Method for producing polyunsaturated fatty acids in transgenic organisms.

Abstract

The present invention relates to a method for the production of polyunsaturated fatty acids in an organism by introducing into the organism nucleic acids encoding polypeptides with Δ5-elongase activity. Advantageously, these nucleic acid sequences can be expressed in the organism if they are compatible with further nucleic acid sequences encoding polypeptides of fatty acid biosynthesis or lipid metabolism. Particularly advantageous are nucleic acid sequences encoding a Δ6-desaturase, Δ5-desaturase, Δ4-desaturase and / or Δ6-elongase activity. These desaturases and elongases are advantageously derived from Thalassiosira, Euglena or Ostreococcus. The invention further relates to a method for the production of oils and / or triacylglycerides with an elevated content of long-chain polyunsaturated fatty acids.In a preferred embodiment, the present invention further relates to a method for producing unsaturated ω3 fatty acids and a method for producing triglycerides with an elevated content of unsaturated fatty acids, especially ω3 fatty acids with more than three double bonds.The invention relates to the creation of a transgenic organism, preferably a transgenic plant or a transgenic microorganism, with an elevated content of unsaturated ω3 fatty acids, oils or lipids with ω3 double bonds as a result of expression of elongases and desaturases used in the method according to the invention, advantageously together with ω3 desaturases, for example an ω3 desaturase from fungi of the family Pythiaceae such as the genus Phytophthora, for example the genus and species Phytophthora infestans or an ω3 desaturase from algae such as the family Prasinophyceae, for example the genus Ostreococcus, specifically the genus and species Ostreococcus tauri or diatoms such as the genus Thalassiosira, specifically the genus and species Thalassiosira pseudonana.The invention further relates to nucleic acid sequences, nucleic acid constructs, vectors and organisms comprising the nucleic acid sequences of the invention, vectors comprising the nucleic acid sequences and / or nucleic acid constructs and transgenic organisms comprising the above-mentioned nucleic acid sequences, nucleic acid constructs and / or vectors. A further part of the invention relates to oils, lipids and / or fatty acids produced by the method of the invention and their use. The invention further relates to unsaturated fatty acids and triglycerides with an elevated content of unsaturated fatty acids and their use.

