NEW PEPTIDE AND ITS USE

MX431753BActive Publication Date: 2026-02-25ENSOL BIOSCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
MX2021010552
Authority / Receiving Office
MX · MX
Patent Type
Patents
Current Assignee / Owner
Priority Date
2019-03-13
Filing Date
2021-09-02
Publication Date
2026-02-25
Estimated Expiration
2040-03-05

AI Technical Summary

Technical Problem

Current treatments for type 1 diabetes and insulitis, caused by lymphocytic infiltration of pancreatic islets, are inadequate in effectively inhibiting cytokine expression and preventing the destruction of pancreatic β cells.

Method used

A novel peptide with the amino acid sequence YGAGAGAGY or its pharmaceutically acceptable salts, which inhibits IFN-γ and TNF-α expression while inducing TGF-β1 expression, is administered to treat or prevent insulitis and type 1 diabetes.

Benefits of technology

The peptide effectively reduces insulitis development, lowers blood glucose levels, and prevents type 1 diabetes by inhibiting harmful cytokines and promoting protective cytokines, demonstrating therapeutic and prophylactic effects.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present invention relates to a peptide consisting of the amino acid sequence SEQ ID NO: 1 or a pharmaceutically acceptable salt thereof, and to the use thereof. The present invention is capable of effectively treating or preventing insulitis. Furthermore, the present invention is capable of effectively treating or preventing type 1 diabetes.
Need to check novelty before this filing date? Find Prior Art

