahydrodipicolinate synthase (dapA)), amino acid 119 of dapA (i.e., tyrosine) was substituted with phenylalanine (Journal of Molecular Biology, Volume 338, Number 2, April 23, 2004) (SEQ ID NO: 76). More specifically, to prepare strains into which the dap / t(Y119F) modification is introduced, PCR was performed using chromosomal DNA from strain ATCC13032 as a template, along with a primer pair from SEQ IDs 77 and 78 or a primer pair from SEQ IDs 79 and 80, respectively. PfuUltra™ high-fidelity DNA polymerase (Stratagene) was used as the polymerase for the PCR reaction. The PCR was performed as follows: 28 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 1 minute. As a result of the dapA gene modification, a 538 bp DNA fragment was obtained in the 5' upstream region and a 528 bp DNA fragment in the 3' downstream region, respectively. PCR was performed using the two amplified DNA fragments as templates along with primers SEQ ID NO: 77 and SEQ ID NO: 80. The PCR was performed as follows: denaturation at 95 °C for 5 minutes; 28 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 2 minutes; and polymerization at 72 °C for 5 minutes. WlA / ai¿V¿l IV l OO4U Table 17 SEQ ID NO Sequence (5'->3j SEQ ID NO: 77 TCGAGCTCGGTACCCTTCATATAGTTAAGACAAC SEQ ID NO: 78 CGGCTTGGAGAAATAAGGAGTTACAACTAAAAG SEQ ID NO: 79 TAACTCCTTATTTCTCCAAGCCGAGCCAAGAG SEQ ID NO: 80 CTCTAGAGGATCCCGAGCCTCAAGTTCCTGCTC As a result, a 1,000 bp DNA fragment was amplified, which includes a modification of the dapA gene encoding a variant of 4-hydroxytetrahydrodipicolinate synthase in which amino acid 119 (i.e., tyrosine) is substituted with phenylalanine. The amplified product was purified using a PCR purification kit (QIAGEN) and used as an insertion DNA fragment for vector preparation. Meanwhile, a pDZ-Y119F vector was prepared for the introduction of a dapA(Y119F) modification into the chromosome as follows: the pDZ vector (which was digested with a Smal restriction enzyme and then subjected to heat treatment at 65 °C for 20 minutes) and the insertion DNA fragment (which was amplified by PCR above) were combined in a molar concentration ratio of 1:2, and cloning was performed using an infusion cloning kit (TaKaRa) according to the handbook provided. The prepared vector was transformed into strain CA09-0904 by electroporation, and the transformed strain was subjected to a second cross, resulting in a strain in which each nucleotide is substituted with a modified nucleotide on the chromosome. The strain was named CA09-0904-Y119F. Table 18. Confirmation of the capabilities of the prepared strains for the production of L-threonine and L-lysine Strain Amino acid (g / L) Thr Lys CA09-0900 1.48 2.68 CA09-0904 2.52 1.57 CA09-0904-Y119F 3.31 0.82 As a result, the modified strain showed a decrease in L-lysine production of 1.86 g / L and an increase in L-threonine production of 1.83 g / L compared to strain CA09-0900 (control group), while showing a decrease in L-lysine production of 0.75 g / L and an increase in L-threonine production of 0.79 g / L compared to strain CA09-0904 (Table 18). Therefore, it was confirmed that weakening the L-lysine production pathway was beneficial for L-threonine production. The above results suggest that a strain that includes a modified meso-diaminopimelate dehydrogenase polypeptide, in which amino acid 169 in the amino acid sequence of SEQ ID NO: 1 of the present disclosure is substituted with leucine, phenylalanine, glutamate, or cysteine, eventually has an enhanced capacity to produce L-threonine through a decrease in the amount of L-lysine production and an increase in the amount of L-threonine production, compared to unmodified strains. Based on the foregoing, a person skilled in the art to which this disclosure pertains will understand that this disclosure may be incorporated into other specific forms without altering the technical concepts or essential characteristics of this disclosure. In this respect, the exemplary embodiments described in this specification are for illustrative purposes only and should not be interpreted as limiting the scope of this disclosure. On the contrary, this disclosure is intended to cover not only the exemplary embodiments but also various alternatives, modifications, equivalents, and other embodiments that may fall within the spirit and scope of this disclosure as defined in the appended claims.

Claims

1. A modified polypeptide, characterized in that the amino acid corresponding to amino acid 169 of SEQ ID NO: 1 is substituted with leucine, phenylalanine, glutamate or cysteine, and having a sequence homology with the amino acid sequence of SEQ ID NO: 1 of 80% or more and less than 100%, and having meso-diaminopimelate dehydrogenase activity.

2. The modified polypeptide according to claim 1, characterized in that the meso-diaminopimelate dehydrogenase activity of the modified polypeptide is weaker than the wild-type meso-diaminopimelate dehydrogenase activity having the amino acid sequence of SEQ ID NO:

1.

3. A polynucleotide, characterized in that it encodes the modified polypeptide of claim 1.

4. The polynucleotide according to claim 3, characterized in that the polynucleotide consists of a nucleotide sequence of SEQ ID NO:

4.

5. A microorganism of the genus Corynebacterium, characterized in that it comprises: a modified polypeptide, wherein the amino acid corresponding to amino acid 169 of SEQ ID NO: 1 is substituted with leucine, phenylalanine, glutamate or cysteine, and having sequence homology with the amino acid sequence of SEQ ID NO: 1 of 80% or more and less than 100%, and having meso-diaminopimelate dehydrogenase activity; or a polynucleotide comprising the same.

6. The microorganism according to claim 5, characterized in that the microorganism of the genus Corynebacterium further comprises one or more selected from the modified polypeptides from (1) to (3) shown below: (i) a modified polypeptide, wherein the activity of dihydrodipicolinate reductase (dapB) is weakened; (ii) a modified polypeptide, wherein the activity of diaminopimelate decarboxylase (lysA) is weakened; and (iii) a modified polypeptide, wherein the activity of dihydrodipicolinate synthase (dapA) is weakened.

7. The microorganism according to claim 6, characterized in that the modified polypeptide comprises one or more selected from the modified polypeptides (1) to (3) shown below: (i) a modified dihydrodipicolinate reductase (dapB) polypeptide, wherein amino acid 13 of the amino acid sequence of SEQ ID NO: 81, arginine (R), is substituted with asparagine (N); (ii) a modified diaminopimelate decarboxylase (lysA) polypeptide, wherein amino acid 408 in the amino acid sequence of SEQ ID NO: 82, methionine (M), is substituted with alanine (A); and (ii) a modified dihydrodipicolinate synthase (dapA) polypeptide, wherein amino acid 119 in the amino acid sequence of SEQ ID NO: 83, tyrosine (T), is substituted with phenylalanine (F).

8. The microorganism according to claim 5, characterized in that the microorganism has an improved L-threonine production capacity compared to an unmodified strain.

9. The microorganism according to claim 5, characterized in that the microorganism is Corynebacterium glutamicum.

10. A process for preparing L-threonine, characterized in that it comprises a culture step in a medium of a microorganism of the genus Corynebacterium comprising a modified polypeptide, wherein the amino acid corresponding to amino acid 169 of SEQ ID NO: 1 is substituted with leucine, phenylalanine, glutamate or cysteine, and having sequence homology with the amino acid sequence of SEQ ID NO: 1 of 80% or more and less than 100%, and having mesodiaminopimelate dehydrogenase activity.

11. The process according to claim 10, characterized in that the microorganism cultivation step further comprises a step of recovering L-threonine from the culture medium and the microorganism.