Description

The present invention relates to a method for the production of polyunsaturated fatty acids in an organism upon introduction into the organism, of nucleic acids such as encodes polypeptides with Δ5-elongase activity. These nucleic acid sequences, if it matches with additional nucleic acid sequences encoding polypeptides of biosynthesis of fatty acid or lipid metabolism, can advantageously be expressed in the organism. Particularly advantageous are nucleic acid sequences which code for a Δ6-desaturase, a Δ5-desaturase, Δ4-desaturase, Δ12-desaturase and / or Δ6-elongase activity. These desaturases and elongases are advantageously derived from Thalassiosira, Euglena or Ostreococcus. The invention further relates to a method for producing oils and / or triacylglycerides with an elevated content of long-chain polyunsaturated fatty acids. In a preferred embodiment, the present invention further relates to a method for the production of unsaturated ω3 fatty acids and a method for the production of triglycerides with an elevated content of unsaturated fatty acids, especially ω3 fatty acids with more than three double bonds. The invention relates to the formation of a transgenic organism, preferably a transgenic plant or a transgenic microorganism, with an elevated content of unsaturated ω3 fatty acids, oils or lipids with ω3 double bonds as a result of expression of the elongases and desaturases used in the method according to the invention, advantageously together with ω3-desaturases, for example an ω3-desaturase from fungi of the family Pythiaceae such as the genus Phytophthora, for example the genus and species Phytophthora infestans or an ω3-desaturase from algae such as the family of Prasinophyceae, for example the genus Ostreococcus, specifically the genus and species Ostreococcus tauri or diatoms such as the genus Thalassiosira, specifically the genus and the species Thalassiosira pseudonana. The invention further relates to nucleic acid sequences, nucleic acid constructs, vectors and organisms comprising the nucleic acid sequences according to the invention, vectors comprising the nucleic acid sequences and / or nucleic acid constructs and transgenic organisms comprising the above nucleic acid sequences, nucleic acid constructs and / or vectors. A further part of the invention concerns oils, lipids and / or fatty acids produced by the process according to the invention and their use. The invention further relates to unsaturated fatty acids and triglycerides with an elevated content of unsaturated fatty acids and application of them. Fatty acids and triacylglycerides have a number of applications in the food industry, i animal nutrition, in cosmetics and in the pharmacological sector. Depending on whether they are free saturated or unsaturated fatty acids or otherwise triacylglycerides with an elevated content of saturated or unsaturated fatty acids, they are suitable for very different applications. Polyunsaturated fatty acids such as linoleic acid and linolenic acid are essential for mammals, since they cannot produce the latter. Polyunsaturated ω3 fatty acids and ω6 fatty acids are therefore an important component in animal and human nutrition. Polyunsaturated long-chain ω3 fatty acids such as eicosapentaenoic acid (= EPA, Δ5,8,11,14,17 Δ4,7,10,13,16,19 C20:5 ) or docosahexaenoic acid (= DHA, C22:6 ) are important components of human nutrition due to their different roles in health aspects, comprehensive development of the child's brain, the functionality of the eyes, synthesis of hormones and other signaling substances and prevention of cardiovascular disorders, cancer and diabetes (Poulos, A Lipids 30:1-14, 1995; Horrocks, LA and Yeo YK Pharmacol Res 40:211-225, 1999). For this reason, there is a demand for the production of polyunsaturated long-chain fatty acids. Due to the current composition of human food, an addition of polyunsaturated ω3 fatty acids, which are preferably found in fish oils, to the food especially important. Thus, for example, polyunsaturated fatty acids such as docosahexaenoic acid (= DHA, Δ4,7,10,13,16,19 Δ5,8,11,14,17 C22:6 ) or eicosapentaenoic acid (= EPA, C20:5 ) added to toddlers formulations to improve the nutritional value. The unsaturated fatty acid DHA is indicated to have a positive effect on the development and maintenance of brain functions. Below, polyunsaturated fatty acids are referred to as PUFA, PUFAs, LCPUFA or LCPUFAs (polyunsaturated fatty acids, PUFA, long-chain polyunsaturated fatty acids, LCPUFA). The various fatty acids and triglycerides are mainly obtained from microorganisms such as Mortierella and Schizochytrium or from oil-producing plants such as soybean, rapeseed, algae such as Crypthecodinium or Phaeodactylum and others, where they are obtained, usually in the form of their triacylglycerides (= triglycerides = triglycerols). However, they can also be obtained from animals, such as for for example fish. The free fatty acids are advantageously produced by hydrolysis. A lot long-chain polyunsaturated fatty acids such as DHA, EPA, arachidonic acid (= ARA, Δ5,8,11,14 Δ8,11,14 C20:4 ), dihomo-γ-linolenic acid (C20:3 ) or docosapentaenoic acid (DPA, Δ7,10,13,16,19 C22:5 ) is not synthesized in oil crops such as rapeseed, soybean, sunflower or milk thistle. Conventional natural sources of these fatty acids are fish such as herring, salmon, sardine, red saltwater fish (redfish), eel, carp, trout, halibut, mackerel, haddock or tuna or algae. Depending on the intended use, oils are either saturated or unsaturated fatty acids preferred. In human nutrition, for example, lipids with unsaturated fatty acids, specifically polyunsaturated fatty acids, preferred. The polyunsaturated ω3 fatty acids are indicated to have a positive effect on the cholesterol level in the blood and thus on the possibility of prevention of heart disease. Risk of heart disease, stroke or hypertension can be reduced marked by the addition of these ω3 fatty acids to the food. ω3 fatty acids also have a positive effect on inflammatory, specifically on chronic inflammatory, processes together with immunological diseases such as rheumatoid arthritis. They are therefore set to foodstuffs, specifically for dietetic foodstuffs or are used in medicines. ω6 fatty acids as arachidonic acid tends to have a negative effect on these disorders i connection with these rheumatic diseases due to our usual dietary intake. ω3 and ω6 fatty acids are precursors of tissue hormones, known as eicosanoids, so such as prostaglandins, which are derived from dihomo-γ-linolenic acid, arachidonic acid and eicosapentaenoic acid and for thromboxanes and leukotrienes, which are derived from arachidonic acid and eicosapentaenoic acid. Eicosanoids (known as PG series) that become 2 formed from ω6 fatty acids generally promote inflammatory reactions, whereas eicosanoids (known as the PG series) from ω3 fatty acids have little or none 3 proinflammatory effect. Due to the positive characteristics of the polyunsaturated fatty acids, there are none lack of attempts previously to make available genes involved in the synthesis of these fatty acids or triglycerides for the production of oils in various organisms with a modified content of unsaturated fatty acids. Thus, WO 91 / 13972 and its US- equivalent to a Δ9-desaturase. WO 93 / 11245 claims a Δ15 desaturase and WO 94 / 11516 a Δ12 desaturase. Additional desaturases are described, for example, in EP-A-0 550 162, WO 94 / 18337, WO 97 / 30582, WO 97 / 21340, WO 95 / 18222, EP-A-0 794,250, Stukey et al., J. Biol. Chem., 265, 1990: 20144-20149, Wada et al., Nature 347, 1990: 200-203 or Huang et al., Lipida 34, 1999: 649-659. However, it is biochemical characterization of the different desaturases insufficient until now the enzymes, which are membrane-bound proteins, present great difficulties in isolation and characterization (McKeon et al., Methods in Enzymol. 71, 1981: 12141-12147, Wang et al., Plant Physiol. Biochem., 26, 1988: 777-792). As a rule, it is membrane-bound desaturases characterized by being introduced into a suitable organism which are then assayed for enzyme activity by analyzing the starting materials and the products. Δ6-desaturases are described in WO 93 / 06712, US 5,614,393, US5614393, WO 96 / 21022, WO 00 / 21557 and WO 99 / 27111 and use for the production of fatty acids in transgenic organisms are described in WO 98 / 46763, WO 98 / 46764 and WO 98 / 46765. In this context, the expression of various desaturases and formation of polyunsaturated fatty acids also described and claimed in WO 99 / 64616 or WO 98 / 46776. Regarding the expression efficiency of desaturases and their effect on formation of polyunsaturated fatty acids, it should be noted that expression of a simple desaturase which described so far has only resulted in a low content of unsaturated fatty acids / lipids such as for for example γ-linolenic acid and stearidonic acid. Furthermore, a mixture of ω3 and ω6 fatty acids was obtained usually achieved. Particularly suitable microorganisms for the production of PUFA are microalgae such as Phaeodactylum tricornutum, Porphiridium species, Thraustochytrium species, Schizochytrium species or Crypthecodinium species, ciliates such as Stylonychia or Colpidium, fungi such as Mortierella, Entomophthora or Mucor and / or mosses such as Physcomitrella, Ceratodon and Marchantia (R. Vazhappilly & F. Chen (1998) Botanica Marina 41: 553-558; K. Totani & K. Oba (1987) Lipids 22: 1060-1062; M. Akimoto et al. (1998) Appl. Biochemistry and Biotechnology 73: 269-278). Tribe- selection has resulted in the development of several mutant strains of those in question the microorganisms that produce a series of desirable compounds including PUFA. However, mutation and selection of strains with an improved production of a particular molecule, such as the polyunsaturated fatty acids a time-consuming and difficult process. For this reason, recombinant methods as described above are preferred whenever possible. However, only limited amounts of the desired polyunsaturated fatty acids can such as DPA, EPA or ARA are produced using the above-mentioned microorganisms and, depending on the microorganism used, these are generally obtained as fatty acid mixtures of, for example, EPA, DPA and ARA. A number of synthetic pathways have been described for the synthesis of arachidonic acid, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) (Figure 1). Thus becomes the EPA or DHA produced in marine bacteria such as Vibrio sp. or Shewanella sp. via the polyketide pathway (Yu, R. et al. Lipids 35:1061-1064, 2000; Takeyama, H. et al. Micro- biology 143:2725-2731, 1997). An alternative strategy is the alternating activity of desaturases and elongases (Zank, T.K. et al. Plant Journal 31:255-268, 2002; Sakuradani, E. et al. Gene 238:445- 453, 1999). A modification of the above described pathway of 6-desaturase, 6- elongase, 5-desaturase, 5-elongase and 4-desaturase are the Sprecher pathway (Sprecher 2000, Biochim. Biophys. Acta 1486:219-231) in mammals. Instead of 4-desaturation becomes a further extension step performed here, giving C , followed by a further 6- 24 desaturation and finally β-oxidation, giving C chain length. Thus is the one that 22 is known as the Sprecher pathway (see Figure 1), however, is not suitable for production in plants and microorganisms since the regulatory mechanisms are not known. Depending on their desaturation pattern, the polyunsaturated fatty acids can be divided up into two large classes, i.e. ω6 or ω3 fatty acids, which differ with respect to their metabolic and functional activities (Fig. 1). Δ9.12 The starting material for the ω6 metabolic pathway is the fatty acid linoleic acid (18:2 ) while Δ9,12,15 The ω3 pathway proceeds via linolenic acid (18:3). Linolenic acid is formed by the activity to an ω3-desaturase (Tocher et al. 1998, Prog. Lipid Res. 37, 73-117; Domergue et al. 2002, Eur. J. Biochem. 269, 4105-4113). Mammals, and thus also humans, have no corresponding desaturase activity (Δ12- and ω3-desaturase) and must absorb these fatty acids (essential fatty acids) via food. By starting with these precursors, they become physiologically important polyunsaturated fatty acids Δ5,8,11,14 arachidonic acid (= ARA, 20:4 ), an ω6 fatty acid and the two ω3 fatty acids Δ5,8,11,14,17 eicosapentaenoic acid (= EPA, 20:5 ) and docosahexaenoic acid (DHA, Δ4,7,10,13,17,19 22:6 ) synthesized via the sequence of desaturase and elongase reactions. The use of ω3 fatty acids shows the therapeutic activity described above by treatment of cardiovascular diseases (Shimikawa 2001, World Rev. Nutr. Diet. 88, 100-108), the Inflammation (Calder 2002, Proc. Nutr. Soc. 61, 345-358) and Arthritis (Cleland and James 2000, J. Rheumatol. 27, 2305-2307). When it comes to the physiology of nutrition, it is therefore important, when synthesizing polyunsaturated fatty acids, to achieve a shift between the ω6 synthesis pathway and the ω3 synthesis pathway (see Figure 1) so that more ω3 fatty acids are produced. The enzymatic activities of a series of ω3-desaturases that desaturate C -, C - or C -fatty acids are described in 18:2 22:4 22:5 the literature (see Figure 1). However, none of the desaturases described convert in terms of biochemistry, a wide substrate spectrum in the ω6 synthesis pathway to the corresponding ones fatty acids in the ω3 synthesis pathway. There is therefore still a high demand for an ω3-desaturase that is suitable for production of ω3 polyunsaturated fatty acids. All known plant and cyanobacteria ω3-desaturases desaturate C fatty acids with linoleic acid as substrate, but cannot 18 desaturate some C - or C -fatty acids. 20 22 The fungus Saprolegnia dicilina is known to have an ω3-desaturase [Pereira et al. 2004, Biochem. J. 378 (Pt 2):665-71] which can desaturate C20 polyunsaturated fatty acids. However, the disadvantage is that this ω3-desaturase cannot desaturate any C - or C - 18 22 PUFA saw as the important fatty acids C -, C - or C - fatty acids in the ω6 synthesis pathway. 18:2 22:4 22:5 A further disadvantage of this enzyme is that it cannot desaturate any fatty acids which are bound to phospholipids. Only CoA fatty acid esters are converted. Elongation of fatty acids, with elongases, with 2 or 4 C atoms is essential importance for the production of C - and C -PUFA, respectively. This process is ongoing 20 22 via 4 steps. The first step is the condensation of malonyl-CoA with fatty acyl-CoA ketoacyl-CoA synthase (KCS, hereafter referred to as elongase). This is followed by a reduction step (ketoacyl-CoA reductase, KCR), a dehydration step (dehydratase) and a final reduction step (enoyl-CoA reductase). It has been postulated that The elongase activity affects the specificity and speed of the entire process (Millar et al Art, 1997 Plant Journal 12:121-131). There have previously been a large number of attempts to obtain elongase genes. Millar and Art, 1997 (Plant Journal 12:121-131) and Millar et al. 1999, (Plant Cell 11:825-838) describes the characterization of plant elongases for the synthesis of monounsaturated long-chain fatty acids (C22:1) and for the synthesis of very long-chain fatty acids for formation of waxes in plants (C -C ). Descriptions concerning the synthesis of arachidonic acid 28 32 and EPA can be found, for example, in WO 0159128, WO 0012720, WO 02077213 and WO 0208401. Synthesis of polyunsaturated C fatty acids is described in, for example, Tvrdik et 24 eel. 2000, JCB 149:707-717 or WO 0244320. No specific elongase has so far been described for the production of DHA (C22:6 n-3) i organisms that do not naturally produce this fatty acid. Only elongases that give C - 20 or C fatty acids have been described so far. A 5-elongase activity has not been described so far. 24 Higher plants include polyunsaturated fatty acids such as linoleic acid (C18:2) and linolenic acid (C18:3). ARA, EPA and DHA are not at all found in germ oil in higher plants or only in negligible quantities (E. Ucciani: Nouveau Dictionnaire des Huiles Végétales [New reference book on vegetable oils]. Technique & Documentation - Lavoisier, 1995. ISBN: 2-7430-0009-0). However, production of LCPUFA in higher plants, preferably in oil crops such as rapeseed, linseed, sunflower and soybeans, be beneficial since large amounts of high-quality LCPUFA for the food industry, animal nutrition and pharmaceutical purposes can be achieved economically. For this purpose it is advantageous for introducing into oil crops, genes that code for enzymes for LCPUFA biosynthesis via recombinant methods and express them therein. These genes code for example for Δ6-desaturases, Δ6-elongases, Δ5-desaturases or Δ4-desaturases. These genes can advantageously be isolated from microorganisms and lower plants such as produces LCPUFA and is introduced into the membranes or the triacylglycerides. Thus it is already possible to isolate Δ6-desaturase genes from the moss Physcomitrella patens and Δ6- elongase genes from P. patens and from the nematode C. elegans. The first transgenic plants that include and express genes that code for LCPUFA biosynthesis enzymes and which, as a consequence, produce LCPUFA were described for the first time in, for example, DE-A-102 19 203 (method for production of polyunsaturated fatty acids in plants). However, these plants produce LCPUFA in quantities that require further optimization for processing the oils which are present in the plants. To enable the fortification of food and / or feed with these polyunsaturated fatty acids, is there is therefore a great need for a simple, cheap method for producing these polyunsaturated fatty acids, specifically in eukaryotic systems. It was therefore a goal to provide additional genes or enzymes that are suitable for synthesis of LCPUFA, specifically genes with 5-elongase-, 5-desaturase-, 4-desaturase, 12-desaturase or 6-desaturase activity, for the production of polyunsaturated fatty acids. A further object of the present invention was provision of genes or enzymes that enable a shift from ω6 fatty acids to ω3 fatty acids. Another goal was to develop a method for the production of polyunsaturated fatty acids in an organism, advantageously in a eukaryotic organism, preferably in a plant or a microorganism. This objective was achieved by the method according to the invention for the preparation of compounds of formula I O CH CH CH 3 1 (IN) 2 2 R CH CH CH 2 n m p in transgenic organisms with a content of at least 1% by weight of these compounds based on the total lipid content of the transgenic organism, which includes the following process steps: a) introduction into the organism of at least one nucleic acid sequence that codes for a 9-elongase and / or a 6-desaturase activity and b) introduction into the organism of at least one nucleic acid sequence which codes for a 8-desaturase and / or a 6-elongase activity and c) introduction into the organism of at least one nucleic acid sequence that codes for a 5- desaturase activity and d) introduction into the organism of at least one nucleic acid sequence that codes for a 5- elongase activity and e) introduction into the organism of at least one nucleic acid sequence that codes for a 4- desaturase activity and where the variables and substituents in formula I have the following meanings: 1 R = hydroxyl, coenzyme A (thioester), lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylglycerol, lysodiphosphatidylglycerol, lysophosphatidylserine, lysophosphatidylinositol, sphingobase or a residue of formula II 2 H C O R 2 3 (II) HC O R HCO 2 where 2 R = hydrogen, lysophosphatidyl choline, lysophosphatidylethanolamine, lysophosphatidylglycerol, lysodiphosphatidylglycerol, lysophosphatidylserine, lysophosphatidylinositol or saturated or unsaturated C -C -alkylcarbonyl, 2 24 3 2 3 R = hydrogen, saturated or unsaturated C -C -alkylcarbonyl or R and R independently of 2 24 each other is a residue of formula Ia: O CH CH CH 3 (Ia) 2 2 CH CH CH 2 n m p where n = 2, 3, 4, 5, 6, 7 or 9, m = 2, 3, 4, 5 or 6 and p = 0 or 3. 1 R in formula I is hydroxyl, coenzyme A (thioester), lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylglycerol, lysodiphosphatidylglycerol, lysophosphatidylserine, lysophosphatidylinositol, sphingobase or a residue of formula II 2 H C O R 2 3 (II) HC O R HCO 2 1 The above-mentioned residues in R are always bound to the compounds of formula I in the form of their thioesters. 2 R in formula II is hydrogen, lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylglycerol, lysodiphosphatidylglycerol, lysophosphatidylserine, lysophosphatidylinositol or saturated or unsaturated C -C -alkylcarbonyl. 2 24 Alkyl radicals that can be mentioned are substituted or unsubstituted, saturated or unsaturated C -C -alkylcarbonyl chains such as ethylcarbonyl, n-propylcarbonyl, 2 24 n-butylcarbonyl, n-pentylcarbonyl, n-hexylcarbonyl, n-heptylcarbonyl, n-octylcarbonyl, n-nonylcarbonyl, n-decylcarbonyl, n-undecylcarbonyl, n-dodecylcarbonyl, n-tridecyl- carbonyl, n-tetradecylcarbonyl, n-pentadecylcarbonyl, n-hexadecylcarbonyl, n-hepta- decylcarbonyl, n-octadecylcarbonyl-, n-nonadecylcarbonyl, n-eicosylcarbonyl, n-docosanylcarbonyl or n-tetracosanylcarbonyl, comprising one or more double bonds. Saturated or unsaturated C -C -alkylcarbonyl radicals such as n-decyl- 10 22 carbonyl, n-undecylcarbonyl, n-dodecylcarbonyl, n-tridecylcarbonyl, n-tetradecyl- carbonyl, n-pentadecylcarbonyl, n-hexadecylcarbonyl, n-heptadecylcarbonyl, n-octadecylcarbonyl, n-nonadecylcarbonyl, n-eicosylcarbonyl, n-docosanylcarbonyl or n-tetracosanylcarbonyl, which comprises one or more double bonds is preferred. Particularly preferred are saturated and / or unsaturated C -C - 10 22 alkylcarbonyl radicals such as C -alkylcarbonyl, C -alkylcarbonyl, C -alkylcarbonyl, C - 10 11 12 13 alkylcarbonyl, C -alkylcarbonyl, C -alkylcarbonyl, C -alkylcarbonyl, C -alkylcarbonyl 14 16 18 20 or C -alkylcarbonyl radicals comprising one or more double bonds. A lot 22 particularly preferred are saturated or unsaturated C -C -alkylcarbonyl radicals such as 16 22 C -alkylcarbonyl, C -alkylcarbonyl, C -alkylcarbonyl or C -alkylcarbonyl residues such as 16 18 20 22 comprises one or more double bonds. These advantageous residues may include two, three, four, five or six double bonds. The particularly preferred residues with 20 or 22 carbon atoms in the fatty acid chain comprise up to six double bonds, advantageously three, four, five or six double bonds, especially preferably five or six double bonds. All the above-mentioned residues are derived from the corresponding fatty acids. 3 R in formula II is hydrogen, saturated or unsaturated C -C -alkylcarbonyl. 2 24 Alkyl radicals that can be mentioned are substituted or unsubstituted, saturated or unsaturated C -C -alkylcarbonyl chains, such as ethylcarbonyl, n-propylcarbonyl, 2 24 n-butylcarbonyl, n-pentylcarbonyl, n-hexylcarbonyl, n-heptylcarbonyl, n-octylcarbonyl, n-nonylcarbonyl, n-decylcarbonyl, n-undecylcarbonyl, n-dodecylcarbonyl, n-tridecyl- carbonyl, n-tetradecylcarbonyl, n-pentadecylcarbonyl, n-hexadecylcarbonyl, n-hepta- decylcarbonyl, n-octadecylcarbonyl-, n-nonadecylcarbonyl, n-eicosylcarbonyl, n-docosanylcarbonyl or n-tetracosanylcarbonyl, comprising one or more double bonds. Saturated or unsaturated C -C -alkylcarbonyl radicals such as n-decyl- 10 22 carbonyl, n-undecylcarbonyl, n-dodecylcarbonyl, n-tridecylcarbonyl, n-tetradecyl- carbonyl, n-pentadecylcarbonyl, n-hexadecylcarbonyl, n-heptadecylcarbonyl, n-octadecylcarbonyl, n-nonadecylcarbonyl, n-eicosylcarbonyl, n-docosanylcarbonyl or n-tetracosanylcarbonyl, comprising one or more double bonds is preferred. Particularly preferred are saturated and / or unsaturated C10-C22 alkylcarbonyl radicals such as C -alkylcarbonyl, C -alkylcarbonyl, C -alkylcarbonyl, C -alkylcarbonyl, 10 11 12 13 C -alkylcarbonyl, C -alkylcarbonyl, C -alkylcarbonyl, C -alkylcarbonyl or 14 16 18 20 C22-alkylcarbonyl residues comprising one or more double bonds. Very special preferred are saturated or unsaturated C -C -alkylcarbonyl radicals such as 16 22 C -alkylcarbonyl, C -alkylcarbonyl, C -alkylcarbonyl or C -alkylcarbonyl residues such as 16 18 20 22 comprises one or more double bonds. These advantageous residues may include two, three, four, five or six double bonds. The particularly preferred residues with 20 or 22 carbon atoms in the fatty acid chain comprise up to six double bonds, advantageously three, four, five or six double bonds, particularly preferably five or six double bonds. All the above-mentioned residues are derived from the corresponding fatty acids. 1 2 3 The above-mentioned residues R, R and R can be substituted with hydroxyl and / or epoxy groups and / or may include triple bonds. The polyunsaturated fatty acids produced by the method according to the invention advantageously comprises at least two, advantageously three, four, five or six, double bonds. The fatty acids which are particularly advantageous comprise four, five or six double bonds. Fatty acids produced by the method advantageously have 18, 20 or 22 C atoms in them the fatty acid chain; the fatty acids preferably comprise 20 or 22 carbon atoms i the fatty acid chain. Saturated fatty acids are advantageously converted to a lesser extent or not at all in it all of the nucleic acids used in the method. To a lesser extent shall be understood to mean that the saturated fatty acids are converted with less than 5% of the activity, beneficial less than 3%, particularly advantageously less than 2%, very particularly preferably with less than 1, 0.5, 0.25 or 0.125% of the activity compared to polyunsaturated fatty acids. These fatty acids that are produced can be produced by the method as a single product or be present in a fatty acid mixture. The nucleic acid sequences used in the method according to the invention are isolated nucleic acid sequences encoding polypeptides with 9-elongase-, 6-desaturase-, 8-desaturase-, 6-elongase-, 5-desaturase-, 5-elongase- and / or 4-desaturase activity. Nucleic acid sequences which are advantageously used in the method according to invention are those that code for polypeptides with 9-elongase-, 6-desaturase-, 8- desaturase, 6-elongase, 5-desaturase, 5-elongase or 4-desaturase activity, selected from the group consisting of: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183, or b) nucleic acid sequences which, as a result of degeneration of the genetic code, can be derived from the amino acid sequences shown in SEQ ID NO: 2, SEQ ID NO NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 132 or SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 or SEQ ID NO: 184, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 3 ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NR: 183, which codes for polypeptides with at least 40% identity at the amino acid level with SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, , SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 92, SEQ ID NO: ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 132 or SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 or SEQ ID NO: 184 and who have 9-elongase-, 6-desaturase-, 8-desaturase-, 6-elongase-, 5-desaturase-, 5-elongase or 4-desaturase activity. 2 3 The substituents R or R in formulas I and II are advantageous and independent of mutually saturated or unsaturated C -C -alkylcarbonyl, particularly advantageous are those, 18 22 independently of each other, unsaturated C -, C - or C -alkylcarbonyl with at least two 18 20 22 double bonds. A preferred embodiment of the method is characterized in that a nucleic acid sequence encoding polypeptides with ω3-desaturase activity selected from the group consisting of: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 87 or SEQ ID NO NO: 105, or b) nucleic acid sequences which, as a result of degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 88 or SEQ ID NO NO: 106, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 87 or SEQ ID NO: 105 which encode polypeptides with at least 60% identity at the amino acid level with SEQ ID NO: 88 or SEQ ID NO: 106 and which has ω3-desaturase activity. in addition, is introduced into the organism. In a further preferred embodiment, the method further comprises introduction into the organism of a nucleic acid sequence that codes for polypeptides with 12-desaturase activity, selected from the group consisting of: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 107 or SEQ ID NO NO: 109 or b) nucleic acid sequences which, as a result of degeneration of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 108 or SEQ ID NO: 110, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 107 or SEQ ID NO NO: 109 which codes for polypeptides with at least 60% identity at the amino acid level with SEQ ID NO: 108 or SEQ ID NO: 110 and which have 12-desaturase- Activity. These above-mentioned 12-desaturase sequences can be used together with the nucleic acid sequences used in the method and which code for 9-elongases, 6-desaturases, 8-desaturases, 6-elongases, 5-desaturases, 5-elongases and / or 4-desaturases, alone or in combination with the ω3-desaturase sequences. Table 1 shows the nucleic acid sequences, the organism of origin and the sequence ID number. No. Organism Activity Sequence number 1. Euglena gracilis Δ8-desaturase SEQ ID NO: 1 No. Organism Activity Sequence number 2. Isochrysis galbana Δ9-elongase SEQ ID NO: 3 3. Phaedodactylum tricornutum Δ5-desaturase SEQ ID NO: 5 4. Ceratodon pupureus Δ5-desaturase SEQ ID NO: 7 5. Physcomitrella patens Δ5-desaturase SEQ ID NO: 9 6. Thraustrochytrium sp. Δ5-desaturase SEQ ID NO: 11 7. Mortierella alpina Δ5-desaturase SEQ ID NO: 13 8. Caenorhabditis elegans Δ5-desaturase SEQ ID NO: 15 9. Borago officinalis Δ6-desaturase SEQ ID NO: 17 10. Ceratodon purpureus Δ6-desaturase SEQ ID NO: 19 11. Phaeodactylum tricornutum Δ6-desaturase SEQ ID NO: 21 12. Physcomitrella patens Δ6-desaturase SEQ ID NO: 23 13. Caenorhabditis elegans Δ6-desaturase SEQ ID NO: 25 14. Physcomitrella patens Δ6-elongase SEQ ID NO: 27 15. Thraustrochytrium sp. Δ6-elongase SEQ ID NO: 29 16. Phytopthera infestans Δ6-elongase SEQ ID NO: 31 17. Mortierella alpina Δ6-elongase SEQ ID NO: 33 18. Mortierella alpina Δ6-elongase SEQ ID NO: 35 19. Caenorhabditis elegans Δ6-elongase SEQ ID NO: 37 20. Euglena gracilis Δ4-desaturase SEQ ID NO: 39 21. Thraustrochytrium sp. Δ4-desaturase SEQ ID NO: 41 22. Thalassiosira pseudonana Δ5-elongase SEQ ID NO: 43 23. Thalassiosira pseudonana Δ6-elongase SEQ ID NO: 45 24. Crypthecodinium cohnii Δ5-elongase SEQ ID NO: 47 25. Crypthecodinium cohnii Δ5-elongase SEQ ID NO: 49 26. Oncorhynchus mykiss Δ5-elongase SEQ ID NO: 51 27. Oncorhynchus mykiss Δ5-elongase SEQ ID NO: 53 28. Thalassiosira pseudonana Δ5-elongase SEQ ID NO: 59 29. Thalassiosira pseudonana Δ5-elongase SEQ ID NO: 61 No. Organism Activity Sequence number 30. Thalassiosira pseudonana Δ5-elongase SEQ ID NO: 63 31. Thraustrochytrium aureum Δ5-elongase SEQ ID NO: 65 32. Ostreococcus tauri Δ5-elongase SEQ ID NO: 67 33. Ostreococcus tauri Δ6-elongase SEQ ID NO: 69 34. Primula farinosa Δ6-desaturase SEQ ID NO: 71 35. Primula vialii Δ6-desaturase SEQ ID NO: 73 36. Ostreococcus tauri Δ5-elongase SEQ ID NO: 75 37. Ostreococcus tauri Δ5-elongase SEQ ID NO: 77 38. Ostreococcus tauri Δ5-elongase SEQ ID NO: 79 39. Ostreococcus tauri Δ6-elongase SEQ ID NO: 81 40. Thraustrochytrium sp. Δ5-elongase SEQ ID NO: 83 41. Thalassiosira pseudonana Δ5-elongase SEQ ID NO: 85 42. Phytopthora infestans ω3-desaturase SEQ ID NO: 87 43. Ostreococcus tauri Δ6-desaturase SEQ ID NO: 89 44. Ostreococcus tauri Δ5-desaturase SEQ ID NO: 91 45. Ostreococcus tauri Δ5-desaturase SEQ ID NO: 93 46. ​​Ostreococcus tauri Δ4-desaturase SEQ ID NO: 95 47. Thalassiosira pseudonana Δ6-desaturase SEQ ID NO: 97 48. Thalassiosira pseudonana Δ5-desaturase SEQ ID NO: 99 49. Thalassiosira pseudonana Δ5-desaturase SEQ ID NO: 101 50. Thalassiosira pseudonana Δ4-desaturase SEQ ID NO: 103 51. Thalassiosira pseudonana ω3-desaturase SEQ ID NO: 105 52. Ostreococcus tauri Δ12-desaturase SEQ ID NO: 107 53. Thalassiosira pseudonana Δ12-desaturase SEQ ID NO: 109 54. Ostreococcus tauri Δ6-elongase SEQ ID NO: 111 55. Ostreococcus tauri Δ5-elongase SEQ ID NO: 113 56. Xenopus laevis (BC044967) Δ5-elongase SEQ ID NO: 117 57. Ciona intestinalis (AK112719) Δ5-elongase SEQ ID NO: 119 No. Organism Activity Sequence number 58. Euglena gracilis Δ5-elongase SEQ ID NO: 131 59. Euglena gracilis Δ5-elongase SEQ ID NO: 133 60. Arabidopsis thaliana Δ5-elongase SEQ ID NO: 135 61. Arabidopsis thaliana Δ5-elongase SEQ ID NO: 137 62. Phaeodactylum tricornutum Δ6-elongase SEQ ID NO: 183 The polyunsaturated fatty acids produced by the method are advantageously bound in membrane lipids and / or triacylglycerides, but can also occur in the organisms that free fatty acids or otherwise bound in the form of other fatty acid esters. In this context they can be present as "pure products" or otherwise advantageously in the form of mixtures of different fatty acids or mixtures of different glycerides. The different Fatty acids bound in the triacylglycerides can be derived from short-chain fatty acids with 4 to 6 C atoms, medium-chain fatty acids with 8 to 12 C atoms or long-chain fatty acids with 14 to 24 C atoms, preferred are long-chain fatty acids, more preferred long-chain polyunsaturated fatty acids with 18, 20 and / or 22 C atoms. The method according to the invention advantageously yields fatty acid esters with polyunsaturated C -, C - and / or C - fatty acid molecules with at least two double bonds in them 18 20 22 the fatty acid ester, advantageously having at least three, four, five or six double bonds in it the fatty acid ester, particularly advantageously having at least five or six double bonds in it Δ9.12 the fatty acid ester and advantageously leads to the synthesis of linoleic acid (=LA, C18:2 ), γ- Δ6,9,12 Δ6,9,12,15 linolenic acid (= GLA, C18:3 ), stearidonic acid (= SDA, C18:4 ), dihomo-γ- Δ8,11,14 Δ5,8,11,14 linolenic acid (= DGLA, 20:3 ), ω3-eicosatetraenoic acid (= ETA, C20:4 ), Δ5,8,11,14 Δ5,8,11,14,17 arachidonic acid (ARA, C20:4 ), eicosapentaenoic acid (EPA, C20:5 ), 4,7,10,13,16 ,7,10,13,16 ω6-docosapentaenoic acid (C22:5 ), ω6-docosatetraenoic acid (C22:4 ), 7,10,13,16,19 ω3-docosapentaenoic acid (= DPA, C22:5 ), docosahexaenoic acid (= DHA, 4,7,10,13,16,19 C22:6 ) or mixtures thereof, preferably ARA, EPA and / or DHA. ω3 fatty acids such as EPA and / or DHA are very particularly preferably produced. Fatty acid esters with polyunsaturated C -, C - and / or C - fatty acid molecules can be isolated in 18 20 22 form of oil or lipid, for example in the form of compounds such as sphingolipids, phosphoglycerides, lipids, glycolipids such as glycosphingolipids, phospholipids such as phosphatidylethanolamine, phosphatidylcholine, phosphatidylserine, phosphatidylglycerol, phosphatidylinositol or diphosphatidylglycerol, monoacylglycerides, diacylglycerides, triacylglycerides or other fatty acid esters such as acetyl-coenzyme A esters which include the polyunsaturated ones fatty acids with at least two, three, four, five or six, preferably five or six double bonds, from the organisms that have been used for the production of the fatty acid esters; preferably they are isolated in the form of their diacylglycerides, triacylglycerides and / or in the form of phosphatidylcholine, particularly preferably in the form of the triacylglycerides. In addition to these esters, the polyunsaturated fatty acids are also present in the organisms, preferably the plants, as free fatty acids or bound to other compounds. As a rule, the various compounds mentioned above (fatty acid esters and free fatty acids) are present present in the organisms with an approximate distribution of 80 to 90% by weight of triglycerides, 2 to 5% by weight of diglycerides, 5 to 10% by weight of monoglycerides, 1 to 5% by weight of free fatty acids, 2 to 8% by weight of phospholipids, the total for the various compounds being 100 weight%. The method according to the invention produces LCPUFA produced with a content of at least 3% by weight, advantageously at least 5% by weight, preferably at least 8% by weight, esp preferably at least 10% by weight, most preferably at least 15% by weight, based on the total fatty acids in the transgenic organisms, preferably in a transgenic plant. In this context, it is advantageous to convert C - and / or C -fatty acids that are present in 18 20 the host organisms to at least 10%, preferably at least 20%, especially preferably at least 30%, most preferably at least 40%, to give the corresponding products such as DPA or DHA, to name just two examples. The fatty acids are advantageously produced in bound form. These unsaturated fatty acids can, with the help of the nucleic acids, be used in the method according to the invention, be positioned in the sn1, sn2 and / or sn3 position of the advantageous produced triglycerides. Since a number of reaction steps are carried out with the starting compounds linoleic acid (C18:2) and linolenic acid (C18:3) in the process according to the invention, the end products of the method are as for example arachidonic acid (ARA), eicosapentaenoic acid (EPA) ω6-docosapentaenoic acid or DHA do not obtained as absolutely pure products; minor traces of the precursors are always present in the final product. If, for example, both linoleic acid and linolenic acid are present in the starting organism and the starting plant, the end products are such as ARA, EPA or DHA present as mixtures. The precursors should preferably not be more than 20% by weight, preferably not more than 15% by weight, especially preferably not more than 10% by weight, most preferably no more than 5% by weight, based on the amount of the subject matter the final product. Advantageously, only ARA, EPA or only DHA, bound or as free acids, produced as end products in a transgenic plant by the method according to the invention. If the compounds ARA, EPA and DHA are produced at the same time, they become advantageously produced in a ratio of at least 1:1:2 (EPA:ARA:DHA), advantageously at least 1:1:3, preferably 1:1:4, especially preferably 1:1:5. Fatty acid esters or fatty acid mixtures produced by the method according to the invention advantageously comprises 6 to 15% palmitic acid, 1 to 6% stearic acid, 7-85% oleic acid, 0.5 to 8% vaccenic acid, 0.1 to 1% of araic acid, 7 to 25% of saturated fatty acids, 8 to 85% of monounsaturated fatty acids and 60 to 85% of polyunsaturated fatty acids, in each case based on 100% and on the total fatty acid content of the organisms. Beneficial are polyunsaturated fatty acids that are present in fatty acid esters or fatty acid mixtures preferably at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 or 1% of arachidonic acid, based on the total fatty acid content. Furthermore, fatty acid esters or fatty acid mixtures produced by the method according to the invention advantageous fatty acids selected from the group of fatty acids erucic acid (13-docosaenoic acid), sterculic acid (9,10-methyleneoctadec-9-enoic acid), malvalic acid (8,9-methyleneheptadec-8- enoic acid), chaulmoogric acid (cyclopentendodecanoic acid), furan fatty acid (9,12-epoxyocta- deca-9,11-dienoic acid), vernolic acid (9,10-epoxyoctadec-12-enoic acid), taryric acid (6- octadecynic acid), 6-nonadecynic acid, santalbic acid (t11-octadecen-9-ynic acid), 6,9- octadecenynic acid, pyruvic acid (t10-heptadecen-8-ynic acid), crepenynic acid (9- octadecen-12-ynic acid), 13,14-dihydrooropheic acid ("13,14-dihydrooropheic acid") Octadecen-13-ene-9,11-dienoic acid, petroselenic acid (cis-6-octadecenoic acid), 9c,12t-octa- decadienoic acid, calendula acid (8t10t12c-octadecatrienoic acid), catalpinic acid (9t11t13c- octadecatrienoic acid), eleostearic acid (9c11t13t-octadedecatrienoic acid), jacaric acid (8c10t12c-octadecatrienoic acid), punicic acid (9c11t13c-octadecatrienoic acid), parinaric acid (9c11t13t15c-octadecatetraenoic acid), pinolenic acid (all-cis-5,9,12-octadecatrienoic acid), labalenic acid (5,6-octadecadienalleic acid), castor oleic acid (12-hydroxyoleic acid) and / or coriolic acid (13-hydroxy-9c,11t-octadecadienoic acid). The above mentioned fatty acids are usually beneficially found only in trace amounts in fatty acid esters or fatty acid mixtures produced by the method according to the invention, that is to say, based on the total fatty acids, that they occur as less than 30%, preferably less than 25%, 24%, 23%, 22% or 21%, especially preferably less than 20%, 15%, 10%, 9%, 8%, 7%, 6% or 5%, very particularly preferably less than 4%, 3%, 2% or 1%. In a in a further preferred form according to the invention, these above-mentioned fatty acids occur such as less than 0.9%, 0.8%, 0.7%, 0.6% or 0.5%, especially preferably less than 0.4%, 0.3%, 0.2%, 0.1%, based on the total fatty acids. Fatty acid esters or fatty acid mixtures produced by the method according to the invention comprise advantageously less than 0.1%, based on the total fatty acids and / or no butyric acid, Δ4,8,12,15,21 no cholesterol, no clupanodonic acid (= docosapentaenoic acid, C22:5 ) and Δ3,8,12,15,18,21 no nisinic acid (tetracosahexaenoic acid, C23:6 ). Because of the nucleic acid sequences or nucleic acid sequences used by the method according to the invention, an increase in the yield of polyunsaturated fatty acids of at least 50%, advantageously at least 80%, particularly advantageously at least 100%, very particularly advantageous at least 150% compared to the non-transgenic starting organism, for for example a yeast, an algae, a fungus or a plant such as arabidopsis or linseed, is obtained when the fatty acids are detected by GC analysis (see examples). Chemically pure polyunsaturated fatty acids or fatty acid preparations can also be used are synthesized by the processes described above. For this purpose, the fatty acids or the fatty acid preparations isolated from the organisms, such as the microorganisms or plants or the culture medium in or on which the organisms are grown or from the organism and the culture medium, in a known manner, for example via extraction, distillation, crystallization, chromatography or a combination of these methods. These chemically clean fatty acids or fatty acid preparations are advantageous for use in the food industry sector, cosmetic sector and especially the pharmaceutical industry sector. Suitable organisms for production by the method according to the invention are i principle any organisms such as microorganisms, non-human animals or plants. Plants that are suitable are, in principle, all plants that can synthesize fatty acids, such as all dicotyledonous or monocotyledonous plants, algae or mosses. Beneficial plants are selected from the group of plant families Adelotheciaceae, Anacardiaceae, Asteraceae, Apiaceae, Betulaceae, Boraginaceae, Brassicaceae, Bromeliaceae, Caricaceae, Cannabaceae, Convolvulaceae, Chenopodiaceae, Crypthecodiniaceae, Cucurbitaceae, Ditrichaceae, Elaeagnaceae, Ericaceae, Euphorbiaceae, Fabaceae, Geraniaceae, Gramineae, Juglandaceae, Lauraceae, Leguminosae, Linaceae, Euglenaceae, Prasinophyceae or useful or ornamental plants such as Tagetes. Examples that can be mentioned are the following plants selected from the existing group of: Adelotheciaceae so as the genera Physcomitrella, for example the genus and species Physcomitrella patens, Anacardiaceae as well as the genera Pistacia, Mangifera, Anacardium, for example the genus and species Pistacia vera [pistachio], Mangifer indica [mango] or Anacardium occidentale [cashew], Asteraceae, so as the genera Calendula, Carthamus, Centaurea, Cichorium, Cynara, Helianthus, Lactuca, Locusta, Tagetes, Valeriana, for example the genus and species Calendula officinalis [common velvet flower], Carthamus tinctorius [dye thistle], Centaurea cyanus [cornflower], Cichorium intybus [chicory], Cynara scolymus [artichoke], Helianthus annus [sunflower], Lactuca sativa, Lactuca crispa, Lactuca esculenta, Lactuca scariola L. ssp. sativa, Lactuca scariola L. var. integrata, Lactuca scariola L. var. integrifolia, Lactuca sativa subsp. romana, Locusta communis, Valeriana locusta [salad vegetable], Tagetes lucida, Tagetes erecta or Tagetes tenuifolia [African or noble velvet flower], Apiaceae, such as the genus Daucus, for example the genus and species Daucus carota [carrot], Betulaceae, such as the genus Corylus, for example the genus and species Corylus avellana or Corylus colurna [hazelnut], Boraginaceae, such as the genus Borago, for example the genus and species Borago officinalis [cucumber], Brassicaceae, such as the genera Brassica, Camelina, Melanosinapis, Sinapis, Arabadopsis, for example the genus and species Brassica napus, Brassica rapa ssp. [rapeseed], Sinapis arvensis Brassica juncea, Brassica juncea was. juncea, Brassica juncea var. crispifolia, Brassica juncea var. foliosa, Brassica nigra, Brassica sinapioides, Camelina sativa, Melanosinapis communis [mustard], Brassica oleracea [fodder beet] or Arabidopsis thaliana, Bromeliaceae, such as the genera Anana, Bromelia (pineapple), for example the genera and species Anana comosus, Ananas ananas or Bromelia comosa [pineapple], Caricaceae, such as the genus Carica, so as the genus and species Carica papaya [papaya], Cannabaceae, so as the genus Cannabis, such as the genus and species Cannabis sativa [hemp], Convolvulaceae, such as the genera Ipomea, Convolvulus, for example the genera and species Ipomoea batatus, Ipomoea pandurata, Convolvulus batatas, Convolvulus tiliaceus, Ipomoea fastigiata, Ipomoea tiliacea, Ipomoea triloba or Convolvulus panduratus [sweet potato], Chenopodiaceae, so as the genus Beta, so as the genera and species Beta vulgaris, Beta vulgaris var. altissima, Beta vulgaris var. vulgaris, Beta maritima, Beta vulgaris var. perennial, Beta vulgaris var. conditiva or Beta vulgaris var. esculenta [sugar beet], Crypthecodiniaceae, such as the genus Crypthecodinium, for example the genus and species Cryptecodinium cohnii, Cucurbitaceae, such as the genus Cucurbita, for example the genera and species Cucurbita maxima, Cucurbita mixta, Cucurbita pepo or Cucurbita moschata [pumpkin / squash], Cymbellaceae, such as the genera Amphora, Cymbella, Okedenia, Phaeodactylum, Reimeria, for example the genus and species Phaeodactylum tricornutum, Ditrichaceae, such as the genera Ditrichaceae, Astomiopsis, Ceratodon, Chrysoblastella, Ditrichum, Distichium, Eccremidium, Lophidion, Philibertiella, Pleuridium, Saelania, Trichodon, Skottsbergia, for example the genera and species Ceratodon antarcticus, Ceratodon columbiae, Ceratodon heterophyllus, Ceratodon purpurascens, Ceratodon purpureus, Ceratodon purpureus ssp. convolutus, Ceratodon purpureus ssp. stenocarpus, Ceratodon purpureus var. rotundifolius, Ceratodon ratodon, Ceratodon stenocarpus, Chrysoblastella chilensis, Ditrichum ambiguum, Ditrichum brevisetum, Ditrichum crispatissimum, Ditrichum difficile, Ditrichum falcifolium, Ditrichum flexicaule, Ditrichum giganteum, Ditrichum heteromallum, Ditrichum lineare, Ditrichum lineare, Ditrichum montanum, Ditrichum montanum, Ditrichum pallidum, Ditrichum punctulatum, Ditrichum pusillum, Ditrichum pusillum var. tortile, Ditrichum rhynchostegium, Ditrichum schimperi, Ditrichum tortile, Distichium capillaceum, Distichium hagenii, Distichium inclinatum, Distichium macounii, Eccremidium floridanum, Eccremidium whiteleggei, Lophidion strictus, Pleuridium acuminatum, Pleuridium alternifolium, Pleuridium holdridgei, Pleuridium mexicanum, Pleuridium ravenelii, Pleuridium subulatum, Saelania glaucescens, Trichodon borealis, Trichodon cylindricus or Trichodon cylindricus var. oblongus, Elaeagnaceae, such as the genus Elaeagnus, for example the genus and species Olea europaea [olive], Ericaceae, such as the genus Kalmia, for example the genera and species Kalmia latifolia, Kalmia angustifolia, Kalmia microphylla, Kalmia polifolia, Kalmia occidentalis, Cistus chamaerhodendros or Kalmia lucida [mountain laurel], Euglenaceae, so the genera Ascoglena, Astasia, Colacium, Cyclidiopsis, Euglena, Euglenopsis, Hyalaphacus, Khawkinea, Lepocinclis, Phacus, Strombomonas, Trachelomonas, for example the genus and species Euglena gracilis; Euphorbiaceae, such as the genera Manihot, Janipha, Jatropha, Ricinus, for example the genera and species Manihot utilissima, Janipha manihot, Jatropha manihot, Manihot aipil, Manihot dulcis, Manihot manihot, Manihot melanobasis, Manihot esculenta [cassava] or Ricinus communis [castor oil plant], Fabaceae, such as the genera Pisum, Albizia, Cathormion, Feuillea, Inga, Pithecolobium, Acacia, Mimosa, Medicajo, Glycine, Dolichos, Phaseolus, soybean, for example the genera and species Pisum sativum, Pisum arvense, Pisum humile [pea], Albizia berteriana, Albizia julibrissin, Albizia lebbeck, Acacia berteriana, Acacia littoralis, Albizia berteriana, Albizzia berteriana, Cathormion berteriana, Feuillea berteriana, Inga fragrans, Pithecellobium berterianum, Pithecellobium fragrans, Pithecolobium berterianum, Pseudalbizzia berteriana, Acacia julibrissin, Acacia nemu, Albizia nemu, Feuilleea julibrissin, Mimosa julibrissin, Mimosa speciosa, Sericanrda julibrissin, Acacia lebbeck, Acacia macrophylla, Albizia lebbeck, Feuilleea lebbeck, Mimosa lebbeck, Mimosa speciosa, Medicago sativa, Medicago falcata, Medicago varia [alfalfa] Glycine max Dolichos soja, Glycine gracilis, Glycine hispida, Phaseolus max, Soja hispida or Soja max [soybean], Funariaceae, such as the genera Aphanorrhegma, Entosthodon, Funaria, Physcomitrella, Physcomitrium, for example the genera and species Aphanorrhegma serratum, Entosthodon attenuatus, Entosthodon bolanderi, Entosthodon bonplandii, Entosthodon californicus, Entosthodon drummondii, Entosthodon jamesonii, Entosthodon leibergii, Entosthodon neoscoticus, Entosthodon rubrisetus, Entosthodon spathulifolius, Entosthodon tucsoni, Funaria americana, Funaria bolanderi, Funaria calcarea, Funaria californica, Funaria calvescens, Funaria convoluta, Funaria flavicans, Funaria groutiana, Funaria hygrometrica, Funaria hygrometrica var. arctica, Funaria hygrometrica var. calvescens, Funaria hygrometrica our. convoluta, Funaria hygrometrica var. muralis, Funaria hygrometrica var. utahensis, Funaria microstoma, Funaria microstoma var. obtusifolia, Funaria muhlenbergii, Funaria orcuttii, Funaria plano-convexa, Funaria polaris, Funaria ravenelii, Funaria rubriseta, Funaria serrata, Funaria sonorae, Funaria sublimbatus, Funaria tucsoni, Physcomitrella californica, Physcomitrella patens, Physcomitrella readeri, Physcomitrium australe, Physcomitrium californicum, Physcomitrium collenchymatum, Physcomitrium coloradense, Physcomitrium cupuliferum, Physcomitrium drummondii, Physcomitrium eurystomum, Physcomitrium flexifolium, Physcomitrium hookeri, Physcomitrium hookeri var. serratum, Physcomitrium immersum, Physcomitrium kellermanii, Physcomitrium megalocarpum, Physcomitrium pyriforme, Physcomitrium pyriform var. serratum, Physcomitrium rufipes, Physcomitrium sandbergii, Physcomitrium subsphaericum, Physcomitrium washingtoniense, Geraniaceae, such as the genera Pelargonium, Cocos, Oleum, for example the genera and species Cocos nucifera, Pelargonium grossularioides or Oleum cocois [coconut], Gramineae, such as the genus Saccharum, for example the genus and species Saccharum officinarum, Juglandaceae, such as the genera Juglans, Wallia, for example the genera and species Juglans regia, Juglans ailanthifolia, Juglans sieboldiana, Juglans cinerea, Wallia cinerea, Juglans bixbyi, Juglans californica, Juglans hindsii, Juglans intermedia, Juglans jamaicensis, Juglans major, Juglans microcarpa, Juglans nigra or Wallia nigra [walnut], Lauraceae, such as the genera Persea, Laurus, for example the genera and the species Laurus nobilis [laurel], Persea americana, Persea gratissima or Persea persea [avocado], Leguminosae, such as the genus Arachis, for example the genus and the species Arachis hypogaea [groundnut], Linaceae, such as the genus Adenolinum, for example the genera and species Linum usitatissimum, Linum humile, Linum austriacum, Linum beenne, Linum angustifolium, Linum catharticum, Linum flavum, Linum grandiflorum, Adenolinum grandiflorum, Linum lewisii, Linum narbonense, Linum perenne, Linum the perennial was. lewisii, Linum pratense or Linum trigynum [linseed], Lythrarieae, such as the genus Punica, for example the genus and species Punica granatum [pomegranate], Malvaceae, such as the genus Gossypium, for example the genera and species Gossypium hirsutum, Gossypium arboreum, Gossypium barbadense, Gossypium herbaceum or Gossypium thurberi [cotton], Marchantiaceae, so as the genus Marchantia, for for example the genera and species Marchantia berteroana, Marchantia foliacea, Marchantia macropora, Musaceae, such as the genus Musa, for example the genera and species Musa nana, Musa acuminata, Musa paradisiaca, Musa spp. [banana], Onagraceae, such as the genera Camissonia, Oenothera, for example the genera and species Oenothera biennis or Camissonia brevipes [night light], Palmae, such as the genus Elaeis, for example the genus and species Elaeis guineensis [oil palm], Papaveraceae, such as for example the genus Papaver, for example the genera and species Papaver orientale, Papaver rhoeas, Papaver dubium [poppy], Pedaliaceae, such as the genus Sesamum, for example the genus and species Sesamum indicum [sesame], Piperaceae, such as the genera Piper, Artanthe, Peperomia, Steffensia, for example the genera and species Piper aduncum, Piper amalago, Piper angustifolium, Piper auritum, Piper betel, Piper cubeba, Piper longum, Piper nigrum, Piper retrofractum, Artanthe adunca, Artanthe elongata, Peperomia elongata, Piper elongatum, Steffensia elongata [cayenne pepper], Poaceae, such as the genera Hordeum, Secale, Avena, Sorghum, Andropogon, Holcus, Panicum, Oryza, Zea (maize), Triticum, for example the genera and species Hordeum vulgare, Hordeum jubatum, Hordeum murinum, Hordeum secalinum, Hordeum distichon Hordeum aegiceras, Hordeum hexastichon, Hordeum hexastichum, Hordeum irregulare, Hordeum sativum, Hordeum secalinum [barley], Secale cereale [rye], Avena sativa, Avena fatua, Avena byzantina, Avena fatua var. sativa, Avena hybrida [oats], Sorghum bicolor, Sorghum halepense, Sorghum saccharatum, Sorghum vulgare, Andropogon drummondii, Holcus bicolor, Holcus sorghum, Sorghum aethiopicum, Sorghum arundinaceum, Sorghum caffrorum, Sorghum cernuum, Sorghum dochna, Sorghum drummondii, Sorghum durra, Sorghum guineense, Sorghum lanceolatum, Sorghum nervosum, Sorghum saccharatum, Sorghum subglabrescens, Sorghum verticilliflorum, Sorghum vulgare, Holcus halepensis, Sorghum miliaceum, Panicum militaceum [millet], Oryza sativa, Oryza latifolia [rice], Zea mays [corn] Triticum aestivum, Triticum durum, Triticum turgidum, Triticum hybernum, Triticum macha, Triticum sativum or Triticum vulgare [wheat], Porphyridiaceae, such as the genera Chroothece, Flintiella, Petrovanella, Porphyridium, Rhodella, Rhodosorus, Vanhoeffenia, for example the genus and species Porphyridium cruentum, Proteaceae, so such as the genus Macadamia, for example the genus and species Macadamia intergrifolia [macadamia nut], Prasinophyceae, such as the genera Nephroselmis, Prasinococcus, Scherffelia, Tetraselmis, Mantoniella, Ostreococcus, for example the genera and species Nephroselmis olivacea, Prasinococcus capsulatus, Scherffelia dubia, Tetraselmis chui, Tetraselmis suecica, Mantoniella squamata, Ostreococcus tauri, Rubiaceae, such as the genus Coffea, for example the genera and species Coffea spp., Coffea arabica, Coffea canephora or Coffea liberica [coffee], Scrophulariaceae, such as the genus Verbascum, for example the genera and species Verbascum blattaria, Verbascum chaixii, Verbascum densiflorum, Verbascum lagurus, Verbascum longifolium, Verbascum lychnitis, Verbascum nigrum, Verbascum olympicum, Verbascum phlomoides, Verbascum phoenicum, Verbascum pulverulentum or Verbascum thapsus [royal candle], Solanaceae, such as the genera Capsicum, Nicotiana, Solanum, Lycopersicon, for example the genera and species Capsicum annuum, Capsicum annuum var. glabriusculum, Capsicum frutescens [pepper], Capsicum annuum [paprika], Nicotiana tabacum, Nicotiana alata, Nicotiana attenuata, Nicotiana glauca, Nicotiana langsdorffii, Nicotiana obtusifolia, Nicotiana quadrivalvis, Nicotiana repanda, Nicotiana rustica, Nicotiana sylvestris [tobacco], Solanum tuberosum [potato], Solanum melongena [eggplant] Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme, Solanum integrifolium or Solanum lycopersicum [tomato], Sterculiaceae, so such as the genus Theobroma, for example the genus and species Theobroma cacao [cocoa] or Theaceae, such as the genus Camellia, for example the genus and species Camellia sinensis [tea]. Beneficial microorganisms are, for example, fungi selected from the group of the families Chaetomiaceae, Choanephoraceae, Cryptococcaceae, Cunninghamellaceae, Demetiaceae, Moniliaceae, Mortierellaceae, Mucoraceae, Pythiaceae, Sacharomycetaceae, Saprolegniaceae, Schizosacharomycetaceae, Sodariaceae or Tuberculariaceae. Examples of microorganisms that can be mentioned are those from the groups: Choanephoraceae, such as the genera Blakeslea, Choanephora, such as the genera and the species Blakeslea trispora, Choanephora cucurbitarum, Choanephora infundibulifera our. cucurbitarum, Mortierellaceae, such as the genus Mortierella, for example the genera and the species Mortierella isabellina, Mortierella polycephala, Mortierella ramanniana, Mortierella vinacea, Mortierella zonata, Pythiaceae, such as the genera Phytium, Phytophthora, for example the genera and species Pythium debaryanum, Pythium intermedium, Pythium irregulare, Pythium megalacanthum, Pythium paroecandrum, Pythium sylvaticum, Pythium ultimum, Phytophthora cactorum, Phytophthora cinnamomi, Phytophthora citricola, Phytophthora citrophthora, Phytophthora cryptogea, Phytophthora drechsleri, Phytophthora erythroseptica, Phytophthora lateralis, Phytophthora megasperma, Phytophthora nicotianae, Phytophthora nicotianae var. parasitica, Phytophthora palmivora, Phytophthora parasitica, Phytophthora syringae, Saccharomycetaceae, such as the genera Hansenula, Pichia, Saccharomyces, Saccharomycodes, Yarrowia, for example the genera and species Hansenula anomala, Hansenula californica, Hansenula canadensis, Hansenula capsulata, Hansenula cifferrii, Hansenula glucozyma, Hansenula henricii, Hansenula holstii, Hansenula minuta, Hansenula nonfermentans, Hansenula philodendri, Hansenula polymorpha, Hansenula saturnus, Hansenula subpelliculosa, Hansenula wickerhamii, Hansenula wingei, Pichia alcoholophila, Pichia angusta, Pichia anomala, Pichia bispora, Pichia burtonii, Pichia canadensis, Pichia capsulata, Pichia carsonii, Pichia cellobiosa, Pichia cifferrii, Pichia farinosa, Pichia fermentans, Pichia finlandica, Pichia glucozyma, Pichia guilliermondii, Pichia haplophila, Pichia henricii, Pichia holstii, Pichia jadinii, Pichia lindnerii, Pichia membranaefaciens, Pichia methanolica, Pichia minuta var. minutes, Pichia minuta var. nonfermentans, Pichia norvegensis, Pichia ohmeri, Pichia pastoris, Pichia philodendri, Pichia pini, Pichia polymorpha, Pichia quercuum, Pichia rhodanensis, Pichia sargentensis, Pichia stipitis, Pichia strasburgensis, Pichia subpelliculosa, Pichia toletana, Pichia trehalophila, Pichia vini, Pichia xylosa, Saccharomyces aceti, Saccharomyces bailii, Saccharomyces bayanus, Saccharomyces bisporus, Saccharomyces capensis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces cerevisiae var. ellipsoideus, Saccharomyces chevalieri, Saccharomyces delbrueckii, Saccharomyces diastaticus, Saccharomyces drosophilarum, Saccharomyces elegans, Saccharomyces ellipsoideus, Saccharomyces fermentati, Saccharomyces florentinus, Saccharomyces fragilis, Saccharomyces heterogenicus, Saccharomyces hienipiensis, Saccharomyces inusitatus, Saccharomyces italicus, Saccharomyces kluyveri, Saccharomyces krusei, Saccharomyces lactis, Saccharomyces marxianus, Saccharomyces microellipsoides, Saccharomyces montanus, Saccharomyces norbensis, Saccharomyces oleaceus, Saccharomyces paradoxus, Saccharomyces pastorianus, Saccharomyces pretoriensis, Saccharomyces rosei, Saccharomyces rouxii, Saccharomyces uvarum, Saccharomycodes ludwigii, Yarrowia lipolytica, Schizosacharomycetaceae such as the genera Schizosaccharomyces e.g. the species Schizosaccharomyces japonicus var. japonicus, Schizosaccharomyces japonicus var. versatilis, Schizosaccharomyces malidevorans, Schizosaccharomyces octosporus, Schizosaccharomyces pombe var. malidevorans, Schizosaccharomyces pombe var. pombe, Thraustochytriaceae such as the genera Althornia, Aplanochytrium, Japonochytrium, Schizochytrium, Thraustochytrium e.g. the species Schizochytrium aggregatum, Schizochytrium limacinum, Schizochytrium mangrovei, Schizochytrium minutum, Schizochytrium octosporum, Thraustochytrium aggregatum, Thraustochytrium amoeboideum, Thraustochytrium antacticum, Thraustochytrium arudimentale, Thraustochytrium aureum, Thraustochytrium benthicola, Thraustochytrium globosum, Thraustochytrium indicum, Thraustochytrium kerguelense, Thraustochytrium kinnei, Thraustochytrium motivum, Thraustochytrium multirudimental, Thraustochytrium pachydermum, Thraustochytrium proliferum, Thraustochytrium roseum, Thraustochytrium rossii, Thraustochytrium striatum or Thraustochytrium visurgense. Further beneficial microorganisms are, for example, bacteria selected from the group of families Bacillaceae, Enterobacteriacae or Rhizobiaceae. Examples that can be mentioned are the following microorganisms selected from the group consisting of: Bacillaceae, such as the genus Bacillus, such as the genera and species Bacillus acidocaldarius, Bacillus acidoterrestris, Bacillus alcalophilus, Bacillus amyloliquefaciens, Bacillus amylolyticus, Bacillus brevis, Bacillus cereus, Bacillus circulans, Bacillus coagulans, Bacillus sphaericus subsp. fusiformis, Bacillus galactophilus, Bacillus globisporus, Bacillus globisporus subsp. marinus, Bacillus halophilus, Bacillus lentimorbus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus polymyxa, Bacillus psychrosaccharolyticus, Bacillus pumilus, Bacillus sphaericus, Bacillus subtilis subsp. spizizenii, Bacillus subtilis subsp. subtilis or Bacillus thuringiensis; Enterobacteriacae such as the genera Citrobacter, Edwardsiella, Enterobacter, Erwinia, Escherichia, Klebsiella, Salmonella or Serratia, for example the genera and species Citrobacter amalonaticus, Citrobacter diversus, Citrobacter freundii, Citrobacter genomospecies, Citrobacter gillenii, Citrobacter intermedium, Citrobacter koseri, Citrobacter murliniae, Citrobacter sp., Edwardsiella hoshinae, Edwardsiella ictaluri, Edwardsiella tarda, Erwinia alni, Erwinia amylovora, Erwinia ananatis, Erwinia aphidicola, Erwinia billingiae, Erwinia cacticida, Erwinia cancerogena, Erwinia carnegieana, Erwinia carotovora subsp. atroseptica, Erwinia carotovora subsp. betavasculorum, Erwinia carotovora subsp. odorifera, Erwinia carotovora subsp. wasabiae, Erwinia chrysanthemi, Erwinia cypripedii, Erwinia dissolvens, Erwinia herbicola, Erwinia mallotivora, Erwinia milletiae, Erwinia nigrifluens, Erwinia nimipressuralis, Erwinia persicina, Erwinia psidii, Erwinia pyrifoliae, Erwinia quercina, Erwinia rhapontici, Erwinia rubrifaciens, Erwinia salicis, Erwinia stewartii, Erwinia tracheiphila, Erwinia uredovora, Escherichia adecarboxylata, Escherichia anindolica, Escherichia aurescens, Escherichia blattae, Escherichia coli, Escherichia coli was. communior, Escherichia coli-mutabile, Escherichia fergusonii, Escherichia hermannii, Escherichia sp., Escherichia vulneris, Klebsiella aerogenes, Klebsiella edwardsii subsp. atlantae, Klebsiella ornithinolytica, Klebsiella oxytoca, Klebsiella planticola, Klebsiella pneumoniae, Klebsiella pneumoniae subsp. pneumoniae, Klebsiella sp., Klebsiella terrigena, Klebsiella trevisanii, Salmonella ebony, Salmonella arizonae, Salmonella bongori, Salmonella choleraesuis subsp. arizonae, Salmonella choleraesuis subsp. bongori, Salmonella choleraesuis subsp. cholereasuis, Salmonella choleraesuis subsp. diarizonae, Salmonella choleraesuis subsp. houtenae, Salmonella choleraesuis subsp. indica, Salmonella choleraesuis subsp. salamae, Salmonella daressalaam, Salmonella enterica subsp. houtenae, Salmonella enterica subsp. salamae, Salmonella enteritidis, Salmonella gallinarum, Salmonella heidelberg, Salmonella panama, Salmonella senftenberg, Salmonella typhimurium, Serratia entomophila, Serratia ficaria, Serratia fonticola, Serratia grimesii, Serratia liquefaciens, Serratia marcescens, Serratia marcescens subsp. marcescens, Serratia marinorubra, Serratia odorifera, Serratia plymouthensis, Serratia plymuthica, Serratia proteamaculans, Serratia proteamaculans subsp. quinovora, Serratia quinivorans or Serratia rubidaea; Rhizobiaceae, such as the genera Agrobacterium, Carbophilus, Chelatobacter, Ensifer, Rhizobium, Sinorhizobium, for example the genera and species Agrobacterium atlanticum, Agrobacterium ferrugineum, Agrobacterium gelatinovorum, Agrobacterium larrymoorei, Agrobacterium meteori, Agrobacterium radiobacter, Agrobacterium rhizogens, Agrobacterium rubi, Agrobacterium stellulatum, Agrobacterium tumefaciens, Agrobacterium vitis, Carbophilus carboxydus, Chelatobacter heintzii, Ensifer adhaerens, Ensifer arboris, Ensifer fredii, Ensifer kostiensis, Ensifer kummerowiae, Ensifer medicae, Ensifer meliloti, Ensifer saheli, Ensifer terangae, Ensifer xinjiangensis, Rhizobium ciceri Rhizobium etli, Rhizobium fredii, Rhizobium galegae, Rhizobium gallicum, Rhizobium