Description

NEW PEPTIDE AND ITS USE Field of invention The present invention relates to a novel peptide, and more particularly to a novel peptide and its use. Background of the invention Lymphocytic infiltration of the pancreatic islet is called insulitis. Insulitis eventually destroys the insulin-secreting pancreatic β cells, leading to type 1 diabetes (T1D) {Lennon GP, ​​Bettini M, Burton AR, Vincent E, Amold PY, Santamaría P, Vignali DA. T cell islet accumulation in type 1 diabetes is a tightly regulated, cell-autonomous event. Immunity. October 16, 2009; 31(4):643-53, etc.}. Furthermore, it has been reported that type 1 diabetes can be alleviated by protecting the pancreas from insulitis {Norman Ende, Ruifeng Chen, Alluru S. Reddi. Effect of human umbilical cord blood cells on glycemia and insulitis in type 1 diabetic mice.} Biochemical and Biophysical Research Communications 325 (2004) 665-669, etc.}. Several cytokines, such as IFN-γ (interferon-gamma), TNF-α (tumor necrosis factor-alpha), and TGF-βI (transforming growth factor-beta-1), are known to be involved in the development and suppression of insulitis. Insulitis is known to be caused by IFN-γ {von Herrath MG, Oldstone MB. Interferon-γ is Essential for Destruction of β Cells and Development of Insulin-dependent Diabetes Mellitus. J. Exp Med. February 3, 1997; 185(3):531-9, etc.}, and also by TNF-α {Kyoungho Suk, Sunshin Kim, Yun-Hcc Kim, Kyoung-Ah Kim, Inik Chang, Hi dco Yagita, Minho Shong, Myung-Shik Lee.} IFN-y / TNF-α Synergism as the Final Effector in Autoimmune Diabetes: A Key Role for STAT1 / IFN Regulatory Factor-1 Pathway in Pancreatic β Cell Death. Immunol. April 1, 2001, 166 (7) 4481-4489, etc.}.Meanwhile, increased expression of TGF-βI has been reported to protect non-obese diabetic (NOD) mice from insulitis {Piccirillo CA, Chang Y, Prud'homme GJ. TGF-βI Somatic Gene Therapy Prevents Autoimmune Disease in Nonobese Diabetic Mice J. Immunol. October 15, 1998; 161(8): 3950-6, etc.}. Therefore, it is necessary to develop a material that has an effect on insulitis. List of appointments Non-Patent Literature (Non-Patent Document 1) Eennon GP, ​​Bettini M, Burton AR, Vincent E, Arnold PY, Santamaría P, Vignali DA. T cell islet accumulation in type 1 diabetes is a tightly regulated, cellautonomous event. Immunity. October 16, 2009; 31 (4): 643-53. (Patent unrelated document 2) Norman Ende, Ruifeng Chen, Alluru S. Reddi. Effect of human umbilical cord blood cells on glycemia and insulitis in type 1 diabetic mice. Biochemical and zccnLn / Lznz / E / Yi Biophysical Research Communications 325 (2004) 665-669. (Patent unrelated document 3) von Herrath MG, Oldstone MB. Interferon-γ Is Essential for Destruction of β Cells and Development of Insulin-dependent Diabetes Mellitus. J. Exp. Med. 3 February 1997; 185(3):531-9. (Patent unrelated document 4) Kyoungho Suk, Sunshin Kim, Yun-Hee Kim, Kyoung-Ah Kim, Inik Chang, Hid eo Yagita, Minho Shong, Myung-Shik Lee. IFN-y / TNF-a Synergism as the Final Effector in Autoimmune Diabetes: A Key Role for STAT1 / IFN Regulatory Factor-1 Pathway in Pancreatic β Cell Death. J. Immunol. 1 April 2001, 166 (7) 4481-4489. (Document not related to patent 5) Piccirillo CA, Chang Y, Prud'homme GJ. TGF-βI Somatic Gene Therapy Prevents Autoimmune Disease in Nonobese Diabetic Patients. J. Immunol. October 15, 1998; 161(8): 3950-6. Disclosure of the invention Technical problem An objective of the present invention is to provide a novel peptide. Another objective of the present invention is to provide a novel use of the peptide of the present invention. The objectives of the present invention are not limited to the foregoing, and those skilled in the art will clearly understand other objectives not mentioned herein from the following description. Solution to the problem The present invention provides a peptide consisting of the amino acid sequence SEQ ID NO: 1 (YGAGAGAGY) or a pharmaceutically acceptable salt thereof. In the amino acid sequence, Y represents tyrosine (Tyr), G represents glycine (Gly), and A represents alanine (Ala). The amino acids that constitute the peptide include L, D, and DL forms, all of which are incorporated into the amino acids of the peptide of the present invention. Furthermore, it will be evident that Y can be interpreted to mean that it includes 4-hydroxyphenylalanine, as well as tyrosine, as the amino acid. The peptide includes variants thereof in which a portion of the peptide structure according to the present invention is varied by natural mutation or artificial mutation without changing the main activity thereof. Examples of pharmaceutically acceptable salts may include hydrochloride, sulfate, phosphate, acetate, citrate, tartrate, succinate, lactate, maleate, fumarate, oxalate, methanesulfonate, paratoluenesulfonate, sodium salt, potassium salt, calcium salt, and the like. zccnLn / Lznz / E / Yi Furthermore, the present invention provides for the use of the peptide or a pharmaceutically acceptable salt thereof according to the present invention, and preferably for the use thereof for the treatment or prevention of insulitis. Herein, the term "treatment" means comprehensively the reduction or relief of symptoms, and the term "prevention" is used with a comprehensive meaning that includes inhibiting the progression of a disease from an asymptomatic stage prior to the expression of symptoms. Treatment or prevention may be due to at least one selected from inhibition of IFN-γ (interferon-gamma) expression, inhibition of TNF-α (tumor necrosis factor alpha) expression, and induction of TGF-βI (transforming growth factor beta-1) expression. Inhibition of IFN-γ expression may be due to the inhibition of IFNγ mRNA expression. Inhibition of TNF-α expression may be due to the inhibition of TNFα mRNA expression. The induction of TGF-βI