giardinii, Rhizobium hainanense, Rhizobium huakuii, Rhizobium huautlense, Rhizobium indigoferae, Rhizobium japonicum, Rhizobium leguminosarum, Rhizobium loessense, Rhizobium loti, Rhizobium lupini, Rhizobium mediterraneum, Rhizobium meliloti, Rhizobium mongolense, Rhizobium phaseoli, Rhizobium radiobacter, Rhizobium rhizogener, Rhizobium rubi, Rhizobium sullae, Rhizobium tianshanense, Rhizobium trifolii, Rhizobium tropici, Rhizobium undicola, Rhizobium vitis, Sinorhizobium adhaerens, Sinorhizobium arboris, Sinorhizobium fredii, Sinorhizobium kostiense, Sinorhizobium kummerowiae, Sinorhizobium medicae, Sinorhizobium meliloti, Sinorhizobium morelense, Sinorhizobium saheli or Sinorhizobium xinjiangense. Further examples of beneficial microorganisms for the method according to the invention, protists or diatoms are selected from the group of families Dinophyceae, Turaniellidae or Oxytrichidae, such as the genera and species: Crypthecodinium cohnii, Phaeodactylum tricornutum, Stylonychia mytilus, Stylonychia pustulata, Stylonychia putrina, Stylonychia notophora, Stylonychia sp., Colpidium campylum or Colpidium sp. Those which are advantageously used in the method according to the invention are transgenic organisms such as fungi, such as mortierella or thraustrochytrium, yeast such as Saccharomyces or Schizosaccharomyces, mosses such as Physcomitrella or Ceratodon, non-human animals such as Caenorhabditis, algae such as Nephroselmis, Pseudoscourfielda, Prasinococcus, Scherffelia, Tetraselmis, Mantoniella, Ostreococcus, Crypthecodinium or Phaeodactylum or plants such as dicots or monocots. Organisms that are particularly advantageously used in the method according to the invention are organisms that belong to oil-producing organisms organisms, that is to say which are used for the production of oil, such as fungi, so such as Mortierella or Thraustochytrium, algae such as Nephroselmis, Pseudoscourfielda, Prasinococcus, Scherffelia, Tetraselmis, Mantoniella, Ostreococcus, Crypthecodinium, Phaeodactylum or plants, especially plants, preferably oilseeds or oilseeds which comprise large amounts of lipid compounds, such as peanut, rapeseed, canola, sunflower, milk thistle (Carthamus tinctoria), poppy, mustard, hemp, castor oil plant, olive, sesame, marigold, punica, evening primrose, primrose, thistle, wild roses, hazelnut, almond, macadamia, avocado, laurel, pumpkin / squash, linseed, soybean, pistachio, borage, trees (oil palm, coconut or walnut) or arable plants such as maize, wheat, rye, oats, rye wheat, rice, barley, cotton, cassava, pepper, Tagetes, Solanaceae plants such as potato, tobacco, eggplant and tomato, Vicia species, peas, alfalfa or shrub plants (coffee, cocoa, tea), Salix- species and perennial grasses and forage plants. Preferred plants according to the invention are oil- useful plants such as peanut, rapeseed, canola, sunflower, thistle, poppy, mustard, hemp, castor oil plant, olive, marigold, punica, evening primrose, pumpkin / squash, linseed, soybean, borage, trees (oil palm, coconut). Particularly preferred are plants which have a lot of C18:2 and / or C18:3 fatty acids, such as sunflower, thistle, tobacco, evening primrose, sesame, cotton, pumpkin / squash, poppy, evening primrose, walnut, linseed, hemp or thistle. Very particularly preferred plants are plants such as thistle, sunflower, poppy, evening primrose, walnut, linseed or hemp. It is therefore advantageous for the above-described method according to the invention i in addition to introducing into the organism, further nucleic acids that code for enzymes of fatty acid or lipid metabolism, in addition to the nucleic acids introduced in process steps (a) to (d) and to the optionally introduced nucleic acid sequences that code for ω3-desaturases. In principle, all genes of fatty acid or lipid metabolism can be used by the method for the production of polyunsaturated fatty acids, advantageous in combination with 5-elongase(s), 6-elongase(s) and / or ω3-desaturases [for the purposes of present invention, the plural shall be understood to include the singular and vice versa]. Annoyed by fatty acid or lipid metabolism selected from the group consisting of acyl-CoA dehydrogenase(s), acyl-ACP [= acyl-carrier protein] desaturase(s), acyl-ACP thioesterase(s), fatty acid acyl transferase(s), acyl-CoA:lysophospholipid acyltransferases, fatty acid synthase(s), fatty acid hydroxylase(s), acetyl-coenzyme A carboxylase(s), acyl- coenzyme A oxidase(s), fatty acid desaturase(s), fatty acid acetylenases, lipoxygenases, triacylglycerol lipases, allene oxide synthases, hydroperoxide lyases or fatty acid elongase(s) are advantageously used in combination with 5-elongase, 6-elongase and / or ω3-desaturase. Genes selected from the group 4-desaturases, 5-desaturases, 6- desaturases, 8-desaturases, 9-desaturases, 12-desaturases, 6-elongases or 9-elongases are particularly preferably used in combination with the above genes for 5-elongase, 6-elongase and / or ω3-desaturase, as it is possible to use individual genes or a number of genes in combination. Compared to the human elongases or elongases from non-human animals such as those from Oncorhynchus, Xenopus or Ciona, have 5-elongases according to invention the advantageous property that they do not extend C -fatty acids to the 22 corresponding C fatty acids. Furthermore, they advantageously do not convert fatty acids with a 24 double bond in the 6 position, which is converted by the human elongases or the elongases from non-human animals. Particularly beneficial converts 5-elongases preferably only unsaturated C fatty acids. These beneficial 5 elongases have some 20 putative transmembrane helices (5-7). Advantageously, only C fatty acids are added 20 double bond in 5 position converted, with ω3-C fatty acids preferred (EPA). In a 20 preferred embodiment according to the invention, they further have the property that they advantageously has no, or only relatively little, 6-elongase activity, in addition to The 5-elongase activity. In contrast, they have human elongases or elongases from non-human animals approximately the same activity on fatty acids with a 6- or 5-double bond. These advantageous elongases are referred to as those known as monofunctional elongases. The human elongases or the elongases from non-humans animals, are in contrast referred to as multifunctional elongases which, in addition to those above-mentioned substrates also convert monounsaturated C - and C -fatty acids, for example 16 18 with a 9 or 11 double bond. In a yeast feeding test where EPA was added to the yeast to act as substrate, monofunctional elongases advantageously convert at least 15% Δ7,10,13,16,19 of the added EPA to docosapentaenoic acid (DPA, C22:5 ), advantageously at least 20 Δ6,9,12 % by weight, particularly advantageously at least 25% by weight. If γ-linolenic acid (= GLA, C18:3 ) becomes added as a substrate, this substance is advantageously not prolonged at all. Δ5,9,12 C18:3 is likewise not extended. In another advantageous embodiment becomes less than 60% by weight, advantageously less than 55% by weight, particularly preferably less than 50% by weight, particularly advantageously less than 45% by weight, very particularly advantageously less Δ8,11,14 than 40% by weight of added GLA converted to dihomo-γ-linolenic acid (= C20:3). In a further, very particularly preferred embodiment of 5-elongase activity according to invention, GLA is not converted. Figures 27 and 28 show the measured substrate specificities of the different ones elongases. Figure 27 shows the specificities of the multifunctional elongases of Xenopus laevis (Fig. 27 A), Ciona intestinalis (Fig. 27 B) and Oncorhynchus mykiss (Fig. 27 C). All of these elongases convert a broad spectrum of substrates. By the method according to invention, this can give rise to by-products which must be converted by further enzymatic activity. For this reason, these enzymes are less preferred by the method according to the invention. The preferred monofunctional elongases and their substrate specificity is shown in Figure 28. Figure 28 A shows the specificity of Ostreococcus tauri Δ5-elongase. This enzyme only converts fatty acids with a double bond in Δ5- score. Advantageously, only C20 fatty acids are converted. A correspondingly high substrate- specificity is shown by Thalassiosira pseudonana Δ5 elongase (Fig. 28 C). Both Ostreococcus tauri Δ6-elongase (Fig. 28 B) and that of Thalassiosira pseudonana (Fig. 28 D) advantageously converts only fatty acids with a double bond in the Δ6 position. Advantageously, only C18 fatty acids are converted. Δ5 elongases from Arabidopsis thaliana and Euglena gracilis also stand out by their specificity. Advantageously, Δ6 elongases according to the invention are also excellent for hay specificity, which means that C -fatty acids are extended by preference. Beneficial 18 they convert fatty acids with a double bond in the Δ6 position. Particularly advantageous Δ6- elongases advantageously convert C -fatty acids with three or four double bonds in them 18 the molecule, which fatty acids must include one double bond in the Δ6 position. In a preferred embodiment according to the invention, they further have the characteristic feature that they advantageously has no, or only relatively little, Δ5-elongase activity, in addition to Δ6- elongase activity. In contrast, the human elongases or elongases from non- human animals about the same activity on fatty acids with a Δ6 or Δ5 double bond. These advantageous elongases are referred to as what are known as monofunctionals elongases. As described above, the human elongases or elongases from non- human animals in contrast referred to as multifunctional elongases which, in addition to those above-mentioned substrates, also convert monounsaturated C - and C -fatty acids, for 16 18 example with a Δ9 or Δ11 double bond. In a yeast feeding test where the EPA had been added to the yeast to act as substrate converted the monofunctional elongases Δ9,12,15 advantageously at least 10% by weight of the added -linolenic acid (= ALA, C18:3 ) or at least Δ6,9,12 40% by weight of the added γ-linolenic acid (= GLA, C18:3), advantageously at least 20% by weight or 50% by weight, particularly advantageously at least 25% by weight or 60% by weight. It is special Δ6,9,12,15 advantageous that C18:4 (stearidonic acid) is also extended. In this context the SDA is converted to at least 40% by weight, advantageously to at least 50% by weight, particularly advantageously to at least 60% by weight, very particularly advantageously to at least 70% by weight. Especially beneficial Δ6-elongases show no or only very little activity (degree of conversion less than Δ6 Δ9 Δ11 Δ11,14 0.1 wt%) against the following substrates: C18:1 , C18:1 , C18:1 , C20:2 , Δ11,14,17 Δ8,11,14 Δ5,8,11,14 Δ5,8,11,14,17 Δ7,10,13,16 C20:3 , C20:3 , C20:4 , C20:5 or C22:4 . Figures 29 and 30 and table 18 show the measured substrate specificities of those different elongases. In contrast to the known ω3-desaturase, ω3-desaturase according to the invention the advantageous characteristic that it can desaturate a wide spectrum of ω6 fatty acids; C - and C - fatty acids such as C -, C -, C -, C - or 20 22 20:2 20:3 20:4 22:4 C fatty acids are desaturated by preference. However, the shorter C -fatty acids are then 22:5 18 as C - or C -fatty acids also advantageously desaturated. Because of these 18:2 18:3 characteristics of ω3-desaturase, it is advantageously possible to change fatty acid aspects in a organism, advantageously in a plant or a fungus, from ω6 fatty acids to ω3 fatty acids. Preferably, ω3-desaturase according to the invention desaturates C20 fatty acids. Within the organism, these fatty acids from the existing fatty acid quantity are converted into at least 10%, 15%, 20%, 25% or 30% to the corresponding ω3 fatty acids. The activity of the enzyme ω3-desaturase towards C -fatty acids is lower by a factor of 10, i.e. only about 1.5 to 18 3% of the fatty acids present in the fatty acid quantity are converted to the corresponding ones ω3 fatty acids. Preferred substrate for ω3-desaturase according to the invention is ω6 fatty acids that are bound in phospholipids. Figure 19 clearly demonstrates with reference to Δ8,11,14 desaturation of dihomo-γ-linolenic acid [C ], that during the desaturation process, 20:4 Advantageously, ω3-desaturase does not distinguish between fatty acids that are bound in the sn1 position or i sn2 position. Both fatty acids bound in the sn1 position and fatty acids bound in the sn2 position i the phospholipids become desaturated. Furthermore, it is advantageous that ω3-desaturase converts a wide range of phospholipids, such as phosphatidylcholine (= PC), phosphatidylinositol (= PIS) or phosphatidylethanolamine (= PE). Finally, desaturation products can also be found in them neutral lipids (= NL), which means in the triglycerides. Compared to the known 4-desaturases, 5-desaturases and 6-desaturases, the advantage of the 4-desaturases, Δ5-desaturases and Δ6- the desaturases according to the invention that they can convert fatty acids that are bound to phospholipids or CoA fatty acid esters, preferably CoA fatty acid esters. The Δ12-desaturases used in the method according to the invention convert Δ9 Δ9,12 Δ6,9 Δ6,9,12 beneficial oleic acid (C18:1 ) to linoleic acid (C18:2 ) or C18:2 to C18:3 (= GLA). The 12-desaturases used advantageously convert fatty acids that are bound to phospholipids or CoA fatty acid esters, advantageously those bound to CoA- fatty acid esters. Due to the enzymatic activity of the nucleic acids used by the method according to the invention which codes for polypeptides with 5-elongase-, Δ6-elongase and / or ω3-desaturase activity, beneficial in combination with nucleic acid sequences encoding polypeptides of fatty acid or lipid metabolism, such as additional polypeptides with Δ4-, 5-, 6-, 8-, 12-desaturase- or Δ5-, Δ6- or Δ9-elongase activity, a wide range of polyunsaturated fatty acids can be produced by the method according to the invention. Depending on the choice of organism, such as those advantageous plants, used for the method according to the invention, can be mixtures of the various polyunsaturated fatty acids or individual polyunsaturated fatty acids, such as EPA or ARA, is produced in free or bound form. Depending on the relevant fatty acid composition in the starting plant (C18:2 or C18:3 fatty acids) become fatty acids that are derived from C18:2 fatty acids, such as GLA, DGLA or ARA or fatty acids derived from from C18:3 fatty acids, such as SDA, ETA or EPA, thus obtained. If only linoleic acid Δ9.12 (= LA, C18:2 ) is present as unsaturated fatty acid in the plant used for the process, can the process only give GLA, DGLA and ARA as products, all of which can be present as Δ9,12,15 free fatty acids or in bound form. If only α-linolenic acid (= ALA, C18:3 ) is present present as unsaturated fatty acid in the plant used for the process, which is the case in for example linseed, the process can only provide SDA, ETA or EPA and / or DHA as products, all of which can be present as free fatty acids or in bound form, such as described above. Due to the modification of the activity of the enzyme Δ5-elongase beneficial in combination with Δ4-, Δ5-, Δ6-, Δ12-desaturase and / or Δ6-elongase or Δ4-, Δ5-, Δ8-, Δ12-desaturase and / or Δ9-elongase that play a role in the synthesis are it possible to produce, in a targeted manner, only individual products in them the above-mentioned organisms, advantageously in the above-mentioned plants. Due to the activity of 6-desaturase and 6-elongase become, for example, GLA and DGLA or SDA and ETA, formed, depending on the starting plant and unsaturated fatty acid. DGLA or ETA or mixtures of these are preferentially formed. If 5-desaturase, 5-elongase and 4-desaturase in addition is introduced into the organisms, becomes beneficial in the plant, ARA, EPA and / or DHA additionally formed. This also applies to organisms in which 8-desaturase and 9-elongase had previously been introduced. Only ARA, EPA or DHA or mixtures of these synthesized, depending on the fatty acid present in the organism or i the plant, which acts as a starting substance for the synthesis. Since biosynthesis cascades are involved, the final products in question are not present in pure form in the organisms. Small quantities of precursor compounds are always present in the final product as well. These little ones amounts amount to less than 20% by weight, advantageously less than 15% by weight, in particular advantageously less than 10% by weight, most advantageously less than 5, 4, 3, 2 or 1% by weight, based on the final products DGLA, ETA or mixtures thereof or ARA, EPA, DHA or mixtures thereof, advantageously EPA or DHA or mixtures thereof. The protein encoded by the nucleic acid of the invention demonstrates high Δ6,9,12,15 Δ5,8,11,14,17 specificity for the two precursors C18:4 and C20:5 fatty acids for synthesis of DHA (precursors and synthesis of DHA, see Figure 1). Thus, the protein coded for by SEQ ID NO: 53 specificity for 6 and 5 fatty acids with an additional ω3 double bond (figure 2). Δ5-elongase has ketoacyl-CoA synthase activity that advantageously elongates fatty acid residues of acyl-CoA esters with 2 carbon atoms. Using the Δ5-elongase genes, Phaeodacylum 5-desaturase and Euglena 4-desaturase, it was possible to demonstrate synthesis of DHA in yeast (Saccharomyces cerevisiae) (Figure 3). In addition to production directly in the organism of starting fatty acids for 5-elongase, The fatty acids can also be 6-elongase and / or ω3-desaturase according to the invention added from outside. Production in the organism is preferred for economic reasons. Δ9.12 Preferred substrates for ω3-desaturase are linoleic acid (C18:2), γ-linolenic acid Δ6,9,12 Δ11,14 Δ8,11,14 (C18:3 ), eicosadienoic acid (C20:2 ), dihomo-γ-linolenic acid (C20:3 ), Δ5,8,11,14 Δ7,10,13,16 arachidonic acid (C20:4), docosatetraenoic acid (C22:4) and docosapentaenoic acid Δ4,7,10,13,15 (C22:5). In order to increase the yield of the above-described method for the production of oils and / or triglycerides with an advantageously increased content of polyunsaturated fatty acids, is it beneficial to increase the amount of starting product for the synthesis of fatty acids; this can achieved by, for example, the introduction into the organism of a nucleic acid that codes for a polypeptide with 12-desaturase. This is particularly beneficial in oil-producing areas organisms such as those from the family Brassicaceae, such as the genus Brassica, for example canola; the family Elaeagnaceae, such as the genus Elaeagnus, for example the genus and species Olea europaea or the family Fabaceae, such as the genus Glycine, for for example the genus and species Glycine max, which has a lot of oleic acid. Since these organisms only have little linoleic acid (Mikoklajczak et al., Journal of the American Oil Chemical Society, 38, 1961, 678 - 681) is application of the above 12-desaturases to advantageously produce the starting material linoleic acid. Nucleic acids used in the method according to the invention are advantageous derived from plants such as algae, for example algae of the family Prasinophyceae so such as the genera Heteromastix, Mammella, Mantoniella, Micromonas, Nephroselmis, Ostreococcus, Prasinocladus, Prasinococcus, Pseudoscourfielda, Pycnococcus, Pyramimonas, Scherffelia or Tetraselmis as well as the genera and species of Heteromastix longifillis, Mamiella gilva, Mantoniella squamata, Micromonas pusilla, Nephroselmis olivacea, Nephroselmis pyriformis, Nephroselmis rotunda, Ostreococcus tauri, Ostreococcus sp. Prasinocladus ascus, Prasinocladus lubricus, Pycnococcus provasolii, Pyramimonas amylifera, Pyramimonas disomata, Pyramimonas obovata, Pyramimonas orientalis, Pyramimonas parkeae, Pyramimonas spinifera, Pyramimonas sp., Tetraselmis apiculata, Tetraselmis carteriaformis, Tetraselmis chui, Tetraselmis convolutae, Tetraselmis desikacharyi, Tetraselmis gracilis, Tetraselmis hazeni, Tetraselmis impellucida, Tetraselmis inconspicua, Tetraselmis levis, Tetraselmis maculata, Tetraselmis marina, Tetraselmis striata, Tetraselmis subcordiformis, Tetraselmis suecica, Tetraselmis tetrabrachia, Tetraselmis tetrathele, Tetraselmis verrucosa, Tetraselmis verrucosa fo. rubens or Tetraselmis sp. or from algae of the Euglenaceae family such as the genera Ascoglena, Astasia, Colacium, Cyclidiopsis, Euglena, Euglenopsis, Hyalophacus, Khawkinea, Lepocinclis, Phacus, Strombomonas or Trachelomonas, such as the genera and species Euglena acus, Euglena geniculata, Euglena gracilis, Euglena mixocylindracea, Euglena rostrifera, Euglena viridis, Colacium stentorium, Trachelomonas cylindrica or Trachelomonas volvocina. The nucleic acids used are advantageously derived from algae of the genera Euglena, Mantoniella or Ostreococcus. Further beneficial plants are algae such as Isochrysis or Crypthecodinium, algae / diatoms such as Thalassiosira or Phaeodactylum, mosses such as Physcomitrella or Ceratodon or higher plants such as Primulaceae such as Aleuritia, Calendula stellata, Osteospermum spinescens or Osteospermum hyoseroides, microorganisms such as fungi, such as Aspergillus, Thraustochytrium, Phytophthora, Entomophthora, Mucor or Mortierella, bacteria such as Shewanella, yeast or animals such as nematodes such as Caenorhabditis, insects, frog, abalone or fish. The isolated nucleic acid sequences according to the invention are advantageously derived from a animals in the group vertebrates. Preferably, the nucleic acid sequences are derived from the classes Vertebrata; Euteleostomy, Actinopterygii; Neopterygii; Teleostei; Euteleostei, Protacanthopterygii, Salmoniformes; Salmonidae or Oncorhynchus or Vertebrata, Amphibia, Anura, Pipidae, Xenopus or Evertebrata such as Protochordata, Tunicata, Holothuroidea, Cionidae such as Amaroucium constellatum, Botryllus schlosseri, Ciona intestinalis, Molgula citrina, Molgula manhattensis, Perophora viridis or Styela partita. The nucleic acids are particularly advantageously derived from fungi, animals or from plants such as algae or mosses, preferably from the order Salmoniformes, such as the family Salmonidae, such as the genus Salmo, for example from the genera and species Oncorhynchus mykiss, Trutta trutta or Salmo trutta fario, from algae, such as the genera Mantoniella or Ostreococcus or from diatoms such as the genera Thalassiosira or Phaeodactylum or from algae such as Crypthecodinium. The method according to the invention advantageously includes the above nucleic acid sequences or their derivatives or homologues which encode polypeptides which retain the enzymatic activity of the proteins coded for by nucleic acid sequences. These sequences, individually or in combination with the nucleic acid sequences encoding 12-desaturase, 4-desaturase, 5-desaturase, 6-desaturase, 5-elongase, 6-elongase and / or ω3-desaturase, are cloned into expression constructs and used for introduction into and expression in organisms. On because of their construction, these expression constructs enable an advantageous optimal synthesis of the polyunsaturated fatty acids produced by the method according to the invention. In a preferred embodiment, the method further comprises the step of obtaining a cell or an intact organism comprising the nucleic acid sequences used in the method, where the cell and / or organism is transformed with a nucleic acid sequence according to the invention which codes for 12-desaturase, 4-desaturase, 5-desaturase, 6-desaturase, 5-elongase, 6-elongase and / or ω3-desaturase, a gene construct or a vector as described above, alone or in combination with additional nucleic acid sequences that code for proteins of fatty acid or lipid metabolism. In a further preferred embodiment, this process comprises further the step of obtaining the oils, lipids or free fatty acids from the organism or from the culture. The culture can, for example, be in the form of a fermentation culture, for example in the case of the cultivation of microorganisms, such as for example Mortierella, Thalassiosira, Mantoniella, Ostreococcus, Saccharomyces or Thraustochytrium or a greenhouse or field-grown culture of a plant. The cell or organism produced is thus advantageously a cell of an oil-producing organism, such as an oil plant, such as, for example, peanut, rapeseed, canola, linseed, hemp, peanut, soybean, milk thistle, hemp, sunflower or borage. In the case of plant cells, plant tissue or plant organs, "cultivation" shall be understood to mean, for example, cultivation on or in a nutrient medium or for the intact plant on or in a substrate, for example in a hydroponic culture, plant compost or on arable country. For the purposes of the invention, "transgenic" or "recombinant" means with regard to, for example, a nucleic acid sequence, an expression cassette (= gene construct) or a vector comprising the nucleic acid sequence or an organism transformed with the nucleic acid sequences, expression cassettes or vectors according to the invention, all the constructions produced by recombinant methods where either a) the nucleic acid sequence according to the invention, or b) a genetic control sequence operably linked to the nucleic acid sequence according to the invention, for example a promoter, or c) a) and b) are not located in their natural genetic environment or are modified by recombinant methods, as it is possible that the modification is in the form of, for example, a substitution, addition, deletion, inversion or insertion of one or more nucleotide residues. Natural genetic environment should be understood to mean the natural genomic or chromosomal locus in the original organism or the presence in a genomic library. In the case of a genomic library, it is natural genetic environment for the nucleic acid sequence preferably retained, in it least partially. The surround flanks the nucleic acid sequence on at least one side and has a sequence length of at least 50 bp, preferably at least 500 bp, particularly preferably at least 1000 bp, most preferably at least 5000 bp. A naturally occurring expression cassette - for example, the naturally occurring combination thereof natural promoter of the nucleic acid sequences with the corresponding Δ12-desaturase-, 4-desaturase-, Δ5-desaturase-, Δ6-desaturase-, 8-desaturase-, ω3-desaturase-, Δ9- elongase, Δ6-elongase and / or Δ5-elongase genes - becomes a transgene expression cassette when this expression cassette is modified by non-natural, synthetic ("artificial") methods such as, for example, mutagenic treatment. Suitable methods are described in, for example, US 5,565,350 or WO 00 / 15815. A transgenic organism or transgenic plant for the purposes of the invention should therefore be understood to mean, as above, that the nucleic acids used in the method are not at their natural locus in the genome of an organism, as it is possible for the nucleic acids to be expressed homologously or heterologously. However, as mentioned means transgene also that, while the nucleic acids according to the invention are in their natural position i the genome of an organism, the sequence is modified with respect to the natural one sequence and / or that the regulatory sequences of the natural sequences have been modified. Transgene should preferably be understood to mean expression of the nucleic acids according to the invention at an unnatural locus in the genome, i.e. homologous or, preferably, heterologous expression of the nucleic acids takes place. Preferred transgenic organisms are fungi such as Mortierella or Phytophthora, mosses such as Physcomitrella, algae such as Mantoniella, Euglena, Crypthecodinium or Ostreococcus, diatoms such as Thalassiosira or Phaeodactylum or plants such as oil plants. Organisms or host organisms for the nucleic acids, the expression cassette or the vector used in the method according to the invention is in principle advantageous all organisms that can synthesize fatty acids, specifically unsaturated fatty acids and / or which is suitable for expression of recombinant genes. Examples that can be mentioned are plants such as Arabidopsis, basket plants such as marigold or useful plants such as soybean, peanut, castor oil plant, sunflower, corn, cotton, flax, rapeseed, coconut, oil palm, milk thistle (Carthamus tinctorius) or cocoa bean, microorganisms, so as fungi, for example the genera Mortierella, Thraustochytrium, Saprolegnia, Phytophthora or Pythium, bacteria, such as the genus Escherichia or Shewanella, yeasts, such as the genus Saccharomyces, cyanobacteria, ciliates, algae such as Mantoniella, Euglena, Thalassiosira or Ostreococcus or protozoa such as dinoflagellates, such as Crypthecodinium. Preferred organisms are those that naturally occur in capable of synthesizing significant amounts of oil, such as fungi, such as Mortierella alpina, Pythium insidiosum, Phytophthora infestans or plants such as soybean, rapeseed, coconut, oil palm, thistle, flax, hemp, castor oil plant, marigold, peanut, cocoa bean or sunflower or yeast such as Saccharomyces cerevisiae with soybean, flax, rapeseed, thistle, sunflower, marigold, Mortierella or Saccharomyces cerevisiae as particularly preferred. In principle, host organisms, in addition to those above mentioned transgenic organisms, also transgenic animals, advantageously non-human animals, for example C. elegans, Ciona intestinalis or Xenopus laevis. Additional useful host cells are detailed in: Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Expression strains that can be used, for example those with a lower protease activity, is described in: Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 119-128. These include plant cells and certain tissues, organs and parts of plants in all their forms phenotypic forms such as anthers, fibers, root hairs, stems, embryos, callus, cotyledon, petiole, harvested material, plant tissue, reproductive tissue and cell cultures that are derived from the relevant transgenic plant and / or can be used to obtain it transgenic plant. Transgenic plants comprising the polyunsaturated fatty acids synthesized by the method according to the invention can advantageously be marketed directly without it is there any need for the oils, lipids or fatty acids synthesized to be isolated. Plants for the process according to the invention shall mean intact plants and all plant parts, plant organs or plant parts such as leaves, stems, seeds, roots, tubers, anthers, fibers, root hairs, stems, embryos, callus, cotyledons, petioles, harvested material, plant tissue, reproductive tissue and cell cultures derived from the relevant transgenic plant and / or can be used to obtain the transgenic plant. In this context seeds include all parts of the seed such as seed coats, epidermal cells, seed cells, endosperm or embryonic tissue. However, the compounds produced by the method according to the invention is also advantageously isolated from the organisms the plants, in the form of their oils, fats, lipids and / or free fatty acids. Polyunsaturated fatty acids produced by this process can be obtained by harvesting the organisms, either from the plant where they grow or from the field. This can be done by pressing or extraction of the plant parts, preferably plant seeds. In this context, oils, fats, lipids and / or free fatty acids are obtained by what is known as cold-tapping or cold- pressing without the application of heat. To achieve easier decomposition of the plant parts, specifically the seeds, they are pre-pulverized, steamed or roasted. The seeds that are pre-treated in this way can then be pressed or extracted with solvents such as hot hexane. The solvent is then removed. In the case of microorganisms are the latter, after harvesting, for example, extracted directly without further processing steps or else, after degradation, extracted via different methods known to a person skilled in the art. In this way, more than 96% of connections can produced by the method is isolated. Then they become the resulting products further processed, i.e. refined. By this process, substances become such as mucilage and suspended matter first removed. What is known as slimming can carried out enzymatically or, for example, chemically-physically by adding acid such as phosphoric acid. The free fatty acids are then removed by treatment with a base, for example sodium hydroxide solution. The resulting product is washed thoroughly with water to remove residual alkali in the product and then dried. To remove the remaining pigment in the product, the product is subjected to bleaching, for example during use of filler's earth or activated charcoal. Finally, the product is deodorized, for example with wood application of steam. PUFA or LCPUFA produced by this process are advantageous C -, C - 18 20 or C -fatty acid molecules, advantageously C - or C -fatty acid molecules, with at least two 22 20 22 double bonds in the fatty acid molecule, preferably three, four, five or six double bonds. These C -, C - or C -fatty acid molecules can be isolated from 18 20 22 the organism in the form of an oil, a lipid or a free fatty acid. Suitable organisms are for example those mentioned above. Preferred organisms are transgenic plants. One embodiment according to the invention is therefore oils, lipids or fatty acids or fractions thereof produced by the process described above, esp preferably an oil, lipid or fatty acid preparation comprising and derived from PUFA transgenic plants. As described above, these oils, lipids or fatty acids advantageously comprise 6 to 15% of palmitic acid, 1 to 6% of stearic acid, 7-85% of oleic acid, 0.5 to 8% of vaccenic acid, 0.1 to 1% of araic acid, 7 to 25% of saturated fatty acids, 8 to 85% of monounsaturated fatty acids and 60 to 85% of polyunsaturated fatty acids, in each case based on 100% and on the total fatty acid content of the organisms. Polyunsaturated are beneficial fatty acids present in fatty acid esters or fatty acid mixtures preferably at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 or 1% arachidonic acid, based on the total fatty acid contents. Furthermore, fatty acid esters or fatty acid mixtures that are produced by the method according to the invention advantageously fatty acids selected from the group of The fatty acids erucic acid (13-docosaenoic acid), sterculic acid (9,10-methyleneoctadec-9-enoic acid), malvalic acid (8,9-methyleneheptadec-8-enoic acid), chaulmoogric acid (cyclo- pentendodecanoic acid), furan fatty acid (9,12-epoxyoctadeca-9,11-dienoic acid), vernolic acid (9,10-epoxyoctadec-12-enoic acid), taryric acid (6-octadecynoic acid), 6-nonadecynoic acid, santalbic acid (t11-octadecen-9-ynic acid), 6,9-octadecenynic acid, pyruvic acid (t10- heptadecen-8-ynoic acid), crepenynic acid (9-octadecen-12-ynoic acid), 13,14- dihydrooropheic acid, octadecen-13-ene-9,11-dienoic acid, petroselenic acid (cis-6- octadecenoic acid), 9c,12t-octadecadienoic acid, calendula acid (8t10t12c-octadecatrienoic acid), catalpic acid (9t11t13c-octadecatrienoic acid), eleostearic acid (9c11t13t- octadecatrienoic acid), jacaric acid (8c10t12c-octadecatrienoic acid), punicic acid (9c11t13c- octadecatrienoic acid), parinaric acid (9c11t13t15c-octadedecatetraenoic acid), pinolenic acid (all- cis-5,9,12-octadecatrienoic acid), laballenic acid (5,6-octadecadienallenic acid), castor oleic acid (12-hydroxyoleic acid) and / or coriolic acid (13-hydroxy-9c,11t-octadecadienoic acid). The the above-mentioned fatty acids are usually, preferably only found in traces in fatty acid esters or fatty acid mixtures produced by the method according to the invention, which means that, based on the total fatty acids, they occur with less than 30%, preferably less than 25%, 24%, 23%, 22% or 21%, especially preferably less than 20%, 15%, 10%, 9%, 8%, 7%, 6% or 5%, very particularly preferably less than 4%, 3%, 2% or 1%. In a further preferred form according to the invention, these occur above fatty acids with less than 0.9%, 0.8%, 0.7%, 0.6% or 0.5%, particularly preferably less than 0.4%, 0.3%, 0.2%, 0.1%, based on the total fatty acids. Fatty acid esters or fatty acid mixtures produced by the method according to the invention comprise advantageously less than 0.1%, based on the total fatty acids and / or no butyric acid, nothing Δ4,8,12,15,21 cholesterol, no clupanodonic acid (= docosapentaenoic acid, C22:5 ) and none Δ3,8,12,15,18,21 nisinic acid (tetracosahexaenoic acid, C23:6 ). Oils, lipids or fatty acids according to the invention advantageously comprise at least 0.5%, 1%, 2%, 3%, 4% or 5%, advantageously at least 6%, 7%, 8%, 9% or 10%, especially advantageously at least 11%, 12%, 13%, 14% or 15% of ARA or at least 0.5%, 1%, 2%, 3%, 4% or 5%, advantageously at least 6% or 7%, particularly advantageously at least 8%, 9% or 10% of EPA and / or DHA, based on the total fatty acid content from the production organism, advantageously a plant, especially preferably an oil utility plant such as soybean, rapeseed, coconut, oil palm, thistle, flax, hemp, castor oil plant, marigold, peanut, cocoa bean, sunflower or the above mentioned additional one or dicot oilseeds. A further embodiment according to the invention is the use of the oil, the lipid, the fatty acids and / or the fatty acid preparation in feed, foodstuffs, cosmetics or pharmaceuticals funds. The oils, lipids, fatty acids or fatty acid mixtures according to the invention can used in a manner known to a person skilled in the art for mixing with other oils, lipids, fatty acids or fatty acid mixtures of animal origin, such as for example fish oils. These oils, lipids, fatty acids or fatty acid mixtures, which are composed of vegetable and animal components, can also be used for the production of feed, foodstuffs, cosmetics or pharmacological agents. The term "oil", "lipid" or "fat" shall be understood to mean a fatty acid mixture including unsaturated, saturated, preferably esterified, fatty acid(s). The oil, lipid or fat has preferably high proportion of polyunsaturated free or, advantageously, esterified fatty acid(s), especially linoleic acid, γ-linolenic acid, dihomo-γ-linolenic acid, arachidonic acid, α-linolenic acid, stearidonic acid, eicosatetraenoic acid, eicosapentaenoic acid, docosapentaenoic acid or docosahexaenoic acid. The amount of unsaturated esterified fatty acids amounts to approximately 30%, a content of 50% is more preferred, a content of 60%, 70%, 80% or more is even more preferred. For analysis, the fatty acid content can, for example, be determined by gas chromatography after conversion of the fatty acids to the methyl esters by transesterification. The oil, lipid or fat may comprise various other saturated or unsaturated fatty acids, for example calendula acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid and the like. The content of the different fatty acids in the oil or fat can vary, in particular depending on the starting organism. The polyunsaturated fatty acids with advantageously at least two double bonds that remain produced by the method are, as described above, for example sphingolipids, phosphoglycerides, lipids, glycolipids, phospholipids, monoacylglycerol, diacylglycerol, triacylglycerol or other fatty acid esters. By starting from the polyunsaturated fatty acids with advantageously at least five or six double bonds, which acids are produced by the method according to the invention, the polyunsaturated fatty acids that are present can is released, for example, via treatment with alkali, for example aqueous KOH or NaOH or acid hydrolysis, advantageously in the presence of an alcohol such as methanol or ethanol or via enzymatic cleavage and is isolated by, for example, phase separation and subsequent acidification with, for example, HSO. The fatty acids can also be released directly without them 2 4 processing steps described above. After their introduction into an organism, advantageously a plant cell or plant, can the nucleic acids used in the method either be present on a separate plasmid or, advantageously, integrated into the genome of the host cell. In the case of integration into the genome, the integration may be random or otherwise carried out by recombination so that the native the gene is replaced with the copy introduced, thereby producing the desired one connection of the cell is modulated or by using a gene in trans, so that the gene is operably linked with a functional expression unit comprising at least one sequence that ensures expression of a gene and at least one sequence that ensures polyadenylation of a functionally transcribed gene. The nucleic acids are advantageously introduced in the organisms via multiexpression cassettes or constructs for multiparallel expression, advantageous in the plants for multiparallel seed-specific expression of genes. Mosses and algae are the only known plant systems that produce essential substances amounts of polyunsaturated fatty acids such as arachidonic acid (ARA) and / or eicosapentaenoic acid (EPA) and / or docosahexaenoic acid (DHA). Mosses include PUFA i membrane lipids, while algae, organisms related to algae and a few fungi also accumulate significant amounts of PUFA in the triacylglycerol fraction. Of this one reason is nucleic acid molecules that are isolated from such strains also accumulate PUFA in the triacylglycerol fraction particularly advantageous for the method according to the invention and thus for modification of the lipid and PUFA production system in a host, especially plants such as oil crops, for example rapeseed, canola, linseed, hemp, soybeans, sunflowers and borage. They can therefore advantageously be used in the method according to the invention. Substrates which are advantageously suitable for the nucleic acids used in the method according to the invention and which codes for polypeptides with Δ12-desaturase-, Δ5-desaturase-, Δ4-desaturase-, Δ6-desaturase-, Δ8-desaturase-, Δ9-elongase, Δ5-elongase, Δ6-elongase and / or ω3-desaturase activity and / or the additional nucleic acids used, such as the nucleic acids encoding polypeptides of fatty acid or lipid metabolism selected from the group of acyl-CoA dehydrogenase(s), acyl- ACP [= acyl-carrier protein] desaturase(s), acyl-ACP thioesterase(s), fatty acid- acyltransferase(s), acyl-CoA:lysophospholipid acyltransferase(s), fatty acid synthase(s), fatty acid hydroxylase(s), acetyl coenzyme A carboxylase(s), acyl coenzyme A oxidase(s), fatty acid desaturase(s), fatty acid acetylenases, lipoxygenases, triacylglycerol lipases, allene oxide synthases, hydroperoxide lyases or fatty acid elongase(s) are advantageously C -, C - or C -fatty acids. The fatty acids converted as 16 18 20 substrates in the method are preferably converted in the form of their acyl-CoA- esters and / or their phospholipid esters. To produce the long-chain PUFAs according to the invention, they must be polyunsaturated C fatty acids are first desaturated by the enzymatic activity of a desaturase and 18 then extended by at least two carbon atoms via an elongase. After one extension- cycle gives this enzyme activity C fatty acids and after two extension cycles 20 C fatty acids. The activity of desaturases and elongases used in the method 22 according to the invention preferably leads to C -, C - and / or C - fatty acids, advantageously with 18 20 22 at least two double bonds in the fatty acid molecule, preferably with three, four, five or six double bonds, especially preferably, to C - and / or C - fatty acids with at least two 20 22 double bonds in the fatty acid molecule, preferably with three, four, five or six double bonds, very particularly preferably with five or six double bonds in them the molecule. After an initial desaturation and elongation has taken place, further desaturation and extension steps such as for example a desaturation in 5- and 4- position is carried out. Products of the method according to the invention which are special preferred are dihomo-γ-linolenic acid, arachidonic acid, eicosapentaenoic acid, docosapentaenoic acid and / or docosahexaenoic acid. C fatty acids with at least two 20 double bonds in the fatty acid can be lengthened by the enzymatic activity according to the invention in the form of the free fatty acid or in the form of esters, such as phospholipids, glycolipids, sphingolipids, phosphoglycerides, monoacylglycerol, diacylglycerol or triacylglycerol. The preferred biosynthesis site of fatty acids, oils, lipids or fats in the plants which advantageously used is, for example, general seeds or the cell stratum of the seeds, so that seed-specific expression of the nucleic acids used in the method becomes reasonable. However, it is obvious that biosynthesis of fatty acids, oils or lipids does not have to be limited to seed tissue, but can also take place in a tissue-specific manner in all the others parts of the plant, for example in epidermal cells or in the tubers. If microorganisms such as yeast, such as Saccharomyces or Schizosaccharomyces, fungi such as Mortierella, Aspergillus, Phytophthora, Entomophthora, Mucor or Thraustochytrium, algae such as Isochrysis, Mantoniella, Euglena, Ostreococcus, Phaeodactylum or Crypthecodinium are used as organisms by the method according to the invention, these organisms become advantageous grown in fermentation cultures. Due to the use of the nucleic acids according to the invention which encode a 5-elongase, the polyunsaturated fatty acids produced by the method can be increased with at least 5%, preferably by at least 10%, especially preferably by at least 20%, a lot especially preferably by at least 50% compared to the wild type of the organisms which does not include the recombinant nucleic acids. In principle, the polyunsaturated fatty acids can be produced by the method according to the invention in the organisms used in the method is increased by two different ways. The amount of free polyunsaturated fatty acids and / or their content can be beneficial esterified polyunsaturated fatty acids produced by the method are enlarged. Advantageous is the proportion of esterified polyunsaturated fatty acids in the transgenic organisms enlarged by the method according to the invention. If microorganisms are used as organisms in the method according to invention, they are grown or cultured in a manner known to a person skilled in the art, depending on the host organism. As a rule, microorganisms are grown in a liquid medium comprising a carbon source, usually in the form of sugars, a nitrogen source, usually i form of organic nitrogen sources such as yeast extract or salts such as ammonium sulphate, trace elements such as salts of iron, manganese and magnesium and, if it fits, vitamins, at temperatures of between 0°C and 100°C, preferably between 10°C and 60°C, while oxygen is supplied. The pH in the liquid medium can either be kept constant, which means regulated during the cultivation period or not. The crops can be grown in batches, semi-batch or continuous. Nutrients can be given at the beginning of the fermentation or fed in semi-continuously or continuously. The polyunsaturated fatty acids produced can be isolated from the organisms as described above by processes known to those skilled in the art, for example by extraction, distillation, crystallization, if that suitable precipitation with salt and / or chromatography. For this purpose, the organisms can advantageously be broken up in advance. If the host organisms are microorganisms, the procedure is according to the invention advantageously carried out at a temperature of between 0°C and 95°C, preferably between 10°C and 85°C, especially preferably between 15°C and 75°C, very especially preferably between 15°C and 45°C. In this process, the pH value is advantageously kept between pH 4 and 12, preferably between pH 6 and 9, especially preferably between pH 7 and 8. The method according to the invention can be carried out batchwise, semi-batchwise or continuous. An overview of known cultivation methods can be found in the textbook by Chmiel (Bioprozeßtechnik 1. Einführung in die Bioverfahrenstechnik [Bioprosess- technology 1. Introduction to Bioprocess technology] (Gustav Fischer Verlag, Stuttgart, 1991)) or in Storhas' textbook (Bioreaktoren und peripherale Einrichtungen [Bioreaktoren and peripheral equipment] (Vieweg Verlag, Braunschweig / Wiesbaden, 1994)). The cultivation medium to be used must appropriately meet the requirements for those relevant strains. Descriptions of culture media for different microorganisms can be found in the textbook "Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington D.C., USA, 1981). As described above, these media can be used according to the invention, usually include one or more carbon sources, nitrogen sources, inorganic salts, vitamins and / or trace elements. Preferred carbon sources are sugars, such as mono-, di- or polysaccharides. Examples of very good carbon sources are glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, starch or cellulose. Sugars can also be added to the media via complex compounds such as molasses or other by-products from sugar refining. Addition of mixtures of a variety carbon sources can also be beneficial. Other possible carbon sources are oils and fats such as for example soya oil, sunflower oil, peanut oil and / or coconut fat, fatty acids etc such as palmitic acid, stearic acid and / or linoleic acid, alcohols and / or polyalcohols such as, for example, glycerol, methanol and / or ethanol and / or organics acids such as, for example, acetic acid and / or lactic acid. Nitrogen sources are usually organic or inorganic nitrogen compounds or materials comprising these compounds. Examples of nitrogen sources include ammonia in liquid or gaseous form or ammonium salts such as ammonium sulphate, ammonium chloride, ammonium phosphate, ammonium carbonate or ammonium nitrate, nitrates, urea, amino acids or complex nitrogen sources such as corn slurry, soy flour, soy protein, yeast extract, meat extract and other. The nitrogen sources can be used individually or as a mixture. Inorganic salt compounds that may be present in the medium include chloride, phosphorus and sulphate salts of calcium, magnesium, sodium, cobalt, molybdenum, potassium, manganese, zinc, copper and iron. Inorganic sulfur-containing compounds such as, for example, sulfates, sulphites, dithionites, tetrathionates, thiosulphates, sulphides or other organic sulfur compounds such as mercaptans and thiols can be used as sources of sulfur for production of sulphur-containing fine chemicals, especially methionine. Phosphoric acid, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or those corresponding sodium-containing salts can be used as sources of phosphorus. Chelating agents can be added to the medium to keep the metal ions in solution. Particularly suitable chelating agents include dihydroxyphenols such as catechol or protocatechuate and organic acids such as citric acid. Fermentation media used according to the invention for the cultivation of microorganisms usually also include other growth factors such as vitamins or growth promoters, which include, for example, biotin, riboflavin, thiamin, folic acid, nicotinic acid, pantothenate and pyridoxine. Growth factors and salts are often derived from complex media components such as yeast extract, molasses, corn liquor and the like. It is also possible to add suitable precursors to the culture medium. It the exact composition of media connections depends heavily on the particular attempts and is determined individually for each specific case. Information about optimization of media can be found in the textbook "Applied Microbiol. Physiology, A Practical Approach" (Ed. P.M. Rhodes, P.F. Stanbury, IRL Press (1997) pp. 53-73, ISBN 0 19 963577 3). Growth media can also be obtained from commercial suppliers, for for example Standard 1 (Merck) or BHI (brain heart infusion, DIFCO) and the like. All media components are sterilized, either with heat (20 min at 1.5 bar and 121°C) or by filter sterilization. The components can be sterilized either together or, if necessary, separately. All media components can be present at start-up the cultivation or be added continuously or in batches, as desired. The culture temperature is normally between 15°C and 45°C, preferably from 25°C to 40°C and can be kept constant or can be changed during the experiment. The pH of the medium should be i the range from 5 to 8.5, preferably around 7.0. pH for cultivation can be controlled below cultivation by adding basic compounds such as sodium hydroxide, potassium hydroxide, ammonia and aqueous ammonia or acidic compounds such as phosphoric acid or sulfuric acid. Foaming can be controlled by the application of anti- foaming agents such as, for example, fatty acid polyglycol esters. To maintain the stability of plasmids, it is possible to add to the medium suitable substances that have a selective effect, for example antibiotics. Aerobic conditions are maintained by introducing oxygen or oxygen-containing gas mixtures such as for example ambient air in the culture. The temperature of the culture is normally 20° to 40°C and preferably 25°C to 40°C. Cultivation is continued until the desired product is formed is at a maximum. This goal is normally achieved within 10 to 160 hours. Fermentation liquids obtained in this way, especially those containing polyunsaturated fatty acids, usually contain a dry mass of from 7.5 to 25% by weight. The fermentation medium can then be processed further. The biomass can, i according to requirements, completely or partially removed from the fermentation medium by separation methods such as, for example, centrifugation, filtration, decantation or a combination of these methods or is completely left in said medium. It is advantageous to process the biomass after its separation. However, the fermentation medium can also be thickened or concentrated without it separation of the cells, using known methods such as for example wood using a rotary evaporator, thin film evaporator, falling film evaporator, wood reverse osmosis or by nanofiltration. Finally, this can be concentrated fermentation medium is processed to obtain the fatty acids present therein. The fatty acids obtained by the method are also suitable as starting materials for the chemical synthesis of additional products of interest. For example, they can used in combination with each other or alone for the production of pharmaceuticals agents, foodstuffs, animal feed or cosmetics. The invention further relates to isolated nucleic acid sequences that code for polypeptides with Δ5 elongase, where Δ5 elongases are encoded by the nucleic acid sequences converts C -fatty acids with at least four double bonds in the fatty acid molecule, which 20 advantageously finally introduced into diacylglycerides and / or triacylglycerides. Advantageously, isolated nucleic acid sequences are nucleic acid sequences which encode for polypeptides with Δ5-elongase activity and comprising an amino acid sequence selected from the group of amino acid sequence having the sequence shown in SEQ ID NO: 115, SEQ ID NO NO: 116, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141 or SEQ ID NO: 142. Further advantageous isolated nucleic acid sequences are nucleic acid sequences which encode polypeptides with Δ5-elongase activity and which comprise a combination of the amino acid sequences selected from the group consisting of: a) SEQ ID NO: 115 and SEQ ID NO: 139, SEQ ID NO: 115 and SEQ ID NO: 140 or SEQ ID NO: 139 and SEQ ID NO: 140; or b) SEQ ID NO: 116 and SEQ ID NO: 141, SEQ ID NO: 116 and SEQ ID NO: 142 or SEQ ID NO: 141 and SEQ ID NO: 142; or c) SEKV ID NO: 115, SEKV ID NO: 139 and SEKV ID NO: 140 or SEKV ID NO: 116, SEQ ID NO: 141 and SEQ ID NO: 142. The sequences shown in the sequences SEQ ID NO: 115 (NXXXHXXMYXYYX), SEQ ID NO: 116 (HHXXXXWAWW), SEQ ID NO: 139 (LHXXHH), SEQ ID NO: 140 (TXXQXXQF), SEQ ID NO: 141 (DTXFMV) and SEQ ID NO: 142 (TQAQXXQF) constitute conserved regions of the different elongases. Table 2 shows the meaning of the amino acids indicated by X, which are present in the above-mentioned nucleic acid sequences (column 3). The preferred amino acids in the different positions can also be found in the table (column 3). Column 1 indicates the SEQ ID NO, column 2 the position in the sequence. Table 2: Meaning of the amino acid marked X in the consensus sequences. SEQ ID NO: Position of Amino Acid Preferred amino acid X i the sequence 115 2 Ser, Cys, Leu, Gly Cys, Leu (NXXXHXXMYXYYX) 115 3 Thr, Phe, Ile, Ser, Phe, Trp Val, Trp, Gly 115 4 Val, Ile Val, Ile 115 6 Val, Ile, Thr Val, Ile 115 7 Ile, Phe, Val, Leu, Cys, Val Cys 115 10 Ser, Gly, Tyr, Thr, Thr, Ser To let 115 13 Phe, Met, Thr, Leu, Leu Alas, Gly 116 3 Ala, Ser, Thr Ala, Ser esp (HHXXXXWAWW) preferably Ala 116 4 Thr, Met, Val, Leu, Leu, Thr esp Ile, Ser preferably Leu 116 5 Val, Thr, Met, Leu, Ile, Ser especially SEQ ID NO: Position of Amino Acid Preferred amino acid X i the sequence Ile preferably Ile 116 6 Val, Met, Leu, Ile, Ile, Ser esp Ala, Pro, Ser, Phe preferably Ile 139 3 Val, Taurus, Ile Val, Thr LHXXHH 139 4 Taurus, Phe Tyr 140 2 Asn, Asp, Thr, Gln, Gln TXXQXXXQF Met, Ser, Ala 140 3 Thr, Cys, Leu, Met, Ala, Met Ala, Ile, Val, Phe 140 5 Met, Ile, Leu Met 140 6 Val, Ile, Leu, Thr, Leu Phew 141 3 Leu, Ile, Val, Taurus, Phe DTXFMV Phe, Ala 142 5 Met, Ile, Leu Met, Leu especially TQAQXXQF preferably Met 142 6 Val, Ile, Leu, Thr, Leu Phew Particularly advantageous Δ5 elongases comprise at least one of the sequences SEQ ID NO NO: 116, SEQ ID NO: 141 and / or SEQ ID NO: 142. Particularly advantageous isolated nucleic acid sequences are sequences selected from the group consisting of: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63; SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 113, SEQ ID NO: 131 or SEQ ID NO: 133, b) nucleic acid sequences which, as a result of degeneracy of the genetic code, can be derived from the amino sequence shown in SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 114, SEQ ID NO: 132 or SEQ ID NO: 134, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63; SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 113, SEQ ID NO: 131 or SEQ ID NO: 133, which encodes polypeptides with at least 40% homology to amino acid level with SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: NO: 50, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 113, SEQ ID NO: 131 or SEQ ID NR: 133 and which has Δ5-elongase activity. The invention further relates to isolated nucleic acid sequences that code for polypeptides with Δ6-elongase activity selected from the group consisting of: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 69, SEQ ID NO: 81, SEQ ID NO: 111 or SEQ ID NO: 183, b) nucleic acid sequences which, as a result of degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 70, SEQ ID NO: 82, SEQ ID NO: 112 or SEQ ID NO: 184, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 69, SEQ ID NO: 81, SEQ ID NO: ID NO: 111 or SEQ ID NO: 183 encoding polypeptides with at least 40% homology at the amino acid level with SEQ ID NO: 70, SEQ ID NO: 82, SEQ ID NO NO: 112 or SEQ ID NO: 184 and which has Δ6-elongase activity. The invention further relates to isolated nucleic acid sequences that code for polypeptides with ω3-desaturase activity selected from the group consisting of: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 87 or SEQ ID NO NO: 105, b) nucleic acid sequences which, as a result of degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 88 or SEQ ID NO NO: 106, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 87 or SEQ ID NO: 105 which have polypeptides with at least 60% identity at amino acid level with SEQ ID NO: 88 or SEQ ID NO: 106 and which has ω3-desaturase activity. The invention further relates to isolated nucleic acid sequences which code for a polypeptide with 6-desaturase activity, selected from the group consisting of: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 89 or in SEQ ID NO NR: 97, or b) nucleic acid sequences which, as a result of degeneration of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 90 or SEQ ID NO: 98, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 89 or SEQ ID NO: 97 which encode polypeptides with at least 40% homology at the amino acid level with SEQ ID NO: 90 or SEQ ID NO: 98 and which have 6-desaturase activity. The invention further relates to isolated nucleic acid sequences which code for a polypeptide with 5-desaturase activity, selected from the group consisting of: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 91, SEQ ID NO NO: 93, SEQ ID NO: 99 or in SEQ ID NO: 101, b) nucleic acid sequences which, as a result of degeneration of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 92, SEQ ID NO NO: 94, SEQ ID NO: 100 or in SEQ ID NO: 102, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 99 or in SEQ ID NO: 101 which encode polypeptides with at least 40% homology at amino acid level with SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 94 ID NO: 100 or in SEQ ID NO: 102 and which has 5-desaturase activity. The invention further relates to isolated nucleic acid sequences which code for a polypeptide with 4-desaturase activity, selected from the group consisting of: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 95 or in SEQ ID NO NO: 103, b) nucleic acid sequences which, as a result of degeneration of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 96 or SEQ ID NO: 104, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 95 or SEQ ID NO NO: 103 which codes for polypeptides with at least 40% homology at the amino acid level with SEQ ID NO: 96 or SEQ ID NO: 104 and which have 4-desaturase- Activity. The invention further relates to isolated nucleic acid sequences which code for a polypeptide with 12-desaturase activity, selected from the group consisting of: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 107 or in SEQ ID NO NO: 109, b) nucleic acid sequences which, as a result of degeneration of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 108 or SEQ ID NO: 110, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 107 or SEQ ID NO NO: 109 which codes for polypeptides with at least 50% homology at the amino acid level with SEQ ID NO: 108 or SEQ ID NO: 110 and which have 12-desaturase- Activity. The invention further relates to gene constructs which comprise the nucleic acid sequences SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 according to the invention, where the nucleic acid is operably bound with one or more regulatory signals. In addition, additional biosynthesis genes of fatty acid or lipid metabolism selected from the group of acyl-CoA dehydrogenase(s), acyl- ACP [= acyl-carrier protein] desaturase(s), acyl-ACP thioesterase(s), fatty acid- acyltransferase(s), acyl-CoA:lysophospholipid acyltransferase(s), fatty acid synthase(s), fatty acid hydroxylase(s), acetyl coenzyme A carboxylase(s), acyl coenzyme A oxidase(s), fatty acid desaturase(s), fatty acid acetylenases, lipoxygenases, triacylglycerol lipases, allene oxide synthases, hydroperoxide lyases or fatty acid elongase(s) be present in the gene construct. Biosynthesis genes are advantageous for fatty acid or lipid metabolism selected from the group Δ4-desaturase, Δ5-desaturase, Δ6- desaturase, Δ8-desaturase, Δ9-desaturase, Δ12-desaturase, Δ6-elongase, Δ9- elongase or ω3-desaturase additionally present. All the nucleic acid sequences used in the method according to the invention is advantageously derived from a eukaryotic organism such as a plant, a microorganism or an animal. The nucleic acid sequences are preferably derived from the order Salmoniformes, algae such as Mantoniella, Crypthecodinium, Euglena or Ostreococcus, then fungi such as the genus Phytophthora or from diatoms such as the genera Thalassiosira or Phaeodactylum. The nucleic acid sequences used in the method that code for proteins with ω3-desaturase-, 4-desaturase-, Δ5-desaturase-, Δ6-desaturase-, Δ8- desaturase-, 9-desaturase-, Δ12-desaturase-, 5-elongase-, Δ6-elongase- or Δ9- elongase activity is advantageously introduced alone or, preferably, in combination with a expression cassette (= nucleic acid construction) which enables the expression of the nucleic acids in an organism, advantageously a plant or a microorganism. The nucleic acid construct may comprise more than one nucleic acid sequence with enzymatic activity, such as for example Δ12-desaturase, 4-desaturase, Δ5- desaturase, Δ6-desaturase, 5-elongase, Δ6-elongase and / or ω3-desaturase. To introduce the nucleic acids used in the method, the latter becomes advantageously amplified and ligated in known manner. Preferably, a procedure will be as follows the protocol for Pfu DNA polymerase or Pfu / Taq DNA polymerase mixture followed. The primers are chosen by taking into account the sequence to be amplified. The primers should advantageously be chosen in such a way that the amplification includes the entire codon sequence from the start codon to the stop codon. After the amplification, the amplified becomes appropriately analyzed. For example, gel electrophoretic separation can be performed, which is followed by quantitative and qualitative analysis. The amplification can then be cleaned with to follow a standard protocol (eg Qiagen). An aliquot of the purified amplificate is then available for the subsequent cloning steps. Suitable cloning vectors are generally known to those skilled in the art. These include in particular vectors that can replicated in microbial systems, which means mainly vectors that ensure efficient cloning in yeast or fungi and which enables stable transformation of plants. Those who can be mentioned in particular are various binary and cointegrated vector systems that are suitable for T-DNA-mediated transformation. Such vector systems are usually characterized in that they comprise at least vir genes necessary for the agrobacterium-mediated transformation and T-DNA border sequences (T-DNA border). These vector systems advantageously also comprise additional cis-regulatory regions such as promoter and terminator sequences and / or selection markers, by means of which appropriately transformed organisms can be identified. While in the case of cointegrated vector systems vir genes and T-DNA sequences are arranged on the same vector, binary systems are based on at least two vectors, one carrying vir genes, but no T-DNA, while the other carries T-DNA, but no vir gene. Because of this in fact, the latter vectors are relatively small, easy to manipulate and replicate both in E. coli and in Agrobacterium. These binary vectors include vectors from the series pBIB-HYG, pPZP, pBecks, pGreen. According to the invention, Bin19 becomes pBI101, pBinAR, pGPTV and pCAMBIA preferentially used. An overview of the binary vectors and their application can be found in Hellens et al, Trends in Plant Science (2000) 5, 446- 451. To prepare the vectors, the vectors can first be linearized with restriction endonuclease(s) and then enzymatically modified in a suitable manner. Then becomes the vector is purified and an aliquot is used for the cloning step. In the cloning step it becomes enzymatically cleaved and, if appropriate, purified amplificate cloned with vector fragments prepared in a similar manner, using ligase. In this context, a particular nucleic acid construct or vector or plasmid can construction, have one or else more than one codogenic gene segment. The code genes gene segments in these constructs are preferably operably linked with regulator sequences. The regulator sequences include in particular plant sequences such as the promoter and terminator sequences described above. The constructions can is advantageously propagated stably in microorganisms, especially in E. coli and Agrobacterium tumefaciens, under selective conditions and enables the transfer of heterologous DNA to plants or microorganisms. The nucleic acids used in the method, the new nucleic acids and nucleic acid constructions, can be introduced into organisms such as microorganisms or advantageously plants, advantageously when using cloning vectors and thus used for transformation of plants such as those published and cited in: Plant Molecular Biology and Biotechnology (CRC Press, Boca Raton, Florida), Chapters 6 / 7, pp. 71-119 (1993); F.F. White, Vectors for Gene Transfer in Higher Plants; in: Transgenic Plants, Vol. 1, Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press, 1993, 15-38; B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press (1993), 128-143; Potrykus, Annu. Fox. Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225. Thus, the nucleic acids, the new nucleic acids and nucleic acid constructs can and / or vectors used in the method are used for recombinant modification of a wide range of organisms, advantageously plants, so that the latter improves and / or more efficient PUFA producers. A series of mechanisms by which a modification of Δ12-desaturase-, 5-elongase-, Δ6-elongase-, Δ5-desaturase-, Δ4-desaturase-, Δ6-desaturase- and / or ω3-desaturase protein and of the additional proteins used in the method, so such as 12-desaturase-, 9-elongase-, 6-desaturase-, 8-desaturase-, 6-elongase-, 5-desaturase or 4-desaturase protein is possible, exists, so that yield, production and / or production efficiency of beneficial polyunsaturated fatty acids in a plant, preferably in an oilseed plant or a microorganism, can be affected directly due to of the modified protein. Number or activity of Δ12-desaturase-, ω3-desaturase-, Δ9-elongase-, Δ6-desaturase-, Δ8-desaturase-, Δ6-elongase-, Δ5-desaturase-, 5-elongase or 4-desaturase proteins or genes can be increased, so that greater amounts of the gene products and, finally, larger amounts of the compounds with it general formula I is produced. A de novo synthesis in an organism that has been lacking the activity and ability to biosynthesize the compounds prior to introduction of it(s) corresponding gene(s) is also possible. This applies analogously to the combination with further desaturases or elongases or further enzymes of fatty acid and lipid metabolism. Application of different divergent sequences, i.e. sequences which differ at the DNA sequence level, can also be advantageous in this context or otherwise, the use of promoters for gene expression that enables a different gene expression over time, for example as a function of the degree of seed maturity or oil storage tissue. Due to the introduction of a Δ12-desaturase-, ω3-desaturase-, Δ9-elongase-, Δ6-desaturase-, Δ8-desaturase-, Δ6-elongase-, Δ5-desaturase-, 5-elongase- and / or 4-desaturase gene in an organism, alone or in combination with other genes in a cell, it is not only possible to increase biosynthesis flux towards the end product, but also to increase or create de novo the corresponding triacylglycerol preparation. Likewise, the number or activity of other genes involved in the import of nutrients that are necessary for the biosynthesis of one or more fatty acids, oils, polar and / or neutral lipids is increased, thus that the concentration of these precursors, cofactors or intermediates in the cells or in the storage chamber is increased, whereby the ability of the cells to produce PUFA as described below is further improved. By optimizing the activity or increasing the number of one or more Δ12-desaturase-, ω3-desaturase-, Δ9-elongase-, Δ6- desaturase-, Δ8-desaturase-, Δ6-elongase-, Δ5-desaturase-, 5-elongase- or 4-desaturase genes that are involved in the biosynthesis of these compounds or by destroy the activity of one or more genes involved in their breakdown compounds, is improved yield, production and / or efficiency of production of fatty acid and lipid molecules in organisms, advantageously in plants, made possible. The isolated nucleic acid molecules used in the method according to the invention codes for proteins or parts thereof, where the proteins or that individual protein or parts thereof comprise an amino acid sequence with sufficient homology with an amino acid sequence shown in the sequences SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 or SEQ ID NO: 184 so that the proteins or parts thereof retain a Δ12-desaturase-, ω3-desaturase-, Δ9- elongase-, Δ6-desaturase-, Δ8-desaturase-, Δ6-elongase-, Δ5-desaturase-, Δ5- elongase or Δ4-desaturase activity. The proteins or parts thereof that are coded for of the nucleic acid molecules preferably retain their essential enzymatic activity and the ability to participate in the metabolism of compounds necessary for the synthesis of cell membranes or lipid substances in organisms, advantageously in plants or in the transport of molecules through these membranes. Advantageously, the proteins encoded by the nucleic acid molecules at least about 50%, preferably at least about 60% and more preferably at least about 70%, 80% or 90% and most preferably at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity with the amino acid sequences shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 or SEQ ID NO: 184. For for the purposes of the invention, homology or homolog shall be understood to mean respectively identity or identical. Homology was calculated over the entire amino acid sequence the nucleic acid sequence region. A professional has available a number of programs such as are based on different algorithms for comparing different sequences. Here gives the algorithms of Needleman and Wunsch or Smith and Waterman particularly reliable results. The program PileUp (J. Mol. Evolution., 25, 351-360, 1987, Higgins et al., CABIOS, 5 1989: 151-153) or the programs Gap and BestFit [Needleman and Wunsch (J. Mol. Biol. 48; 443-453 (1970) and Smith and Waterman (Adv. Appl. Math. 2; 482-489 (1981)], which is part of the GCG software package [Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711 (1991)], was used for sequence- the lineup. The sequence homology values ​​given above as a percentage were determined over the entire sequence region using the program GAP and de following settings: Gap Weight: 50, Length Weight: 3, Average Match: 10,000 and Average Mismatch: 0.000. If not otherwise specified, these settings were always used as default settings for the sequence layouts. Essential enzymatic activity of Δ12-desaturase, ω3-desaturase, Δ9-elongase, Δ6-desaturase, Δ8-desaturase, Δ6-elongase, Δ5-desaturase, Δ5-elongase or Δ4- desaturase used in the method according to the invention shall be understood to mean that they retains at least an enzymatic activity of at least 10%, preferably 20%, esp preferably 30% and very particularly 40% compared to the proteins / enzymes encoded by the sequence SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 and their derivatives and can thus participate in the metabolism of compounds necessary for the synthesis of fatty acids, fatty acid esters such as diacylglycerides and / or triacylglycerides in an organism, advantageously a plant or a plant cell or in the transport of molecules through membranes, which means C18, C20 or C22 carbon chains in the fatty acid molecule with double bonds in at least two, advantageously three, four, five or six positions. Nucleic acids that can advantageously be used in the method are derived from bacteria, fungi, diatoms, animals such as Caenorhabditis or Oncorhynchus or plants such as algae or mosses, such as the genera Shewanella, Physcomitrella, Thraustochytrium, Fusarium, Phytophthora, Ceratodon, Mantoniella, Ostreococcus, Isochrysis, Aleurita, Muscarioides, Mortierella, Borago, Phaeodactylum, Crypthecodinium, specifically from the genera and species Oncorhynchus mykiss, Xenopus laevis, Ciona intestinalis, Thalassiosira pseudonona, Mantoniella squamata, Ostreococcus sp., Ostreococcus tauri, Euglena gracilis, Physcomitrella patens, Phytophthora infestans, Fusarium graminaeum, Cryptocodinium cohnii, Ceratodon purpureus, Isochrysis galbana, Aleurita farinosa, Thraustochytrium sp., Muscarioides viallii, Mortierella alpina, Borago officinalis, Phaeodactylum tricornutum, Caenorhabditis elegans or particularly advantageously from Oncorhynchus mykiss, Euglena gracilis, Thalassiosira pseudonona or Crypthecodinium cohnii. Alternatively, nucleic acid sequences encoding Δ12-desaturase, ω3- desaturase, Δ9-elongase, Δ6-desaturase, Δ8-desaturase, Δ6-elongase, Δ5- desaturase, Δ5-elongase or Δ4-desaturase and which advantageously hybridizes under stringent conditions with a nucleic acid sequence as shown in SEQ ID NO: 1, SEQ ID NO NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NR: 183 is used in the method according to the invention. The nucleic acid sequences used in the method are advantageously introduced in an expression cassette that enables expression of the nucleic acids in organisms such as microorganisms or plants. In this way, the nucleic acid sequences that code for Δ12-desaturase, ω3- desaturase, Δ9-elongase, Δ6-desaturase, Δ8-desaturase, Δ6-elongase, Δ5- desaturase, 5-elongase or 4-desaturase operably linked by one or more regulatory signals, beneficial for enhancing gene expression. These regulatory sequences must enable specific expression of the genes and proteins. Depending on the host organism, this may mean, for example, that the gene is expressed and / or overexpressed only after induction has taken place or else that it is expressed and / or overexpressed immediately. For example, these are regulatory sequences in the form of sequences to which inducers or repressors bind, and thus control expression of the nucleic acid. In addition to these new regulatory sequences or instead of these sequences, natural regulatory elements in these sequences may still be present before they relevant structural genes and, if appropriate, may have been genetically modified on a such a way that their natural regulation is removed and expression of the genes is improved. However, the expression cassette (= expression construct =). reengineering) also be simpler in construction, which means no further regulatory signals are inserted before the nucleic acid sequence or derivatives thereof and it natural promoter along with its regulation is not removed. Instead, it becomes natural regulatory sequence mutated in such a way that regulation can no longer be found location and / or gene expression is enhanced. These modified promoters can also be positioned alone before the natural gene in the form of partial sequences (= promoter with parts). of the nucleic acid sequences used according to the invention) to improve the activity. Furthermore, the genetic engineering can advantageously also include one or more of what is known as enhancer sequences in operable linkage with the promoter, enabling a improved expression of the nucleic acid sequence. Additional beneficial sequences, then as additional regulatory elements or terminator sequences, can also be inserted at the 3' end of the DNA sequences. Δ12-desaturase-, ω3-desaturase-, 4-desaturase-, Δ5-desaturase-, Δ6-desaturase-, Δ8-desaturase-, 5-elongase-, Δ6-elongase- and / or Δ9 elongase genes may be present in one or more copies of the expression cassette (= the genetic engineering). Preferably only one copy of the genes is present in each expression cassette. This gene construct or gene constructs can be expressed together in the host organism. In this context, the gene construct(s) may be inserted into one or more vectors and be present in the cell in free form or otherwise be inserted into the genome. It is beneficial for the insertion of additional genes into the genome when the genes to be expressed are present together in one gene construct. In this context, the regulatory sequences or factors, as described, can above, preferably have a positive effect on gene expression of the genes introduced, and thus improving it. Thus, an improvement of the regulatory elements, beneficial at the transcriptional level, occur by the application of strong transcriptional signals such as promoters and / or enhancers. In addition, however improved translation also possible, for example by improving the stability of mRNA. A further embodiment according to the invention is one or more gene constructs comprising one or more sequences defined by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 or derivatives thereof and which encode polypeptides as shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 or SEQ ID NO: 184. The above-mentioned Δ12-desaturase-, ω3-desaturase-, Δ9- elongase-, Δ6-desaturase-, Δ8-desaturase-, Δ6-elongase-, Δ5-desaturase-, Δ5- elongase or Δ4-desaturase proteins advantageously lead to desaturation or extension of fatty acids, the substrate advantageously having one, two, three, four, five or six double bonds and advantageously 18, 20 or 22 carbon atoms in the fatty acid molecule. The the same applies to their homologues, derivatives or analogues, which are operably linked with one or more regulatory signals, to advantageously enhance gene expression. Advantageous regulator sequences for the new process are present, for example in promoters such as cos, tac, trp, tet, trp-tet, lpp, lac, lpp-lac, lacIq, T7, T5, T3, gal, trc, ara, SP6, λ-PR or λ-PL promoter and is advantageously used in Gram-negative bacteria. Additional advantageous regulator sequences for example present in the Gram-positive promoters amy and SPO2, in yeast or fungal promoters ADC1, MFα, AC, P-60, CYC1, GAPDH, TEF, rp28, ADH or in plant promoters CaMV / 35S [Franck et al., Cell 21 (1980) 285-294], PRP1 [Ward et al., Plant. Mol. Biol. 22 (1993)], SSU, OCS, lib4, usp, STLS1, B33, nos or in ubiquitin or phaseolin promoter. Beneficial i this context are also inducible promoters, such as the promoters described in EP-A-0 388 186 (benzenesulfonamide inducible), Plant J. 2, 1992:397-404 (Gatz et al., tetracycline inducible), EP-A-0 335 528 (abscisic acid inducible) or WO 93 / 21334 (ethanol or cyclohexenol inducible). Additional suitable plant promoters are cytosolic FBPase promoter or ST-LSI promoter in potato (Stockhaus et al., EMBO J. 8, 1989, 2445), glycine max phosphoribosyl pyrophosphate- amidotransferase promoter (Genbank accession number U87999) or the nodal specific promoter described in EP-A-0 249 676. Particularly advantageous promoters are promoters that enable expression in tissues which is involved in the biosynthesis of fatty acids. Very particularly advantageous are seed-specific ones promoters, such as USP promoter as described, but also other promoters such as LeB4, DC3, phaseolin or napin promoter. Additional particularly beneficial promoters are seed-specific promoters that can be used for monocots or dicotyledonous plants and which is described in US 5,608,152 (rape napin promoter), WO 98 / 45461 (Arabidopsis oleosin promoter), US 5,504,200 (Phaseolus vulgaris phaseolin promoter), WO 91 / 13980 (Brassica Bce4 promoter), by Baeumlein et al., Plant J., 2, 2, 1992:233-239 (LeB4 promoter from a legume), these promoters being suitable for dicotyledonous plants. Examples of promoters suitable for monocots are barley lpt-2 or lpt-1 promoter (WO 95 / 15389 and WO 95 / 23230), barley hordein promoter and other suitable promoters described in WO 99 / 16890. In principle, it is possible to use all natural promoters together with theirs regulator sequences, such as those mentioned above, for the new process. It is also possible and advantageously using synthetic promoters, either in addition or alone, especially when they mediate seed-specific expression, such as those described in WO 99 / 16890. To achieve a particularly high PUFA content, especially in transgenic plants, should PUFA biosynthesis genes advantageously be expressed in oil crops in a seed-specific manner. For this purpose, seed-specific promoters can be used or the promoters that are active in the embryo and / or in the endosperm. In principle, seed-specific promoters can is isolated from both dicotyledonous and monocotyledonous plants. Preferred promoters are listed below: USP (= unknown seed protein) and vicilin (Vicia faba) [Bäumlein et al., Mol. Gen Genet., 1991, 225(3)], napin (rape) [US 5,608,152], acyl carrier protein (rape) [US 5,315,001 and WO 92 / 18634], oleosin (Arabidopsis thaliana) [WO 98 / 45461 and WO 93 / 20216], phaseolin (Phaseolus vulgaris) [US 5,504,200], Bce4 [WO 91 / 13980], legumines B4 (LegB4 promoter) [Bäumlein et al., Plant J., 2,2, 1992], Lpt2 and lpt1 (barley) [WO 95 / 15389 and WO95 / 23230], seed-specific promoters from rice, maize and wheat [WO 99 / 16890], Amy32b, Amy 6-6 and aleurain [US 5,677,474], Bce4 (rape) [US 5,530,149], glycinin (soybean) [EP 571,741], phosphoenol pyruvate carboxylase (soybean) [JP 06 / 62870], ADR12-2 (soybean) [WO 98 / 08962], isocitrate lyase (rape) [US 5,689,040] or α-amylase (barley) [EP 781 849]. Plant gene expression can also be facilitated via a chemically inducible promoter (see overview in Gatz 1997, Annu. Fox. Plant Physiol. Plant Mol. Biol., 48:89-108). Chemical inducible promoters are particularly suitable when gene expression is desired place in a time-specific way. Examples of such promoters are a salicylic acid- inducible promoter (WO 95 / 19443), a tetracycline-inducible promoter (Gatz et al. (1992) Plant J. 2, 397-404) and an ethanol-inducible promoter. To ensure stable integration of biosynthesis genes in the transgenic plant over a series of generations, each of the nucleic acids encoding Δ12-desaturase, ω3- desaturase, Δ9-elongase, Δ6-desaturase, Δ8-desaturase, Δ6-elongase, Δ5-desaturase, 5-elongase and / or 4-desaturase and which are used in method, be expressed under the control of a separate promoter, preferably a promoter that differs from the other promoters, since repetitive sequence motifs can lead to instability of T-DNA or to recombination events. In this connection, the expression cassette is advantageously constructed in such a way that a promoter is followed by a suitable cleavage site, advantageously in a polylinker, for insertion of the nucleic acid to be expressed and, if appropriate, a terminator sequence positioned behind the polylinker. This sequence is repeated many times, preferably three, four or five times, so that up to five genes can be combined in one construct and introduced into the transgenic plant to be expressed. Advantageously, the sequence is repeated up to three times. To express the nucleic acid sequences, the latter is inserted behind the promoter via a suitable cleavage site, for example in the polylinker. Beneficial has each nucleic acid sequence its own promoter and, if appropriate, its own terminator sequence. Such advantageous constructions are described in, for example, DE 101 02 337 or DE 101 02 338. However, it is also possible to insert a number of nucleic acid sequences behind a promoter and, if appropriate, in front of one terminator sequence. Here is the insertion site or sequence, of the inserted nucleic acids i the expression cassette is not of critical importance, which means that a nucleic acid sequence can be inserted in the first or last position in the cassette without its expression being significantly affected by it. Advantageously, different promoters can, such as for example USP, LegB4 or DC3 promoter and different terminator sequences are used in the expression cassette. However, it is also possible to use only one type of promoter i the cassette. However, this can lead to unwanted recombination events. As described above, the transcription of the genes introduced should be beneficial are terminated with suitable terminator sequences at the 3' end of the biosynthesis genes which is introduced (behind the stop codon). An example of a sequence that can be used in this context is the OCS 1 terminator sequence. As is the case with the promoters should different terminator sequences are used for each gene. As described above, the gene construct can also comprise additional genes which must be introduced into the organisms. It is possible and advantageous to introduce i the host organisms and express therein, regulatory genes such as genes for inducers, repressors or enzymes which, due to their enzymatic activity, participate in the regulation of one or more genes in a biosynthesis pathway. These genes can be of heterologous or of homologous origin. Furthermore, additional biosynthesis genes for fatty acid or lipid metabolism advantageously be present in a nucleic acid construct or gene engineering; however, these genes can also be positioned on one or more additional nucleic acid constructs. Biosynthesis genes for fatty acid or lipid metabolism that is preferably used is a gene selected from the group consisting of acyl- CoA dehydrogenase(s), acyl-ACP [= acyl-carrier protein] desaturase(s), acyl-ACP thioesterase(s), fatty acid acyltransferase(s), acyl-CoA:lysophospholipid acyltransferases, fatty acid synthase(s), fatty acid hydroxylase(s), acetyl coenzyme A carboxylase(s), acyl- coenzyme A oxidase(s), fatty acid desaturase(s), fatty acid acetylenase(s), lipoxygenase(s), triacylglycerol lipase(s), allene oxide synthase(s), hydroperoxide lyase(s) or fatty acid elongase(s) or combinations thereof. Especially beneficial nucleic acid sequences are biosynthesis genes for fatty acid or lipid metabolism selected from group acyl-CoA:lysophospholipid acyltransferase, ω3-desaturase, 4-desaturase, Δ5- desaturase, 6-desaturase, Δ8-desaturase, Δ9-desaturase, 12-desaturase, Δ5- elongase, Δ6-elongase and / or Δ9-elongase. In this context, the above-mentioned nucleic acids or genes can be cloned into expression cassettes, such as those mentioned above, in combination with other elongases and desaturases and are used for the transformation of plants using Agrobacterium. Here, the regulatory sequences or factors, as described above, can preferably have a positive effect on, and thus improve, expression genes that are introduced. Thus, improvement of the regulatory elements can advantageously take place at the transcriptional level using strong transcriptional signals such as promote and / or enhance. However, an improved translation is also possible, for example by improving the stability of mRNA. In principle, the expression cassettes can used directly for introduction into the plants or otherwise introduced in a vector. These advantageous vectors, preferably expression vectors, include the nucleic acids that code for Δ12-desaturases, ω3-desaturases, 9-elongases, Δ6-desaturases, Δ8-desaturases, Δ6-elongases, 5-desaturases, 5-elongases or Δ4-desaturases and which are used in the method or else one nucleic acid construct that the nucleic acid used either alone or in combination with additional biosynthesis genes for fatty acid or lipid metabolism such as acyl- CoA:lysophospholipid acyltransferases, ω3-desaturases, 4-desaturases, 5-desaturases, 6-desaturases, Δ8-desaturases, 9-desaturases, 12-desaturases, ω3-desaturases, Δ5 elongases, Δ6 elongases and / or Δ9 elongases. As used herein context, the term "vector" denotes a nucleic acid molecule that can transport another nucleic acid to which it is bound. One type of vector is a “plasmid”, a circular double-stranded DNA loop into which additional DNA segments can be ligated. One an additional type of vector is a viral vector, as it is possible for additional DNA segments to be ligated into the viral genome. Certain vectors can replicate autonomously in a host cell into which they are introduced (for example, bacterial vectors with bacterial origin of replication). Other vectors are advantageously integrated into the genome of a host cell when they are introduced into the host cell and thus replicate together with the host genome. Furthermore, certain vectors can control the expression of genes with which they are operably linked. These vectors are referred to in the present context as "expression vectors". Generally, expression vectors suitable for DNA recombination techniques are in form of plasmids. In the present description, "plasmid" and "vector" can be used interchangeably each other since the plasmid is the form of vector most often used. However, is the invention is also intended to cover other forms of expression vectors, such as viral ones vectors, which perform similar functions. Furthermore, the term "vector" is also intended to include other vectors known to one skilled in the art, such as phage, viruses such as SV40, CMV, TMV, transposons, IS elements, phasmids, phagemids, cosmids, linear or circular DNA. Recombinant expression vectors advantageously used in the method includes the nucleic acids described below or the one described above gene construction in a form suitable for expressing the nucleic acids used in a host cell, which means that the recombinant expression vectors comprise one or more regulatory sequences, selected on the basis of the host cells used for expression, which regulator sequence(s) are operably linked with the nucleic acid sequence to is expressed. In a recombinant expression vector, "linked operably" means that the nucleotide sequence of interest is linked to the regulatory sequence(s) in such a way that expression of the nucleotide sequence is possible and they are bound to each other in such a way way that both sequences perform the assumed function attributed to the sequence (for example in an in vitro transcription / translation system or in a host cell if the vector is introduced into the host cell). The term "regulatory sequence" shall include promoters, enhancers and other expression control elements (eg polyadenylation signals). These regulatory sequences are described in, for example Goeddel: Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990) or see: Gruber and Crosby, in: Methods in Plant Molecular Biology and Biotechnology, CRC Press, Boca Raton, Florida, Ed.: Glick and Thompson, Chapter 7, 89-108, including the references given there. Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cells and those that control the direct expression of the nucleotide sequence only in specific host cells under specific conditions. A person skilled in the art knows that the design of the expression vector may depend on factors such as the choice of host cell to is transformed, the desired expression level of the protein and the like. The recombinant expression vectors used can be designed for expression of Δ12-desaturases, ω3-desaturases, Δ9-elongases, Δ6-desaturases, Δ8-desaturases, Δ6- elongases, Δ5-desaturases, Δ5-elongases and / or Δ4-desaturases in prokaryotic or eukaryotic cells. This is advantageous since the intermediate step of vector construction often is performed in microorganisms for convenience. For example, Δ12-desaturase-, ω3-desaturase-, Δ9-elongase-, Δ6-desaturase-, Δ8-desaturase-, Δ6-elongase-, Δ5- desaturase, Δ5-elongase and / or Δ4-desaturase genes are expressed in bacterial cells, insect cells (using Baculovirus expression vectors), yeast and others fungal cells (see Romanos, M.A., et al. (1992) "Foreign gene expression in yeast: a review”, Yeast 8:423-488; van den Hondel, C. A. M. J. J., et al. (1991) "Heterologous gene expression in filamentous fungi”, in: More Gene Manipulations in Fungi, J.W. Bennet & L.L. Lasure, Ed., pp. 396-428: Academic Press: San Diego; and water it Hondel, C.A.M.J.J., & Punt, P.J. (1991) "Gene transfer systems and vectors development for filamentous fungi, in: Applied Molecular Genetics of Fungi, Peberdy, J.F., et al., Ed., pp. 1-28, Cambridge University Press: Cambridge), algae (Falciatore et al., 1999, Marine Biotechnology,1, 3:239-251), ciliates of the types: Holotrichia, Peritrichia, Spirotrichia, Suctoria, Tetrahymena, Paramecium, Colpidium, Glaucoma, Platyophrya, Potomacus, Desaturaseudocohnilembus, Euplotes, Engelmaniella and Stylonychia, especially of the genus Stylonychia lemnae, using vectors in a transformation method as described in WO 98 / 01572 and, preferably, in cells of multicellular plants (see Schmidt, R. and Willmitzer, L. (1988) "High efficiency Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana leaf and cotyledon explants” Plant Cell Rep.:583-586; Plant Molecular Biology and Biotechnology, C Press, Boca Raton, Florida, Chapters 6 / 7, pp. 71-119 (1993); F.F. White, B. Jenes et al., Techniques for Gene Transfer in: Transgenic Plants, Vol. 1, Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press (1993), 128-43; Potrykus, Annu. Fox. Plant Physiol. Plant Molec. Biol. 42 (1991), 205-225 (and references indicated there)). Suitable host cells are further described in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase. In most cases, expression of proteins in prokaryotes involves the use of vectors comprising constitutive or inducible promoters that direct expression of fusion or non-fusion proteins. Typical fusion expression vectors are i.a. pGEX (Pharmacia Biotech Inc; Smith, D.B. and Johnson, K.S. (1988) Gene 67:31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ), where glutathione S-transferase (GST), maltose-E binding protein and protein A, respectively, are condensed with the recombinant target protein. Examples of suitable inducible non-fusion E. coli expression vectors are blue. pTrc (Amann et al. (1988) Gene 69:301-315) and pET 11d (Studier et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 60-89). Target gene expression from the pTrc vector is based on transcription from a hybrid trp-lac fusion promoter of host RNA polymerase. Target gene expression from the vector pET 11d is based on the transcription of a T7-gn10-lac fusion promoter, which is mediated by a viral RNA polymerase (T7 gn1), which is co-expressed. This viral polymerase is provided by host strains BL21 (DE3) or HMS174 (DE3) from a resident λ prophage containing a T7 gn1 gene under transcriptional control of lacUV 5 promoter. Other vectors suitable for prokaryotic organisms are known to those skilled in the art, these vectors are for example in E. coli pLG338, pACYC184, pBR series such as pBR322, pUC series such as pUC18 or pUC19, M113mp series, pKC30, pRep4, pHS1, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III113-B1, λgt11 or pBdCI, in Streptomyces pIJ101, pIJ364, pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in Corynebacterium pSA77 or pAJ667. In a further embodiment, the expression vector is a yeast expression vector. Examples of vectors for expression in the yeast S. cerevisiae include pYeDesaturasec1 (Baldari et al. (1987) Embo J. 6:229-234), pMFa (Kurjan and Herskowitz (1982) Cell 30:933-943), pJRY88 (Schultz et al. (1987) Gene 54:113-123) and pYES2 (Invitrogen Corporation, San Diego, CA). Vectors and processes for construction of vectors suitable for use in other fungi such as filamentous fungi, include those described in detail in: van den Hondel, C.A.M.J.J., & Punt, P.J. (1991) ”Gene transfer systems and vector development for filamentous fungi, in: Applied Molecular Genetics of Fungi, J.F. Peberdy et al., Ed., pp. 1- 28, Cambridge University Press: Cambridge or in: More Gene Manipulations in Fungi [J.W. Bennet & L.L. Lasure, Ed., pp. 396-428: Academic Press: San Diego]. Additional suitable yeast vectors are for example pAG-1, YEp6, YEp13 or pEMBLYe23. Alternatively, Δ12-desaturases, ω3-desaturases, Δ9-elongases, Δ6- desaturases, Δ8-desaturases, Δ6-elongases, Δ5-desaturases, Δ5-elongases and / or Δ4- desaturases are expressed in insect cells using Baculovirus vectors. Baculovirus expression vectors available for expression of proteins in cultured insect cells (eg Sf9 cells) comprise the pAc series (Smith et al. (1983) Mol. Cell Biol.. 3:2156-2165) and the pVL series (Lucklow and Summers (1989) Virology 170:31-39). The above vectors are just a small overview of suitable vectors that are possible. Additional plasmids are known to those skilled in the art and are described in, for example: Cloning vectors (Ed. Pouwels, P.H., et al., Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018). For additional suitable prokaryotic expression systems and eukaryotic cells, see Chapters 16 and 17 in Sambrook, J., Fritsch, E.F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. In a further embodiment of the method, Δ12-desaturases, ω3- desaturases, Δ9-elongases, Δ6-desaturases, Δ8-desaturases, Δ6-elongases, Δ5- desaturases, Δ5-elongases and / or Δ4-desaturases are expressed in unicellular plant cells (such as algae), see Falciatore et al., 1999, Marine Biotechnology 1 (3):239- 251 and references given there and in plant cells from higher plants (eg spermatophytes such as arable crops). Examples of plant expression vectors include those described in detail in: Becker, D., Kemper, E., Schell, J. and Masterson, R. (1992) "New plant binary vectors with selectable markers located proximal to the left border”, Plant Mol. Biol. 20:1195-1197; and Bevan, M.W. (1984) "Binary Agrobacterium vectors for plant transformation", Nucl. Acids Res. 12:8711-8721; Vectors for Gene Transfer in Higher Plants; in: Transgenic Plants, Vol. 1, Engineering and Utilization, Ed.: Kung and R. Wu, Academic Press, 1993, pp. 15-38. A plant expression cassette preferably comprises regulatory sequences which can control the expression of genes in plant cells and which are bound operably so that each sequence can fulfill its function, such as transcriptional termination, for example polyadenylation signals. Preferred polyadenylation signals are those deriv from Agrobacterium tumefaciens T-DNA, such as gene 3 of the Ti plasmid pTiACH5 (Gielen et al., EMBO J. 3 (1984) 835 et seq.), which is known as octopine synthase or functional equivalents thereof, but all other terminator sequences that are functionally active in plants are also suitable. Since plant gene expression is very often not limited to transcription level, a plant expression cassette preferably comprises other sequences which are bound operably, such as translational enhancers, for example "overdrive"- the sequence, which amplifies the tobacco mosaic virus 5' - untranslated leader sequence, which increases the protein / RNA ratio (Gallie et al., 1987, Nucl. Acids Research 15:8693-8711). As described above, plant gene expression must be operably linked with a suitable promoter that triggers gene expression with correct timing or on a cell or tissue-specific manner. Useful promoters are constitutive promoters (Benfey et al., EMBO J. 8 (1989) 2195-2202), such as those derived from plant viruses, such as 35S CaMV (Franck et al., Cell 21 (1980) 285-294), 19S CaMV (see also US 5352605 and WO 84 / 02913) or plant promoters, such as the Rubisco subunit promoter, which is described in US 4,962,028. Other preferred sequences for use in operable binding in plant gene expression cassettes are targeting sequences, which are necessary for the control of the gene product to its corresponding cell compartment (see a review in Kermode, Crit. Rev. Plant Sci. 15, 4 (1996) 285-423 and references therein), for example into the vacuole, in the nucleus, all types of plastids, such as amyloplasts, chloroplasts, chromoplasts, it extracellular space, the mitochondria, endoplasmic reticulum, elaioplasts, peroxisomes and other chambers in plant cells. As described above, plant gene expression can also be achieved via a chemical inducible promoter (see overview in Gatz 1997, Annu. Rev. Plant Physiol. Plant Mol. Biol., 48:89-108). Chemically inducible promoters are particularly suitable when it is desired that gene expression takes place in a time-specific manner. Examples of such promoters are a salicylic acid-inducible promoter (WO 95 / 19443), a tetracycline-inducible promoter (Gatz et al. (1992) Plant J. 2, 397-404) and an ethanol-inducible promoter. Promoters that respond to biotic or abiotic stress conditions are also suitable, for example the pathogen-induced PRP1 gene promoter (Ward et al., Plant. Mol. Biol. 22 (1993) 361-366), the heat-inducible tomato hsp80 promoter (US 5,187,267), the cold-inducible potato alpha-amylase promoter (WO 96 / 12814) or the wound-inducible pinII promoter (EP-A-0 375 091). Particularly preferred are the promoters which bring about gene expression in tissues and organs where the biosynthesis of fatty acids, lipids and oils takes place, in germ cells, such as cells in the endosperm and in the developing embryo. Suitable promoters are rapeseed napin- promoter (US 5,608,152), Vicia faba USP promoter (Baeumlein et al., Mol Gen Genet, 1991, 225 (3):459-67), Arabidopsis oleosin promoter (WO 98 / 45461), Phaseolus vulgaris phaseolin promoter (US 5,504,200), Brassica Bce4 promoter (WO 91 / 13980) or leguminous B4 promoter (LeB4; Baeumlein et al., 1992, Plant Journal, 2 (2):233-9) and promoters that cause seed-specific expression in monocots such as maize, barley, wheat, rye, rice and the like. Suitable special promoters are barley lpt2 or lpt1 gene promoter (WO 95 / 15389 and WO 95 / 23230) or the promoters from barley hordein gene, rice glutelin gene, rice oryzin gene, rice prolamin gene, wheat gliadin gene, wheat glutelin gene, maize zein gene, oat glutelin gene, sorghum casein gene or rye secalin gene, which are described in WO 99 / 16890. In particular, it may be desired to achieve multiparallel expression of Δ12-desaturases, ω3-desaturases, Δ9-elongases, Δ6-desaturases, Δ8-desaturases, Δ6- elongases, Δ5-desaturases, Δ5-elongases and / or Δ4-desaturases used in the procedure. Such expression cassettes can be introduced by simultaneous transformation of a variety of individual expression constructs or, preferably, by combining a series of expression cassettes on one construct. A number of vectors can too transformed with in each case a number of expression cassettes and then transferred to the host cell. Other promoters which are likewise particularly suitable are those which entail a plastid- specific expression, since plastids constitute the chamber where the precursors and some end products of lipid biosynthesis are synthesized. Suitable promoters, such as the viral one RNA polymerase promoter, is described in WO 95 / 16783 and WO 97 / 06250 and clpP- promoter from Arabidopsis, described in WO 99 / 46394. Vector DNA can be introduced into prokaryotic and eukaryotic cells by conventional transformation or transfection techniques. The terms "transformation" and "transfection", conjugation and transduction, as used in the present context, shall include a number of methods known in the prior art for the introduction of foreign nucleic acid (eg DNA) in a host cell, comprising calcium phosphate or calcium chloride coprecipitation, DEAE-dextran-mediated transfection, lipofection, natural competence, chemically mediated transfer, electroporation or particle bombardment. Suitable methods of transformation or transfection of host cells, including plant cells, can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual., 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) and other laboratory textbooks such as Methods in Molecular Biology, 1995, Vol. 44, Agrobacterium Protocols, Ed.: Gartland and Davey, Humana Press, Totowa, New Jersey. Host cells which are in principle suitable for taking up the nucleic acid according to the invention, the gene product according to the invention or the vector according to the invention is any prokaryotic or eukaryotic organism. The host organisms that benefit used are microorganisms such as fungi or yeast or plant cells, preferably plants or parts thereof. Mushrooms, yeasts or plants are preferably used, especially preferably plants, very particularly preferably plants such as oil crops, which have a lot of lipid compounds, such as canola, evening primrose, hemp, thistle, peanut, canola, linseed, soybean, thistle, sunflower, borage or plants such as corn, wheat, rye, oats, rye wheat, rice, barley, cotton, cassava, pepper, Tagetes, Solanacea plants such as potato, tobacco, aubergine and tomato, Vicia species, pea, alfalfa, shrubs (coffee, cocoa, tea), Salix species, trees (oil palm, coconut) and perennial grasses and forage crops. Special preferred plants according to the invention are oil crops such as soybean, peanut, rapeseed, canola, linseed, hemp, evening primrose, sunflower, milk thistle, trees (oil palm, coconut). The invention further relates to the isolated nucleic acid sequence described above which encode polypeptides with Δ5-elongase activity, where the elongase was encoded by av the nucleic acid sequences convert C - and C -fatty acids with one double bond and 16 18 advantageously polyunsaturated C fatty acids with one Δ6 double bond and polyunsaturated C - 18 20 fatty acids with one Δ5 double bond. C fatty acids are not extended. 22 Advantageous isolated nucleic acid sequences are nucleic acid sequences which encode for polypeptides with Δ5-elongase activity and comprising an amino acid sequence selected from the group of amino acid sequences having the sequence shown in SEQ ID NO: 115, SEQ ID NO NO: 116, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141 or SEQ ID NO: 142. Further advantageous isolated nucleic acid sequences are nucleic acid sequences which encode polypeptides with Δ5-elongase activity and which comprise a combination of the amino acid sequences selected from the group consisting of: a) SEQ ID NO: 115 and SEQ ID NO: 139, SEQ ID NO: 115 and SEQ ID NO: 140 or SEQ ID NO: 139 and SEQ ID NO: 140; or b) SEQ ID NO: 116 and SEQ ID NO: 141, SEQ ID NO: 116 and SEQ ID NO: 142 or SEQ ID NO: 141 and SEQ ID NO: 142; or c) SEKV ID NO: 115, SEKV ID NO: 139 and SEKV ID NO: 140 or SEKV ID NO: 116, SEQ ID NO: 141 and SEQ ID NO: 142. Preferred nucleic acid sequences encoding polypeptides with Δ5 elongase activity advantageously comprises the above amino acid sequences. The latter is described in more detail in Table 2. Particularly advantageous isolated nucleic acid sequences are sequences selected from the group consisting of: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 113, SEQ ID NO: 131 or SEQ ID NO: 133, b) nucleic acid sequences which, as a result of degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 114, SEQ ID NO: 132 or SEQ ID NO: 134, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 113, SEQ ID NO: 131 or SEQ ID NO: 133 having polypeptides with at least 40% homology to amino acid level with SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: NO: 50, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 114, SEQ ID NO: 132 or SEQ ID NR: 134 and which has Δ5-elongase activity. The invention further relates to the nucleic acid sequences specified below and which encode Δ6-elongases, ω3-desaturases, Δ6-desaturases, Δ5-desaturases, Δ4- desaturases or Δ12-desaturases. Further advantageous isolated nucleic acid sequences are sequences selected from the group consisting of: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 69, SEQ ID NO: 81, SEQ ID NO: 111 or SEQ ID NO: 183, b) nucleic acid sequences which, as a result of degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 70, SEQ ID NO: 82, SEQ ID NO: 112 or SEQ ID NO: 184, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 69, SEQ ID NO: 81, SEQ ID NO: ID NO: 111 or SEQ ID NO: 183 encoding polypeptides with at least 40% homology at the amino acid level with SEQ ID NO: 70, SEQ ID NO: 82, SEQ ID NO NO: 112 or SEQ ID NO: 184 and which has Δ6-elongase activity. Isolated nucleic acid sequences encoding polypeptides with ω3-desaturase- activity, selected from the group consisting of: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 87 or SEQ ID NO NO: 105, b) nucleic acid sequences which, as a result of degeneracy of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 88 or SEQ ID NO NO: 106, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 87 or SEQ ID NO: 105 which have polypeptides with at least 60% identity at amino acid level with SEQ ID NO: 88 or SEQ ID NO: 106 and which has ω3-desaturase activity. Isolated nucleic acid sequences encoding polypeptides with 6-desaturase- activity, selected from the group consisting of: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 89 or in SEQ ID NO NO: 97, b) nucleic acid sequences which, as a result of degeneration of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 90 or SEQ ID NO NO: 98, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 89 or SEQ ID NO: 97 which encode polypeptides with at least 40% homology at the amino acid level with SEQ ID NO: 90 or SEQ ID NO: 98 and which have 6-desaturase activity. Isolated nucleic acid sequences encoding polypeptides with 5-desaturase activity, selected from the group consisting of: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 99 or in SEQ ID NO: 101, b) nucleic acid sequences which, as a result of degeneration of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 92, SEQ ID NO NO: 94, SEQ ID NO: 100 or in SEQ ID NO: 102, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 99 or in SEQ ID NO: 101 which encode polypeptides with at least 40% homology at the amino acid level with SEQ ID NO: 92, SEQ ID NO: 92, SEQ ID NO: 92, SEQ ID NO: 92 ID NO: 94, SEKV ID NO: 100 or in SEKV ID NO: 102 and who have 5-desaturase activity. Isolated nucleic acid sequences encoding polypeptides with 12-desaturase- activity, selected from the group consisting of: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 95 or in SEQ ID NO NO: 103, b) nucleic acid sequences which, as a result of degeneration of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 96 or in SEQ ID NO: 104, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 95 or in SEQ ID NO NO: 103 which codes for polypeptides with at least 40% homology at the amino acid level with SEQ ID NO: 96 or in SEQ ID NO: 104 and which has 6-desaturase Activity. Isolated nucleic acid sequences encoding polypeptides with 12-desaturase- activity, selected from the group consisting of: a) a nucleic acid sequence with the sequence shown in SEQ ID NO: 107 or in SEQ ID NO NO: 109, b) nucleic acid sequences which, as a result of degeneration of the genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 108 or SEQ ID NO: 110, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 107 or SEQ ID NO NO: 109 which codes for polypeptides with at least 50% homology at the amino acid level with SEQ ID NO: 108 or SEQ ID NO: 110 and which have 12-desaturase- Activity. The above-mentioned nucleic acids according to the invention are derived from organisms so such as non-human animals, ciliates, fungi, plants such as algae or dinoflagellates such as can synthesize PUFA. The isolated nucleic acid sequences mentioned above are advantageously derived from the order Salmoniformes, Xenopus or Ciona, diatom genera Thalassiosira or Crythecodinium or from the family of Prasinophyceae, such as the genus Ostreococcus or the family Euglenaceae, such as the genus Euglena or Pythiaceae, such as the genus Phytophthora. The invention further relates to isolated nucleic acid sequences as described above which encode polypeptides with ω3-desaturase activity, where ω3-desaturases coded for by the nucleic acid sequences converts C -, C - and C -fatty acids with two, three, 18 20 22 four or five double bonds and advantageously polyunsaturated C fatty acids with two or three 18 double bonds and polyunsaturated C fatty acids with two, three or four double bonds. 20 C fatty acids with four or five double bonds are also desaturated. 22 As described above, the invention further relates to isolated nucleic acid sequences which encode polypeptides with Δ12-desaturases, Δ4-desaturases, Δ5-desaturases and Δ6-desaturases, where Δ12-desaturases, Δ4-desaturases, Δ5-desaturases or Δ6- desaturases encoded by these nucleic acid sequences convert C -, C - and C - 18 20 22 fatty acids with one, two, three, four or five double bonds and advantageously polyunsaturated C - 18 9 9,12 fatty acids with one, two or three double bonds such as C18:1, C18:2 or C18:3 9,12,15 8,11,14 , polyunsaturated C fatty acids with three or four double bonds such as C20:3 20 8,11,14,17 or C20:4 or polyunsaturated C fatty acids with four or five double bonds 22 7,10,13,16 7,10,13,16,19 such as C22:4 or C22:5 . The fatty acids are advantageously desaturated in phospholipids or CoA fatty acid esters, advantageously in CoA fatty acid esters. In an advantageous embodiment, the term "nucleic acid (molecule)" includes which used in this context in addition the untranslated sequence at its 3' and 5' end coding gene region: at least 500, preferably 200, especially preferably 100 nucleotides of the sequence upstream of the 5' end of the coding region and at least 100, preferably 50, especially preferably 20 nucleotides of the sequence downstream of the 3' end of the coding gene region. An "isolated" nucleic acid molecule is separated from others nucleic acid molecules that are present in the natural source of the nucleic acid. One "isolated" nucleic acid preferably has no naturally flanking sequences the nucleic acid in genomic DNA in the organism from which the nucleic acid is derived (for for example sequences that are located at the 5'- and 3'-ends of the nucleic acid). In different embodiments, the isolated Δ12-desaturase-, ω3-desaturase-, Δ9-elongase-, Δ6-desaturase-, Δ8-desaturase-, Δ6-elongase-, Δ5-desaturase-, Δ5-elongase- or Δ4-desaturase molecule include, for example, fewer than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of naturally flanking nucleotide sequences the nucleic acid molecule in genomic DNA in the cell from which the nucleic acid is derived. The nucleic acid molecules used in the method, for example et nucleic acid molecule with a nucleotide sequence SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 or a part of it can be isolated using standard molecular-biological techniques and the sequence information provided here. For example, a homologous sequence or homologous, conserved sequence regions are also identified on DNA or amino acid level using comparative algorithms. They can be used as hybridization probes and standard hybridization techniques (such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) to isolate further nucleic acid sequences that can be used in the method. Furthermore, can a nucleic acid molecule comprising a complete sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NR: 183 or part thereof, is isolated by polymerase chain reaction, where oligonucleotide primers are used on the basis of this sequence or parts thereof (for example et nucleic acid molecule comprising the complete sequence or part thereof can be isolated by polymerase chain reaction using oligonucleotide primers that have been formed based on this same sequence). For example, mRNA can be isolated from cells (for for example using the guanidinium thiocyanate extraction method according to Chirgwin et eel. (1979) Biochemistry 18:5294-5299) and cDNA by reverse transcriptase (for for example, Moloney MLV reverse transcriptase, available from Gibco / BRL, Bethesda, MD or AMV reverse transcriptase, available from Seikagaku America, Inc., St.Petersburg, FL). Synthetic oligonucleotide primers for the amplification using polymerase chain reaction can be formed based on one of the sequences shown in SEQ ID NO NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 or using the amino acid sequences set forth in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 118, SEQ ID NO: 120, SEQ ID NO: 132, SEQ ID NO: 134, SEQ ID NO: 136, SEQ ID NO: 138 or SEQ ID NO: ID NO: 184. A nucleic acid according to the invention can be amplified by standard PCR amplification techniques using cDNA or, alternatively, genomic DNA such as template and suitable oligonucleotide primers. The nucleic acid thus amplified can be cloned into a suitable vector and characterized by means of DNA sequence analysis. Oligonucleotides corresponding to a desaturase nucleotide sequence can be formed by standard synthesis methods, for example using an automatic DNA synthesizer. Homologs of Δ12-desaturase-, ω3-desaturase-, Δ9-elongase-, Δ6-desaturase- , Δ8-desaturase-, Δ6-elongase-, Δ5-desaturase-, Δ5-elongase- or Δ4-desaturase- nucleic acid sequences with the sequence SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 means for for example allelic variants by at least about 50 or 60%, preferably at least about 60 or 70%, more preferably at least about 70 or 80%, 90% or 95% and even more preferred at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity or homology with a nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 or their homologues, derivatives or analogues or parts thereof. Furthermore, isolated nucleic acid molecules in a nucleotide sequence which hybridizes with one of the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 or with a portion thereof, for example hybridized under stringent conditions. A part of it shall be understood to mean, according to the invention, that at least 25 base pairs (= bp), 50 bp, 75 bp, 100 bp, 125 bp or 150 bp, preferably at least 175 bp, 200 bp, 225 bp, 250 bp, 275 bp or 300 bp, especially preferably 350 bp, 400 bp, 450 bp, 500 bp or more base pairs are used for the hybridization. It is also possible and beneficial to use it complete sequence. Allelic variants include especially functional variants such as can be achieved by deletion, insertion or substitution of nucleotides from / to the sequence indicated in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183, it being believed, however, that the enzyme activity of the resulting proteins that are synthesized are advantageously retained for the insertion of one or more genes. Proteins that retain the enzymatic activity of Δ12-desaturase, ω3-desaturase, Δ9-elongase, Δ6-desaturase, Δ8-desaturase, Δ6-elongase, Δ5- desaturase, Δ5-elongase or Δ4-desaturase, i.e. whose activity is essentially not reduced, means proteins by at least 10%, preferably 20%, especially preferably 30%, very particularly preferably 40% of the original enzyme activity compared to the protein encoded by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183. The homology was calculated over the entire amino acid or nucleic acid sequence region. A professional has available a number programs that are based on different algorithms for comparing different sequences. Here the algorithms of Needleman and Wunsch or Smith and Waterman give particularly reliable results. The program PileUp (J. Mol. Evolution, 25, 351-360, 1987, Higgins et al., CABIOS, 5 1989: 151-153) or the programs Gap and BestFit [Needleman and Wunsch (J. Mol. Biol. 48; 443-453 (1970) and Smith and Waterman (Adv. Appl. Math. 2; 482-489 (1981)], which is part of the GCG software package [Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711 (1991)] was used for the sequence alignment. Sequence homology values ​​indicated above as a percentage was determined over the entire sequence region using the program GAP and the following settings: Gap Weight: 50, Length Weight: 3, Average Match: 10,000 and Average Mismatch: 0,000. If not otherwise specified these were settings always used as default settings for the sequence lineups. Homologues of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 mean, for example, also bacterial, fungal and plant homologues, shortened sequences, single-stranded DNA or RNA thereof coding and non-coding DNA sequence. Homologues of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 117, SEQ ID NO: 119, SEQ ID NO: 131, SEQ ID NO: 133, SEQ ID NO: 135, SEQ ID NO: 137 or SEQ ID NO: 183 also means derivatives such as for example promoter variants. The promoters upstream of the nucleotide sequences indicated can be modified by one or more nucleotide exchanges, by insertion(s) and / or deletion(s), however, without loss of functionality or activity of the promoters negatively affected. It is further possible that modification of the promoter sequence improves their activity or that they are completely replaced by more active promoters, comprehensively those from heterologous organisms. The above-mentioned nucleic acids and protein molecules with Δ12-desaturase-, ω3-desaturase-, Δ9-elongase-, Δ6-desaturase-, Δ8-desaturase-, Δ6-elongase-, Δ5-desaturase, Δ5-elongase and / or Δ4-desaturase activity involved in the metabolism of lipids and fatty acids, PUFA cofactors and enzymes or in the transport of lipophilic compounds through membranes, are used in the method according to the invention for modulating the production of PUFA in transgenic organisms, beneficial in plants such as corn, wheat, rye, oats, triticale, rice, barley, soybean, peanut, cotton, Linum species such as linseed or flax, Brassica species such as canola, canola and turnips, pepper, sunflower, borage, evening primrose and Tagetes, Solanaceae plants such as potato, tobacco, aubergine and tomato, Vicia species, pea, cassava, alfalfa, shrubs (coffee, cocoa, tea), Salix species, trees (oil palm, coconut) and perennial grasses and forage crops, either directly (for example, when the overexpression or optimization of a fatty acid biosynthesis protein has a direct effect on yield, production and / or production efficiency of the fatty acid from modified organisms) and / or may have a indirect effect which nevertheless leads to improved yield, production and / or production efficiency of PUFA or a reduction of unwanted compounds (for example when modulating the metabolism of lipids and fatty acids, cofactors and enzymes lead to modifications of yield, production and / or production efficiency or the composition of the desired compounds in the cells, which in turn can affect production of one or more fatty acids). The combination of different precursor molecules and biosynthetic enzymes leads to production of different fatty acid molecules, which have a decisive effect on the lipid preparation, since polyunsaturated fatty acids (= PUFA) are not only introduced into triacylglycerol but also in membrane lipids. Brassicaceae, Boraginaceae, Primulaceae or Linaceae are particularly suitable for production of PUFA, for example stearidonic acid, eicosapentaenoic acid and docosahexaenoic acid. Linseed (Linum usitatissimum) is particularly advantageously suitable for production of PUFA with the nucleic acid sequences according to the invention, advantageously, which described, in combination with additional desaturases and elongases. Lipid synthesis can be divided into two sections: synthesis of fatty acids and their binding to sn-glycerol-3-phosphate and addition or modification of a polar head group. Common lipids used in membranes include phospholipids, glycolipids, sphingolipids and phosphoglycerides. Fatty acid synthesis starts with the conversion of acetyl- CoA to malonyl-CoA by acetyl-CoA carboxylase or to acetyl-ACP by acetyl- transacylase. After the condensation reaction, these form two product molecules together with acetoacetyl-ACP, which is converted via a series of condensation, reduction and dehydration reactions so that a saturated fatty acid molecule with it desired chain length is achieved. Production of the unsaturated fatty acids from these molecules are catalyzed by specific desaturases, either aerobically by means of molecular oxygen or anaerobic (regarding fatty acid synthesis in microorganisms, see F.C. Neidhardt et al. (1996) E. coli and Salmonella. ASM Press: Washington, D.C., pp. 612-636 and references cited therein; Lengeler et al. (Ed.) (1999) Biology of Prokaryotes. Thieme: Stuttgart, New York and the references therein and Magnuson, K., et al. (1993) Microbiological Reviews 57:522-542 and the references therein). To review it further extension steps, the resulting phospholipid-bound fatty acids must be returned to the fatty acid CoA ester pool. This is made possible with acyl-CoA:lysophospholipid acyltransferases. Furthermore, these enzymes can transfer the extended fatty acids from CoA- esters back to the phospholipids. If appropriate, this reaction sequence can be followed repeatedly. Examples of precursors for the biosynthesis of PUFA are oleic acid, linoleic acid and linolenic acid. C18-carbon fatty acids must be extended to C20 and C22 to obtain fatty acids of the eicosa and docosa chain type. By means of the desaturases used by method, such as Δ12-, ω3-, Δ4-, Δ5-, Δ6- and Δ8-desaturases and / or Δ5-, Δ6-, Δ9-elongases, can arachidonic acid, eicosapentaenoic acid, docosapentaenoic acid or docosahexaenoic acid, advantageously eicosapentaenoic acid and / or docosahexaenoic acid, are produced and then used in various applications relating to foodstuffs, fodder, cosmetics or pharmaceuticals. C - and / or C -fatty acids with at least two, 20 22 advantageously at least three, four, five or six double bonds in the fatty acid molecule, preferably C - or C -fatty acids with advantageously four, five or six double bonds in 20 22 the fatty acid molecule, can be produced using the above-mentioned enzymes. Desaturation can take place before or after extension of the relevant fatty acid. Of this one reason can the products of desaturase activities and the further desaturation and extension step that is possible, result in preferred PUFA with a higher degree of desaturation, comprising a further extension from C - to C - fatty acids, to fatty acids 20 22 such as γ-linolenic acid, dihomo-γ-linolenic acid, arachidonic acid, stearidonic acid, eicosatetraenoic acid or eicosapentaenoic acid. Substrates for the desaturases and elongases used in the method according to the invention are C -, C - or C -fatty acids 16 18 20 such as linoleic acid, γ-linolenic acid, α-linolenic acid, dihomo-γ-linolenic acid, eicosatetraenoic acid or stearidonic acid. Preferred substrates are linoleic acid, γ-linolenic acid and / or α-linolenic acid, dihomo-γ-linolenic acid, arachidonic acid, eicosatetraenoic acid or eicosapentaenoic acid. They synthesized C - or C - fatty acids with at least two, three, four, five 20 22 or six double bonds in the fatty acids are obtained by the method according to the invention in the form of the free fatty acid or in the form of their esters, for example in the form of their glycerides. The term "glyceride" shall be understood to mean glycerol esterified with one, two or three carboxyl residues (mono-, di- or triglyceride). "Glyceride" shall also be understood to mean a mixture of different glycerides. The glyceride or glyceride mixture may include additional additives, for example free fatty acids, antioxidants, proteins, carbohydrates, vitamins and / or other substances. For the purposes of the invention, "glyceride" shall further be understood to mean glycerol derivatives. In addition to the fatty acid glycerides described above, these also include glycerophospholipids and glyceroglycolipids. Preferred examples that can be mentioned in this connection is glycerophospholipids such as lecithin (phosphatidylcholine), cardiolipin, phosphatidylglycerol, phosphatidylserine and alkylacylglycerophospholipids. Furthermore, fatty acids must then be translocated to different modification sites and introduced into triacylglycerol storage lipid. A further important step in lipid synthesis is transfer of fatty acids to the polar head groups, for example by glycerol fatty acid acyltransferase (see Frentzen, 1998, Lipid, 100(4-5):161-166). For publications on plant fatty acid biosynthesis and on desaturation, lipid metabolism and membrane transport of lipid compounds, about beta-oxidation, fatty acid modification and cofactors, triacylglycerol storage and triacylglycerol composition, including the references therein, see the following articles: Kinney, 1997, Genetic Engineering, Ed.: JK Setlow, 19:149-166; Ohlrogge and Browse, 1995, Plant Cell 7:957-970; Shanklin and Cahoon, 1998, Annu. Fox. Plant Physiol. Plant Mol. Biol. 49:611-641; Voelker, 1996, Genetic Engineering, Ed.: JK Setlow, 18:111-13; Gerhardt, 1992, Prog. Lipid R. 31:397-417; Gühnemann-Schäfer & Kindl, 1995, Biochim. Biophys Acta 1256:181-186; Kunau et al., 1995, Prog. Lipid Res. 34:267-342; Stymne et al., 1993, in: Biochemistry and Molecular Biology of Membrane and Storage Lipids of Plants, Ed.: Murata and Somerville, Rockville, American Society of Plant Physiologists, 150- 158, Murphy & Ross 1998, Plant Journal. 