expression may be the induction of TGF-βI mRNA expression. Furthermore, the present invention provides for the use of the peptide or a pharmaceutically acceptable salt thereof according to the present invention, and preferably the use thereof for the treatment or prevention of type 1 diabetes (T1D). Type 1 diabetes can be caused by insulitis. Treatment or prevention may be due to at least one selected from either inhibiting the development of insulitis or reducing it. Treatment or prevention may be due to a reduction in blood glucose. The reduction in blood glucose may be due to at least one selected from the inhibition of insulitis development and its reduction. Furthermore, the present invention provides a composition for the treatment or prevention of insulitis comprising the peptide or a pharmaceutically acceptable salt thereof according to the present invention. Additionally, the present invention provides a composition for the treatment or prevention of type 1 diabetes comprising the peptide or a pharmaceutically acceptable salt thereof according to the present invention. The composition may be a pharmaceutical composition. The composition may comprise, as an active ingredient, the peptide or the pharmaceutically acceptable salt thereof according to the present invention. The composition further comprises a pharmaceutically acceptable additive and may consist of the peptide or the pharmaceutically acceptable salt thereof according to the present invention and the pharmaceutically acceptable additive. zccnLn / Lznz / E / Yi The peptide of the present invention can be prepared by methods typically used in the field of peptide chemistry. For example, the peptide can be prepared with reference to widely known literature on the subject, or by a method such as solution-phase synthesis or solid-phase synthesis. Examples of the process for forming a peptide bond may include an acyl azide method, an acyl halide method, an acyl imidazole method, a carbodiimide method, a phosphonium method, an anhydride method, a mixed anhydride method, an oxidation-reduction method, and the use of Woodward's reagent K. Before the condensation reaction, a carboxyl group, an amino group or the like, which does not participate in the reaction, can be protected, and a carboxyl group that participates in the condensation reaction can be activated by methods known in the field. Examples of functional groups to protect the carboxyl group may include ester-forming groups such as methyl, tere-butyl, aryl, pentafluorophenyl, benzyl, para-methoxybenzyl, and methoxyethoxymethyl. Examples of functional groups to protect the amino group may include trityl carbonyl, aryloxycarbonyl, cyclohexyloxycarbonyl, trichloroethyloxycarbonyl, benzyloxycarbonyl, tert-butoxycarbonyl and / or 9-fluorenylmethyloxycarbonyl. Examples of the active form of the carboxyl group may include a mixed anhydride, azide, acyl chloride, and active ester [ester with alcohol (e.g., pentachlorophenol, 2,4-dinitrophenol, cyanomctyl alcohol, p-nitrophenol, N-hydroxy-5-norbomcno-2,3-dicarboximide, N-hydroxysuccinimide, N-hydroxyphthalimide, or 1-hydroxybenzotriazole)]. Solvents that can be used in the condensation reaction to form a peptide bond may include benzene, toluene, hexane, acetone, nitromethane, cyclohexane, ether, chloroform, dichloromethane, ethyl acetate, N,N-dimethylformamide, dimethyl sulfoxide, pyridine, dioxane, tetrahydrofuran, water, methanol, and ethanol, which can be used alone or in combination. The reaction temperature can fall in the range of approximately -70°C to 100°C, which is typically applied in the reaction, and preferably falls in the range of -30°C to 30°C. The deprotection reaction to remove the protecting group from the peptide can be carried out using an acid compound, a base compound, or a transition metal, capable of removing the protecting group without influencing the peptide bond, depending on the type of protecting group. The deprotection reaction can be carried out by acid treatment using, for example, hydrogen chloride, hydrogen bromide, hydrogen fluoride, acetic acid, methanesulfonic acid, trifluoromethanesulfonic acid, trifluoroacetic acid, trimethylchlorosilane or mixtures thereof. When the deprotection reaction is carried out by acid treatment, it can be promoted by adding an adjuvant such as anisole, phenol, or thioanisole. Alternatively, the deprotection reaction can be carried out through a base treatment using, for example, ammonia, diethylamine, hydrazine, morpholine, N-methylpyrrolidine, piperidine, sodium carbonate, or mixtures thereof. Alternatively, the deprotection reaction can be carried out by treatment with transition metals using, for example, zinc, mercury, palladium / hydrogen, etc. Once the reaction is complete, the peptide can be purified using a typical peptide purification process, such as extraction, layer separation, solid precipitation, recrystallization, or column chromatography. Furthermore, the peptide according to the present invention can be converted into a variant thereof or a pharmaceutically acceptable salt thereof using a typical process. The peptide according to the present invention can be synthesized using an automated peptide synthesizer or can be produced by genetic manipulation. For example, a fusion gene encoding a fusion protein comprising a fusion partner and the peptide according to the present invention is manufactured by genetic manipulation and then used to transform a host microorganism, and the fusion protein is expressed in the host microorganism, after which the peptide according to the present invention is cleaved or separated from the fusion protein using an enzyme or proteolytic compound, thereby producing a desired peptide. The peptide or a pharmaceutically acceptable salt thereof according to the present invention is