13(1):1-16. PUFA produced by the method comprises a group of molecules which higher animals are no longer able to synthesize and therefore must be taken up or as higher animals are no longer able to synthesize themselves in sufficient quantity and therefore must take up additional amounts, although they can be easily synthesized by other organisms such as bacteria; for example, cats are no longer able to synthesize arachidonic acid. Phospholipids for the purposes of the invention shall be understood to mean phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol and / or phosphatidylinositol, beneficial phosphatidylcholine. The terms production or productivity are known by area and includes concentration of the fermentation product (compounds with formula I) which is formed within a specific time period and in a specific fermentation volume (for example kg of product per hour per litre). They also include the productivity of a plant cell or a plant, which means the content of the desired fatty acids produced by the process in relation to the content of all fatty acids in this cell or plant. The term production efficiency includes the time required to achieve a specific production rate (for example, the time required for the cell to establish a certain production rate of a fine chemical). The term dividend or product / carbon yield is known in the field and includes the efficiency of the conversion of the carbon source of the product (ie the fine chemical). This is usually expressed for example as kg of product per kg of carbon source. In the event of an increase in the dividend or the production of the compound, the quantity of the molecules obtained by it the compound or of the suitable molecules of this compound obtained in a specific culture amount over a specified time period increased. The terms biosynthesis or biosynthetic pathway is known in the art and includes synthesis of a compound, preferably an organic compound, of a cell from intermediates, for example in a multi-step and highly regulated process. The terms catabolism or catabolic pathway is known in the field and involves cleavage of a compound, preferably an organic one compound, of a cell to give catabolites (in more general terms, less or less complex molecules), for example in a multi-step and highly regulated process. The term metabolism is known in the field and includes the total biochemical reactions that take place in an organism. Metabolism of a certain compound (for example metabolism of a fatty acid) thus includes the total biosynthesis pathways, modification pathways and catabolic pathways of this compound in the cell concerned this connection. In a further embodiment, derivatives of the nucleic acid molecule encode according to the invention represented in SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: 183 for proteins with at least 40%, advantageous about 50 or 60%, advantageously at least about 60 or 70% and more preferably at least about 70 or 80%, 80 to 90%, 90 to 95% and most preferably at least about 96%, 97%, 98%, 99% or more homology (= identity) with a complete amino acid sequence i SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 132, SEQ ID NO: 134 or SEQ ID NO: 184. The homology is calculated over the entire amino acid or the nucleic acid sequence region. The program PileUp (J. Mol. Evolution, 25, 351-360, 1987, Higgins et al., CABIOS, 5 1989: 151-153) or the programs Gap and BestFit [Needleman and Wunsch (J. Mol. Biol. 48; 443-453 (1970) and Smith and Waterman (Adv. Appl. Math. 2; 482-489 (1981)], which is part of the GCG software package [Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711 (1991)], was used for the sequence alignment. Sequence homology values ​​indicated above as a percentage was determined over the entire sequence region using the program BestFit and the following settings: Gap Weight: 50, Length Weight: 3, Average Match: 10,000 and Average Mismatch: 0,000. If not otherwise specified these were settings always used as default settings for the sequence layouts. Furthermore, the invention encompasses nucleic acid molecules that differ from one of the nucleotide sequences shown in SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: 183 (and parts thereof) due to degeneration of the genetic code and which thus codes for the same Δ12-desaturase, ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ4-desaturase, Δ6-elongase or Δ5-elongase as they encoded by the nucleotide sequences shown in SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: 183. In addition to Δ12-desaturases, ω3-desaturases, Δ5-elongases, Δ6-desaturases, Δ5- desaturases, Δ4-desaturases or Δ6-elongases shown in SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: 183, a person skilled in the art will understand that DNA sequence polymorphisms that lead to changes in the amino acid sequences of Δ12-desaturase, ω3-desaturase, Δ5-elongase, Δ6-desaturase, Δ5-desaturase, Δ4- desaturase and / or Δ6-elongase may exist in a population. These genetic polymorphisms in Δ12-desaturase-, ω3-desaturase-, Δ5-elongase-, Δ6-desaturase-, Δ5- desaturase, Δ4-desaturase and / or Δ6-elongase gene can exist between individuals in a population due to natural variation. These natural variations entail usually a variance of 1 to 5% in the nucleotide sequence of Δ12-desaturase-, ω3- desaturase, Δ5-elongase, Δ6-desaturase, Δ5-desaturase, Δ4-desaturase and / or The Δ6 elongase gene. Each and every one of these nucleotide variations and resulting amino acid polymorphisms in Δ12-desaturase, ω3-desaturase, Δ5-elongase, Δ6-desaturase, Δ5-desaturase, Δ4-desaturase and / or Δ6-elongase resulting from natural variation and does not modify the functional activity shall be covered by the invention. Due to their homology with Δ12-desaturase-, ω3-desaturase-, Δ5- elongase-, Δ6-desaturase-, Δ5-desaturase-, Δ4-desaturase- and / or Δ6-elongase- nucleic acids described herein, nucleic acid molecules that are advantageous in the method according to the invention is isolated by following the standard hybridization techniques under stringent hybridization conditions, using the sequences or part thereof as a hybridization probe. In this context it is possible, for example, to use isolated nucleic acid molecules that are at least 15 nucleotides in length and which hybridize under stringent conditions with the nucleic acid molecules comprising a nucleotide sequence in SEQ ID NO: 43, SEQ ID NO NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: 183. Nucleic acids with at least 25, 50, 100, 200 or more nucleotides can also be used. “Hybridizing under stringent conditions" as used in this context shall describe the hybridization and washing conditions under which nucleotide sequences with at least 60% homology with each other usually remain hybridized with each other. The conditions are preferably such that sequences by at least about 65%, preferably at least about 70% and esp preferably at least 75% or more homology with each other usually remain hybridized to each other. These stringent conditions are known to those skilled in the art and described in, for example Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. A preferred non-limiting example of stringent hybridization conditions is hybridizations in 6 x sodium chloride / sodium citrate (= SSC) at approximately 45°C, followed by one or several washing steps in 0.2 x SSC, 0.1% SDS at 50 to 65°C. A person skilled in the art knows that these hybridization conditions differ depending on the type of nucleic acid and, for example, when organic solvents are present, in terms of temperature and buffer concentration. Under "standard hybridization conditions" is for example the hybridization temperature, depending on the type of nucleic acid, between 42°C and 58°C i aqueous buffer with a concentration of 0.1 to 5 x SSC (pH 7.2). If organic solvents, for example 50% formamide, are present in the above buffer is the temperature under standard conditions approximately 42°C. The hybridization conditions for DNA:DNA hybrids are, for example, 0.1 x SSC and 20°C to 45°C, preferably 30°C to 45°C. The hybridization conditions for DNA:RNA hybrids are, for example, 0.1 x SSC and 30°C to 55°C, preferably 45°C to 55°C. The above hybridization conditions become determined for example for a nucleic acid of approximately 100 bp (= base pairs) in length and with a G + C content of 50% in the absence of formamide. A professional knows how determine the necessary hybridization conditions on the basis of the above textbooks or textbooks such as Sambrook et al., "Molecular Cloning", Cold Spring Harbor Laboratory, 1989; Hames and Higgins (Ed.) 1985, "Nucleic Acids Hybridization: A Practical Approach”, IRL Press at Oxford University Press, Oxford; Brown (Ed.) 1991, "Essential Molecular Biology: A Practical Approach", IRL Press at Oxford University Press, Oxford. To determine the percentage of homology (= identity) of two amino acid sequences (for example one of the sequences in SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 114, SEQ ID NO: 132, SEQ ID NO: 134 or SEQ ID NO: 184) or of two nucleic acids (for example SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: ID NO: 183) the sequences are written one below the other for an optimal comparison (for example, gaps can be introduced into the sequence of a protein or of a nucleic acid to generate an optimal alignment with the other protein or nucleic acid). The amino acid residue or nucleotides then become in the corresponding amino acid positions or nucleotide positions compared. If a position in a sequence is occupied by the same amino acid residue or the same nucleotide as the corresponding position in the second sequence, then the molecules are homologous in this position (ie amino acid or nucleic acid "homology" as used in this context corresponds to amino acid or nucleic acid "identity"). The percentage of homology between the two sequences is a function of the number of positions that the sequences have in common (ie % homology = number of identical positions / total number of positions x 100). The terms homology and identity must therefore are considered synonymous. An isolated nucleic acid molecule encoding a Δ12-desaturase, ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ4-desaturase, Δ5-elongase and / or Δ6-elongase which is homologous to a protein sequence in SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: NO: 48, SEQ ID NO: 50, SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 76, SEQ ID NO: 78, SEQ ID NO: 80, SEQ ID NO: 82, SEQ ID NO: 84, SEQ ID NO: 86, SEQ ID NO: 88, SEQ ID NO: 90, SEQ ID NO: 92, SEQ ID NO: 94, SEQ ID NO: 96, SEQ ID NO: 98, SEQ ID NO: 100, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 114, SEQ ID NO: 132, SEQ ID NO: 134 or SEQ ID NO: 184 can be formed by introducing one or more nucleotide substitutions, additions or deletions in a nucleotide sequence in SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: 183 so that one or several amino acid substitutions, additions or deletions are introduced into the protein which is coded. Mutations in one of the sequences in SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: 183 can be introduced by standard techniques such as site-specific mutagenesis and PCR-mediated mutagenesis. It is preferred to form conservative amino acid substitutions in one or more of the presumed non-essential amino acid residues. In a "conservative amino acid substitution", the amino acid residue becomes replaced with an amino acid residue with a similar side chain. Families of amino acid residues with similar side chains are defined in the area. These families include amino acids with basic side chains (eg lysine, arginine, histidine), acidic side chains (e.g. aspartic acid, glutamic acid), uncharged polar side chains (for eg glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (for example, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (eg threonine, valine, isoleucine) and aromatic side chains (eg tyrosine, phenylalanine, tryptophan, histidine). One predicted non-essential amino acid residue in a Δ12-desaturase, ω3-desaturase, Δ6- desaturase, Δ5-desaturase, Δ4-desaturase, Δ5-elongase or Δ6-elongase thus become preferably replaced by another amino acid residue from the same family of side chains. In a another embodiment, the mutations can alternatively be introduced randomly over the whole or part of the sequence that codes for Δ12-desaturase, ω3-desaturase, Δ6-desaturase, Δ5- desaturase, Δ4-desaturase, Δ5-elongase or Δ6-elongase for example by saturation mutagenesis and the resulting mutants can be screened by recombinant expression for the Δ12-desaturase-, ω3-desaturase-, Δ6-desaturase-, Δ5-desaturase, Δ4-desaturase, Δ5-elongase or Δ6-elongase activity to identify mutants that have retained Δ12-desaturase-, ω3-desaturase-, Δ6- desaturase, Δ5-desaturase, Δ4-desaturase, Δ5-elongase or Δ6-elongase activity. After mutagenesis of one of the sequences SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: 183, the protein encoded for can be recombinantly expressed and the activity of the protein can be determined, for example by using the tests described in the present text. The invention further relates to transgenic non-human organisms which include the nucleic acids SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 75, SEQ ID NO: 77, SEQ ID NO: 79, SEQ ID NO: 81, SEQ ID NO: 83, SEQ ID NO: 85, SEQ ID NO: 87, SEQ ID NO: 89, SEQ ID NO: 91, SEQ ID NO: 93, SEQ ID NO: 95, SEQ ID NO: 97, SEQ ID NO: 99, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 113, SEQ ID NO: 131, SEQ ID NO: 133 or SEQ ID NO: ID NO: 183 according to the invention or a gene construct or a vector comprising these nucleic acid sequences according to the invention. The non-human organism is advantageously a microorganism, a non-human animal or a plant, particularly preferably a plant. The present invention is illustrated in more detail by the examples that follow, which should not be considered limiting. The content of all the references, patent applications, patents and published patent applications cited herein patent application is hereby incorporated by reference. Examples: Example 1: General cloning methods: Cloning methods such as restriction digests, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, binding of DNA fragments, transformation of E. coli cells, bacterial cultures and sequence analysis of recombinant DNA were performed as described by Sambrook et al. (1989) (Cold Spring Harbor Laboratory Press: ISBN 0-87969-309- 6). Example 2: Sequence analysis of recombinant DNA: Recombinant DNA molecules were sequenced with an ABI laser fluorescence DNA- sequencer by the method according to Sanger (Sanger et al. (1977) Proc. Natl. Acad. Sci. USA74, 5463-5467). Fragments obtained by polymerase chain reaction were sequenced and verified to avoid polymerase errors in constructs that should is expressed. Example 3: Cloning of Oncorhynchus mykiss genes Search for conserved regions in the protein sequences corresponding to the elongase genes indicated in the application identified two sequences with corresponding motifs in Genbank sequence database. Name of gene Genbank no. Amino acids OmELO2 CA385234, CA364848, 264 CA366480 OmELO3 CA360014, CA350786 295 Oncoryhnchus mykiss total RNA was isolated using the RNAeasy kit from Qiagen (Valencia, CA, US). Poly-A+ RNA (mRNA) was isolated from the total RNA using oligo-dT-cellulose (Sambrook et al., 1989). RNA was subjected to reverse transcription using the Reverse Transcription System kit from Promega and cDNA synthesized was cloned into the vector lambda ZAP (lambda ZAP Gold, Stratagene). The cDNA was then extracted according to the manufacturer's instructions to yield plasmid DNA. The cDNA plasmid library was then used for PCR to clone expression plasmids. Example 4: Cloning of expression plasmids for the purpose of heterologous expression in yeast The following oligonucleotides were used for the PCR reaction to clone the two sequences for heterologous expression in yeast: Primer Nucleotide sequence 5' f* OmELO2 5' aagcttacataatggcttcaacatggcaa (SEQ ID NO: 179) 3' r* OmELO2 5' ggatccttatgtcttcttgctcttcctgtt (SEQ ID NO: 180) 5' f OmELO3 5' aagcttacataatggagaacttttaat (SEQ ID NO: 181) 3' r OmELO3 5' ggatccttcagtccccccctcactttcc (SEQ ID NO: 182) * f: forward, r: reverse Composition of PCR mix (50 μl): 5.00 μl template cDNA 5.00 μl 10x buffer (Advantage polymerase) + 25 mM MgCl 2 5.00 μl 2 mM dNTP 1.25 μl of each primer (10 pmol / μl) 0.50 µl Advantage polymerase Advantage polymerase from Clontech was used. PCR reaction conditions: Hybridization temperature: 1 minute at 55°C Denaturation temperature: 1 minute at 94°C Extension temperature: 2 minutes at 72°C Number of bikes: 35 The PCR product was incubated for 2 hours at 37°C with the restriction enzymes HindIII and Bam HI. Yeast expression vector pYES3 (Invitrogen) was incubated in the same way. Then the 812 bp PCR product, 905 bp PCR product and the vector were separated by agarose gel electrophoresis and the corresponding DNA fragments were taken out. DNA was purified using the Qiagen Gel Cleansing Kit following the manufacturer's instructions. Then became vector and elongase cDNA ligated. The Rapid Ligation kit from Roche was used for this purpose. The resulting plasmids pYES3-OmELO2 and pYES3-OmELO3 were verified by sequencing and transformed into Saccharomyces strain INVSc1 (Invitrogen) by electroporation (1500 V). As a control, pYES3 was transformed in parallel. Then became the yeast was plated on minimal "dropout" tryptophan medium supplemented with 2% glucose. Cells that were able to grow without tryptophan in the medium thus included the corresponding ones plasmids pYES3, pYES3-OmELO2 (SEQ ID NO: 51) and pYES3-OmELO3 (SEQ ID NR: 53). After selection, in each case two transformants were selected for further functional expression. Example 5: Cloning of expression plasmids for the purpose of seed-specific expression i plants To transform plants, an additional transformation vector based on pSUN- USP formed. For this purpose, NotI cleavage sites were introduced at the 5' and 3' ends of the coding sequence, using the following primer pair: PSUN-OmELO2 Forward: 5'-GCGGCCGCATAATGGCTTCAACATGGCAA (SEQ ID NO: 175) Reverse: 3'-GCGGCCGCTTATGTCTTCTTGCTCTTCCTGTT (SEQ ID NO: 176) PSUN-OMELO3 Forward: 5'-GCGGCCGCataatggagacttttaat (SEQ ID NO: 177) Reverse: 3'-GCGGCCGCtcagtccccccctcactttcc (SEQ ID NO: 178) Composition of PCR mix (50 μl): 5.00 μl template cDNA 5.00 μl 10x buffer (Advantage polymerase) + 25 mM MgCl 2 5.00 μl 2 mM dNTP 1.25 μl of each primer (10 pmol / μl) 0.50 µl Advantage polymerase Advantage polymerase from Clontech was used. PCR reaction conditions: Hybridization temperature: 1 minute at 55°C Denaturation temperature: 1 minute at 94°C Extension temperature: 2 minutes at 72°C Number of bikes: 35 The PCR products were incubated for 16 hours at 37°C with the restriction enzyme NotI. Plant expression vector pSUN300-USP was incubated in the same way. Then became The PCR products and 7624 bp vector separated by agarose gel electrophoresis and those corresponding DNA fragments were taken out. DNA was purified using Qiagen gel cleansing kit by following the manufacturer's instructions. Then vector and PCR- products ligated. Rapid ligation kits from Roche were used for this purpose. The resulting plasmids pSUN-OmELO2 and pSUN-OmELO3 were verified by sequencing. pSUN300 is a derivative of plasmid pPZP (Hajdukiewicz, P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plants transformation. Plant Mol Biol 25:989-994). pSUN-USP was derived from pSUN300, by insertion of a USP promoter as EcoRI fragment into pSUN300. The polyadenylation signal is that of the octopine synthase gene from the A. tumefaciens Ti plasmid (ocs terminator, Genbank Accession V00088) (De Greve, H., Dhaese, P., Seurinck, J., Lemmers, M., Van Montagu, M. and Schell, J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol. Appl. The gene. 1 (6), 499-511 (1982). The USP promoter corresponds to nucleotides 1-684 (Genbank Accession X56240), where part of the non-coding region of the USP gene is present in the promoter. The promoter fragment which is 684 base pairs in size was amplified using commercially available T7 standard primers (Stratagene) and using a synthesized primer via a PCR reaction following standard methods (primer sequence: 5'-GTCGACCCGCGGACTAGTGGGCCCTCT- AGACCCGGGGGATCCGGATCTGCTGGCTATGAA-3', SEQ ID NO: 174). PCR fragment again cut with EcoRI / SalI and introduced into the vector pSUN300 with OCS- terminator. This gave rise to the plasmid named pSUN-USP. The construction was used for transformation of Arabidopsis thaliana, rapeseed, tobacco and linseed. Example 6: Lipid extraction from yeast and seeds The effect of genetic modification on plants, fungi, algae, ciliates or on production of a desired compound (such as a fatty acid) can be determined by growing them modified microorganisms or the modified plant under suitable conditions (so such as those described above) and analysis of the medium and / or the cellular components for increased production of the desired product (ie of the lipids or a fatty acid). These analytical techniques are known to those skilled in the art and include spectroscopy, thin layer chromatography, different types of labeling methods, enzymatic and microbiological methods and analytical chromatography such as high performance liquid chromatography (see, for example, Ullman, Encyclopedia of Industrial Chemistry, Vol. A2, pp. 89-90 and pp. 443-613, VCH: Weinheim (1985); Fallon, A., et al., (1987) "Applications of HPLC in Biochemistry" in: Laboratory Techniques in Biochemistry and Molecular Biology, Vol. 17; Rehm et al. (1993) Biotechnology, Vol. 3, Chapter III: "Product recovery and purification", pp. 469-714, VCH: Weinheim; Belter, P. A., et al. (1988) Bioseparations: downstream processing for Biotechnology, John Wiley and Sons; Kennedy, J.F. and Cabral, J.M.S. (1992) Recovery processes for biological Materials, John Wiley and Sons; Shaeiwitz, J.A. and Henry, J.D. (1988) Biochem Separations, in: Ullmann's Encyclopedia of Industrial Chemistry, Vol. B3; Chap. 11, pp. 1-27, VCH: Weinheim; and Dechow, F.J. (1989) Separation and purification techniques in biotechnology, Noyes Publications). In addition to the above processes, plant lipids are extracted from plant material such as described by Cahoon et al. (1999) Proc. Natl. Acad. Sci. USA 96 (22):12935-12940 and Browse et al. (1986) Analytical Biochemistry 152:141-145. Qualitative and quantitative analysis of lipids or fatty acids is described by Christie, William W., Advances in Lipid Methodology, Ayr / Scotland: Oily Press (Oily Press Lipid Library; 2); Christie, William W., Gas chromatography and Lipids. A Practical Guide - Ayr, Scotland: Oily Press, 1989, Repr. 1992, IX, 307 pp. (Oily Press Lipid Library; 1); “Progress in Lipid Research, Oxford: Pergamon Press, 1 (1952) - 16 (1977) under the title: Progress in the Chemistry of Fats and Other Lipids CODEN. In addition to measuring the final product from the fermentation, it is also possible to analyse other components of the metabolic pathways used for its production desired compound, such as intermediates and byproducts, to determine it total production efficiency of the compound. The analytical methods include measurement of the amount of nutrients in the medium (for example sugars, hydrocarbons, nitrogen sources, phosphate and other ions), measurement of biomass composition and growth, analyzing the production of conventional metabolites in biosynthesis pathways and measurement of gases that are formed during fermentation. Standard methods for these measurements are described in Applied Microbial Physiology; A Practical Approach, P.M. Rhodes and P.F. Stanbury, Ed., IRL Press, pp. 103-129; 131-163 and 165-192 (ISBN: 0199635773) and references indicated therein. One example is the analysis of fatty acids (abbreviations: FAME, fatty acid methyl ester; GC-MS, gas-liquid chromatography / mass spectrometry; TAG, triacylglycerol; TLC, thin layer chromatography). Unequivocal detection of the presence of fatty acid products can be achieved by analyzing recombinant organisms using analytical standard methods: GC, GC-MS or TLC, as described in many cases by Christie et the references there (1997, in: Advances on Lipid Methodology, Fourth Edition: Christie, Oily Press, Dundee, 119-169; 1998, Gas chromatography-Massenspectrometrie-Verfahren [Gas chromatography / mass spectrometry methods], Lipide 33:343-353). The material to be analyzed can be broken up by ultrasonic treatment, painting in one glass mill, liquid nitrogen and paint or via other applicable methods. After breaking up, the material must be centrifuged. The sediment is resuspended in distilled water, heated for 10 minutes at 100°C, cooled on ice and centrifuged again, followed by extraction for one hour at 90°C in 0.5 M sulfuric acid in methanol with 2% dimethoxypropane, which leads to hydrolysed oil and lipid compounds, which give transmethylated lipids. These fatty acid methyl esters are extracted in petroleum ether and finally subjected to GC analysis by application of a capillary column (Chrompack, WCOT Fused Silica, CP-Vax-52 CB, 25 µm, 0.32 mm) at a temperature gradient between 170°C and 240°C for 20 minutes and 5 minutes at 240°C. The identity of the resulting fatty acid methyl esters must be defined using standards available from commercial sources (i.e. Sigma). Plant material is initially homogenized mechanically by pulverizing with impactors and mortar to make it more amenable to extraction. This is followed by heating at 100°C for 10 minutes and, after cooling on ice, at resedimentation. The cell sediment is hydrolysed for one hour at 90°C with 1 M methanolic sulfuric acid and 2% dimethoxypropane and the lipids are transmethylated. The resulting fatty acid methyl esters (FAME) are extracted in petroleum ether. They extracted FAME is analyzed by gas-liquid chromatography using a capillary column (Chrompack, WCOT Fused Silica, CP-Vax-52 CB, 25 m, 0.32 mm) and a temperature gradient from 170°C to 240°C for 20 minutes and 5 minutes at 240°C. The identity of the fatty acid methyl esters is confirmed by comparison with equivalents FAME standards (Sigma). The identity and position of the double bond can is further analyzed by suitable chemical derivatization of FAME mixtures, for example to give 4,4-dimethoxyoxazoline derivatives (Christie, 1998) by GC-MS. Yeast which had been transformed as described in Example 4 with the plasmids pYES3, pYES3-OmELO2 and pYES3-OmELO3 were analyzed as follows: The yeast cells from primary cultures were harvested by centrifugation (100 x g, 10 min, 20°C) and washed with 100 mM NaHCO, pH 8.0 to remove residual medium and fatty acids. 3 Fatty acid methyl esters (FAME) were produced from yeast cell sediments by acid methanolysis. For this purpose, the cell sediments were incubated with 2 ml of 1N methanolic sulfuric acid and 2% (vol / vol) dimethoxypropane for 1 hour at 80°C. FAME was extracted by extraction twice with petroleum ether (PE). To remove underivatized fatty acids, they were the organic phases in each case washed once with 2 ml of 100 mM NaHCO, pH 8.0 and 3 2 ml of distilled water. Then the PE phases were dried with NaSO, evaporated under 2 4 argon and taken up in 100 µl PE. The samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 µm, Agilent) in a Hewlett-Packard 6850 gas chromatograph flame ionization detector. The conditions for GLC analysis were as follows: the oven temperature was programmed from 50°C to 250°C at a rate of 5°C / min and finally 10 minutes at 250°C (hold). The signals were identified by comparing the retention times with the corresponding ones fatty acid standards (Sigma). The methodology is described, for example, in Napier and Michaelson, 2001, Lipids. 36(8):761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52(360):1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388(2):293-298 and Michaelson et al., 1998, FEBS Letters. 439(3):215-218. Example 7: Functional characterization of OmELO2 and OmELO3: While OmELO2 shows no elongase activity, OmELO3 was shown to have a distinct one activity with different substrates. The substrate specificity of OmElo3 was determined by expression and feeding of a variety of fatty acids (Figure 2). The substrates fed can be detected in large amounts in all transgenic yeast. All transgenic yeast show synthesis of new fatty acids, the products of OmElo3 reaction. This means that functional expression of the gene OmElo3 is possible. Figure 2 shows that OmElo3 has a substrate specificity which with high specificity leads to extension of 5 and 6 fatty acids with one ω3 double bond. Furthermore, ω6 fatty acids were (C18 and C20) further also extended with less specificity. The best substrates for OmElo3 (up to 66% elongation) was stearidonic acid (C18:4 ω3) and eicosapentaenoic acid (C20:5ω3). Example 8: Reconstitution of synthesis of DHA in yeast Reconstitution of biosynthesis of DHA (22:6 ω3) was performed starting from EPA (20:5 ω3) or stearidonic acid (18:4 ω3) by co-expression of OmElo3 together with Euglena gracilis Δ4-desaturase or Phaeodactylum tricornutum Δ5-desaturase and Euglena gracilis Δ4-desaturase. For this purpose, the expression vectors pYes2- EgD4 and pESCLeu-PtD5 additionally constructed. The above yeast strain which already transformed with pYes3-OtElo3 (SEQ ID NO: 55), was further transformed with pYes2-EgD4 or simultaneously with pYes2-EgD4 and pESCLeu-PtD5. It transformed yeasts were selected on complete minimal "dropout" tryptophan and uracil medium agar plates supplemented with 2% glucose in the case of pYes3-OmELO / pYes2-EgD4 strain and complete minimal "dropout" tryptophan, uracil and leucine medium in the case of pYes3-OmELO / pYes2-EgD4+pESCLeu-PtD5 strain. Expression was elicited by addition of 2% (w / v) galactose as indicated above. The cultures were incubated in a further 120 hours at 15°C. Figure 3 shows the fatty acid profiles of transgenic yeast that were fed with 20:5 ω3. In control yeast (A), which was transformed with the vector pYes3-OmElo3 and the blank vector pYes2, 20:5 ω3 was elongated very efficiently, yielding 22:5 ω3 (65% elongation). Further introduction of EgΔ-4 desaturase resulted in conversion of 22:5 ω3 to 22:6 ω3 (DHA). The fatty acid composition in the transgenic yeast is shown in Figure 5. After coexpression of OmElo3 and EgD4, up to 3% of DHA was detected in yeast. In a further coexpression experiment, OmElo3, EgD4 and P. tricornutum Δ5- desaturase (PtD5) co-expressed. The transgenic yeast was fed with stearidonic acid (18:4 ω3) and it was analyzed (Figure 4). The fatty acid composition of this yeast is shown in Figure 5. The fatty acid fed, 18:4 ω3, was elongated by OmElo3, yielding 20:4 ω3 (60% extension). The latter was desaturated by PtD5, yielding 20:5 ω3. PtD5- activity was 15%. Furthermore, it was possible to extend 20:5 ω3 with OmElo3, which gave 22:5 ω3. Then the newly synthesized 22:5 ω3 was desaturated to 22:6 ω3 (DHA). Up to 0.7% of DHA was obtained in these experiments. It can be seen from these experiments that the sequences OmElo3, EgD4 and PtD5 are used of the present invention is suitable for the production of DHA in eukaryotic cells. Example 9: Formation of transgenic plants a) Formation of transgenic rapeseed plants (modified method of Moloney et al., 1992, Plant Cell Reports, 8:238-242) Binary vectors in Agrobacterium tumefaciens C58C1:pGV2260 or Escherichia coli (Deblaere et al, 1984, Nucl. Acids. Res. 13, 4777-4788) can be used for generation of transgenic rapeseed plants. To transform rapeseed plants (Var. Drakkar, NPZ Nordeutsche Pflanzenzucht, Hohenlieth, Germany) becomes a 1:50 dilution of a night over culture of a positively transformed agrobacterial colony in Murashige-Skoog medium (Murashige and Skoog 1962 Physiol. Plant. 15, 473) supplemented with 3% sucrose (3MS medium) applied. Petioles or hypocotyls of newly germinated sterile rape plants (in each 2 case approx. 1 cm ) is incubated with a 1:50 agrobacterial dilution for 5-10 minutes in a Petri dish. This is followed by 3 days of co-incubation in the dark at 25°C on 3MS medium supplemented with 0.8% Bacto-agar. The cultures are then grown for 3 days with 16 hours light / 8 hours dark and cultivation continues in a weekly rhythm on MS medium supplemented with 500 mg / l Claforan (cefotaxime sodium), 50 mg / l kanamycin, 20 M benzylaminopurine (BAP), now supplemented with 1.6 g / l glucose. Growing shoots become transferred to MS medium supplemented with 2% sucrose, 250 mg / l Claforan and 0.8% Bacto- agar. If no roots were developed after three weeks, 2-indolebutyric acid was added to the medium as a growth hormone for root formation. Regenerated shoots were obtained on 2MS medium supplemented with kanamycin and Claforan; after rooting, they were transferred to compost and, after growing for two weeks in a controlled environment cabinets or in greenhouses, allowed to flower and mature seeds were harvested and analyzed by lipid assay for elongase expression, such as Δ5-elongase or Δ6-elongase activity or ω3-desaturase activity. In this way, lines with elevated content of polyunsaturated C - and C -fatty acids is identified. 20 22 b) Formation of transgenic flax seedlings Transgenic flax seedlings can be formed by, for example, the method according to Bell et al., 1999, In Vitro Cell. Dev. Biol.-Plant. 35(6):456-465 using particle bombardment. In general, linseed was transformed by an agrobacterium-mediated transformation, for example by the method according to Mlynarova et al. (1994), Plant Cell Reports 13: 282-285. Example 10: Cloning of 5-elongase genes from Thraustochytrium aureum ATCC34304 and Thraustochytrium ssp. By comparing the different elongase protein sequences found in the present application, it was possible to define conserved nucleic acid regions (histidine box: His-Val-X-His-His, tyrosine box: Met-Tyr-X-Tyr-Tyr). An EST database of T. aureum ATCC34304 and Thraustochytrium ssp. were screened for further Δ5 elongases using these sequences. The following new sequences were found: Name of gene Nucleotides Amino acids BioTaurELO1 828 bp 275 TL16y2 831 276 T. aureum ATCC34304 and Thraustochytrium ssp. total RNA was isolated using RNAeasy kit from Qiagen (Valencia, CA, US). mRNA was isolated from total RNA by using PolyATract insulation system (Promega). mRNA was subjected to reverse transcription using the Marathon cDNA amplification kit (BD Biosciences) and adapters were ligated according to the manufacturer's instructions. The cDNA library was then used for PCR for cloning expression plasmids using 5'- and 3'-RACE (rapid amplification of cDNA ends). Example 11: Cloning of expression plasmids for heterologous expression in yeast The following oligonucleotides were used for the PCR reaction to clone the sequence for heterologous expression in yeast: Primer Nucleotide sequence 5' f* BioTaurELO1 5' gacataatgacgagcaacatgag (SEQ ID NO: 170) 3' r* BioTaurELO1 5' cggcttaggccgacttggccttggg (SEQ ID NO: 171) 5'f*TL16y2 5' agacataatggacgtcgtcgagcagcaatg (SEQ ID NO: 172) 3'r*TL16y2 5' ttagatggtcttctgcttcttgggcgcc (SEQ ID NO: 173) * f: forward, r: reverse Composition of PCR mix (50 μl): 5.00 μl template cDNA 5.00 μl 10x buffer (Advantage polymerase) + 25 mM MgCl 2 5.00 μl 2 mM dNTP 1.25 μl of each primer (10 pmol / μl) 0.50 µl Advantage polymerase Advantage polymerase from Clontech was used. PCR reaction conditions: Hybridization temperature: 1 minute at 55°C Denaturation temperature: 1 minute at 94°C Extension temperature: 2 minutes at 72°C Number of bikes: 35 The PCR products BioTaurELO1 (see SEQ ID NO: 65) and TL16y2 (see SEQ ID NO: 83) was incubated for 30 minutes at 21°C together with the yeast expression vector pYES2.1-TOPO (Invitrogen) according to the manufacturer's instructions. Here, PCR- the product ligated into the vector by means of a T overhang and the activity of a topoisomerase (Invitrogen). After the incubation, E. coli DH5  cells were transformed. Suitable clones were identified by PCR, plasmid DNA was isolated using Qiagen DNAeasy seen and verified by sequencing. The correct sequence was then transformed into Saccharomyces strain INVSc1 (Invitrogen) by electroporation (1500 V). As a control, blank vector pYES2.1 was transformed in parallel. Then, the yeast was plated on minimal "dropout" uracil medium supplemented with 2% glucose. Cells that were able to grow in the medium without uracil thus include the corresponding ones plasmids pYES2.1, pYES2.1-bioTaurELO1 and pYES2.1-TL16y2. After selection was i in each case two transformants selected for further functional expression. Example 12: Cloning of expression plasmids for the purpose of seed-specific expression i plants To transform plants, an additional transformation vector based on pSUN- USP formed. For this purpose, NotI cleavage sites were introduced at the 5' and 3' ends of the coding sequence, using the following primer pairs: PSUN-bioTaurELO1 Forward: 5'-GCGGCCGCATAATGACGAGCAACATGAGC (SEQ ID NO: 166) Reverse: 3'-GCGGCCGCTTAGGCCGACTTGGCCTTGGG (SEQ ID NO: 167) PSUN-TL16y2 Forward: 5'-GCGGCCGCACCATGGACGTCGTCGAGCAGCAATG (SEQ ID NO: 168) Reverse: 5'-GCGGCCGCTTAGATGGTCTTCTGCTTCTTGGGCGCC (SEQ ID NO NO: 169) Composition of the PCR mixture (50 μl): 5.00 μl template cDNA 5.00 μl 10x buffer (Advantage polymerase) + 25 mM MgCl 2 5.00 μl 2 mM dNTP 1.25 μl of each primer (10 pmol / μl) 0.50 µl Advantage polymerase Advantage polymerase from Clontech was used. PCR reaction conditions: Hybridization temperature: 1 minute at 55°C Denaturation temperature: 1 minute at 94°C Extension temperature: 2 minutes at 72°C Number of bikes: 35 The PCR products were incubated for 16 hours at 37°C with restriction enzyme NotI. Plant- expression vector pSUN300-USP was incubated in the same way. Subsequently, PCR- the products and 7624 bp vector separated by agarose gel electrophoresis and the corresponding DNA fragments were extracted. DNA was purified using the Qiagen gel purification kit at to follow the manufacturer's instructions. Next, vector and PCR products were ligated. Rapid Ligation kits from Roche were used for this purpose. The resulting plasmids pSUN- bioTaurELO1 and pSUN-TL16y2 were verified by sequencing. pSUN300 is a derivative of plasmid pPZP (Hajdukiewicz, P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plants transformation. Plant Mol Biol 25:989-994). pSUN-USP was derived from pSUN300, by insertion of a USP promoter as EcoRI fragment into pSUN300. Polyadenylation signal is that of octopine synthase gene from A. tumefaciens Ti plasmid (ocs terminator, Genbank accession V00088) (De Greve, H., Dhaese, P., Seurinck, J., Lemmers, M., Van Montagu, M. and Schell, J. Nucleotide sequence and transcript map of Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol. Appl. The gene. 1 (6), 499-511 (1982). The USP promoter corresponds to nucleotides 1-684 (Genbank Accession X56240), where part of the non-coding region of the USP gene is present in the promoter. The promoter fragment which is 684 base pairs in size was amplified using commercially available T7 standard primers (Stratagene) and using a synthesized primer via a PCR reaction following standard methods (primer- sequence: 5'-GTCGACCCGCGGACTAGTGGGCCCTCT- AGACCCGGGGGATCCGGATCTGCTGGCTATGAA-3', SEQ ID NO: 165). PCR the fragment was cut again with EcoRI / SalI and introduced into the vector pSUN300 with OCS terminator. This gave rise to the plasmid named pSUN-USP. The construction was used for transformation of Arabidopsis thaliana, rapeseed, tobacco and linseed. Lipid extraction from yeast and seeds was performed as described in Example 6 Example 13: Functional characterization of BioTaurELO1 and TL16y2: The substrate specificity of BioTaurELO1 was determined after expression and feeding of different fatty acids (Figure 6). Figure 6 shows feeding trials to determine the functionality and substrate specificity with yeast strains comprising either the vector pYes2.1 (control) or the vector pYes2.1-bioTaurELO1 (= BioTaur) with Δ5-elongase. In both portions, 200 µM -linolenic acid and eicosapentaenoic acid were added yeast incubation medium and incubation was carried out for 24 hours. After the fatty acids were extracted from the yeast, they were transmethylated and separated by gas chromatography. Extension products obtained from the two fatty acids that were fed are identified by arrows. The substrates fed can be detected in large amounts in all transgenic yeast. All transgenic yeast shows synthesis of new fatty acids, the products of BioTaurELO1 reaction. This means functional expression of the gene BioTaurELO1 is possible. Figure 6 shows that BioTaurELO1 shows a substrate specificity as with high specificity leads to elongation of 5 and 6 fatty acids with one ω3 double bond. ω6 fatty acids (C18 and C20) were also further extended. -linolenic acid (C18:3 ω6) was converted in a degree of 65.28%, stearidonic acid (C18:4 ω3) to a degree of 65.66% and eicosapentaenoic acid (C20:5 ω3) to an extent of 22.01%. Substrate specificities of the different feeding trials are shown in Table 3 (see end of description). The conversion rate of GLA when GLA and EPA were fed was 65.28%. The conversion rate of EPA when equal amounts of GLA and EPA were fed was 9.99%. If only EPA was fed the EPA conversion rate was 22.01%. Arachidonic acid (= ARA) was also converted when fed. The conversion rate was 14.47%. Stearidonic acid (= SDA) was also converted. In this case, the conversion rate was 65.66%. The functionality and substrate specificity of TL16y2 were determined by expression and feeding different fatty acids. Table 4 shows feeding trials. The feeding trials were performed in the same way as described for BioTaurELO1. The substrates fed can are detected in large amounts in all transgenic yeast. All transgenic yeast showed synthesis of new fatty acids, the products of the TL16y2 reaction (Fig. 11). This means that functional expression of the gene TL16y2 is possible. Table 4: Expression of TL16y2 in yeast. Areas of gas chromatographic analysis in % Plasmid Fatty acid C18:3 C18:4 C20:3 C20:4 C20:4 C20:5 C22:4 C22:5 (n-6) (n-3) (n-6) (n-6) (n-3) (n-3) (n-6) (n-3) pYES 250 µM EPA 13.79 TL16y2 250 uM EPA 25.81 2.25 pYES 50 µM EPA 5.07 TL16y2 50 µM EPA 2.48 1.73 pYES 250 uMGLA 8.31 TL16y2 250 uM GLA 3.59 10.71 pYES 250 µM ARA 16.03 TL16y2 250 uM ARA 15.2 3.87 pYES 250 µM SDA 26.79 0.35 TL16y2 250 uM SDA 7.74 29.17 The results for TL16y2 compared to the control, which are shown in Table 4, show that the following conversion rates in percent: a) % conversion rate of EPA (250 µM): 8%, b) % conversion rate of EPA (50 µM): 41%, c) % conversion rate of ARA: 20.3%, d) % conversion rate of SDA: 79.4% and e) % conversion rate of GLA: 74.9%. Thus, TL16y2 shows 5-, 6- and 8-elongase activity. Among these is the activity for C18 fatty acids with 6 double bond the highest. Depending on the concentration of fatty acids fed, this is followed by lengthening of C20 fatty acids by one 5- or 8 double bond. Example 14: Cloning of genes from Ostreococcus tauri When searching for conserved regions in the protein sequences using elongase the genes listed in the application with Δ5-elongase activity or Δ6-elongase activity were it possible to identify two sequences with corresponding motifs in an Ostreococcus tauri sequence database (genomic sequences). The sequences are the following Name of gene SEQ ID Amino acids OtELO1, (Δ5-elongase) SEQ ID NO: 67,300 OtELO2, (Δ6-elongase) SEQ ID NO: 69,292 OtElo1 has the highest similarity to a Danio rerio elongase (GenBank AAN77156; about. 26% identity), while OtElo2 has the greatest similarity to Physcomitrella Elo (PSE) [approx. 36% identity] (alignments were performed using the tBLASTn algorithm (Altschul et al., J. Mol. Biol. 1990, 215: 403-410). The cloning procedure was performed as follows: 40 ml of an Ostreococcus tauri culture in the stationary phase was spun down and the pellet was resuspended in 100 µl double-distilled water and stored at -20°C. The relevant genomic DNA was amplified based on the PCR method. The equivalent primer pairs were chosen in such a way that they contained too much yeast consensus sequence efficient translation (Kozak, Cell 1986, 44:283-292) adjacent to the start codon. Amplification of OtElo DNA was carried out using in each case 1 µl thawed cells, 200 µM dNTP, 2.5 U Taq polymerase and 100 pmol of each primer in a total volume of 50 µl. The conditions for PCR were as follows: first denaturation at 95°C for 5 minutes, followed by 30 cycles at 94°C for 30 seconds, 55°C for 1 minute and 72°C for 2 minutes and a final extension step at 72°C for 10 minutes. Example 15: Cloning of expression plasmids for heterologous expression in yeast To characterize the function of Ostreococcus tauri elongases, they were opened the reading frames of the respective DNAs cloned downstream of the galactose-inducible GAL1 promoter of pYES2.1 / V5-His-TOPO (Invitrogen), which gave rise to pOTE1 and pOTE2. Saccharomyces cerevisiae strain 334 was transformed with the respective vector pOTE1 or pOTE2, by electroporation (1500 V). Yeast that was transformed with blank vector pYES2 was used as a control. The transformed yeast was selected on completely minimal dropout uracil medium (CMdum) agar plates supplemented with 2% glucose. After the selection, in each case three transformants were selected for further functional expression. To express Ot elongases, pre-cultures consisting in each case of 5 ml of CMdum were prepared "dropout" uracil liquid medium supplemented with 2% (w / v) raffinose initially inoculated with the selected transformants and incubated for 2 days at 30°C and 200 rpm. Then became 5 ml CMdum ("dropout" uracil) liquid medium supplemented with 2% raffinose and 300 µM of different fatty acids inoculated with pre-cultures to an OD of 0.05. Expression became 600 induced by the addition of 2% (w / v) of galactose. The cultures were incubated in a further 96 hours at 20°C. Example 16 Cloning of expression plasmids for seed-specific expression in plants To transform plants, an additional transformation vector based on pSUN- USP formed. For this purpose, NotI cleavage sites were inserted at the 5' and 3' ends of the coding sequences, using PCR. The corresponding primer sequences were derived from the 5' and 3' regions of OtElo1 and OtElo2. Composition of PCR mix (50 μl): 5.00 μl template cDNA 5.00 μl 10x buffer (Advantage polymerase) + 25mM MgCl 2 5.00 μl 2 mM dNTP 1.25 μl of each primer (10 pmol / μl) 0.50 µl Advantage polymerase Advantage polymerase from Clontech was used. PCR reaction conditions: Hybridization temperature: 1 min 55°C Denaturation temperature: 1 min 94°C Extension temperature: 2 min 72°C Number of bikes: 35 The PCR products were incubated with the restriction enzyme NotI for 16 hours at 37°C. Plant expression vector pSUN300-USP was incubated in the same way. Then became The PCR product and the vector separated by agarose gel electrophoresis and the corresponding DNA fragments were extracted. DNA was purified using the Qiagen Gel Purification Kit at to follow the manufacturer's instructions. Next, vector and PCR products were ligated. Raid Ligation kits from Roche were used for this purpose. The resulting plasmids pSUN- OtELO1 and pSUN-OtELO2 were verified by sequencing. pSUN300 is a derivative of plasmid pPZP (Hajdukiewicz, P, Svab, Z, Maliga, P., (1994). The small versatile pPZP family of Agrobacterium binary vectors for plants transformation. Plant Mol Biol 25:989-994). pSUN-USP was derived from pSUN300, by insertion of a USP promoter into pSUN300 in the form of an EcoRI fragment. The polyadenylation signal is at the Ostreococcus gene from the A. tumefaciens Ti plasmid (ocs-Terminator, Genbank Accession V00088) (De Greve, H., Dhaese, P., Seurinck, J., Lemmers, M., Van Montagu, M. and Schell, J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid encoded octopine synthase gene J. Mol. Appl. The gene. 1 (6), 499-511 (1982). USP promoter corresponds to nucleotides 1 to 684 (Genbank Accession X56240), where part of the non-coding region of the USP gene is present in the promoter. The promoter fragment which is 684 base pairs in size was amplified by a PCR reaction and standard methods using a synthesized primer and by using a commercially available T7 standard primer (Stratagene). Primer sequence: 5'-GTCGACCCGCGGACTAGTGGG- CCCTCTAGACCCGGGGGATCCGGATCTGCTGGCTATGAA-3', SEQ ID NO: 164). PCR fragment was cut again with EcoRI / SalI and inserted into the vector pSUN300 with OCS terminator. This gave rise to the plasmid named pSUN-USP. The construction was used for transformation of Arabidopsis thaliana, rapeseed, tobacco and linseed. Example 17: Expression of OtELO1 and OtELO2 in yeast Yeast transformed with the plasmids pYES3, pYES3-OtELO1 and pYES3- OtELO2 as described in Example 15 was analyzed as follows: The yeast cells from primary cultures were harvested by centrifugation (100 x g, 5 min, 20°C) and washed with 100 mM NaHCO, pH 8.0 to remove residual medium and fatty acids. 3 Starting with yeast cell sediments, fatty acid methyl esters (FAME) were produced by acid methanolysis. For this purpose, the cell sediments were incubated for one hour at 80°C together with 2 ml of 1 N methanolic sulfuric acid and 2% (vol / vol) of dimethoxypropane. FAME was extracted twice with petroleum ether (PE). To remove non-derivatized fatty acids, the organic phases were washed in each case once with 2 ml 100 mM NaHCO , pH 8.0 and 2 ml distilled water. PE phases were then dried with 3 Na SO , evaporated under argon and taken up in 100 µl PE. The samples were separated on a 2 4 DB-23 capillary column (30 m, 0.25 mm, 0.25 µm, Agilent) in a Hewlett-Packard 6850 gas chromatograph equipped with flame ionization detector. The conditions for the GLC the analysis was as follows: the oven temperature was programmed from 50°C to 250°C with a rate of 5°C / min and finally 10 min at 250°C (hold). The signals were identified by comparing the retention times with the corresponding ones fatty acid standards (Sigma). The methodology is described in, for example, Napier and Michaelson, 2001, Lipids. 36(8):761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52(360):1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388(2):293-298 and Michaelson et al., 1998, FEBS Letters. 439(3):215-218. Example 18: Functional characterization of OtELO1 and OtELO2: The substrate specificity of OtElo1 was determined after expression and after feeding different fatty acids (Tab. 5). The substrates fed can be detected in large quantities in all the transgenic yeast. The transgenic yeast revealed the synthesis of new fatty acids, the products from the OtElo1 reaction. This means that the gene OtElo1 was expressed functionally. Table 4 shows that OtElo1 has a small degree of substrate specificity. OtElo1 was only able to extend the C fatty acids eicosapentaenoic acid (Figure 7) and arachidonic acid (Figure 8), but 20 preferentially 3-desaturated eicosapentaenoic acid. Table 5: Fatty acid substrate Degree of conversion (in %) 16:0 - Δ9 16:1 - 18:0 - Δ9 18:1 - Δ11 18:1 - Δ9.12 18:2 - Δ6,9,12 18:3 - Δ5,9,12 18:3 - Δ8,11,14 20:3 - Δ5, 8,11,14 20:4 10.8  0.6 Δ5, 8,11,14,17 20:5 46.8  3.6 Δ7, 10,13,16 22:4 - Δ4,7,10,13,16,19 22:6 - Table 5 shows the substrate specificity of the elongase OtElo1 for C -polyunsaturated fatty acids 20 with a double bond in the 5 position compared to different fatty acids. The yeast transformed with the vector pOTE1 was grown in minimal medium i presence of the fatty acids indicated. The fatty acid methyl esters were synthesized by subjecting intact cells for acid methanolysis. The FAME was then analyzed by GLC. Each value represents mean (n=3)  standard deviation. The substrate specificity of OtElo2 (SEQ ID NO: 81) was determined after expression and after feeding different fatty acids (Tab. 6). The substrates fed can be detected in large amounts in all the transgenic yeast. The transgenic yeast revealed the synthesis of new fatty acids, the products of the OtElo2 reaction. This means that the gene OtElo2 was expressed functional. Table 6: Fatty acid substrate Degree of conversion (in %) 16:0 - Δ9 16:1 - Δ7,10,13 16:3 - 18:0 - Δ6 18:1 - Δ9 18:1 - Δ11 18:1 - Δ9.12 18:2 - Δ6,9,12 18:3 15.3  Δ5,9,12 18:3 - Δ6,9,12,15 18:4 21.1  Δ11.14 20:2 - Δ8,11,14 20:3 - Δ5, 8,11,14 20:4 - Δ5, 8,11,14,17 20:5 - Δ7, 10,13,16 22:4 - Δ7, 10,13,16,19 22:5 - Δ4,7,10,13,16,19 22:6 - Table 6 shows the substrate specificity of the elongase OtElo2 with respect to different fatty acids. The yeast transformed with the vector pOTE2 was grown in minimal medium i presence of the fatty acids indicated. The fatty acid methyl esters were synthesized by subjecting intact cells for acid methanolysis. The FAME was then analyzed by GLC. Each value represents the mean (n=3)  standard deviation. The enzymatic activity shown in Table 3 clearly demonstrates that OtElo2 is a Δ6-elongase. Example 19: Cloning of genes from Thalassiosira pseudonana When searching for conserved regions in the protein sequences using elongase the genes with Δ5-elongase activity or Δ6-elongase activity, which are indicated in application, it is possible to identify two sequences with corresponding motifs in one Thalassiosira pseudonana sequence database (genomic sequences). The sequences were the following: Name of gene SEQ. ID Amino acids 43,358 TpELO1 ( 5-elongase) 59,358 TpELO2 ( 5-elongase) 45,272 TpELO3 ( 6-elongase) A 2 l culture of T. pseudonana was grown in f / 2 medium (Guillard, R.R.L. 1975. Culture of phytoplankton for feeding marine invertebrates. In Culture of Marine Invertebrates Animals (Eds. Smith, W.L. and Chanley, M.H.), Plenum Press, New York, pp. 29-60) in 2 14 days with a light intensity of 80 E / cm. After centrifugation of the cells, the RNA was isolated using the RNAeasy kit from Qiagen (Valencia, CA, US) by following manufacturer's instructions. mRNA was subjected to reverse transcription with Marathon cDNA amplification kit (BD Biosciences) and adapters were ligated according to manufacturer's instructions. The cDNA library was then used for PCR for cloning of expression plasmids using 5'- and 3'-RACE (rapid amplification of cDNA ends). Example 20: Cloning of expression plasmids for the purpose of heterologous expression i yeast The appropriate primer pair was chosen in such a way that it carried the yeast consensus sequence for highly efficient translation (Kozak, Cell 1986, 44:283-292) next to the start codon. Amplification of TpElo DNA was performed in each case with 1 µl of cDNA, 200 µM dNTP, 2.5 U Advantage polymerase and 100 pmol of each primer in a total volume of 50 µl. The PCR conditions were as follows: first denaturation at 95°C i 5 minutes, followed by 30 cycles at 94°C for 30 seconds, 55°C for 1 minute and 72°C for 2 minutes and a final extension step at 72°C for 10 minutes. The following oligonucleotides for the PCR reaction were used to clone the sequence for heterologous expression in yeast: Name of gene and SEQ ID NO: Primer sequence F:5'-accatgtgctcaccaccgccgtc TpELO1 ( 5-elongase), SEQ ID NO: 59 (SEQ ID NO: 158) R:5'- ctacatggcaccagtaac (SEQ ID NO: 159) F:5'-accatgtgctcatcaccgccgtc TpELO2 ( 5-elongase), SEQ ID NO: 85 (SEQ ID NO: 160) R:5'-ctacatggcaccagtaac (SEQ ID NO: 161) TpELO3 ( 6-elongase), SEQ ID NO: 45 F:5'-accatggacgcctacaacgctgc (SEQ ID NO: 162) R:5'- ctaagcactcttcttcttt (SEQ ID NO: 163) *F = forward primer, R = reverse primer The PCR products were incubated for 30 minutes at 21°C with yeast expression vector pYES2.1-TOPO (Invitrogen) by following the manufacturer's instructions. the PCR product was ligated into the vector using a T overhang and the activity of a topoisomerase (Invitrogen). After the incubation, E. coli DH5  cells were transformed. Suitable clones were identified by PCR, plasmid DNA was isolated using the Qiagen DNAeasy kit and verified by sequencing. The correct sequence was then transformed into Saccharomyces strain INVSc1 (Invitrogen) by electroporation (1500 V). As control blank vector pYES2.1 was transformed in parallel. The yeast was then plated out minimal "dropout" uracil medium supplemented with 2% glucose. Cells that were able to grow in the medium without uracil thus comprise the corresponding plasmids pYES2.1, pYES2.1-TpELO1, pYES2.1-ELO2 and pYES2.1-TpELO3. After the selection was in each case two transformants selected for further functional expression. Example 21: Cloning of expression plasmids for the purpose of seed-specific expression i plants To transform plants, an additional transformation vector based on pSUN- USP formed. For this purpose, NotI cleavage sites are introduced at the 5' and 3' ends of the coding sequence, using the following primer pair: PSUN-TPELO1 Forward: 5'-GCGGCCGCACCATGTGCTCACCACCGCCGTC (SEQ ID NO: 152) Reverse: 3'-GCGGCCGCCTACATGGCACCAGTAAC (SEQ ID NO: 153) PSUN-TPELO2 Forward: 5'-GCGGCCGCACCATGTGCTCATCACCGCCGTC (SEQ ID NO: 154) Reverse: 3'-GCGGCCGCCTACATGGCACCAGTAAC (SEQ ID NO: 155) PSUN-TPELO3 Forward: 5'-GCGGCCGCacatggacgcctacaacgctgc (SEQ ID NO: 156) Reverse: 3'-GCGGCCGCCTAAGCACTCTTCTTCTTT (SEQ ID NO: 157) Composition of PCR mix (50 μl): 5.00 μl template cDNA 5.00 μl 10x buffer (Advantage polymerase) + 25 mM MgCl 2 5.00 μl 2 mM dNTP 1.25 μl of each primer (10 pmol / μl) 0.50 µl Advantage polymerase Advantage polymerase from Clontech was used. PCR reaction conditions: Hybridization temperature: 1 minute at 55°C Denaturation temperature: 1 minute at 94°C Extension temperature: 2 minutes at 72°C Number of bikes: 35 The PCR products were incubated for 16 hours at 37°C with the restriction enzyme NotI. The plant expression vector pSUN300-USP was incubated in the same way. Then became The PCR products and 7624 bp vector separated by agarose gel electrophoresis and those corresponding DNA fragments were taken out. DNA was purified using Qiagen gel cleaning kit by following the manufacturer's instructions. Then vector and PCR- products ligated. Rapid ligation kits from Roche were used for this purpose. The resulting plasmids pSUN-TPELO1, pSUN-TPELO2 and pSUN-TPELO3 were verified by sequencing. pSUN300 is a derivative of plasmid pPZP (Hajdukiewicz, P, Svab, Z, Maliga, P., (1994) The small versatile pPZP family of Agrobacterium binary vectors for plants transformation. Plant Mol Biol 25:989-994). pSUN-USP was derived from pSUN300, by insertion of a USP promoter as EcoRI fragment into pSUN300. The polyadenylation signal is at the octopine synthase gene from the A. tumefaciens Ti plasmid (ocs-terminator, Genbank accession V00088) (De Greve, H., Dhaese, P., Seurinck, J., Lemmers, M., Van Montagu, M. and Schell, J. Nucleotide sequence and transcript map of the Agrobacterium tumefaciens Ti plasmid-encoded octopine synthase gene J. Mol. Appl. The gene. 1 (6), 499-511 (1982). The USP promoter corresponds to nucleotides 1-684 (Genbank accession X56240), where part of the non-coding region of the USP gene is present in the promoter. The promoter fragment which is 684 base pairs in size was amplified using commercially available T7 standard primers (Stratagene) and by of a synthesized primer via a PCR reaction following standard methods. (Primer sequence: 5'-GTCGACCCGCGGACTAGTGGGCCCTCTAGACCCGGGGGA- TCCGGATCTGCTGGCTATGAA-3’; SEQ ID NO: 151). The PCR fragment was cut again with EcoRI / SalI and introduced into the vector pSUN300 with OCS terminator. This gave rise to the plasmid named pSUN-USP. The construction was used for transformation of Arabidopsis thaliana, rapeseed, tobacco and linseed. Lipid extraction from yeast and seeds was performed as described in Example 6 Example 22: Expression of TpELO1, TpELO2 and TpELO3 in yeast Yeast transformed with plasmids pYES2, pYES2-TpELO1, pYES2-TpELO2 and pYES2-TpELO3 as described in Example 4 were analyzed as follows: The yeast cells from the main cultures were harvested by centrifugation (100 x g, 5 min, 20°C) and washed with 100 mM NaHCO, pH 8.0 to remove residual medium and fatty acids. 3 Starting with the yeast cell sediments, fatty acid methyl esters (FAME) were produced by acid methanolysis. For this purpose, the cell sediments were incubated for 1 hour at 80°C together with 2 ml of 1 N methanolic sulfuric acid and 2% (vol / vol) of dimethoxypropane. FAME was extracted twice with petroleum ether (PE). To remove non-derivatized fatty acids, the organic phases were washed in each case once with 2 ml 100 mM NaHCO , pH 8.0 and 2 ml distilled water. The PE phases were then dried with 3 Na2SO4, evaporated under argon and taken up in 100 µl PE. The samples were separated on a DB-23 capillary column (30 m, 0.25 mm, 0.25 µm, Agilent) in a Hewlett-Packard 6850 gas chromatograph equipped with flame ionization detector. The conditions for the GLC analysis was as follows: the oven temperature was programmed from 50°C to 250°C with a rate of 5°C / min and finally 10 min at 250°C (hold). The signals were identified by comparing the retention times with the corresponding ones fatty acid standards (Sigma). The methodology is described in, for example, Napier and Michaelson, 2001, Lipids. 36(8):761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52(360):1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388(2):293-298 and Michaelson et al., 1998, FEBS Letters. 439(3):215-218. Example 23: Functional characterization of TpELO1 and TPELO3: The substrate specificity of TpElo1 was determined after expression and after feeding different fatty acids (Fig. 9). The substrates fed can be detected in large quantities in all of it transgenic yeast. The transgenic yeast revealed the synthesis of new fatty acids, the products of TpElo1 reaction. This means that the gene TpElo1 was expressed functionally. Table 7 shows that TpElo1 has a narrow degree of substrate specificity. TpElo1 was only i capable of elongating the C20 fatty acids eicosapentaenoic acid and arachidonic acid, but preferentially 3-desaturated eicosapentaenoic acid. The yeast transformed with the pYES2-TpELO1 vector was grown in minimal medium in the presence of the fatty acids indicated. The fatty acid methyl esters were then synthesized by subjecting intact cells to acid methanolysis. Subsequently, FAME was analyzed by GLC. Table 7: Expression of TpELO1 in yeast. Columns 1 and 3 show control reactions for columns 2 (fed 250 µM 20:4 5,8,11,14) and 4 (fed 250 µM 20:5 5,8,11,14,17). Expression Expression Expression Expression Fatty acids 1 2 3 4 16:0 18.8 17.8 25.4 25.2 Δ9 16:1 28.0 29.8 36.6 36.6 18:0 5.2 5.0 6.8 6.9 Δ9 18:1 25.5 23.6 24.6 23.9 Δ5,8,11,14 20:4 22.5 23.4 - - Δ7,10,13,16 22:4 - 0.4 - - Δ5,8,11,14,17 20:5 - - 6.6 6.5 Δ7,10,13,16,19 22:5 - - - 0.9 % conversion rate 0 1.7 0 12.2 The substrate specificity of TpElo3 was determined after expression and after feeding different fatty acids (Fig. 10). The substrates fed can be detected in large quantities in all the transgenic yeast. The transgenic yeast revealed the synthesis of new fatty acids, the products from the TpElo3 reaction. This means that the gene TpElo3 was expressed functionally. Table 8 shows that TpElo3 has narrow substrate specificity. TpElo3 was only able to extend C18 fatty acids -linolenic acid and stearidonic acid, but preferentially ω3-desaturated stearidonic acid. The yeast transformed with the pYES2-TpELO3 vector was grown in minimal medium in the presence of the fatty acids indicated. The fatty acid methyl esters were then synthesized by subjecting intact cells to acid methanolysis. Subsequently, FAME was analyzed by GLC. Table 8: Expression of TpELO3 in yeast. Column 1 shows the fatty acid profile of yeast without feeding. Column 2 shows the control reaction. In columns 3 to 6 was -linolenic acid, stearidonic acid, arachidonic acid and eicosapentaenoic acid fed (250 µM of each fatty acid). Fatty acids 1 2 3 4 5 6 16:0 17.9 20.6 17.8 16.7 18.8 18.8 Δ9 16:1 41.7 18.7 27.0 33.2 24.0 31.3 18:0 7.0 7.7 6.4 6.6 5.2 6.0 Δ9 18:1 33.3 16.8 24.2 31.8 25.5 26.4 Δ9.12 18:2 - 36.1 - - - - Δ6,9,12 6.1 18:3 - - - - Δ6,9,12,15 18:4 - - - 1.7 - Δ11.14 0 20:2 - - - - Δ8,11,14 20:3 - - 18.5 - - Δ8,11,14,17 20:4 - - - 10.0 - Δ5,8,11,14 20:4 - - - - 22.5 Δ7,10,13,16 22:4 - - - - 0 Δ5,8,11,14,17 20:5 - - - - - 17.4 Δ7,10,13,16,19 22:5 - - - - - 0 % conversion rate 0 0 75 85 0 0 Example 24: Cloning of expression plasmid for heterologous expression of Pi-omega3Des in yeast For heterologous expression in yeast, the Pi-omega3Des clone was cloned into the yeast the expression vector pYES3 via PCR with suitable Pi-omega3Des-specific primers. Only the open reading frame of the gene, which coded for Pi-omega3Des protein remained amplified; two cleavage sites were provided for cloning into the expression vector pYES3: Forward primer: 5'-TAAGCTTACATGGCGACGAAGGAGG (SEQ ID NO: 149) Reverse primer: 5'-TGGATCCACTTACGTGGACTTGGT (SEQ ID NO: 150) Composition of the PCR mixture (50 μl): 5.00 μl temp...

Claims

1. Isolated nucleic acid sequence encoding a polypeptide with 6-desaturase activity, which has a) a nucleic acid with the sequence shown in SEQ ID NO: 89, b) a nucleic acid which, as the result of its degeneration genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 90, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 89 which codes for polypeptides with at least 60% identity on amino acid level with SEQ ID NO: 90 and which have 6-desaturase activity.

2. Amino acid sequence encoded by the isolated nucleic acid with a sequence according to claim 1.

3. Gene construction comprising the isolated nucleic acid according to claim 1 or 2, wherein the nucleic acid is operably linked by one or more regulatory signals.

4. The gene construct according to claim 3, wherein the nucleic acid construct comprises additional biosynthesis genes from fatty acid or lipid metabolism selected from the group acyl-CoA dehydrogenase(s), acyl-ACP [= acyl-carrier protein] desaturase(s), acyl–ACP thioesterase(s), fatty acid acyltransferase(s), acyl-CoA:lysophospholipid- acyltransferase(s), fatty acid synthase(s), fatty acid hydroxylase(s), acetyl-coenzyme A-carboxylase(s), acyl-coenzyme A-oxidase(s), fatty acid desaturase(s), fatty acid acetylenases, lipoxygenases, triacylglycerol lipases, allene oxide synthases, hydroperoxide lyases or fatty acid elongase(s).

5. The gene construct according to claim 3 or 4, where the nucleic acid construction comprises further biosynthesis genes from fatty acid or lipid metabolism selected from the group 4-desaturase, 5- desaturase, 6-desaturase, Δ8-desaturase, 9-desaturase, 12- desaturase, 6-elongase or Δ9-elongase.

6. Vector comprising a nucleic acid according to claim 1 or 2 or one gene engineering according to any one of claims 3 to 5.

7. Transgenic microorganism or transgenic plant, comprising at least one nucleic acid according to claim 1, a gene construct according to which preferably from claims 3 to 5 or a vector according to claim 6.

8. Process for the preparation of compounds of formula I O CH CH CH 3 1 (I) 2 2 R CH CH CH 2 n m p in transgenic non-human organisms with a content of at least 1% by weight of these compounds based on its total lipid content transgenic non-human organism, which includes the following process steps: a) introduction into the organism of at least one nucleic acid with a sequence encoding a 6-desaturase activity and b) introduction into the organism of at least one nucleic acid with a sequence encoding a 6-elongase activity and c) introduction into the organism of at least one nucleic acid with a sequence encoding a 5-desaturase activity and d) introduction into the organism of at least one nucleic acid with a sequence encoding a 5-elongase activity and e) introduction into the organism of at least one nucleic acid with a sequence encoding a 4-desaturase activity and where the variables and substituents in formula I have the following meanings: 1 R = hydroxyl, coenzyme A (thioester), lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylglycerol, lyso- diphosphatidylglycerol, lysophosphatidylserine, lysophosphatidylinositol, sphingo base or a residue of formula II 2 H C O R 2 3 (II) HC O R H C O 2 where 2 R = hydrogen, lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylglycerol, lysodiphosphatidylglycerol, lysophosphatidyl- serine, lysophosphatidylinositol or saturated or unsaturated C -C - 2 24 alkylcarbonyl, 3 2 R = hydrogen, saturated or unsaturated C -C -alkylcarbonyl or R 2 24 3 and R independently of each other is a residue of formula Ia: O CH CH CH 3 (Ia) 2 2 CH CH CH 2 n m p where n = 2, 3, 4, 5, 6, 7 or 9, m = 2, 3, 4, 5 or 6 and p = 0 or 3, where the nucleic acid with a sequence that codes for the polypeptide with 6-desaturase activity, is selected from the group consisting of: a) a nucleic acid with the sequence shown in SEQ ID NO: 89, or b) nucleic acids which, as the result of its degeneration genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 90, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 89 which codes for polypeptides with at least 60% identity on amino acid level with SEQ ID NO: 90 and which have 6-desaturase activity.

9. Method according to claim 8, where a nucleic acid with a sequence which encode polypeptides with ω3-desaturase activity, selected from the group consisting of: a) a nucleic acid with the sequence shown in SEQ ID NO: 87 or SEQ ID NO: 105, or b) nucleic acids which, as the result of its degeneration genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 88 or SEQ ID NO: 106, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 87 or SEQ ID NO: 105 which encodes polypeptides with at least 60% identity at the amino acid level with SEQ ID NO: 88 or SEQ ID NO: 106 and which has ω3-desaturase activity, in addition, is introduced into the organism.

10. Method according to claim 8 or 9, where a nucleic acid with a sequence encoding polypeptides with 12-desaturase activity, selected from the group consisting of: a) a nucleic acid with the sequence shown in SEQ ID NO: 107 or SEQ ID NO: 109, or b) nucleic acids which, as the result of its degeneration genetic code, can be derived from the amino acid sequence shown in SEQ ID NO: 108 or SEQ ID NO: 110, or c) derivatives of the nucleic acid sequence shown in SEQ ID NO: 107 or SEQ ID NO: 109 which encodes polypeptides with at least 60% identity at the amino acid level with SEQ ID NO: 108 or SEQ ID NO: 110 and which has 12-desaturase activity in addition, is introduced into the organism.

11. A method according to any one of claims 8 to 10, wherein the transgenic non-human organism is a transgene microorganism or a transgenic plant.