administered parenterally in an amount of 24.3 mg / day to 4860 mg / day, and preferably from 48.6 mg / day to 2430 mg / day. Following oral administration, the amount is 5 to 10 times the amount following parenteral administration. Administration may be once daily or several times daily, and the amount may be based on an adult (weighing 60 kg), but may vary according to weight, body condition, and other factors. The peptide or a pharmaceutically acceptable salt thereof according to the present invention may be administered primarily by parenteral routes, for example, intravenous injection, subcutaneous injection, intraspinal administration, transdermal administration, transnasal administration, or intrarectal administration. In some cases, oral administration is possible. The peptide or the pharmaceutically acceptable salt thereof, or the composition according to the present invention, may be formulated, together with a pharmaceutically acceptable additive, in an injection, a suppository, a powder, a nasal drop, a granule, a tablet, or a transdenal patch. The pharmaceutically acceptable additive can be applied depending on a variety of factors well known to those skilled in the art, including, for example, a specific bioactive material, its concentration, stability, and intended bioavailability; disorders and diseases to be treated or conditions associated with them; individuals to be treated, their age, size, and general health status; and routes of administration of the composition, for example, nasal, oral, ocular, topical, transdermal, and intramuscular, but the present invention is not limited to these. The pharmaceutically acceptable additive, used for the administration of the bioactive material, in addition to the oral route of administration, may include an aqueous solution comprising D5W (5% glucose in water), dextrose, and a physiological salt in an amount within 5% of the volume thereof.For topical intralesional injection, any injectable hydrogel may be used to enhance the therapeutic effects and increase their duration. Furthermore, the pharmaceutically acceptable additive may comprise additional components to improve the stability of effective components, such as preservatives and antioxidants. The peptide or pharmaceutically acceptable salt thereof, or the composition according to the present invention, may be formulated using appropriate methods in the related field, and preferably formulated to be suitable for each disease or component with reference to widely known literature regarding formulation methods in the field. The peptide of the present invention can be stored in a saline solution, or it can be lyophilized in an ampoule after the addition of mannitol or sorbitol, and can be administered after dissolution in saline solution. Furthermore, the present invention provides a method for treating or preventing insulitis, including administering the peptide or a pharmaceutically acceptable salt thereof according to the present invention to a mammal, including a human, in need of such administration. In addition, the present invention provides a method for treating or preventing type 1 diabetes, including administering the peptide or a pharmaceutically acceptable salt thereof according to the present invention to a mammal, including a human, in need of such administration. Furthermore, the present invention provides for the use of the peptide or a pharmaceutically acceptable salt thereof according to the present invention for the manufacture of a medicament for the treatment or prevention of insulitis.Furthermore, the present invention provides for the use of the peptide or a pharmaceutically acceptable salt thereof according to the present invention for the manufacture of a medicament for the treatment or prevention of type 1 diabetes. The administered peptide or pharmaceutically acceptable salt thereof may be a peptide or a pharmaceutically acceptable salt thereof in an effective amount. Unless otherwise stated, the matters described in relation to the peptide or the pharmaceutically acceptable salt thereof, as well as the use, composition, and method according to the present invention, apply equally to each other within the same scope unless they are contradictory to each other. zccnLn / Lznz / E / Yi Advantageous effects of the invention According to the present invention, insulitis can be effectively treated or prevented. Furthermore, according to the present invention, type 1 diabetes can be treated effectively. or prevent zccnLn / Lznz / E / Yi Brief description of the drawings Figure 1 is a graph showing the results of example 1 on the inhibition or reduction of the development of insulitis; Figure 2 is a graph showing the results of example 1 on the reduction of blood glucose levels; Figure 3 is a graph showing the results of the analysis of example 1 on the inhibition of IFN-γ expression and TNF-α expression; Figure 4 is a graph showing the results of the analysis of the effect of the peptide from example 1 on the induction of TGF-βI expression; Figure 5 is a graph showing the results of the analysis of the effects of the peptides from comparative example 1 and comparative example 2 on the inhibition of IFN-γ expression and TNF-α expression; and Figure 6 is a graph showing the results of the analysis of the effects of the peptides from comparative example 1 and comparative example 2 on the induction of TGF-βI expression. Mode of the invention A better understanding of the present invention is provided through the following examples, comparative examples, and preparation examples, wherein the examples and preparation examples are set forth simply to illustrate the present invention, but should not be construed as limiting the scope of the present invention. The reagents used in the following and similar examples are commercially available and high-quality products, and are purchased from Sigma-Aldrich, unless otherwise stated. Example 1 - Peptide Preparation The peptide shown in Table 1 below was prepared using a solid-phase peptide synthesis method. Specifically, the peptide was synthesized using a solid-phase method based on the chemical properties of Fmoc (9-fluorenyl-methoxycarbonyl). More specifically, 0.55 mmol / g of a solid resin (Wang resin; Sigma-Aldrich), 5 mL of dimethylformamide (DMF), 1.1 mmol of Fmoc-Tyr(tBu)-OH and 0.55 mmol of O-benzotriazol-N,N,N',N'-tetramethyl-uronium-hexafluoro-phosphate (HBTU) were placed in a well-dried reactor and stirred at room temperature for 2 h, thereby synthesizing an Fmoc-Tyr(tBu) resin, after which the synthesized resin was filtered and then washed with dimethylformamide. The washed resin was added to 8 mL of a 20% piperidine solution (dissolved in dimethylformamide) and stirred at room temperature for 30 min, thus synthesizing a Fmoc-deprotected (fluorenylmethyloxycarbonyl)-Tyr(tBu) resin. The synthesized Tyr(tBu) resin was filtered and then washed with dimethylformamide. The washed Tyr(tBu) resin was mixed with 5 mL of dimethylformamide, 1.1 mmol of Fmoc-GlyOH, and 0.55 mmol of O-benzotriazol-N,N,N',N'-tetramethyluroniumhexafluorophosphate (HBTU), and stirred at room temperature for 2 hours, synthesizing an Fmoc-Gly-Tyr(tBu) resin. The synthesized resin was then filtered and washed with dimethylformamide. To the washed resin, 8 mL of a 20% piperidine solution (dissolved in dimethylformamide) was added, and the mixture was stirred at room temperature for 30 minutes, synthesizing an Fmoc-deprotected Gly-Tyr(tBu) resin. The synthesized Gly-Tyr(tBu) resin was filtered and washed with dimethylformamide. Through these procedures, a peptide bond was formed between glycine and tyrosine. From then on, Fmoc-Ala-OH, Fmoc-Gly-OH, Fmoc-Ala-OH, Fmoc-Gly-OH, Fmoc-AlaOH, Fmoc-Gly-OH and Fmoc-Tyr(tBu)-OH were used sequentially, and the same procedures as for forming the peptide bond between glycine and tyrosine were repeated, thus preparing a peptide-resin compound comprising the amino acid sequence shown in Table 1 below. Subsequently, the compound was added to 10 mL of a 95:5 (v / v) mixed solution of trifluoroacetic acid and water, stirred at room temperature for 3 hours, and then filtered. The resulting filtrate was then treated with diethyl ether to crystallize a solid. The solid obtained was filtered, washed with diethyl ether, and then dried, thus synthesizing a crude peptide compound comprising the amino acid sequence shown in Table 1 below. The crude peptide compound was purified by reversed-phase high-performance liquid chromatography (RP-HPLC) using a Shimadzu ODS C18 column with 5 mm Shim packing (20 x 250 mm) and lyophilized, thus obtaining the peptide of example 1 in white solid form. The purified peptide was identified by analytical RP-HPLC using a 5 mm (4.6 x 250 mm) Shim-packed ODS C18 column, and the molecular weight of the peptide was measured using a matrix-assisted laser ionization / desorption (MALDI) mass spectrometer (Axima CFR, Kratos Analytical, Manchester, UK). Table 1 zccnLn / Lznz / E / Yi Amino acid sequence SEQ ID NO: Example 1 YGAGAGAGY 1 In Table 1, Y represents tyrosine (Tyr), G represents glycine (Gly), and A represents alanine (Ala). Example 2 - Evaluation of the effects of peptides 2-1. Evaluation of the effect of inhibiting or reducing the development of insulitis. The effect of the peptide from example 1 on the inhibition or reduction of the development of insulitis was experimentally verified. The experimental animals were 8-week-old female NOD / ShiLtJ mice (Jackson Lab). NOD (non-obese diabetic) mice are animal models of insulitis and type 1 diabetes. In these animals, type 1 diabetes is known to present at an average age of 18 weeks, with 90% of cases occurring by 30 weeks of age. All animals were housed under SPF barrier conditions. This study was approved by the Institutional Animal Care and Use Committee of the Osong Medical Innovation Foundation Laboratory Animal Center (Kbio-IACUC-2018066). The acclimation period was 1 week, and the light / dark cycle was 12 hours (8:00 AM with lights off - 8:00 PM with lights on). The temperature was 20 ± 2°C, and the relative humidity was 60–80%. Since the incidence of diabetes can be inhibited by intestinal microorganisms, water was supplied to the experimental animals, the pH of which was adjusted to 2.8 - 3.2 using HC1. The tail end of the previously prepared experimental animals was punctured once a week, and a drop of blood was taken to measure blood glucose levels using a glucometer (Roche, Accu-CHEK Performa). When blood glucose levels were measured at 250 mg / dL or higher, and blood glucose levels measured again on the third day thereafter were also 250 mg / dL or higher, type 1 diabetes was considered to have occurred, and the experiment was continued. Two experimental animals with type 1 diabetes were selected as the treatment group for Example 1 and were administered 100 pL of the peptide from Example 1 (5 mg / kg) subcutaneously (SC). Administration was performed every morning and evening for 14 days, and blood glucose levels were measured using a glucometer. Administration was stopped when the blood glucose level decreased to 250 mg / dL or less. In addition, two experimental animals with type 1 diabetes were selected as the negative control group and were treated in the same manner as the treatment group in Example 1, except that PBS (phosphate-buffered saline, Welgene) was administered instead of the peptide from Example 1.On day 14, an experimental animal, whose blood glucose levels were measured at less than 250 mg / dL, was selected as a normal group and used to compare insulitis counts of experimental animals with type 1 