12. A method according to any one of claims 8 to 11, wherein the compounds of the general formula I are isolated from the organism i form of their oils, lipids or free fatty acids. SEQUENCE LISTING <110> BASF Plant Science GmbH <120> Process for the production of polyunsaturated fatty acids in trans- genic organisms <130> PF54756 <140> 20030601 <141> 2003-08-01 <160> 192 <170> PatentIn version 3.1 <210> 1 <211> 1266 <212> DNA <213> Euglena gracilis <220> <221> CDS <222> (1)..(1266) <223> Δ8-desaturase <400> 1 atg aag tca aag cgc caa gcg ctt ccc ctt aca att gat gga aca aca 48 Met Lys Ser Lys Arg Gln Ala Leu Pro Leu Thr Ile Asp Gly Thr Thr 1 5 10 15 tat gat gtg tct gcc tgg gtc aat ttc cac cct ggt ggt gcg gaa att 96 Tyr Asp Val Ser Ala Trp Val Asn Phe His Pro Gly Gly Ala Glu Ile 20 25 30 ata gag aat tac caa gga agg gat gcc act gat gcc ttc atg gtt atg 144 Ile Glu Asn Tyr Gln Gly Arg Asp Ala Thr Asp Ala Phe Met Val Met 35 40 45 cac tct caa gaa gcc ttc gac aag ctc aag cgc atg ccc aaa atc ​​aat 192 His Ser Gln Glu Ala Phe Asp Lys Leu Lys Arg Met Pro Lys Ile Asn 50 55 60 2 ccc agt tct gag ttg cca ccc cag gct gca gtg aat gaa gct caa gag 240 Pro Ser Ser Glu Leu Pro Pro Gln Ala Ala Val Asn Glu Ala Gln Glu 65 70 75 80 gat ttc cgg aag ctc cga gaa gag ttg atc gca act ggc atg ttt gat 288 Asp Phe Arg Lys Leu Arg Glu Glu Leu Ile Ala Thr Gly Met Phe Asp 85 90 95 gcc tcc ccc ctc tgg tac tca tac aaa atc ​​agc acc aca ctg ggc ctt 336 Ala Ser Pro Leu Trp Tyr Ser Tyr Lys Ile Ser Thr Thr Leu Gly Leu 100 105 110 gga gtg ctg ggt tat ttc ctg atg gtt cag tat cag atg tat ttc att 384 Gly Val Leu Gly Tyr Phe Leu Met Val Gln Tyr Gln Met Tyr Phe Ile 115 120 125 ggg gca gtg ttg ctt ggg atg cac tat caa cag atg ggc tgg ctt tct 432 Gly Ala Val Leu Leu Gly Met His Tyr Gln Gln Met Gly Trp Leu Ser 130 135 140 cat gac att tgc cac cac cag act ttc aag aac cgg aac tgg aac aac 480 His Asp Ile Cys His His Gln Thr Phe Lys Asn Arg Asn Trp Asn Asn 145 150 155 160 ctc gtg gga ctg gta ttt ggc aat ggt ctg caa ggt ttt tcc gtg aca 528 Leu Val Gly Leu Val Phe Gly Asn Gly Leu Gln Gly Phe Ser Val Thr 165 170 175 tgc tgg aag gac aga cac aat gca cat cat tcg gca acc aat gtt caa 576 Cys Trp Lys Asp Arg His Asn Ala His His Ser Ala Thr Asn Val Gln 180 185 190 ggg cac gac cct gat att gac aac ctc ccc ctc tta gcc tgg tct gag 624 Gly His Asp Pro Asp Ile Asp Asn Leu Pro Leu Leu Ala Trp Ser Glu 195 200 205 gat gac gtc aca cgg gcg tca ccg att tcc cgc aag ctc att cag ttc 672 Asp Asp Val Thr Arg Ala Ser Pro Ile Ser Arg Lys Leu Ile Gln Phe 210 215 220 cag cag tat tat ttc ttg gtc atc tgt atc ttg ttg cgg ttc att tgg 720 Gln Gln Tyr Tyr Phe Leu Val Ile Cys Ile Leu Leu Arg Phe Ile Trp 225 230 235 240 tgt ttc cag agc gtg ttg acc gtg cgc agt ctg aag gac aga gat aac 768 Cys Phe Gln Ser Val Leu Thr Val Arg Ser Leu Lys Asp Arg Asp Asn 245 250 255 caa ttc tat cgc tct cag tat aag aag gag gcc att ggc ctc gcc ctg 816 Gln Phe Tyr Arg Ser Gln Tyr Lys Lys Glu Ala Ile Gly Leu Ala Leu 260 265 270 cat tgg aca ttg aag gcc ctg ttc cac tta ttc ttt atg ccc agc atc 864 His Trp Thr Leu Lys Ala Leu Phe His Leu Phe Phe Met Pro Ser Ile 275 280 285 ctc aca tcg ctg ttg gta ttt ttc gtt tcg gag ctg gtt ggc ggc ttc 912 Leu Thr Ser Leu Leu Val Phe Phe Val Ser Glu Leu Val Gly Gly Phe 290 295 300 ggc att gcg atc gtg gtg ttc atg aac cac tac cca ctg gag aag atc 960 Gly Ile Ala Ile Val Val Phe Met Asn His Tyr Pro Leu Glu Lys Ile 305 310 315 320 ggg gac tcg gtc tgg gat ggc cat gga ttc tcg gtt ggc cag atc cat 1008 Gly Asp Ser Val Trp Asp Gly His Gly Phe Ser Val Gly Gln Ile His 325 330 335 3 gag acc atg aac att cgg cga ggg att atc aca gat tgg ttt ttc gga 1056 Glu Thr Met Asn Ile Arg Arg Gly Ile Ile Thr Asp Trp Phe Phe Gly 340 345 350 ggc ttg aac tac cag atc gag cac cat ttg tgg ccg acc ctc cct cgc 1104 Gly Leu Asn Tyr Gln Ile Glu His His Leu Trp Pro Thr Leu Pro Arg 355 360 365 cac aac ctg aca gcg gtt agc tac cag gtg gaa cag ctg tgc cag aag 1152 His Asn Leu Thr Ala Val Ser Tyr Gln Val Glu Gln Leu Cys Gln Lys 370 375 380 cac aac ctg ccg tat cgg aac ccg ctg ccc cat gaa ggg ttg gtc atc 1200 His Asn Leu Pro Tyr Arg Asn Pro Leu Pro His Glu Gly Leu Val Ile 385 390 395 400 ctg ctg cgc tat ctg gcg gtg ttc gcc cgg atg gcg gag aag caa ccc 1248 Leu Leu Arg Tyr Leu Ala Val Phe Ala Arg Met Ala Glu Lys Gln Pro 405 410 415 gcg ggg aag gct cta taa 1266 Ala Gly Light Ala Leu 420 <210> 2 <211> 421 <212> PRT <213> Euglena gracilis <400> 2 Met Lys Ser Lys Arg Gln Ala Leu Pro Leu Thr Ile Asp Gly Thr Thr 1 5 10 15 Tyr Asp Val Ser Ala Trp Val Asn Phe His Pro Gly Gly Ala Glu Ile 20 25 30 Ile Glu Asn Tyr Gln Gly Arg Asp Ala Thr Asp Ala Phe Met Val Met 35 40 45 His Ser Gln Glu Ala Phe Asp Lys Leu Lys Arg Met Pro Lys Ile Asn 50 55 60 Pro Ser Ser Glu Leu Pro Pro Gln Ala Ala Val Asn Glu Ala Gln Glu 65 70 75 80 Asp Phe Arg Lys Leu Arg Glu Glu Leu Ile Ala Thr Gly Met Phe Asp 85 90 95 Ala Ser Pro Leu Trp Tyr Ser Tyr Lys Ile Ser Thr Thr Leu Gly Leu 100 105 110 Gly Val Leu Gly Tyr Phe Leu Met Val Gln Tyr Gln Met Tyr Phe Ile 115 120 125 4 Gly Ala Val Leu Leu Gly Met His Tyr Gln Gln Met Gly Trp Leu Ser 130 135 140 His Asp Ile Cys His His Gln Thr Phe Lys Asn Arg Asn Trp Asn Asn 145 150 155 160 Leu Val Gly Leu Val Phe Gly Asn Gly Leu Gln Gly Phe Ser Val Thr 165 170 175 Cys Trp Lys Asp Arg His Asn Ala His His Ser Ala Thr Asn Val Gln 180 185 190 Gly His Asp Pro Asp Ile Asp Asn Leu Pro Leu Leu Ala Trp Ser Glu 195 200 205 Asp Asp Val Thr Arg Ala Ser Pro Ile Ser Arg Lys Leu Ile Gln Phe 210 215 220 Gln Gln Tyr Tyr Phe Leu Val Ile Cys Ile Leu Leu Arg Phe Ile Trp 225 230 235 240 Cys Phe Gln Ser Val Leu Thr Val Arg Ser Leu Lys Asp Arg Asp Asn 245 250 255 Gln Phe Tyr Arg Ser Gln Tyr Lys Lys Glu Ala Ile Gly Leu Ala Leu 260 265 270 His Trp Thr Leu Lys Ala Leu Phe His Leu Phe Phe Met Pro Ser Ile 275 280 285 Leu Thr Ser Leu Leu Val Phe Phe Val Ser Glu Leu Val Gly Gly Phe 290 295 300 Gly Ile Ala Ile Val Val Phe Met Asn His Tyr Pro Leu Glu Lys Ile 305 310 315 320 Gly Asp Ser Val Trp Asp Gly His Gly Phe Ser Val Gly Gln Ile His 325 330 335 Glu Thr Met Asn Ile Arg Arg Gly Ile Ile Thr Asp Trp Phe Phe Gly 340 345 350 Gly Leu Asn Tyr Gln Ile Glu His His Leu Trp Pro Thr Leu Pro Arg 355 360 365 His Asn Leu Thr Ala Val Ser Tyr Gln Val Glu Gln Leu Cys Gln Lys 370 375 380 His Asn Leu Pro Tyr Arg Asn Pro Leu Pro His Glu Gly Leu Val Ile 385 390 395 400 5 Leu Leu Arg Tyr Leu Ala Val Phe Ala Arg Met Ala Glu Lys Gln Pro 405 410 415 Ala Gly Light Ala Leu 420 <210> 3 <211> 777 <212> DNA <213> Isochrysis galbana <220> <221> CDS <222> (1)..(777) <223> Δ9 elongase <400> 3 atg gcc ctc gca aac gac gcg gga gag cgc atc tgg gcg gct gtg acc 48 Met Ala Leu Ala Asn Asp Ala Gly Glu Arg Ile Trp Ala Ala Val Thr 1 5 10 15 gac ccg gaa atc ​​ctc att ggc acc ttc tcg tac ttg cta ctc aaa ccg 96 Asp Pro Glu Ile Leu Ile Gly Thr Phe Ser Tyr Leu Leu Leu Lys Pro 20 25 30 ctg ctc cgc aat tcc ggg ctg gtg gat gag aag aag ggc gca tac agg 144 Leu Leu Arg Asn Ser Gly Leu Val Asp Glu Lys Lys Gly Ala Tyr Arg 35 40 45 acg tcc atg atc tgg tac aac gtt ctg ctg gcg ctc ttc tct gcg ctg 192 Thr Ser Met Ile Trp Tyr Asn Val Leu Leu Ala Leu Phe Ser Ala Leu 50 55 60 agc ttc tac gtg acg gcg acc gcc ctc ggc tgg gac tat ggt acg ggc 240 Ser Phe Tyr Val Thr Ala Thr Ala Leu Gly Trp Asp Tyr Gly Thr Gly 65 70 75 80 gcg tgg ctg cgc agg caa acc ggc gac aca ccg cag ccg ctc ttc cag 288 Ala Trp Leu Arg Arg Gln Thr Gly Asp Thr Pro Gln Pro Leu Phe Gln 85 90 95 tgc ccg tcc ccg gtt tgg gac tcg aag ctc ttc aca tgg acc gcc aag 336 Cys Pro Ser Pro Val Trp Asp Ser Lys Leu Phe Thr Trp Thr Ala Lys 100 105 110 gca ttc tat tac tcc aag tac gtg gag tac ctc gac acg gcc tgg ctg 384 Ala Phe Tyr Tyr Ser Lys Tyr Val Glu Tyr Leu Asp Thr Ala Trp Leu 115 120 125 agg gtc tcc ttt ctc cag gcc ttc cac cac ttt ggc gcg ccg tgg gat 432 Arg Val Ser Phe Leu Gln Ala Phe His His Phe Gly Ala Pro Trp Asp 130 135 140 gtg tac ctc ggc att cgg ctg cac aac gag ggc gta tgg atc ttc atg 480 Val Tyr Leu Gly Ile Arg Leu His Asn Glu Gly Val Trp Ile Phe Met 6 145 150 155 160 ttt ttc aac tcg ttc att cac acc atc atg tac acc tac tac ggc ctc 528 Phe Phe Asn Ser Phe Ile His Thr Ile Met Tyr Thr Tyr Tyr Gly Leu 165 170 175 acc gcc gcc ggg tat aag ttc aag gcc aag ccg ctc atc acc gcg atg 576 Thr Ala Ala Gly Tyr Lys Phe Lys Ala Lys Pro Leu Ile Thr Ala Met 180 185 190 cag atc tgc cag ttc gtg ggc ggc ttc ctg ttg gtc tgg gac tac atc 624 Gln Ile Cys Gln Phe Val Gly Gly Phe Leu Leu Val Trp Asp Tyr Ile 195 200 205 aac gtc ccc tgc ttc aac tcg gac aaa ggg aag ttg ttc agc tgg gct 672 Asn Val Pro Cys Phe Asn Ser Asp Lys Gly Lys Leu Phe Ser Trp Ala 210 215 220 ttc aac tat gca tac gtc ggc tcg gtc ttc ttg ctc ttc tgc cac ttt 720 Phe Asn Tyr Ala Tyr Val Gly Ser Val Phe Leu Leu Phe Cys His Phe 225 230 235 240 ttc tac cag gac aac ttg gca acg aag aaa tcg gcc aag gcg ggc aag 768 Phe Tyr Gln Asp Asn Leu Ala Thr Lys Lys Ser Ala Lys Ala Gly Lys 245 250 255 cag ctc tag 777 Gln Leu <210> 4 <211> 258 <212> PRT <213> Isochrysis galbana <400> 4 Met Ala Leu Ala Asn Asp Ala Gly Glu Arg Ile Trp Ala Ala Val Thr 1 5 10 15 Asp Pro Glu Ile Leu Ile Gly Thr Phe Ser Tyr Leu Leu Leu Lys Pro 20 25 30 Leu Leu Arg Asn Ser Gly Leu Val Asp Glu Lys Lys Gly Ala Tyr Arg 35 40 45 Thr Ser Met Ile Trp Tyr Asn Val Leu Leu Ala Leu Phe Ser Ala Leu 50 55 60 Ser Phe Tyr Val Thr Ala Thr Ala Leu Gly Trp Asp Tyr Gly Thr Gly 65 70 75 80 Ala Trp Leu Arg Arg Gln Thr Gly Asp Thr Pro Gln Pro Leu Phe Gln 85 90 95 Cys Pro Ser Pro Val Trp Asp Ser Lys Leu Phe Thr Trp Thr Ala Lys 7 100 105 110 Ala Phe Tyr Tyr Ser Lys Tyr Val Glu Tyr Leu Asp Thr Ala Trp Leu 115 120 125 Arg Val Ser Phe Leu Gln Ala Phe His His Phe Gly Ala Pro Trp Asp 130 135 140 Val Tyr Leu Gly Ile Arg Leu His Asn Glu Gly Val Trp Ile Phe Met 145 150 155 160 Phe Phe Asn Ser Phe Ile His Thr Ile Met Tyr Thr Tyr Tyr Gly Leu 165 170 175 Thr Ala Ala Gly Tyr Lys Phe Lys Ala Lys Pro Leu Ile Thr Ala Met 180 185 190 Gln Ile Cys Gln Phe Val Gly Gly Phe Leu Leu Val Trp Asp Tyr Ile 195 200 205 Asn Val Pro Cys Phe Asn Ser Asp Lys Gly Lys Leu Phe Ser Trp Ala 210 215 220 Phe Asn Tyr Ala Tyr Val Gly Ser Val Phe Leu Leu Phe Cys His Phe 225 230 235 240 Phe Tyr Gln Asp Asn Leu Ala Thr Lys Lys Ser Ala Lys Ala Gly Lys 245 250 255 Gln Leu <210> 5 <211> 1410 <212> DNA <213> Phaeodactylum tricornutum <220> <221> CDS <222> (1)..(1410) <223> Δ5-desaturase <400> 5 atg gct ccg gat gcg gat aag ctt cga caa cgc cag acg act gcg gta 48 Met Ala Pro Asp Ala Asp Lys Leu Arg Gln Arg Gln Thr Thr Ala Val 1 5 10 15 8 gcg aag cac aat gct gct acc ata tcg acg cag gaa cgc ctt tgc agt 96 Ala Lys His Asn Ala Ala Thr Ile Ser Thr Gln Glu Arg Leu Cys Ser 20 25 30 ctg tct tcg ctc aaa ggc gaa gaa gtc tgc atc gac gga atc ​​atc tat 144 Leu Ser Ser Leu Lys Gly Glu Glu Val Cys Ile Asp Gly Ile Ile Tyr 35 40 45 gac ctc caa tca ttc gat cat ccc ggg ggt gaa acg atc aaa atg ttt 192 Asp Leu Gln Ser Phe Asp His Pro Gly Gly Glu Thr Ile Lys Met Phe 50 55 60 ggt ggc aac gat gtc act gta cag tac aag atg att cac ccg tac cat 240 Gly Gly Asn Asp Val Thr Val Gln Tyr Lys Met Ile His Pro Tyr His 65 70 75 80 acc gag aag cat ttg gaa aag atg aag cgt gtc ggc aag gtg acg gat 288 Thr Glu Lys His Leu Glu Lys Met Lys Arg Val Gly Lys Val Thr Asp 85 90 95 ttc gtc tgc gag tac aag ttc gat acc gaa ttt gaa cgc gaa atc ​​aaa 336 Phe Val Cys Glu Tyr Lys Phe Asp Thr Glu Phe Glu Arg Glu Ile Lys 100 105 110 cga gaa gtc ttc aag att gtg cga cga ggc aag gat ttc ggt act ttg 384 Arg Glu Val Phe Lys Ile Val Arg Arg Gly Lys Asp Phe Gly Thr Leu 115 120 125 gga tgg ttc ttc cgt gcg ttt tgc tac att gcc att ttc ttc tac ctg 432 Gly Trp Phe Phe Arg Ala Phe Cys Tyr Ile Ala Ile Phe Phe Tyr Leu 130 135 140 cag tac cat tgg gtc acc acg gga acc tct tgg ctg ctg gcc gtg gcc 480 Gln Tyr His Trp Val Thr Thr Gly Thr Ser Trp Leu Leu Ala Val Ala 145 150 155 160 tac gga atc ​​tcc caa gcg atg att ggc atg aat gtc cag cac gat gcc 528 Tyr Gly Ile Ser Gln Ala Met Ile Gly Met Asn Val Gln His Asp Ala 165 170 175 aac cac ggg gcc acc tcc aag cgt ccc tgg gtc aac gac atg cta ggc 576 Asn His Gly Ala Thr Ser Lys Arg Pro Trp Val Asn Asp Met Leu Gly 180 185 190 ctc ggt gcg gat ttt att ggt ggt tcc aag tgg ctc tgg cag gaa caa 624 Leu Gly Ala Asp Phe Ile Gly Gly Ser Lys Trp Leu Trp Gln Glu Gln 195 200 205 cac tgg acc cac cac gct tac acc aat cac gcc gag atg gat ccc gat 672 His Trp Thr His His Ala Tyr Thr Asn His Ala Glu Met Asp Pro Asp 210 215 220 agc ttt ggt gcc gaa cca atg ctc cta ttc aac gac tat ccc ttg gat 720 Ser Phe Gly Ala Glu Pro Met Leu Leu Phe Asn Asp Tyr Pro Leu Asp 225 230 235 240 cat ccc gct cgt acc tgg cta cat cgc ttt caa gca ttc ttt tac atg 768 His Pro Ala Arg Thr Trp Leu His Arg Phe Gln Ala Phe Phe Tyr Met 245 250 255 ccc gtc ttg gct gga tac tgg ttg tcc gct gtc ttc aat cca caa att 816 Pro Val Leu Ala Gly Tyr Trp Leu Ser Ala Val Phe Asn Pro Gln Ile 260 265 270 ctt gac ctc cag caa cgc ggc gca ctt tcc gtc ggt atc cgt ctc gac 864 Leu Asp Leu Gln Gln Arg Gly Ala Leu Ser Val Gly Ile Arg Leu Asp 275 280 285 9 aac gct ttc att cac tcg cga cgc aag tat gcg gtt ttc tgg cgg gct 912 Asn Ala Phe Ile His Ser Arg Arg Lys Tyr Ala Val Phe Trp Arg Ala 290 295 300 gtg tac att gcg gtg aac gtg att gct ccg ttt tac aca aac tcc ggc 960 Val Tyr Ile Ala Val Asn Val Ile Ala Pro Phe Tyr Thr Asn Ser Gly 305 310 315 320 ctc gaa tgg tcc tgg cgt gtc ttt gga aac atc atg ctc atg ggt gtg 1008 Leu Glu Trp Ser Trp Arg Val Phe Gly Asn Ile Met Leu Met Gly Val 325 330 335 gcg gaa tcg ctc gcg ctg gcg gtc ctg ttt tcg ttg tcg cac aat ttc 1056 Ala Glu Ser Leu Ala Leu Ala Val Leu Phe Ser Leu Ser His Asn Phe 340 345 350 gaa tcc gcg gat cgc gat ccg acc gcc cca ctg aaa aag acg gga gaa 1104 Glu Ser Ala Asp Arg Asp Pro Thr Ala Pro Leu Lys Lys Thr Gly Glu 355 360 365 cca gtc gac tgg ttc aag aca cag gtc gaa act tcc tgc act tac ggt 1152 Pro Val Asp Trp Phe Lys Thr Gln Val Glu Thr Ser Cys Thr Tyr Gly 370 375 380 gga ttc ctt tcc ggt tgc ttc acg gga ggt ctc aac ttt cag gtt gaa 1200 Gly Phe Leu Ser Gly Cys Phe Thr Gly Gly Leu Asn Phe Gln Val Glu 385 390 395 400 cac cac ttg ttc cca cgc atg agc agc gct tgg tat ccc tac att gcc 1248 His His Leu Phe Pro Arg Met Ser Ser Ala Trp Tyr Pro Tyr Ile Ala 405 410 415 ccc aag gtc cgc gaa att tgc gcc aaa cac ggc gtc cac tac gcc tac 1296 Pro Lys Val Arg Glu Ile Cys Ala Lys His Gly Val His Tyr Ala Tyr 420 425 430 tac ccg tgg atc cac caa aac ttt ctc tcc acc gtc cgc tac atg cac 1344 Tyr Pro Trp Ile His Gln Asn Phe Leu Ser Thr Val Arg Tyr Met His 435 440 445 gcg gcc ggg acc ggt gcc aac tgg cgc cag atg gcc aga gaa aat ccc 1392 Ala Ala Gly Thr Gly Ala Asn Trp Arg Gln Met Ala Arg Glu Asn Pro 450 455 460 ttg acc gga cgg gcg taa 1410 Leu Thr Gly Arg Ala 465 <210> 6 <211> 469 <212> PRT <213> Phaeodactylum tricornutum <400> 6 Met Ala Pro Asp Ala Asp Lys Leu Arg Gln Arg Gln Thr Thr Ala Val 1 5 10 15 Ala Lys His Asn Ala Ala Thr Ile Ser Thr Gln Glu Arg Leu Cys Ser 20 25 30 10 Leu Ser Ser Leu Lys Gly Glu Glu Val Cys Ile Asp Gly Ile Ile Tyr 35 40 45 Asp Leu Gln Ser Phe Asp His Pro Gly Gly Glu Thr Ile Lys Met Phe 50 55 60 Gly Gly Asn Asp Val Thr Val Gln Tyr Lys Met Ile His Pro Tyr His 65 70 75 80 Thr Glu Lys His Leu Glu Lys Met Lys Arg Val Gly Lys Val Thr Asp 85 90 95 Phe Val Cys Glu Tyr Lys Phe Asp Thr Glu Phe Glu Arg Glu Ile Lys 100 105 110 Arg Glu Val Phe Lys Ile Val Arg Arg Gly Lys Asp Phe Gly Thr Leu 115 120 125 Gly Trp Phe Phe Arg Ala Phe Cys Tyr Ile Ala Ile Phe Phe Tyr Leu 130 135 140 Gln Tyr His Trp Val Thr Thr Gly Thr Ser Trp Leu Leu Ala Val Ala 145 150 155 160 Tyr Gly Ile Ser Gln Ala Met Ile Gly Met Asn Val Gln His Asp Ala 165 170 175 Asn His Gly Ala Thr Ser Lys Arg Pro Trp Val Asn Asp Met Leu Gly 180 185 190 Leu Gly Ala Asp Phe Ile Gly Gly Ser Lys Trp Leu Trp Gln Glu Gln 195 200 205 His Trp Thr His His Ala Tyr Thr Asn His Ala Glu Met Asp Pro Asp 210 215 220 Ser Phe Gly Ala Glu Pro Met Leu Leu Phe Asn Asp Tyr Pro Leu Asp 225 230 235 240 His Pro Ala Arg Thr Trp Leu His Arg Phe Gln Ala Phe Phe Tyr Met 245 250 255 Pro Val Leu Ala Gly Tyr Trp Leu Ser Ala Val Phe Asn Pro Gln Ile 260 265 270 Leu Asp Leu Gln Gln Arg Gly Ala Leu Ser Val Gly Ile Arg Leu Asp 275 280 285 Asn Ala Phe Ile His Ser Arg Arg Lys Tyr Ala Val Phe Trp Arg Ala 290 295 300 11 Val Tyr Ile Ala Val Asn Val Ile Ala Pro Phe Tyr Thr Asn Ser Gly 305 310 315 320 Leu Glu Trp Ser Trp Arg Val Phe Gly Asn Ile Met Leu Met Gly Val 325 330 335 Ala Glu Ser Leu Ala Leu Ala Val Leu Phe Ser Leu Ser His Asn Phe 340 345 350 Glu Ser Ala Asp Arg Asp Pro Thr Ala Pro Leu Lys Lys Thr Gly Glu 355 360 365 Pro Val Asp Trp Phe Lys Thr Gln Val Glu Thr Ser Cys Thr Tyr Gly 370 375 380 Gly Phe Leu Ser Gly Cys Phe Thr Gly Gly Leu Asn Phe Gln Val Glu 385 390 395 400 His His Leu Phe Pro Arg Met Ser Ser Ala Trp Tyr Pro Tyr Ile Ala 405 410 415 Pro Lys Val Arg Glu Ile Cys Ala Lys His Gly Val His Tyr Ala Tyr 420 425 430 Tyr Pro Trp Ile His Gln Asn Phe Leu Ser Thr Val Arg Tyr Met His 435 440 445 Ala Ala Gly Thr Gly Ala Asn Trp Arg Gln Met Ala Arg Glu Asn Pro 450 455 460 Leu Thr Gly Arg Ala 465 <210> 7 <211> 1344 <212> DNA <213> Ceratodon purpureus <220> <221> CDS <222> (1)..(1344) <223> Δ5-desaturase <400> 7 atg gta tta cga gag caa gag cat gag cca ttc ttc att aaa att gat 48 Met Val Leu Arg Glu Gln Glu His Glu Pro Phe Phe Ile Lys Ile Asp 12 1 5 10 15 gga aaa tgg tgt caa att gac gat gct gtc ctg aga tca cat cca ggt 96 Gly Lys Trp Cys Gln Ile Asp Asp Ala Val Leu Arg Ser His Pro Gly 20 25 30 ggt agt gca att act acc tat aaa aat atg gat gcc act acc gta ttc 144 Gly Ser Ala Ile Thr Thr Tyr Lys Asn Met Asp Ala Thr Thr Val Phe 35 40 45 cac aca ttc cat act ggt tct aaa gaa gcg tat caa tgg ctg aca gaa 192 His Thr Phe His Thr Gly Ser Lys Glu Ala Tyr Gln Trp Leu Thr Glu 50 55 60 ttg aaa aaa gag tgc cct aca caa gaa cca gag atc cca gat att aag 240 Leu Lys Lys Glu Cys Pro Thr Gln Glu Pro Glu Ile Pro Asp Ile Lys 65 70 75 80 gat gac cca atc ​​aaa gga att gat gat gtg aac atg gga act ttc aat 288 Asp Asp Pro Ile Lys Gly Ile Asp Asp Val Asn Met Gly Thr Phe Asn 85 90 95 att tct gag aaa cga tct gcc caa ata aat aaa agt ttc act gat cta 336 Ile Ser Glu Lys Arg Ser Ala Gln Ile Asn Lys Ser Phe Thr Asp Leu 100 105 110 cgt atg cga gtt cgt gca gaa gga ctt atg gat gga tct cct ttg ttc 384 Arg Met Arg Val Arg Ala Glu Gly Leu Met Asp Gly Ser Pro Leu Phe 115 120 125 tac att aga aaa att ctt gaa aca atc ​​ttc aca att ctt ttt gca ttc 432 Tyr Ile Arg Lys Ile Leu Glu Thr Ile Phe Thr Ile Leu Phe Ala Phe 130 135 140 tac ctt caa tac cac aca tat tat ctt cca tca gct att cta atg gga 480 Tyr Leu Gln Tyr His Thr Tyr Tyr Leu Pro Ser Ala Ile Leu Met Gly 145 150 155 160 gtt gcg tgg caa caa ttg gga tgg tta atc ​​cat gaa ttc gca cat cat 528 Val Ala Trp Gln Gln Leu Gly Trp Leu Ile His Glu Phe Ala His His 165 170 175 cag ttg ttc aaa aac aga tac tac aat gat ttg gcc agc tat ttc gtt 576 Gln Leu Phe Lys Asn Arg Tyr Tyr Asn Asp Leu Ala Ser Tyr Phe Val 180 185 190 gga aac ttt tta caa gga ttc tca tct ggt ggt tgg aaa gag cag cac 624 Gly Asn Phe Leu Gln Gly Phe Ser Ser Gly Gly Trp Lys Glu Gln His 195 200 205 aat gtg cat cac gca gcc aca aat gtt gtt gga cga gac gga gat ctt 672 Asn Val His His Ala Ala Thr Asn Val Val Gly Arg Asp Gly Asp Leu 210 215 220 gat tta gtc cca ttc tat gct aca gtg gca gaa cat ctc aac aat tat 720 Asp Leu Val Pro Phe Tyr Ala Thr Val Ala Glu His Leu Asn Asn Tyr 225 230 235 240 tct cag gat tca tgg gtt atg act cta ttc aga tgg caa cat gtt cat 768 Ser Gln Asp Ser Trp Val Met Thr Leu Phe Arg Trp Gln His Val His 245 250 255 tgg aca ttc atg tta cca ttc ctc cgt ctc tcg tgg ctt ctt cag tca 816 Trp Thr Phe Met Leu Pro Phe Leu Arg Leu Ser Trp Leu Leu Gln Ser 260 265 270 atc att ttt gtt agt cag atg cca act cat tat tat gac tat tac aga 864 Ile Ile Phe Val Ser Gln Met Pro Thr His Tyr Tyr Asp Tyr Tyr Arg 13 275 280 285 aatactgcgatttatgaacaggttggtctctctttgcactgggcttgg 912AsnThrAlaIleTyrGluGlnValGlyLeuSerLeuHisTrpAlaTrp 290 295 300 tcattgggtcaattgtatttcctacccgattggtcaactagaataatg 960SerLeuGlyGlnLeuTyrPheLeuProAspTrpSerThrArgIleMet 305 310 315 320 ttcttccttgtttctcatcttgttggaggtttcctgctctctcatgta 1008PhePheLeuValSerHisLeuValGlyGlyPheLeuLeuSerHisVal 325 330 335 gttactttcaatcattattcagtggagaagtttgcattgagctcgaac 1056ValThrPheAsnHisTyrSerValGluLysPheAlaLeuSerSerAsn 340 345 350 atcatgtcaaattacgcttgtcttcaaatcatgaccacaagaaatatg 1104IleMetSerAsnTyrAlaCysLeuGlnIleMetThrThrArgAsnMet 355 360 365 agacctggaagattcattgactggctttggggaggtcttaactatcag 1152ArgProGlyArgPheIleAspTrpLeuTrpGlyGlyLeuAsnTyrGln 370 375 380 attgagcaccatcttttcccaacgatgccacgacacaacttgaacact 1200IleGluHisHisLeuPheProThrMetProArgHisAsnLeuAsnThr 385 390 395 400 gttatgccacttgttaaggagtttgcagcagcaaatggtttaccatac 1248ValMetProLeuValLysGluPheAlaAlaAlaAsnGlyLeuProTyr 405 410 415 atggtcgacgattatttcacaggattctggcttgaaattgagcaattc 1296MetValAspAspTy rPheThrGlyPheTrpLeuGluIleGluGlnPhe 420 425 430 cgaaatattgcaaatgttgctgctaaattgactaaaaagattgcctag 1344ArgAsnIleAlaAsnValAlaAlaLysLeuThrLysLysIleAla 435 440 445 <210> 8<211> 447<212> PRT<213> Ceratodonpurpureus<400> 8MetValLeuArgGluGlnGluHisGluProPhePheIleLysIleAsp 1 5 10 15 GlyLysTrpCysGlnIleAspAspAlaValLeuArgSerHisProGly 20 25 30 GlySerAlaIleThrThrTyrLysAsnMetAspAlaThrThrValPhe 35 40 45 HisThrPheHisThrGlySerLysGluAlaTyrGlnTrpLeuThrGlu 14 50 55 60 Leu Lys Lys Glu Cys Pro Thr Gln Glu Pro Glu Ile Pro Asp Ile Lys 65 70 75 80 Asp Asp Pro Ile Lys Gly Ile Asp Asp Val Asn Met Gly Thr Phe Asn 85 90 95 Ile Ser Glu Lys Arg Ser Ala Gln Ile Asn Lys Ser Phe Thr Asp Leu 100 105 110 Arg Met Arg Val Arg Ala Glu Gly Leu Met Asp Gly Ser Pro Leu Phe 115 120 125 Tyr Ile Arg Lys Ile Leu Glu Thr Ile Phe Thr Ile Leu Phe Ala Phe 130 135 140 Tyr Leu Gln Tyr His Thr Tyr Tyr Leu Pro Ser Ala Ile Leu Met Gly 145 150 155 160 Val Ala Trp Gln Gln Leu Gly Trp Leu Ile His Glu Phe Ala His His 165 170 175 Gln Leu Phe Lys Asn Arg Tyr Tyr Asn Asp Leu Ala Ser Tyr Phe Val 180 185 190 Gly Asn Phe Leu Gln Gly Phe Ser Ser Gly Gly Trp Lys Glu Gln His 195 200 205 Asn Val His His Ala Ala Thr Asn Val Val Gly Arg Asp Gly Asp Leu 210 215 220 Asp Leu Val Pro Phe Tyr Ala Thr Val Ala Glu His Leu Asn Asn Tyr 225 230 235 240 Ser Gln Asp Ser Trp Val Met Thr Leu Phe Arg Trp Gln His Val His 245 250 255 Trp Thr Phe Met Leu Pro Phe Leu Arg Leu Ser Trp Leu Leu Gln Ser 260 265 270 Ile Ile Phe Val Ser Gln Met Pro Thr His Tyr Tyr Asp Tyr Tyr Arg 275 280 285 Asn Thr Ala Ile Tyr Glu Gln Val Gly Leu Ser Leu His Trp Ala Trp 290 295 300 Ser Leu Gly Gln Leu Tyr Phe Leu Pro Asp Trp Ser Thr Arg Ile Met 305 310 315 320 Phe Phe Leu Val Ser His Leu Val Gly Gly Phe Leu Leu Ser His Val 15 325 330 335 ValThrPheAsnHisTyrSerValGluLysPheAlaLeuSerSerAsn 340 345 350 IleMetSerAsnTyrAlaCysLeuGlnIleMetThrThrArgAsnMet 355 360 365 ArgProGlyArgPheIleAspTrpLeuTrpGlyGlyLeuAsnTyrGln 370 375 380 IleGluHisHisLeuPheProThrMetProArgHisAsnLeuAsnThr 385 390 395 400 ValMetProLeuValLysGluPheAlaAlaAlaAsnGlyLeuProTyr 405 410 415 MetValAspAspTyrPheThrGlyPheTrpLeuGluIleGluGlnPhe 420 425 430 ArgAsnIleAlaAsnValAlaAlaLysLeuThrLysLysIleAla 435 440 445 <210> 9<211> 1443<212> DNA<213> Physcomitrellapatens< 220><221> CDS<222> (1)..(1443)<223> Δ5-desaturase<400> 9atggcgccccactctgcggatactgctgggctcgtgccttctgacgaa 48MetAlaProHisSerAlaAspThrAlaGlyLeuValProSerAspGlu 1 5 10 15 ttgaggctacgaacgtcgaattcaaagggtcccgaacaagagcaaact 96LeuArgLeuArgThrSerAsnSerLysGlyProGluGlnGluGlnThr 20 25 30 ttgaagaagtacacccttgaagatgtcagccgccacaacaccccagca 144LeuLysLysTyrThrLeuGluAspValSerArgHisAsnThrProAla 35 40 45 gattgttggttggtgatatggggcaaagtctacgatgtcacaagctgg 192AspCysTrpLeuValIleTrpGlyLysValTyrAspValThrSerTrp 50 55 60 16 att ccc aat cat ccg ggg ggc agt ctc atc cac gta aaa gca ggg cag 240 Ile Pro Asn His Pro Gly Gly Ser Leu Ile His Val Lys Ala Gly Gln 65 70 75 80 gat tcc act cag ctt ttc gat tcc tat cac ccc ctt tat gtc agg aaa 288 Asp Ser Thr Gln Leu Phe Asp Ser Tyr His Pro Leu Tyr Val Arg Lys 85 90 95 atg ctc gcg aag tac tgt att ggg gaa tta gta ccg tct gct ggt gat 336 Met Leu Ala Lys Tyr Cys Ile Gly Glu Leu Val Pro Ser Ala Gly Asp 100 105 110 gac aag ttt aag aaa gca act ctg gag tat gca gat gcc gaa aat gaa 384 Asp Lys Phe Lys Lys Ala Thr Leu Glu Tyr Ala Asp Ala Glu Asn Glu 115 120 125 gat ttc tat ttg gtt gtg aag caa cga gtt gaa tct tat ttc aag agt 432 Asp Phe Tyr Leu Val Val Lys Gln Arg Val Glu Ser Tyr Phe Lys Ser 130 135 140 aac aag ata aac ccc caa att cat cca cat atg atc ctg aag tca ttg 480 Asn Lys Ile Asn Pro Gln Ile His Pro His Met Ile Leu Lys Ser Leu 145 150 155 160 ttc att ctt ggg gga tat ttc gcc agt tac tat tta gcg ttc ttc tgg 528 Phe Ile Leu Gly Gly Tyr Phe Ala Ser Tyr Tyr Leu Ala Phe Phe Trp 165 170 175 tct tca agt gtc ctt gtt tct ttg ttt ttc gca ttg tgg atg ggg ttc 576 Ser Ser Ser Val Leu Val Ser Leu Phe Phe Ala Leu Trp Met Gly Phe 180 185 190 ttc gca gcg gaa gtc ggc gtg tcg att caa cat gat gga aat cat ggt 624 Phe Ala Ala Glu Val Gly Val Ser Ile Gln His Asp Gly Asn His Gly 195 200 205 tca tac act aaa tgg cgt ggc ttt gga tat atc atg gga gcc tcc cta 672 Ser Tyr Thr Lys Trp Arg Gly Phe Gly Tyr Ile Met Gly Ala Ser Leu 210 215 220 gat cta gtc gga gcc agt agc ttc atg tgg aga cag caa cac gtt gtg 720 Asp Leu Val Gly Ala Ser Ser Phe Met Trp Arg Gln Gln His Val Val 225 230 235 240 gga cat cac tcg ttt aca aat gtg gac aac tac gat cct gat att cgt 768 Gly His His Ser Phe Thr Asn Val Asp Asn Tyr Asp Pro Asp Ile Arg 245 250 255 gtg aaa gat cca gat gtc agg agg gtt gcg acc aca caa cca aga caa 816 Val Lys Asp Pro Asp Val Arg Arg Val Ala Thr Thr Gln Pro Arg Gln 260 265 270 tgg tat cat gcg tat cag cat atc tac ctg gca gta tta tat gga act 864 Trp Tyr His Ala Tyr Gln His Ile Tyr Leu Ala Val Leu Tyr Gly Thr 275 280 285 cta gct ctt aag agt att ttt cta gat gat ttc ctt gcg tac ttc aca 912 Leu Ala Leu Lys Ser Ile Phe Leu Asp Asp Phe Leu Ala Tyr Phe Thr 290 295 300 gga tca att ggc cct gtc aag gtg gcg aaa atg acc ccc ctg gag ttc 960 Gly Ser Ile Gly Pro Val Lys Val Ala Lys Met Thr Pro Leu Glu Phe 305 310 315 320 aac atc ttc ttt cag gga aag ctg cta tat gcg ttc tac atg ttc gtg 1008 Asn Ile Phe Phe Gln Gly Lys Leu Leu Tyr Ala Phe Tyr Met Phe Val 325 330 335 17 ttg cca tct gtg tac ggt gtt cac tcc gga gga act ttc ttg gca cta 1056 Leu Pro Ser Val Tyr Gly Val His Ser Gly Gly Thr Phe Leu Ala Leu 340 345 350 tat gtg gct tct cag ctc att aca ggt tgg atg tta gct ttt ctt ttt 1104 Tyr Val Ala Ser Gln Leu Ile Thr Gly Trp Met Leu Ala Phe Leu Phe 355 360 365 caa gta gca cat gtc gtg gat gat gtt gca ttt cct aca cca gaa ggt 1152 Gln Val Ala His Val Val Asp Asp Val Ala Phe Pro Thr Pro Glu Gly 370 375 380 ggg aag gtg aag gga gga tgg gct gca atg cag gtt gca aca act acg 1200 Gly Lys Val Lys Gly Gly Trp Ala Ala Met Gln Val Ala Thr Thr Thr 385 390 395 400 gat ttc agt cca cgc tca tgg ttc tgg ggt cat gtc tct gga gga tta 1248 Asp Phe Ser Pro Arg Ser Trp Phe Trp Gly His Val Ser Gly Gly Leu 405 410 415 aac aac caa att gag cat cat ctg ttt cca gga gtg tgc cat gtt cat 1296 Asn Asn Gln Ile Glu His His Leu Phe Pro Gly Val Cys His Val His 420 425 430 tat cca gcc att cag cct att gtc gag aag acg tgc aag gaa ttc gat 1344 Tyr Pro Ala Ile Gln Pro Ile Val Glu Lys Thr Cys Lys Glu Phe Asp 435 440 445 gtg cct tat gta gcc tac cca act ttt tgg act gcg ttg aga gcc cac 1392 Val Pro Tyr Val Ala Tyr Pro Thr Phe Trp Thr Ala Leu Arg Ala His 450 455 460 ttt gcg cat ttg aaa aag gtt gga ttg aca gag ttt cgg ctc gat ggc 1440 Phe Ala His Leu Lys Lys Val Gly Leu Thr Glu Phe Arg Leu Asp Gly 465 470 475 480 took 1443 <210> 10 <211> 480 <212> PRT <213> Physcomitrella patens <400> 10 Met Ala Pro His Ser Ala Asp Thr Ala Gly Leu Val Pro Ser Asp Glu 1 5 10 15 Leu Arg Leu Arg Thr Ser Asn Ser Lys Gly Pro Glu Gln Glu Gln Thr 20 25 30 Leu Lys Lys Tyr Thr Leu Glu Asp Val Ser Arg His Asn Thr Pro Ala 35 40 45 Asp Cys Trp Leu Val Ile Trp Gly Lys Val Tyr Asp Val Thr Ser Trp 50 55 60 Ile Pro Asn His Pro Gly Gly Ser Leu Ile His Val Lys Ala Gly Gln 18 65 70 75 80 Asp Ser Thr Gln Leu Phe Asp Ser Tyr His Pro Leu Tyr Val Arg Lys 85 90 95 Met Leu Ala Lys Tyr Cys Ile Gly Glu Leu Val Pro Ser Ala Gly Asp 100 105 110 Asp Lys Phe Lys Lys Ala Thr Leu Glu Tyr Ala Asp Ala Glu Asn Glu 115 120 125 Asp Phe Tyr Leu Val Val Lys Gln Arg Val Glu Ser Tyr Phe Lys Ser 130 135 140 Asn Lys Ile Asn Pro Gln Ile His Pro His Met Ile Leu Lys Ser Leu 145 150 155 160 Phe Ile Leu Gly Gly Tyr Phe Ala Ser Tyr Tyr Leu Ala Phe Phe Trp 165 170 175 Ser Ser Ser Val Leu Val Ser Leu Phe Phe Ala Leu Trp Met Gly Phe 180 185 190 Phe Ala Ala Glu Val Gly Val Ser Ile Gln His Asp Gly Asn His Gly 195 200 205 Ser Tyr Thr Lys Trp Arg Gly Phe Gly Tyr Ile Met Gly Ala Ser Leu 210 215 220 Asp Leu Val Gly Ala Ser Ser Phe Met Trp Arg Gln Gln His Val Val 225 230 235 240 Gly His His Ser Phe Thr Asn Val Asp Asn Tyr Asp Pro Asp Ile Arg 245 250 255 Val Lys Asp Pro Asp Val Arg Arg Val Ala Thr Thr Gln Pro Arg Gln 260 265 270 Trp Tyr His Ala Tyr Gln His Ile Tyr Leu Ala Val Leu Tyr Gly Thr 275 280 285 Leu Ala Leu Lys Ser Ile Phe Leu Asp Asp Phe Leu Ala Tyr Phe Thr 290 295 300 Gly Ser Ile Gly Pro Val Lys Val Ala Lys Met Thr Pro Leu Glu Phe 305 310 315 320 Asn Ile Phe Phe Gln Gly Lys Leu Leu Tyr Ala Phe Tyr Met Phe Val 325 330 335 Leu Pro Ser Val Tyr Gly Val His Ser Gly Gly Thr Phe Leu Ala Leu 19 340 345 350 TyrValAlaSerGlnLeuIleThrGlyTrpMetLeuAlaPheLeuPhe 355 360 365 GlnValAlaHisValValAspAspValAlaPheProThrProGluGly 370 375 380 GlyLysValLysGlyGlyTrpAlaAlaMetGlnValAlaThrThrThr 385 390 395 400 AspPheSerProArgSerTrpPheTrpGlyHisValSerGlyGlyLeu 405 410 415 AsnAsnGlnIleGluHisHisLeuPheProGlyValCysHisValHis 420 425 430 TyrProAlaIleGlnProIleValGluLysThrCysLysGluPheAsp 435 440 445 ValProTyrValAlaTyrProThrPheTrpThrAlaLeuArgAlaHis 450 455 460 PheAlaHisLeuLysLysValGlyLeuThrGluPheArgLeuAspGly 465 470 475 480 <210> 11<211> 1320<212> DNA <213> Thraustrochytrium<220><221> CDS<222> (1)..(1320)<223> <400> 11atgggcaagggcagcgagggccgcagcgcggcgcgcgagatgacggcc 48MetGlyLysGlySerGluGlyArgSerAlaAlaArgGluMetThrAla 1 5 10 15 gaggcgaacggcgacaagcggaaaacgattctgatcgagggcgtcctg 96GluAlaAsnGlyAspLysArgLysThrIleLeuIleGluGlyValLeu 20 25 30 tacgacgcgacgaactttaagcacccgggcggttcgatcatcaacttc 144TyrAspAlaThrAsnPheLysHisProGlyGlySerIleIleAsnPhe 35 40 45 20 ttg acc gag ggc gag gcc ggc gtg gac gcg acg cag gcg tac cgc gag 192 Leu Thr Glu Gly Glu Ala Gly Val Asp Ala Thr Gln Ala Tyr Arg Glu 50 55 60 ttt cat cag cgg tcc ggc aag gcc gac aag tac ctc aag tcg ctg ccg 240 Phe His Gln Arg Ser Gly Lys Ala Asp Lys Tyr Leu Lys Ser Leu Pro 65 70 75 80 aag ctg gat gcg tcc aag gtg gag tcg cgg ttc tcg gcc aaa gag cag 288 Lys Leu Asp Ala Ser Lys Val Glu Ser Arg Phe Ser Ala Lys Glu Gln 85 90 95 gcg cgg cgc gac gcc atg acg cgc gac tac gcg gcc ttt cgc gag gag 336 Ala Arg Arg Asp Ala Met Thr Arg Asp Tyr Ala Ala Phe Arg Glu Glu 100 105 110 ctc gtc gcc gag ggg tac ttt gac ccg tcg atc ccg cac atg att tac 384 Leu Val Ala Glu Gly Tyr Phe Asp Pro Ser Ile Pro His Met Ile Tyr 115 120 125 cgc gtc gtg gag atc gtg gcg ctc ttc gcg ctc tcg ttc tgg ctc atg 432 Arg Val Val Glu Ile Val Ala Leu Phe Ala Leu Ser Phe Trp Leu Met 130 135 140 tcc aag gcc tcg ccc acc tcg ctc gtg ctg ggc gtg gtg atg aac ggc 480 Ser Lys Ala Ser Pro Thr Ser Leu Val Leu Gly Val Val Met Asn Gly 145 150 155 160 att gcg cag ggc cgc tgc ggc tgg gtc atg cac gag atg ggc cac ggg 528 Ile Ala Gln Gly Arg Cys Gly Trp Val Met His Glu Met Gly His Gly 165 170 175 tcg ttc acg ggc gtc atc tgg ctc gac gac cgg atg tgc gag ttc ttc 576 Ser Phe Thr Gly Val Ile Trp Leu Asp Asp Arg Met Cys Glu Phe Phe 180 185 190 tac ggc gtc ggc tgc ggc atg agc ggg cac tac tgg aag aac cag cac 624 Tyr Gly Val Gly Cys Gly Met Ser Gly His Tyr Trp Lys Asn Gln His 195 200 205 agc aag cac cac gcc gcg ccc aac cgc ctc gag cac gat gtc gat ctc 672 Ser Lys His His Ala Ala Pro Asn Arg Leu Glu His Asp Val Asp Leu 210 215 220 aac acg ctg ccc ctg gtc gcc ttt aac gag cgc gtc gtg cgc aag gtc 720 Asn Thr Leu Pro Leu Val Ala Phe Asn Glu Arg Val Val Arg Lys Val 225 230 235 240 aag ccg gga tcg ctg ctg gcg ctc tgg ctg cgc gtg cag gcg tac ctc 768 Lys Pro Gly Ser Leu Leu Ala Leu Trp Leu Arg Val Gln Ala Tyr Leu 245 250 255 ttt gcg ccc gtc tcg tgc ctg ctc atc ggc ctt ggc tgg acg ctc tac 816 Phe Ala Pro Val Ser Cys Leu Leu Ile Gly Leu Gly Trp Thr Leu Tyr 260 265 270 ctg cac ccg cgc tac atg ctg cgc acc aag cgg cac atg gag ttc gtc 864 Leu His Pro Arg Tyr Met Leu Arg Thr Lys Arg His Met Glu Phe Val 275 280 285 tgg atc ttc gcg cgc tac att ggc tgg ttc tcg ctc atg ggc gct ctc 912 Trp Ile Phe Ala Arg Tyr Ile Gly Trp Phe Ser Leu Met Gly Ala Leu 290 295 300 ggc tac tcg ccg ggc acc tcg gtc ggg atg tac ctg tgc tcg ttc ggc 960 Gly Tyr Ser Pro Gly Thr Ser Val Gly Met Tyr Leu Cys Ser Phe Gly 305 310 315 320 21 ctc ggc tgc att tac att ttc ctg cag ttc gcc gtc agc cac acg cac 1008 Leu Gly Cys Ile Tyr Ile Phe Leu Gln Phe Ala Val Ser His Thr His 325 330 335 ctg ccg gtg acc aac ccg gag gac cag ctg cac tgg ctc gag tac gcg 1056 Leu Pro Val Thr Asn Pro Glu Asp Gln Leu His Trp Leu Glu Tyr Ala 340 345 350 gcc gac cac acg gtg aac att agc acc aag tcc tgg ctc gtc acg tgg 1104 Ala Asp His Thr Val Asn Ile Ser Thr Lys Ser Trp Leu Val Thr Trp 355 360 365 tgg atg tcg aac ctg aac ttt cag atc gag cac cac ctc ttc ccc acg 1152 Trp Met Ser Asn Leu Asn Phe Gln Ile Glu His His Leu Phe Pro Thr 370 375 380 gcg ccg cag ttc cgc ttc aag gaa atc ​​agt cct cgc gtc gag gcc ctc 1200 Ala Pro Gln Phe Arg Phe Lys Glu Ile Ser Pro Arg Val Glu Ala Leu 385 390 395 400 ttc aag cgc cac aac ctc ccg tac tac gac ctg ccc tac acg agc gcg 1248 Phe Lys Arg His Asn Leu Pro Tyr Tyr Asp Leu Pro Tyr Thr Ser Ala 405 410 415 gtc tcg acc acc ttt gcc aat ctt tat tcc gtc ggc cac tcg gtc ggc 1296 Val Ser Thr Thr Phe Ala Asn Leu Tyr Ser Val Gly His Ser Val Gly 420 425 430 gcc gac acc aag aag cag gac tga 1320 Ala Asp Thr Lys Lys Gln Asp 435 <210> 12 <211> 439 <212> PRT <213> Thraustrochytrium <400> 12 Met Gly Lys Gly Ser Glu Gly Arg Ser Ala Ala Arg Glu Met Thr Ala 1 5 10 15 Glu Ala Asn Gly Asp Lys Arg Lys Thr Ile Leu Ile Glu Gly Val Leu 20 25 30 Tyr Asp Ala Thr Asn Phe Lys His Pro Gly Gly Ser Ile Ile Asn Phe 35 40 45 Leu Thr Glu Gly Glu Ala Gly Val Asp Ala Thr Gln Ala Tyr Arg Glu 50 55 60 Phe His Gln Arg Ser Gly Lys Ala Asp Lys Tyr Leu Lys Ser Leu Pro 65 70 75 80 Lys Leu Asp Ala Ser Lys Val Glu Ser Arg Phe Ser Ala Lys Glu Gln 85 90 95 22AlaArgArgAspAlaMetThrArgAspTyrAlaAlaPheArgGluGlu 100 105 110 LeuValAlaGluGlyTyrPheAspProSerIleProHisMetIleTyr 115 120 125 ArgValValGluIleValAlaLeuPheAlaLeuSerPheTrpLeuMet 130 135 140 SerLysAlaSerProThrSerLeuValLeuGlyValValMetAsnGly 145 150 155 160 IleAlaGlnGlyArgCysGlyTrpValMetHisGluMetGlyHisGly 165 170 175 SerPheThrGlyValIleTrpLeuAspAspArgMetCysGluPhePhe 180 185 190 TyrGlyValGlyCysGlyMetSerGlyHisTyrTrpLysAsnGlnHis 195 200 205 SerLysHisHisAlaAlaProAsnArgLeuGluHisAspValAspLeu 210 215 220 AsnThrLeuProLeuValAlaPheAsnGluArgValValArgLysVal 225 230 235 240 LysProGlySerLeuLeuAlaLeuTrpLeuArgValGlnAlaTyrLeu 245 250 255 PheAlaProValSerCysLeuLeuIleGlyLeuGlyTrpThrLeuTyr 260 265 270 LeuHisProArgTyrMetLeuArgThrLysArgHisMetGluPheVal 275 280 285 Trpilephealaartyrileglytreppheserleumetglyalaleu 290 295 300 GLYTYRSERPROSPROYTHR SELECTIONLYLYPLYPLYPLYPLYCESERPHEGLY 305 310 315 320 Leuglycysilephelephelepheirilephelephydirilephelephydiaksilphasilephelephye hrValAsnIleSerThrLysSerTrpLeuValThrTrp 355 360 365 23 Trp Met Ser Asn Leu Asn Phe Gln Ile Glu His His Leu Phe Pro Thr 370 375 380 Ala Pro Gln Phe Arg Phe Lys Glu Ile Ser Pro Arg Val Glu Ala Leu 385 390 395 400 Phe Lys Arg His Asn Leu Pro Tyr Tyr Asp Leu Pro Tyr Thr Ser Ala 405 410 415 Val Ser Thr Thr Phe Ala Asn Leu Tyr Ser Val Gly His Ser Val Gly 420 425 430 Ala Asp Thr Lys Lys Gln Asp 435 <210> 13 <211> 1341 <212> DNA <213> Mortierella alpina <220> <221> CDS <222> (1)..