diabetes and experimental animals without type 1 diabetes. After measuring blood glucose levels on day 14, the pancreas was removed from the experimental animals and fixed in 10% natural buffered formalin (10% NBF, Sigma, HT5011) to fabricate a paraffin block. The fixed pancreatic tissue was sliced, stained with hematoxylin and eosin (H&E), and examined using a light microscope to confirm the development of insulitis. Insulitis was divided into four stages depending on its extent: stage 0, in which no insulitis was observed; stage 1, in which insulitis was observed around the pancreatic islets; stage 2, in which insulitis was less than 75%; and stage 3, in which insulitis was 75% or more.For the treatment group in Example 1, the number of islets was measured in two animals. Individual islets were classified according to the stage of insulitis to determine the insulitis count, and the number of islets corresponding to each insulitis stage was expressed as a percentage of the total number of islets. For the negative control and normal groups, insulitis counts were determined as in the treatment group of Example 1, and the number of islets corresponding to each insulitis stage was then expressed as a percentage of the total number of islets. The results are shown in Figure 1. Figure 1 is a graph showing the results of the analysis of the effect of the peptide from Example 1 on the inhibition or reduction of insulitis development. In Figure 1, the x-axis represents each group and the y-axis represents the insulitis count {insulitis (% of islets)}. In Figure 1, a count of 0 represents stage 0, a count of 1 represents stage 1, a count of 2 represents stage 2, and a count of 3 represents stage 3. As shown in Figure 1, in the treatment group of Example 1, the percentage in stage 3, the most severe stage, decreased, and the percentages in stages 0-2, where insulin secretion is possible, increased compared to the negative control group. Specifically, in the treatment group of Example 1, the percentage in stage 0, where no insulitis developed, approximately doubled compared to the negative control group. Based on these results, it can be concluded that the peptide in Example 1 was effective in treating insulitis by inhibiting its development and alleviating existing insulitis. Furthermore, the percentage in stage 0 was higher in the treatment group of Example 1 than in the control group. Therefore, the peptide in Example 1 was able to inhibit the development of insulitis, indicating that it was effective in both treating and preventing insulitis. Ultimately, it can be concluded that the peptide of the present invention has a therapeutic and / or prophylactic effect on insulitis. 2-2. Evaluation of the effect of reducing blood glucose levels To evaluate the effect of the peptide in example 1 on type 1 diabetes (T1D), the effect of the peptide in example 1 on lowering blood glucose levels in experimental animals with type 1 diabetes was experimentally verified. Specifically, blood glucose levels were analyzed in the treatment group of Example 1 and the negative control group, among the experimental animals of Example 2-1, and therefore the effect of the peptide from Example 1 on lowering blood glucose levels was evaluated. The results are shown in Figure 2. Figure 2 is a graph showing the results of the analysis of the effect of the peptide from Example 1 on reducing blood glucose levels. Here, the x-axis represents time after treatment (d) and the y-axis represents blood glucose levels (mg / dL). As shown in Figure 2, the blood glucose levels of the two animals in the treatment group of Example 1 (Example 1-1 and Example 1-2) decreased significantly and then remained within the normal range, but the blood glucose levels of the two animals in the negative control group (negative control group-1 and negative control group-2) increased continuously. Based on the preceding results, it can be confirmed that the peptide of the present invention was effective in reducing blood glucose levels. Since the peptide of the present invention is effective in reducing blood glucose levels in mice with type 1 diabetes and maintaining normal blood glucose levels, the peptide of the present invention appears to be capable of treating or preventing type 1 diabetes by reducing blood glucose levels. Furthermore, as confirmed above, since the peptide of the present invention is capable of inhibiting and reducing the development of insulitis, it may exhibit a therapeutic and / or prophylactic effect on type 1 diabetes through its action, and can be considered to have a blood glucose-lowering effect. Finally, it can be concluded that the peptide of the present invention allows the treatment and / or prevention of type 1 diabetes. 2-3. Evaluation of the effect of inhibiting IFN-γ expression and TNF-α expression on inducing TGF-βI expression The effect of the peptide from Example 1 on the cytokines {IFN-γ (interferon-gamma), TNF-α (tumor necrosis factor alpha), and TGF-βI (transforming growth factor-beta-1)} associated with insulitis was evaluated. Insulitis is known to be caused by the expression of IFN-γ and TNF-α, and increased TGF-βI expression is known to protect the pancreas from insulitis. Therefore, by measuring whether the peptide from Example 1 inhibits the expression of IFN-γ and TNF-α and induces the expression of TGF-βI, its effect on insulitis was assessed. The tail end of experimental animals prepared as in Example 2-1 was injured once a week, and blood glucose levels were measured from a drop of blood using a glucometer (Roche, Accu-CHEK Performa). When blood glucose levels were confirmed to be high (600 mg / dL or higher), the mice underwent cervical dislocation, and their spleens were removed. A cell strainer (BD, 352350) was placed in a 50 mL tube, and the removed spleen tissue was passed through the cell strainer using the plunger end of a syringe. HBSS (Hanks Balanced Salt Solution) was then added, and the cells were washed with water, zccnLn / Lznz / E / Yi, followed by centrifugation (1,000 rpm, 5 min) to remove the supernatant.Cells were resuspended in 1 mL of HBSS, 10 mL of RBC lysis buffer (Ebioscience, 00-4333-57) were added, mixed with gentle shaking, allowed to stand on ice for 5 min, and then centrifuged (1,000 rpm, 5 min) to remove the supernatant. The resulting cells were added to 10 mL of RBC lysis buffer once more, allowed to stand on ice for 5 min, centrifuged again (1,000 rpm, 5 min) to remove the supernatant, and then washed twice with 10 mL of HBSS. After the final centrifugation (1,000 rpm, 5 min), the cells were resuspended in 1 mL of HBSS, 50 pL of the cells were diluted with trypan blue solution at a 1:1 ratio, and the number of cells was counted using a hemocytometer.The separated splenocytes were placed at a density of 1 x 10⁷ cells per well in a 6-well plate in 2 mL of RPML1640 medium (Welgene, LM011-01) containing 10% FBS (fetal bovine serum, Corning, 35-015-CV) and 2 ng / mL of anti-mouse CD28 (Ebioscience, 16-0281-82) was added to induce T cell activity. Simultaneously, the cells were treated with 100 mM of the peptide from Example 1 in a 5% CO₂ incubator at 37°C for 3 hours to assess changes in IFN-γ and TNF-α expression and for 72 hours to assess changes in TGF-βI expression. Subsequently, the cells were centrifuged (1,000 rpm, 5 min) to remove the supernatant, lysed by pipetting with 5 mL of TRIzol (Invitrogen, 15596-018), and allowed to stand at room temperature for 5 min. The cells were then added to 100 µL of chloroform, mixed with vigorous shaking, and allowed to stand at room temperature for 2 min. Next, the cells were centrifuged (12,000 rpm, 15 min), and only the supernatant was carefully transferred to a new 1.5 mL e-tube. 300 µL of isopropanol was added, the mixture was mixed with gentle shaking, and then allowed to stand at room temperature for 10 min.Next, centrifugation (12,000 rpm, 15 min) was performed to remove the supernatant, followed by washing with 500 pL of 70% ethanol diluted in DEPC (diethyl pyrocarbonate) treated water (LPS solution, CBW004) and centrifugation (12,000 rpm, 10 min) to remove the supernatant, after which the remaining ethanol was evaporated in the uncovered state. RNA was eluted by adding 30 pL of DEPC-treated water and quantified. cDNA was synthesized using the experimental procedure for a cDNA synthesis kit (ELPISbio, EBT-1512) using 1 mg of the quantified RNA. Then, according to the procedure for a PCR (polymerase chain reaction) kit (Solgent, SEF01-M50H), cDNA for each cytokine (IFN-γ, IFN-α, TGF-βI) and a constitutive GAPDH gene were amplified for the quantitative determination of changes in cytokine expression. The PCR products were then subjected to electrophoresis on a 2% agarose gel to confirm the DNA bands, which were subsequently quantified using ImageJ software, and the quantified values ​​were calculated as a percentage relative to GAPDH.The control group was treated in the same way as the zccnLn / Lznz / E / Yi treatment group in Example 1, except that PBS (phosphate-buffered saline, Welgene) was used instead of the peptide from Example 1 and anti-mouse CD28. The negative control group was treated in the same way as the treatment group in Example 1, except that PBS (phosphate-buffered saline, Welgene) was used instead of the peptide from Example 1. The results are shown in Figures 3 and 4. The primer sequences for PCR of each cytokine are shown in Table 2 below. zccnLn / Lznz / E / Yi Table 2 Cytokine Base sequence SEQ ID NO: IFN-β direct actggcaaaaggatggtgac 2 reverse tgagctcattgaatgcttgg 3 TNF-a direct agcccccagtctgtatcctt 4 reverse ctccctttgcagaactcagg 5 TGF-βΙ direct gcttcagctccacagag 6 reverse ggttgtagagggcaagg 7 GAPDH forward tcatgaccacagtccatgcc 8 reverse tccaccaccctgttgctgta 9 In Table 2, t represents thymine, a represents adenine, c represents cytosine, and g represents guanine. Figure 3 is a graph showing the results of the analysis of the effect of the peptide from Example 1 on the inhibition of IFN-γ and TNF-α expression, and Figure 4 is a graph showing the results of the analysis of the effect of the peptide from Example 1 on the induction of TGF-βI expression. In Figures 3 and 4, the x-axis represents the control group {(-)}, the negative control group (anti-CD28), and the treatment group from Example 1 (anti-CD28 + Example 1), and in Figures 3 and 4, the y-axis represents the mRNA expression level as a percentage relative to GAPDH {cytokines / GAPDH (%)}. As shown in Figure 3, based on the results of the evaluation of IFN-γ and TNF-α expression levels, which are known to induce insulitis, each expression level was reduced compared to the negative control group. Therefore, it can be confirmed that the peptide from Example 1 inhibited the expression of IFN-γ and TNF-α, indicating that it inhibited the development of insulitis, thus effectively treating and / or preventing it. As shown in Figure 4, based on the results of the assessment of TGF-β1 expression levels, which are known to affect pancreatic protection against insulitis, the expression level was increased compared to the negative control group. Therefore, it can be confirmed that the peptide from Example 1 induced TGF-β1 expression, thereby protecting the pancreas against insulitis and effectively treating and / or preventing it. Therefore, it can be confirmed that the peptide in example 1 is effective in the treatment and / or prevention of insulitis by inhibiting the expression of IFN-γ and the expression of TNF-α and / or inducing the expression of TGF-βI. In conclusion, the peptide or pharmaceutically acceptable salt thereof according to the present invention is capable of exhibiting a therapeutic and / or prophylactic effect on insulitis by inhibiting the expression of IFN-γ, inhibiting the expression of TNF-α, and / or inducing the expression of TGF-βI. Ultimately, it can be concluded that the peptide or pharmaceutically acceptable salt thereof according to the present invention is capable of treating and / or preventing type 1 diabetes. Comparative example 1 and comparative example 2 - Peptide preparation To evaluate whether a portion of the peptide in Example 1 exhibits activity, the peptide in Comparative Example 1 and the peptide in Comparative Example 2 were prepared, comprising amino acid sequences that correspond to a portion of the amino acid sequence of the peptide in Example 1. The peptide in Comparative Example 1 and the peptide in Comparative Example 2 were a peptide (GAGAGY) composed of 6 amino acids sequentially from the C-terminus of the amino acid sequence (YGAGAGAGY) of the peptide in Example 1, and a peptide (YGAGAG) composed of 6 amino acids sequentially from the N-terminus of the same, respectively. The peptide in Comparative Example 1 and the peptide in Comparative Example 2 were fabricated in the same manner as the peptide in Example 1 based on the amino acid sequence shown in Table 3 below. Table 3 zccnLn / Lznz / E / Yi Amino acid sequence SEQ ID NO: Comparative example 1 GAGAGY 10 Comparative example 2 YGAGAG 11 In Table 3, Y represents tyrosine (Tyr), G represents glycine (Gly), and A represents alanine (Ala). Comparative experiment - Evaluation of the peptide effects of comparative example 1 and comparative example 2 In order to evaluate whether the peptides in comparative examples 1 and 2 are effective in inhibiting the expression of IFN-γ and TNF-α and inducing the expression of TGF-βI as in the peptide in example 1, the following experiment was performed. The present experiment was carried out in the same way as in examples 2-3, with the exception that the peptide from comparative example 1 or the peptide from comparative example 2 was used instead of the peptide from example 1. The results thereof are shown in figures 5 and 6. Figure 5 is a graph showing the results of the analysis of the effects of the peptides from comparative examples 1 and 2 on the inhibition of IFN-γ and TNF-α expression, and Figure 6 is a graph showing the results of the analysis of the effects of the peptides from comparative examples 1 and 2 on the induction of TGF-βI expression. In Figures 5 and 6, the x-axis represents the control group {(-)}, the negative control group (anti-CD28), the treatment group from comparative example 1 (anti-CD28 + comparative example 1), and the treatment group from comparative example 2 (anti-CD28 + comparative example 2). In Figures 5 and 6, the y-axis represents the mRNA expression level as the percentage {cytokines / GAPDH (%)} relative to GAPDH. As shown in Figure 5, based on the results of the assessment of IFN-γ and TNF-α expression levels, which are known to induce insulitis, the expression levels of these enzymes in each treatment group of comparative example 1 and the treatment group of comparative example 2 did not change significantly compared to the negative control group. However, the treatment group in comparative example 2 was found to have increased TNF-α expression levels. Furthermore, as shown in Figure 6, based on the results of the assessment of TGF-βI expression levels, which are known to affect pancreatic protection against insulitis, the expression levels of TGF-βI in each of the treatment groups of comparative example 1 and the treatment group of comparative example 2 did not change significantly compared to the negative control group.From these results, it can be seen that the peptides in comparative example 1 and comparative example 2 did not exhibit effects of inhibiting IFN-γ expression, inhibiting TNF-α expression, and inducing TGF-βI expression, unlike the peptide in example 1. Based on the above results, it can be concluded that the entire peptide from example 1, not a portion of it, is effective in inhibiting the expression of IFN-γ and TNF-α and inducing the expression of TGF-βI, and has an effect on insulitis and type 1 diabetes. Example of preparation 1 - Preparation of injectable solution Ten mg of the peptide, prepared in the same manner as in Example 1, were dissolved in PBS to obtain 1 mL of solution. This solution was then loaded into an injection ampoule to provide an injectable solution. Industrial applicability The present invention is effective for treating or preventing insulitis. Furthermore, the present invention is effective for treating or preventing type 1 diabetes. Therefore, the present invention is industrially applicable.

Claims

1. A peptide consisting of the amino acid sequence SEQ ID NO: 1 or a pharmaceutically acceptable salt thereof. 5 2. A pharmaceutical composition for the treatment or prevention of insulitis, comprising the peptide or a pharmaceutically acceptable salt thereof according to claim 1.

3. The pharmaceutical composition according to claim 2, wherein the treatment or prevention is due to at least one selected from the inhibition of IFN-γ (interferon-gamma) expression, the inhibition of TNF-α (tumor necrosis factor-alpha) expression, and the induction of TGF-βI (transforming growth factor beta-1) expression.

4. A pharmaceutical composition for the treatment or prevention of type 1 diabetes, comprising the peptide or a pharmaceutically acceptable salt thereof according to claim 1.

5. The pharmaceutical composition according to claim 4, wherein type 1 diabetes is caused by insulitis.

6. The pharmaceutical composition according to claim 5, wherein the treatment or prevention is due to at least one selected from the inhibition of the development of insulitis and the reduction thereof.