(1341) <223> Δ5-desaturase <400> 13 atg gga acg gac caa gga aaa acc ttc acc tgg gaa gag ctg gcg gcc 48 Met Gly Thr Asp Gln Gly Lys Thr Phe Thr Trp Glu Glu Leu Ala Ala 1 5 10 15 cat aac acc aag gac gac cta ctc ttg gcc atc cgc ggc agg gtg tac 96 His Asn Thr Lys Asp Asp Leu Leu Leu Ala Ile Arg Gly Arg Val Tyr 20 25 30 gat gtc aca aag ttc ttg agc cgc cat cct ggt gga gtg gac act ctc 144 Asp Val Thr Lys Phe Leu Ser Arg His Pro Gly Gly Val Asp Thr Leu 35 40 45 ctg ctc gga gct ggc cga gat gtt act ccg gtc ttt gag atg tat cac 192 Leu Leu Gly Ala Gly Arg Asp Val Thr Pro Val Phe Glu Met Tyr His 50 55 60 gcg ttt ggg gct gca gat gcc att atg aag aag tac tat gtc ggt aca 240 Ala Phe Gly Ala Ala Asp Ala Ile Met Lys Lys Tyr Tyr Val Gly Thr 65 70 75 80 ctg gtc tcg aat gag ctg ccc atc ttc ccg gag cca acg gtg ttc cac 288 Leu Val Ser Asn Glu Leu Pro Ile Phe Pro Glu Pro Thr Val Phe His 85 90 95 aaa acc atc aag acg aga gtc gag ggc tac ttt acg gat cgg aac att 336 Lys Thr Ile Lys Thr Arg Val Glu Gly Tyr Phe Thr Asp Arg Asn Ile 24 100 105 110 gat ccc aag aat aga cca gag atc tgg gga cga tac gct ctt atc ttt 384 Asp Pro Lys Asn Arg Pro Glu Ile Trp Gly Arg Tyr Ala Leu Ile Phe 115 120 125 gga tcc ttg atc gct tcc tac tac gcg cag ctc ttt gtg cct ttc gtt 432 Gly Ser Leu Ile Ala Ser Tyr Tyr Ala Gln Leu Phe Val Pro Phe Val 130 135 140 gtc gaa cgc aca tgg ctt cag gtg gtg ttt gca atc ​​atc atg gga ttt 480 Val Glu Arg Thr Trp Leu Gln Val Val Phe Ala Ile Ile Met Gly Phe 145 150 155 160 gcg tgc gca caa gtc gga ctc aac cct ctt cat gat gcg tct cac ttt 528 Ala Cys Ala Gln Val Gly Leu Asn Pro Leu His Asp Ala Ser His Phe 165 170 175 tca gtg acc cac aac ccc act gtc tgg aag att ctg gga gcc acg cac 576 Ser Val Thr His Asn Pro Thr Val Trp Lys Ile Leu Gly Ala Thr His 180 185 190 gac ttt ttc aac gga gca tcg tac ctg gtg tgg atg tac caa cat atg 624 Asp Phe Phe Asn Gly Ala Ser Tyr Leu Val Trp Met Tyr Gln His Met 195 200 205 ctc ggc cat cac ccc tac acc aac att gct gga gca gat ccc gac gtg 672 Leu Gly His His Pro Tyr Thr Asn Ile Ala Gly Ala Asp Pro Asp Val 210 215 220 tcg acg tct gag ccc gat gtt cgt cgt atc aag ccc aac caa aag tgg 720 Ser Thr Ser Glu Pro Asp Val Arg Arg Ile Lys Pro Asn Gln Lys Trp 225 230 235 240 ttt gtc aac cac atc aac cag cac atg ttt gtt cct ttc ctg tac gga 768 Phe Val Asn His Ile Asn Gln His Met Phe Val Pro Phe Leu Tyr Gly 245 250 255 ctg ctg gcg ttc aag gtg cgc att cag gac atc aac att ttg tac ttt 816 Leu Leu Ala Phe Lys Val Arg Ile Gln Asp Ile Asn Ile Leu Tyr Phe 260 265 270 gtc aag acc aat gac gct att cgt gtc aat ccc atc tcg aca tgg cac 864 Val Lys Thr Asn Asp Ala Ile Arg Val Asn Pro Ile Ser Thr Trp His 275 280 285 act gtg atg ttc tgg ggc ggc aag gct ttc ttt gtc tgg tat cgc ctg 912 Thr Val Met Phe Trp Gly Gly Lys Ala Phe Phe Val Trp Tyr Arg Leu 290 295 300 att gtt ccc ctg cag tat ctg ccc ctg ggc aag gtg ctg ctc ttg ttc 960 Ile Val Pro Leu Gln Tyr Leu Pro Leu Gly Lys Val Leu Leu Leu Phe 305 310 315 320 acg gtc gcg gac atg gtg tcg tct tac tgg ctg gcg ctg acc ttc cag 1008 Thr Val Ala Asp Met Val Ser Ser Tyr Trp Leu Ala Leu Thr Phe Gln 325 330 335 gcg aac cac gtt gtt gag gaa gtt cag tgg ccg ttg cct gac gag aac 1056 Ala Asn His Val Val Glu Glu Val Gln Trp Pro Leu Pro Asp Glu Asn 340 345 350 ggg atc atc caa aag gac tgg gca gct atg cag gtc gag act acg cag 1104 Gly Ile Ile Gln Lys Asp Trp Ala Ala Met Gln Val Glu Thr Thr Gln 355 360 365 gat tac gca cac gat tcg cac ctc tgg acc agc atc act ggc agc ttg 1152 Asp Tyr Ala His Asp Ser His Leu Trp Thr Ser Ile Thr Gly Ser Leu 25 370 375 380 aactaccaggctgtgcaccatctgttccccaacgtgtcgcagcaccat 1200AsnTyrGlnAlaValHisHisLeuPheProAsnValSerGlnHisHis 385 390 395 400 tatcccgatattctggccatcatcaagaacacctgcagcgagtacaag 1248TyrProAspIleLeuAlaIleIleLysAsnThrCysSerGluTyrLys 405 410 415 gttccataccttgtcaaggatacgttttggcaagcatttgcttcacat 1296ValProTyrLeuValLysAspThrPheTrpGlnAlaPheAlaSerHis 420 425 430 ttggagcacttgcgtgttcttggactccgtcccaaggaagagtag 1341LeuGluHisLeuArgValLeuGlyLeuArgProLysGluGlu 435 440 445 <210> 14<211> 446<212> PRT<213> Mortierellaalpina<400> 14MetGlyThrAspGlnGlyLysThrPheThrTrpGluGluLeuAlaAla 1 5 10 15 HisAsnThrLysAspAspLeuLeuLeuAlaIleArgGlyArgValTyr 20 25 30 AspValThrLysPheLeuSerArgHisProGlyGlyValAspThrLeu 35 40 45 LeuLeuGlyAlaGlyArgAspValThrProValPheGluMetTyrHis 50 55 60 AlaPheGlyAlaAlaAspAlaIleMetLysLysTyrTyrValGlyThr 65 70 75 80 LeuValSerAsnGluLeuProIlePheProGluProThrValPheHis 85 90 95 LysThrIleLysThrArgValGluGlyTyrPheThrAspArgAsnIle 100 105 110 AspProLysAsnArgProGluIleTrpGlyArgTyrAlaLeuIlePhe 115 120 125 Gly SerLeuIleAlaSerTyrTyrAlaGlnLeuPheValProPheVal 130 135 140 ValGluArgThrTrpLeuGlnValValPheAlaIleIleMetGlyPhe 26 145 150 155 160 Ala Cys Ala Gln Val Gly Leu Asn Pro Leu His Asp Ala Ser His Phe 165 170 175 Ser Val Thr His Asn Pro Thr Val Trp Lys Ile Leu Gly Ala Thr His 180 185 190 Asp Phe Phe Asn Gly Ala Ser Tyr Leu Val Trp Met Tyr Gln His Met 195 200 205 Leu Gly His His Pro Tyr Thr Asn Ile Ala Gly Ala Asp Pro Asp Val 210 215 220 Ser Thr Ser Glu Pro Asp Val Arg Arg Ile Lys Pro Asn Gln Lys Trp 225 230 235 240 Phe Val Asn His Ile Asn Gln His Met Phe Val Pro Phe Leu Tyr Gly 245 250 255 Leu Leu Ala Phe Lys Val Arg Ile Gln Asp Ile Asn Ile Leu Tyr Phe 260 265 270 Val Lys Thr Asn Asp Ala Ile Arg Val Asn Pro Ile Ser Thr Trp His 275 280 285 Thr Val Met Phe Trp Gly Gly Lys Ala Phe Phe Val Trp Tyr Arg Leu 290 295 300 Ile Val Pro Leu Gln Tyr Leu Pro Leu Gly Lys Val Leu Leu Leu Phe 305 310 315 320 Thr Val Ala Asp Met Val Ser Ser Tyr Trp Leu Ala Leu Thr Phe Gln 325 330 335 Ala Asn His Val Val Glu Glu Val Gln Trp Pro Leu Pro Asp Glu Asn 340 345 350 Gly Ile Ile Gln Lys Asp Trp Ala Ala Met Gln Val Glu Thr Thr Gln 355 360 365 Asp Tyr Ala His Asp Ser His Leu Trp Thr Ser Ile Thr Gly Ser Leu 370 375 380 Asn Tyr Gln Ala Val His His Leu Phe Pro Asn Val Ser Gln His His 385 390 395 400 Tyr Pro Asp Ile Leu Ala Ile Ile Lys Asn Thr Cys Ser Glu Tyr Lys 405 410 415 Val Pro Tyr Leu Val Lys Asp Thr Phe Trp Gln Ala Phe Ala Ser His 27 420 425 430 Leu Glu His Leu Arg Val Leu Gly Leu Arg Pro Lys Glu Glu 435 440 445 <210> 15 <211> 1344 <212> DNA <213> Caenorhabditis elegans <220> <221> CDS <222> (1)..(1344) <223> Δ5-desaturase <400> 15 atg gta tta cga gag caa gag cat gag cca ttc ttc att aaa att gat 48 Met Val Leu Arg Glu Gln Glu His Glu Pro Phe Phe Ile Lys Ile Asp 1 5 10 15 gga aaa tgg tgt caa att gac gat gct gtc ctg aga tca cat cca ggt 96 Gly Lys Trp Cys Gln Ile Asp Asp Ala Val Leu Arg Ser His Pro Gly 20 25 30 ggt agt gca att act acc tat aaa aat atg gat gcc act acc gta ttc 144 Gly Ser Ala Ile Thr Thr Tyr Lys Asn Met Asp Ala Thr Thr Val Phe 35 40 45 cac aca ttc cat act ggt tct aaa gaa gcg tat caa tgg ctg aca gaa 192 His Thr Phe His Thr Gly Ser Lys Glu Ala Tyr Gln Trp Leu Thr Glu 50 55 60 ttg aaa aaa gag tgc cct aca caa gaa cca gag atc cca gat att aag 240 Leu Lys Lys Glu Cys Pro Thr Gln Glu Pro Glu Ile Pro Asp Ile Lys 65 70 75 80 gat gac cca atc ​​aaa gga att gat gat gtg aac atg gga act ttc aat 288 Asp Asp Pro Ile Lys Gly Ile Asp Asp Val Asn Met Gly Thr Phe Asn 85 90 95 att tct gag aaa cga tct gcc caa ata aat aaa agt ttc act gat cta 336 Ile Ser Glu Lys Arg Ser Ala Gln Ile Asn Lys Ser Phe Thr Asp Leu 100 105 110 cgt atg cga gtt cgt gca gaa gga ctt atg gat gga tct cct ttg ttc 384 Arg Met Arg Val Arg Ala Glu Gly Leu Met Asp Gly Ser Pro Leu Phe 115 120 125 tac att aga aaa att ctt gaa aca atc ​​ttc aca att ctt ttt gca ttc 432 Tyr Ile Arg Lys Ile Leu Glu Thr Ile Phe Thr Ile Leu Phe Ala Phe 130 135 140 tac ctt caa tac cac aca tat tat ctt cca tca gct att cta atg gga 480 Tyr Leu Gln Tyr His Thr Tyr Tyr Leu Pro Ser Ala Ile Leu Met Gly 145 150 155 160 28gttgcgtggcaacaattgggatggttaatccatgaattcgcacatcat 528ValAlaTrpGlnGlnLeuGlyTrpLeuIleHisGluPheAlaHisHis 165 170 175 cagttgttcaaaaacagatactacaatgatttggccagctatttcgtt 576GlnLeuPheLysAsnArgTyrTyrAsnAspLeuAlaSerTyrPheVal 180 185 190 ggaaactttttacaaggattctcatctggtggttggaaagagcagcac 624GlyAsnPheLeuGlnGlyPheSerSerGlyGlyTrpLysGluGlnHis 195 200 205 aatgtgcatcacgcagccacaaatgttgttggacgagacggagatctt 672AsnValHisHisAlaAlaThrAsnValValGlyArgAspGlyAspLeu 210 215 220 gatttagtcccattctatgctacagtggcagaacatctcaacaattat 720AspLeuValProPheTyrAlaThrValAlaGluHisLeuAsnAsnTyr 225 230 235 240 tctcaggattcatgggttatgactctattcagatggcaacatgttcat 768SerGlnAspSerTrpValMetThrLeuPheArgTrpGlnHisValHis 245 250 255 tggacattcatgttaccattcctccgtctctcgtggcttcttcagtca 816TrpThrPheMetLeuProPheLeuArgLeuSerTrpLeuLeuGlnSer 260 265 270 atcatttttgttagtcagatgccaactcattattatgactattacaga 864IleIlePheValSerGlnMetProThrHisTyrTyrAspTyrTyrArg 275 280 285 aatactgcgatttatgaacaggttggtctctctttgcactgggcttgg 912AsnThrAlaIleTyrGluGlnValGlyLeuSerLeuHi sTrpAlaTrp 290 295 300 tcattgggtcaattgtatttcctacccgattggtcaactagaataatg 960SerLeuGlyGlnLeuTyrPheLeuProAspTrpSerThrArgIleMet 305 310 315 320 ttcttccttgtttctcatcttgttggaggtttcctgctctctcatgta 1008PhePheLeuValSerHisLeuValGlyGlyPheLeuLeuSerHisVal 325 330 335 gttactttcaatcattattcagtggagaagtttgcattgagctcgaac 1056ValThrPheAsnHisTyrSerValGluLysPheAlaLeuSerSerAsn 340 345 350 atcatgtcaaattacgcttgtcttcaaatcatgaccacaagaaatatg 1104IleMetSerAsnTyrAlaCysLeuGlnIleMetThrThrArgAsnMet 355 360 365 agacctggaagattcattgactggctttggggaggtcttaactatcag 1152ArgProGlyArgPheIleAspTrpLeuTrpGlyGlyLeuAsnTyrGln 370 375 380 attgagcaccatcttttcccaacgatgccacgacacaacttgaacact 1200IleGluHisHisLeuPheProThrMetProArgHisAsnLeuAsnThr 385 390 395 400 gttatgccacttgttaaggagtttgcagcagcaaatggtttaccatac 1248ValMetProLeuValLysGluPheAlaAlaAlaAsnGlyLeuProTyr 405 410 415 atggtcgacgattatttcacaggattctggcttgaaattgagcaattc 1296MetValAspAspTyrPheThrGlyPheTrpLeuGluIleGluGlnPhe 420 425 430 29 cga aat att gca aat gtt gct gct aaa ttg act aaa aag att gcc tag 1344 Arg Asn Ile Ala Asn Val Ala Ala Light Leu Thr Light Light Ile Ala 435 440 445 <210> 16 <211> 447 <212> PRT <213> Caenorhabditis elegans <400> 16 Met Val Leu Arg Glu Gln Glu His Glu Pro Phe Phe Ile Lys Ile Asp 1 5 10 15 Gly Lys Trp Cys Gln Ile Asp Asp Ala Val Leu Arg Ser His Pro Gly 20 25 30 Gly Ser Ala Ile Thr Thr Tyr Lys Asn Met Asp Ala Thr Thr Val Phe 35 40 45 His Thr Phe His Thr Gly Ser Lys Glu Ala Tyr Gln Trp Leu Thr Glu 50 55 60 Leu Lys Lys Glu Cys Pro Thr Gln Glu Pro Glu Ile Pro Asp Ile Lys 65 70 75 80 Asp Asp Pro Ile Lys Gly Ile Asp Asp Val Asn Met Gly Thr Phe Asn 85 90 95 Ile Ser Glu Lys Arg Ser Ala Gln Ile Asn Lys Ser Phe Thr Asp Leu 100 105 110 Arg Met Arg Val Arg Ala Glu Gly Leu Met Asp Gly Ser Pro Leu Phe 115 120 125 Tyr Ile Arg Lys Ile Leu Glu Thr Ile Phe Thr Ile Leu Phe Ala Phe 130 135 140 Tyr Leu Gln Tyr His Thr Tyr Tyr Leu Pro Ser Ala Ile Leu Met Gly 145 150 155 160 Val Ala Trp Gln Gln Leu Gly Trp Leu Ile His Glu Phe Ala His His 165 170 175 Gln Leu Phe Lys Asn Arg Tyr Tyr Asn Asp Leu Ala Ser Tyr Phe Val 180 185 190 Gly Asn Phe Leu Gln Gly Phe Ser Ser Gly Gly Trp Lys Glu Gln His 195 200 205 30 Asn Val His His Ala Ala Thr Asn Val Val Gly Arg Asp Gly Asp Leu 210 215 220 Asp Leu Val Pro Phe Tyr Ala Thr Val Ala Glu His Leu Asn Asn Tyr 225 230 235 240 Ser Gln Asp Ser Trp Val Met Thr Leu Phe Arg Trp Gln His Val His 245 250 255 Trp Thr Phe Met Leu Pro Phe Leu Arg Leu Ser Trp Leu Leu Gln Ser 260 265 270 Ile Ile Phe Val Ser Gln Met Pro Thr His Tyr Tyr Asp Tyr Tyr Arg 275 280 285 Asn Thr Ala Ile Tyr Glu Gln Val Gly Leu Ser Leu His Trp Ala Trp 290 295 300 Ser Leu Gly Gln Leu Tyr Phe Leu Pro Asp Trp Ser Thr Arg Ile Met 305 310 315 320 Phe Phe Leu Val Ser His Leu Val Gly Gly Phe Leu Leu Ser His Val 325 330 335 Val Thr Phe Asn His Tyr Ser Val Glu Lys Phe Ala Leu Ser Ser Asn 340 345 350 Ile Met Ser Asn Tyr Ala Cys Leu Gln Ile Met Thr Thr Arg Asn Met 355 360 365 Arg Pro Gly Arg Phe Ile Asp Trp Leu Trp Gly Gly Leu Asn Tyr Gln 370 375 380 Ile Glu His His Leu Phe Pro Thr Met Pro Arg His Asn Leu Asn Thr 385 390 395 400 Val Met Pro Leu Val Lys Glu Phe Ala Ala Ala Asn Gly Leu Pro Tyr 405 410 415 Met Val Asp Asp Tyr Phe Thr Gly Phe Trp Leu Glu Ile Glu Gln Phe 420 425 430 Arg Asn Ile Ala Asn Val Ala Ala Light Leu Thr Light Light Ile Ala 435 440 445 <210> 17 <211> 1683 <212> DNA 31 <213> Borago officinalis <220> <221> CDS <222> (42)..(1388) <223> Δ6-desaturase <400> 17 tatctgccta ccctcccaaa gagagtagtc attttcatc a atg gct gct caa atc ​​56 Met Ala Ala Gln Ile 1 5 aag aaa tac att acc tca gat gaa ctc aag aac cac gat aaa ccc gga 104 Lys Lys Tyr Ile Thr Ser Asp Glu Leu Lys Asn His Asp Lys Pro Gly 10 15 20 gat cta tgg atc tcg att caa ggg aaa gcc tat gat gtt tcg gat tgg 152 Asp Leu Trp Ile Ser Ile Gln Gly Lys Ala Tyr Asp Val Ser Asp Trp 25 30 35 gtg aaa gac cat cca ggt ggc agc ttt ccc ttg aag agt ctt gct ggt 200 Val Lys Asp His Pro Gly Gly Ser Phe Pro Leu Lys Ser Leu Ala Gly 40 45 50 caa gag gta act gat gca ttt gtt gca ttc cat cct gcc tct aca tgg 248 Gln Glu Val Thr Asp Ala Phe Val Ala Phe His Pro Ala Ser Thr Trp 55 60 65 aag aat ctt gat aag ttt ttc act ggg tat tat ctt aaa gat tac tct 296 Lys Asn Leu Asp Lys Phe Phe Thr Gly Tyr Tyr Leu Lys Asp Tyr Ser 70 75 80 85 gtt tct gag gtt tct aaa gat tat agg aag ctt gtg ttt gag ttt tct 344 Val Ser Glu Val Ser Lys Asp Tyr Arg Lys Leu Val Phe Glu Phe Ser 90 95 100 aaa atg ggt ttg tat gac aaa aaa ggt cat att atg ttt gca act ttg 392 Lys Met Gly Leu Tyr Asp Lys Lys Gly His Ile Met Phe Ala Thr Leu 105 110 115 tgc ttt ata gca atg ctg ttt gct atg agt gtt tat ggg gtt ttg ttt 440 Cys Phe Ile Ala Met Leu Phe Ala Met Ser Val Tyr Gly Val Leu Phe 120 125 130 tgt gag ggt gtt ttg gta cat ttg ttt tct ggg tgt ttg atg ggg ttt 488 Cys Glu Gly Val Leu Val His Leu Phe Ser Gly Cys Leu Met Gly Phe 135 140 145 ctt tgg att cag agt ggt tgg att gga cat gat gct ggg cat tat atg 536 Leu Trp Ile Gln Ser Gly Trp Ile Gly His Asp Ala Gly His Tyr Met 150 155 160 165 gta gtg tct gat tca agg ctt aat aag ttt atg ggt att ttt gct gca 584 Val Val Ser Asp Ser Arg Leu Asn Lys Phe Met Gly Ile Phe Ala Ala 170 175 180 aat tgt ctt tca gga ata agt att ggt tgg tgg aaa tgg aac cat aat 632 Asn Cys Leu Ser Gly Ile Ser Ile Gly Trp Trp Lys Trp Asn His Asn 185 190 195 gca cat cac att gcc tgt aat agc ctt gaa tat gac cct gat tta caa 680 32 Ala His His Ile Ala Cys Asn Ser Leu Glu Tyr Asp Pro Asp Leu Gln 200 205 210 tat ata cca ttc ctt gtt gtg tct tcc aag ttt ttt ggt tca ctc acc 728 Tyr Ile Pro Phe Leu Val Val Ser Ser Lys Phe Phe Gly Ser Leu Thr 215 220 225 tct cat ttc tat gag aaa agg ttg act ttt gac tct tta tca aga ttc 776 Ser His Phe Tyr Glu Lys Arg Leu Thr Phe Asp Ser Leu Ser Arg Phe 230 235 240 245 ttt gta agt tat caa cat tgg aca ttt tac cct att atg tgt gct gct 824 Phe Val Ser Tyr Gln His Trp Thr Phe Tyr Pro Ile Met Cys Ala Ala 250 255 260 agg ctc aat atg tat gta caa tct ctc ata atg ttg ttg acc aag aga 872 Arg Leu Asn Met Tyr Val Gln Ser Leu Ile Met Leu Leu Thr Lys Arg 265 270 275 aat gtg tcc tat cga gct cag gaa ctc ttg gga tgc cta gtg ttc tcg 920 Asn Val Ser Tyr Arg Ala Gln Glu Leu Leu Gly Cys Leu Val Phe Ser 280 285 290 att tgg tac ccg ttg ctt gtt tct tgt ttg cct aat tgg ggt gaa aga 968 Ile Trp Tyr Pro Leu Leu Val Ser Cys Leu Pro Asn Trp Gly Glu Arg 295 300 305 att atg ttt gtt att gca agt tta tca gtg act gga atg caa caa gtt 1016 Ile Met Phe Val Ile Ala Ser Leu Ser Val Thr Gly Met Gln Gln Val 310 315 320 325 cag ttc tcc ttg aac cac ttc tct tca agt gtt tat gtt gga aag cct 1064 Gln Phe Ser Leu Asn His Phe Ser Ser Ser Val Tyr Val Gly Lys Pro 330 335 340 aaa ggg aat aat tgg ttt gag aaa caa acg gat ggg aca ctt gac att 1112 Lys Gly Asn Asn Trp Phe Glu Lys Gln Thr Asp Gly Thr Leu Asp Ile 345 350 355 tct tgt cct cct tgg atg gat tgg ttt cat ggt gga ttg caa ttc caa 1160 Ser Cys Pro Pro Trp Met Asp Trp Phe His Gly Gly Leu Gln Phe Gln 360 365 370 att gag cat cat ttg ttt ccc aag atg cct aga tgc aac ctt agg aaa 1208 Ile Glu His His Leu Phe Pro Lys Met Pro Arg Cys Asn Leu Arg Lys 375 380 385 atc tcg ccc tac gtg atc gag tta tgc aag aaa cat aat ttg cct tac 1256 Ile Ser Pro Tyr Val Ile Glu Leu Cys Lys Lys His Asn Leu Pro Tyr 390 395 400 405 aat tat gca tct ttc tcc aag gcc aat gaa atg aca ctc aga aca ttg 1304 Asn Tyr Ala Ser Phe Ser Lys Ala Asn Glu Met Thr Leu Arg Thr Leu 410 415 420 agg aac aca gca ttg cag gct agg gat ata acc aag ccg ctc ccg aag 1352 Arg Asn Thr Ala Leu Gln Ala Arg Asp Ile Thr Lys Pro Leu Pro Lys 425 430 435 aat ttg gta tgg gaa gct ctt cac act cat ggt taa aattaccctt 1398 Asn Leu Val Trp Glu Ala Leu His Thr His Gly 440 445 agttcatgta ataatttgag attatgtatc tcctatgttt gtgtcttgtc ttggttctac 1458 ttgttggagt cattgcaact tgtcttttat ggttattag atgtttttta atatatttta 1518 gaggttttgc tttcatctcc attattgatg aataaggagt tgcatattgt caattgttgt 1578 33 gctcaatatc tgatattttg gaatgtactt tgtaccactg tgttttcagt tgaagctcat 1638 gtgtacttct atagactttg tttaaatggt tatgtcatgt tattt 1683 <210> 18 <211> 448 <212> PRT <213> Borago officinalis <400> 18 Met Ala Ala Gln Ile Lys Lys Tyr Ile Thr Ser Asp Glu Leu Lys Asn 1 5 10 15 His Asp Lys Pro Gly Asp Leu Trp Ile Ser Ile Gln Gly Lys Ala Tyr 20 25 30 Asp Val Ser Asp Trp Val Lys Asp His Pro Gly Gly Ser Phe Pro Leu 35 40 45 Lys Ser Leu Ala Gly Gln Glu Val Thr Asp Ala Phe Val Ala Phe His 50 55 60 Pro Ala Ser Thr Trp Lys Asn Leu Asp Lys Phe Phe Thr Gly Tyr Tyr 65 70 75 80 Leu Lys Asp Tyr Ser Val Ser Glu Val Ser Lys Asp Tyr Arg Lys Leu 85 90 95 Val Phe Glu Phe Ser Lys Met Gly Leu Tyr Asp Lys Lys Gly His Ile 100 105 110 Met Phe Ala Thr Leu Cys Phe Ile Ala Met Leu Phe Ala Met Ser Val 115 120 125 Tyr Gly Val Leu Phe Cys Glu Gly Val Leu Val His Leu Phe Ser Gly 130 135 140 Cys Leu Met Gly Phe Leu Trp Ile Gln Ser Gly Trp Ile Gly His Asp 145 150 155 160 Ala Gly His Tyr Met Val Val Ser Asp Ser Arg Leu Asn Lys Phe Met 165 170 175 Gly Ile Phe Ala Ala Asn Cys Leu Ser Gly Ile Ser Ile Gly Trp Trp 180 185 190 Lys Trp Asn His Asn Ala His His Ile Ala Cys Asn Ser Leu Glu Tyr 195 200 205 34 Asp Pro Asp Leu Gln Tyr Ile Pro Phe Leu Val Val Ser Ser Lys Phe 210 215 220 Phe Gly Ser Leu Thr Ser His Phe Tyr Glu Lys Arg Leu Thr Phe Asp 225 230 235 240 Ser Leu Ser Arg Phe Phe Val Ser Tyr Gln His Trp Thr Phe Tyr Pro 245 250 255 Ile Met Cys Ala Ala Arg Leu Asn Met Tyr Val Gln Ser Leu Ile Met 260 265 270 Leu Leu Thr Lys Arg Asn Val Ser Tyr Arg Ala Gln Glu Leu Leu Gly 275 280 285 Cys Leu Val Phe Ser Ile Trp Tyr Pro Leu Leu Val Ser Cys Leu Pro 290 295 300 Asn Trp Gly Glu Arg Ile Met Phe Val Ile Ala Ser Leu Ser Val Thr 305 310 315 320 Gly Met Gln Gln Val Gln Phe Ser Leu Asn His Phe Ser Ser Ser Val 325 330 335 Tyr Val Gly Lys Pro Lys Gly Asn Asn Trp Phe Glu Lys Gln Thr Asp 340 345 350 Gly Thr Leu Asp Ile Ser Cys Pro Pro Trp Met Asp Trp Phe His Gly 355 360 365 Gly Leu Gln Phe Gln Ile Glu His His Leu Phe Pro Lys Met Pro Arg 370 375 380 Cys Asn Leu Arg Lys Ile Ser Pro Tyr Val Ile Glu Leu Cys Lys Lys 385 390 395 400 His Asn Leu Pro Tyr Asn Tyr Ala Ser Phe Ser Lys Ala Asn Glu Met 405 410 415 Thr Leu Arg Thr Leu Arg Asn Thr Ala Leu Gln Ala Arg Asp Ile Thr 420 425 430 Lys Pro Leu Pro Lys Asn Leu Val Trp Glu Ala Leu His Thr His Gly 435 440 445 <210> 19 <211> 1563 <212> DNA 35 <213> Ceratodon purpureus <220> <221> CDS <222> (1)..(1563) <223> Δ6-desaturase <400> 19 atg gtg tcc cag ggc ggc ggt ctc tcg cag ggt tcc att gaa gaa aac 48 Met Val Ser Gln Gly Gly Gly Leu Ser Gln Gly Ser Ile Glu Glu Asn 1 5 10 15 att gac gtt gag cac ttg gca acg atg ccc ctc gtc agt gac ttc cta 96 Ile Asp Val Glu His Leu Ala Thr Met Pro Leu Val Ser Asp Phe Leu 20 25 30 aat gtc ctg gga acg act ttg ggc cag tgg agt ctt tcc act aca ttc 144 Asn Val Leu Gly Thr Thr Leu Gly Gln Trp Ser Leu Ser Thr Thr Phe 35 40 45 gct ttc aag agg ctc acg act aag aaa cac agt tcg gac atc tcg gtg 192 Ala Phe Lys Arg Leu Thr Thr Lys Lys His Ser Ser Asp Ile Ser Val 50 55 60 gag gca caa aaa gaa tcg gtt gcg cgg ggg cca gtt gag aat att tct 240 Glu Ala Gln Lys Glu Ser Val Ala Arg Gly Pro Val Glu Asn Ile Ser 65 70 75 80 caa tcg gtt gcg cag ccc atc agg cgg agg tgg gtg cag gat aaa aag 288 Gln Ser Val Ala Gln Pro Ile Arg Arg Arg Trp Val Gln Asp Lys Lys 85 90 95 ccg gtt act tac agc ctg aag gat gta gct tcg cac gat atg ccc cag 336 Pro Val Thr Tyr Ser Leu Lys Asp Val Ala Ser His Asp Met Pro Gln 100 105 110 gac tgc tgg att ata atc ​​aaa gag aag gtg tat gat gtg agc acc ttc 384 Asp Cys Trp Ile Ile Ile Lys Glu Lys Val Tyr Asp Val Ser Thr Phe 115 120 125 gct gag cag cac cct gga ggc acg gtt atc aac acc tac ttc gga cga 432 Ala Glu Gln His Pro Gly Gly Thr Val Ile Asn Thr Tyr Phe Gly Arg 130 135 140 gac gcc aca gat gtt ttc tct act ttc cac gca tcc acc tca tgg aag 480 Asp Ala Thr Asp Val Phe Ser Thr Phe His Ala Ser Thr Ser Trp Lys 145 150 155 160 att ctt cag aat ttc tac atc ggg aac ctt gtt agg gag gag ccg act 528 Ile Leu Gln Asn Phe Tyr Ile Gly Asn Leu Val Arg Glu Glu Pro Thr 165 170 175 ttg gag ctg ctg aag gag tac aga gag ttg aga gcc ctt ttc ttg aga 576 Leu Glu Leu Leu Lys Glu Tyr Arg Glu Leu Arg Ala Leu Phe Leu Arg 180 185 190 gaa cag ctt ttc aag agt tcc aaa tcc tac tac ctt ttc aag act ctc 624 Glu Gln Leu Phe Lys Ser Ser Lys Ser Tyr Tyr Leu Phe Lys Thr Leu 195 200 205 ata aat gtt tcc att gtt gcc aca agc att gcg ata atc ​​agt ctg tac 672 36IleAsnValSerIleValAlaThrSerIleAlaIleIleSerLeuTyr 210 215 220 aagtcttaccgggcggttctgttatcagccagtttgatgggcttgttt 720LysSerTyrArgAlaValLeuLeuSerAlaSerLeuMetGlyLeuPhe 225 230 235 240 attcaacagtgcggatggttgtctcacgattttctacaccatcaggta 768IleGlnGlnCysGlyTrpLeuSerHisAspPheLeuHisHisGlnVal 245 250 255 tttgagacacgctggctcaatgacgttgttggctatgtggtcggcaac 816PheGluThrArgTrpLeuAsnAspValValGlyTyrValValGlyAsn 260 265 270 gttgttctgggattcagtgtctcgtggtggaagaccaagcacaacctg 864ValValLeuGlyPheSerValSerTrpTrpLysThrLysHisAsnLeu 275 280 285 catcatgctgctccgaatgaatgcgaccaaaagtacacaccgattgat 912HisHisAlaAlaProAsnGluCysAspGlnLysTyrThrProIleAsp 290 295 300 gaggatattgatactctccccatcattgcttggagtaaagatctcttg 960GluAspIleAspThrLeuProIleIleAlaTrpSerLysAspLeuLeu 305 310 315 320 gccactgttgagagcaagaccatgttgcgagttcttcagtaccagcac 1008AlaThrValGluSerLysThrMetLeuArgValLeuGlnTyrGlnHis 325 330 335 ctattctttttggttcttttgacgtttgcccgggcgagttggctattt 1056LeuPhePheLeuValLeuLeuThrPheAlaArgAlaSerTrpLeuPhe 340 345 350 tggagcgcggccttcactctcag gcccgagttgacccttggcgagaag 1104TrpSerAlaAlaPheThrLeuArgProGluLeuThrLeuGlyGluLys 355 360 365 cttttggagaggggaacgatggctttgcactacatttggtttaatagt 1152LeuLeuGluArgGlyThrMetAlaLeuHisTyrIleTrpPheAsnSer 370 375 380 gttgcgttttatctgctccccggatggaaaccagttgtatggatggtg 1200ValAlaPheTyrLeuLeuProGlyTrpLysProValValTrpMetVal 385 390 395 400 gtcagcgagctcatgtctggtttcctgctgggatacgtatttgtactc 1248ValSerGluLeuMetSerGlyPheLeuLeuGlyTyrValPheValLeu 405 410 415 agtcacaatggaatggaggtgtacaatacgtcaaaggacttcgtgaat 1296SerHisAsnGlyMetGluValTyrAsnThrSerLysAspPheValAsn 420 425 430 gcccagattgcatcgactcgcgacatcaaagcaggggtgtttaatgat 1344AlaGlnIleAlaSerThrArgAspIleLysAlaGlyValPheAsnAsp 435 440 445 tggttcaccggaggtctcaacagacagattgagcatcatctatttcca 1392TrpPheThrGlyGlyLeuAsnArgGlnIleGluHisHisLeuPhePro 450 455 460 acgatgcccaggcacaaccttaataaaatttctcctcacgtggagact 1440ThrMetProArgHisAsnLeuAsnLysIleSerProHisValGluThr 465 470 475 480 ttgtgcaagaagcatggactggtctacgaagacgtgagcatggcttcg 1488 37 Leu Cys Lys Lys His Gly Leu Val Tyr Glu Asp Val Ser Met Ala Ser 485 490 495 ggc act tac cgg gtt ttg aaa aca ctt aag gac gtt gcc gat gct gct 1536 Gly Thr Tyr Arg Val Leu Lys Thr Leu Lys Asp Val Ala Asp Ala Ala 500 505 510 tca cac cag cag ctt gct gcg agt tga 1563 Ser His Gln Gln Leu Ala Ala Ser 515 520 <210> 20 <211> 520 <212> PRT <213> Ceratodon purpureus <400> 20 Met Val Ser Gln Gly Gly Gly Leu Ser Gln Gly Ser Ile Glu Glu Asn 1 5 10 15 Ile Asp Val Glu His Leu Ala Thr Met Pro Leu Val Ser Asp Phe Leu 20 25 30 Asn Val Leu Gly Thr Thr Leu Gly Gln Trp Ser Leu Ser Thr Thr Phe 35 40 45 Ala Phe Lys Arg Leu Thr Thr Lys Lys His Ser Ser Asp Ile Ser Val 50 55 60 Glu Ala Gln Lys Glu Ser Val Ala Arg Gly Pro Val Glu Asn Ile Ser 65 70 75 80 Gln Ser Val Ala Gln Pro Ile Arg Arg Arg Trp Val Gln Asp Lys Lys 85 90 95 Pro Val Thr Tyr Ser Leu Lys Asp Val Ala Ser His Asp Met Pro Gln 100 105 110 Asp Cys Trp Ile Ile Ile Lys Glu Lys Val Tyr Asp Val Ser Thr Phe 115 120 125 Ala Glu Gln His Pro Gly Gly Thr Val Ile Asn Thr Tyr Phe Gly Arg 130 135 140 Asp Ala Thr Asp Val Phe Ser Thr Phe His Ala Ser Thr Ser Trp Lys 145 150 155 160 Ile Leu Gln Asn Phe Tyr Ile Gly Asn Leu Val Arg Glu Glu Pro Thr 165 170 175 38LeuGluLeuLeuLysGluTyrArgGluLeuArgAlaLeuPheLeuArg 180 185 190 GluGlnLeuPheLysSerSerLysSerTyrTyrLeuPheLysThrLeu 195 200 205 IleAsnValSerIleValAlaThrSerIleAlaIleIleSerLeuTyr 210 215 220 LysSerTyrArgAlaValLeuLeuSerAlaSerLeuMetGlyLeuPhe 225 230 235 240 IleGlnGlnCysGlyTrpLeuSerHisAspPheLeuHisHisGlnVal 245 250 255 PheGluThrArgTrpLeuAsnAspValValGlyTyrValValGlyAsn 260 265 270 ValValLeuGlyPheSerValSerTrpTrpLysThrLysHisAsnLeu 275 280 285 HisHisAlaAlaProAsnGluCysAspGlnLysTyrThrProIleAsp 290 295 300 GluAspIleAspThrLeuProIleIleAlaTrpSerLysAspLeuLeu 305 310 315 320 AlaThrValGluSerLysThrMetLeuArgValLeuGlnTyrGlnHis 325 330 335 LeuPhePheLeuValLeuLeuThrPheAlaArgAlaSerTrpLeuPhe 340 345 350 TrpSerAlaAlaPheThrLeuArgProGluLeuThrLeuGlyGluLys 355 360 365 LeuleUlluarg glythr -metalaleuhistyriletrppheasns 370 375 380 Valalaphetyrloglytroglytralvalvaltraltrevaltrval 385 390 395 400 Valsolgluleumswallsgloleglypaltolyglypalywalksvalleu 415 410 410 410 410 410 410 410 410 410 410 410 410 410 410 LaserThrArgAspIleLysAlaGlyValPheAsnAsp 435 440 445 39TrpPheThrGlyGlyLeuAsnArgGlnIleGluHisHisLeuPhePro 450 455 460 ThrMetProArgHisAsnLeuAsnLysIleSerProHisValGluThr 465 470 475 480 LeuCysLysLysHisGlyLeuValTyrGluAspValSerMetAlaSer 485 490 495 GlyThrTyrArgValLeuLysThrLeuLysAspValAlaAspAlaAla 500 505 510 SerHisGlnGlnLeuAlaAlaSer 515 520 <210> 21<211> 1434<212> DNA<213> Phaeodactylumtricornutum<220><221> CDS<222> (1). .(1434)<223> Δ6-desaturase<400> 21atgggcaaaggaggggacgctcgggcctcgaagggctcaacggcggct 48MetGlyLysGlyGlyAspAlaArgAlaSerLysGlySerThrAlaAla 1 5 10 15 cgcaagatcagttggcaggaagtcaagacccacgcgtctccggaggac 96ArgLysIleSerTrpGlnGluValLysThrHisAlaSerProGluAsp 20 25 30 gcctggatcattcactccaataaggtctacgacgtgtccaactggcac 144AlaTrpIleIleHisSerAsnLysValTyrAspValSerAsnTrpHis 35 40 45 gaacatcccggaggcgccgtcattttcacgcacgccggtgacgacatg 192GluHisProGlyGlyAlaValIlePheThrHisAlaGlyAspAspMet 50 55 60 acggacattttcgctgcctttcacgcacccggatcgcagtcgctcatg 240ThrAspIlePheAlaAlaPheHisAlaProGlySerGlnSerLeuMet 65 70 75 80 aagaagttctacattggcgaattgctcccggaaaccaccggcaaggag 2 88LysLysPheTyrIleGlyGluLeuLeuProGluThrThrGlyLysGlu 85 90 95 ccgcagcaaatcgcctttgaaaagggctaccgcgatctgcgctccaaa 336ProGlnGlnIleAlaPheGluLysGlyTyrArgAspLeuArgSerLys 100 105 110 40 ctc atc atg atg ggc atg ttc aag tcc aac aag tgg ttc tac gtc tac 384 Leu Ile Met Met Gly Met Phe Lys Ser Asn Lys Trp Phe Tyr Val Tyr 115 120 125 aag tgc ctc agc aac atg gcc att tgg gcc gcc gcc tgt gct ctc gtc 432 Lys Cys Leu Ser Asn Met Ala Ile Trp Ala Ala Ala Cys Ala Leu Val 130 135 140 ttt tac tcg gac cgc ttc tgg gta cac ctg gcc agc gcc gtc atg ctg 480 Phe Tyr Ser Asp Arg Phe Trp Val His Leu Ala Ser Ala Val Met Leu 145 150 155 160 gga aca ttc ttt cag cag tcg gga tgg ttg gca cac gac ttt ctg cac 528 Gly Thr Phe Phe Gln Gln Ser Gly Trp Leu Ala His Asp Phe Leu His 165 170 175 cac cag gtc ttc acc aag cgc aag cac ggg gat ctc gga gga ctc ttt 576 His Gln Val Phe Thr Lys Arg Lys His Gly Asp Leu Gly Gly Leu Phe 180 185 190 tgg ggg aac ctc atg cag ggt tac tcc gta cag tgg tgg aaa aac aag 624 Trp Gly Asn Leu Met Gln Gly Tyr Ser Val Gln Trp Trp Lys Asn Lys 195 200 205 cac aac gga cac cac gcc gtc ccc aac ctc cac tgc tcc tcc gca gtc 672 His Asn Gly His His Ala Val Pro Asn Leu His Cys Ser Ser Ala Val 210 215 220 gcg caa gat ggg gac ccg gac atc gat acc atg ccc ctt ctc gcc tgg 720 Ala Gln Asp Gly Asp Pro Asp Ile Asp Thr Met Pro Leu Leu Ala Trp 225 230 235 240 tcc gtc cag caa gcc cag tct tac cgg gaa ctc caa gcc gac gga aag 768 Ser Val Gln Gln Ala Gln Ser Tyr Arg Glu Leu Gln Ala Asp Gly Lys 245 250 255 gat tcg ggt ttg gtc aag ttc atg atc cgt aac caa tcc tac ttt tac 816 Asp Ser Gly Leu Val Lys Phe Met Ile Arg Asn Gln Ser Tyr Phe Tyr 260 265 270 ttt ccc atc ttg ttg ctc gcc cgc ctg tcg tgg ttg aac gag tcc ttc 864 Phe Pro Ile Leu Leu Leu Ala Arg Leu Ser Trp Leu Asn Glu Ser Phe 275 280 285 aag tgc gcc ttt ggg ctt gga gct gcg tcg gag aac gct gct ctc gaa 912 Lys Cys Ala Phe Gly Leu Gly Ala Ala Ser Glu Asn Ala Ala Leu Glu 290 295 300 ctc aag gcc aag ggt ctt cag tac ccc ctt ttg gaa aag gct ggc atc 960 Leu Lys Ala Lys Gly Leu Gln Tyr Pro Leu Leu Glu Lys Ala Gly Ile 305 310 315 320 ctg ctg cac tac gct tgg atg ctt aca gtt tcg tcc ggc ttt gga cgc 1008 Leu Leu His Tyr Ala Trp Met Leu Thr Val Ser Ser Gly Phe Gly Arg 325 330 335 ttc tcg ttc gcg tac acc gca ttt tac ttt cta acc gcg acc gcg tcc 1056 Phe Ser Phe Ala Tyr Thr Ala Phe Tyr Phe Leu Thr Ala Thr Ala Ser 340 345 350 tgt gga ttc ttg ctc gcc att gtc ttt ggc ctc ggc cac aac ggc atg 1104 Cys Gly Phe Leu Leu Ala Ile Val Phe Gly Leu Gly His Asn Gly Met 355 360 365 gcc acc tac aat gcc gac gcc cgt ccg gac ttc tgg aag ctc caa gtc 1152 Ala Thr Tyr Asn Ala Asp Ala Arg Pro Asp Phe Trp Lys Leu Gln Val 370 375 380 41 acc acg act cgc aac gtc acg ggc gga cac ggt ttc ccc caa gcc ttt 1200 Thr Thr Thr Arg Asn Val Thr Gly Gly His Gly Phe Pro Gln Ala Phe 385 390 395 400 gtc gac tgg ttc tgt ggt ggc ctc cag tac caa gtc gac cac cac tta 1248 n Tyr Gln Val Asp His His Leu Val Asp Trp Phe Cys Gly Gly Leu Gl 405 410 415 ttc ccc agc ctg ccc cga cac aat ctg gcc aag aca cac gca ctg gtc 1296 Phe Pro Ser Leu Pro Arg His Asn Leu Ala Lys Thr His Ala Leu Val 420 425 430 gaa tcg ttc tgc aag gag tgg ggt gtc cag tac cac gaa gcc gac ctt 1344 Glu Ser Phe Cys Lys Glu Trp Gly Val Gln Tyr His Glu Ala Asp Leu 435 440 445 gtg gac ggg acc atg gaa gtc ttg cac cat ttg ggc agc gtg gcc ggc 1392 Val Asp Gly Thr Met Glu Val Leu His His Leu Gly Ser Val Ala Gly 450 455 460 gaa ttc gtc gtg gat ttt gta cgc gat gga ccc gcc atg taa 1434 Glu Phe Val Val Asp Phe Val Arg Asp Gly Pro Ala Met 465 470 475 <210> 22 <211> 477 <212> PRT <213> Phaeodactylum tricornutum <400> 22 Met Gly Lys Gly Gly Asp Ala Arg Ala Ser Lys Gly Ser Thr Ala Ala 1 5 10 15 Arg Lys Ile Ser Trp Gln Glu Val Lys Thr His Ala Ser Pro Glu Asp 20 25 30 Ala Trp Ile Ile His Ser Asn Lys Val Tyr Asp Val Ser Asn Trp His 35 40 45 Glu His Pro Gly Gly Ala Val Ile Phe Thr His Ala Gly Asp Asp Met 50 55 60 Thr Asp Ile Phe Ala Ala Phe His Ala Pro Gly Ser Gln Ser Leu Met 65 70 75 80 Lys Lys Phe Tyr Ile Gly Glu Leu Leu Pro Glu Thr Thr Gly Lys Glu 85 90 95 Pro Gln Gln Ile Ala Phe Glu Lys Gly Tyr Arg Asp Leu Arg Ser Lys 100 105 110 Leu Ile Met Met Gly Met Phe Lys Ser Asn Lys Trp Phe Tyr Val Tyr 115 120 125 42LysCysLeuSerAsnMetAlaIleTrpAlaAlaAlaCysAlaLeuVal 130 135 140 PheTyrSerAspArgPheTrpValHisLeuAlaSerAlaValMetLeu 145 150 155 160 GlyThrPhePheGlnGlnSerGlyTrpLeuAlaHisAspPheLeuHis 165 170 175 HisGlnValPheThrLysArgLysHisGlyAspLeuGlyGlyLeuPhe 180 185 190 TrpGlyAsnLeuMetGlnGlyTyrSerValGlnTrpTrpLysAsnLys 195 200 205 HisAsnGlyHisHisAlaValProAsnLeuHisCysSerSerAlaVal 210 215 220 AlaGlnAspGlyAspProAspIleAspThrMetProLeuLeuAlaTrp 225 230 235 240 SerValGlnGlnAlaGlnSerTyrArgGluLeuGlnAlaAspGlyLys 245 250 255 AspSerGlyLeuValLysPheMetIleArgAsnGlnSerTyrPheTyr 260 265 270 PheProIleLeuLeuLeuAlaArgLeuSerTrpLeuAsnGluSerPhe 275 280 285 LysCysAlaPheGlyLeuGlyAlaAlaSerGluAsnAlaAlaLeuGlu 290 295 300 LeuLysAlaLysGlyLeuGlnTyrProLeuLeuGluLysAlaGlyIle 305 310 315 320 LeuLeuHisTyrAlaTrpMetLeuThrValSerSerGlyPheGlyArg 325 330 335 PheSerPheAlaTyrThrAlaPheTyrPheLeuThrAlaThrAlaSer 340 345 350 CysGlyPheLeuLeuAlaIleValPheGlyLeuGlyHisAsnGlyMet 355 360 365 AlaThrTyrAsnAlaAspAlaArgProAspPheTrpLysLeuGlnVal 370 375 380 ThrThrThrA rgAsnValThrGlyGlyHisGlyPheProGlnAlaPhe 385 390 395 400 43 Val Asp Trp Phe Cys Gly Gly Leu Gln Tyr Gln Val Asp His His Leu 405 410 415 Phe Pro Ser Leu Pro Arg His Asn Leu Ala Lys Thr His Ala Leu Val 420 425 430 Glu Ser Phe Cys Lys Glu Trp Gly Val Gln Tyr His Glu Ala Asp Leu 435 440 445 Val Asp Gly Thr Met Glu Val Leu His His Leu Gly Ser Val Ala Gly 450 455 460 Glu Phe Val Val Asp Phe Val Arg Asp Gly Pro Ala Met 465 470 475 <210> 23 <211> 1578 <212> DNA <213> Physcomitrella patens <220> <221> CDS <222> (1)..(1578) <223> Δ6-desaturase <400> 23 atg gta ttc gcg ggc ggt gga ctt cag cag ggc tct ctc gaa gaa aac 48 Met Val Phe Ala Gly Gly Gly Gly Leu Gln Gln Gly Ser Leu Glu Glu Asn 1 5 10 15 atc gac gtc gag cac att gcc agt atg tct ctc ttc agc gac ttc ttc 96 Ile Asp Val Glu His Ile Ala Ser Met Ser Leu Phe Ser Asp Phe Phe 20 25 30 agt tat gtg tct tca act gtt ggt tcg tgg agc gta cac agt ata caa 144 Ser Tyr Val Ser Ser Thr Val Gly Ser Trp Ser Val His Ser Ile Gln 35 40 45 cct ttg aag cgc ctg acg agt aag aag cgt gtt tcg gaa agc gct gcc 192 Pro Leu Lys Arg Leu Thr Ser Lys Lys Arg Val Ser Glu Ser Ala Ala 50 55 60 gtg caa tgt ata tca gct gaa gtt cag aga aat tcg agt acc cag gga 240 Val Gln Cys Ile Ser Ala Glu Val Gln Arg Asn Ser Ser Thr Gln Gly 65 70 75 80 act gcg gag gca ctc gca gaa tca gtc gtg aag ccc acg aga cga agg 288 Thr Ala Glu Ala Leu Ala Glu Ser Val Val Lys Pro Thr Arg Arg Arg 85 90 95 tca tct cag tgg aag aag tcg aca cac ccc cta tca gaa gta gca gta 336 44SerSerGlnTrpLysLysSerThrHisProLeuSerGluValAlaVal 100 105 110 cacaacaagccaagcgattgctggattgttgtaaaaaacaaggtgtat 384HisAsnLysProSerAspCysTrpIleValValLysAsnLysValTyr 115 120 125 gatgtttccaattttgcggacgagcatcccggaggatcagttattagt 432AspValSerAsnPheAlaAspGluHisProGlyGlySerValIleSer 130 135 140 acttattttggacgagacggcacagatgttttctctagttttcatgca 480ThrTyrPheGlyArgAspGlyThrAspValPheSerSerPheHisAla 145 150 155 160 gcttctacatggaaaattcttcaagacttttacattggtgacgtggag 528AlaSerThrTrpLysIleLeuGlnAspPheTyrIleGlyAspValGlu 165 170 175 agggtggagccgactccagagctgctgaaagatttccgagaaatgaga 576ArgValGluProThrProGluLeuLeuLysAspPheArgGluMetArg 180 185 190 gctcttttcctgagggagcaacttttcaaaagttcgaaattgtactat 624AlaLeuPheLeuArgGluGlnLeuPheLysSerSerLysLeuTyrTyr 195 200 205 gttatgaagctgctcacgaatgttgctatttttgctgcgagcattgca 672ValMetLysLeuLeuThrAsnValAlaIlePheAlaAlaSerIleAla 210 215 220 ataatatgttggagcaagactatttcagcggttttggcttcagcttgt 720IleIleCysTrpSerLysThrIleSerAlaValLeuAlaSerAlaCys 225 230 235 240 atgatggctctgtgtttccaacagt gcggatggctatcccatgatttt 768MetMetAlaLeuCysPheGlnGlnCysGlyTrpLeuSerHisAspPhe 245 250 255 ctccacaatcaggtgtttgagacacgctggcttaatgaagttgtcggg 816LeuHisAsnGlnValPheGluThrArgTrpLeuAsnGluValValGly 260 265 270 tatgtgatcggcaacgccgttctggggtttagtacagggtggtggaag 864TyrValIleGlyAsnAlaValLeuGlyPheSerThrGlyTrpTrpLys 275 280 285 gagaagcataaccttcatcatgctgctccaaatgaatgcgatcagact 912GluLysHisAsnLeuHisHisAlaAlaProAsnGluCysAspGlnThr 290 295 300 taccaaccaattgatgaagatattgatactctccccctcattgcctgg 960TyrGlnProIleAspGluAspIleAspThrLeuProLeuIleAlaTrp 305 310 315 320 agcaaggacatactggccacagttgagaataagacattcttgcgaatc 1008SerLysAspIleLeuAlaThrValGluAsnLysThrPheLeuArgIle 325 330 335 ctccaataccagcatctgttcttcatgggtctgttatttttcgcccgt 1056LeuGlnTyrGlnHisLeuPhePheMetGlyLeuLeuPhePheAlaArg 340 345 350 ggtagttggctcttttggagctggagatatacctctacagcagtgctc 1104GlySerTrpLeuPheTrpSerTrpArgTyrThrSerThrAlaValLeu 355 360 365 tcacctgtcgacaggttgttggagaagggaactgttctgtttcactac 1152 45 Ser Pro Val Asp Arg Leu Leu Glu Lys Gly Thr Val Leu Phe His Tyr 370 375 380 ttt tgg ttc gtc ggg aca gcg tgc tat ctt ctc cct ggt tgg aag cca 1200 Phe Trp Phe Val Gly Thr Ala Cys Tyr Leu Leu Pro Gly Trp Lys Pro 385 390 395 400 tta gta tgg atg gcg gtg act gag ctc atg tcc ggc atg ctg ctg ggc 1248 Leu Val Trp Met Ala Val Thr Glu Leu Met Ser Gly Met Leu Leu Gly 405 410 415 ttt gta ttt gta ctt agc cac aat ggg atg gag gtt tat aat tcg tct 1296 Phe Val Phe Val Leu Ser His Asn Gly Met Glu Val Tyr Asn Ser Ser 420 425 430 aaa gaa ttc gtg agt gca cag atc gta tcc aca cgg gat atc aaa gga 1344 Lys Glu Phe Val Ser Ala Gln Ile Val Ser Thr Arg Asp Ile Lys Gly 435 440 445 aac ata ttc aac gac tgg ttc act ggt ggc ctt aac agg caa ata gag 1392 Asn Ile Phe Asn Asp Trp Phe Thr Gly Gly Leu Asn Arg Gln Ile Glu 450 455 460 cat cat ctt ttc cca aca atg ccc agg cat aat tta aac aaa ata gca 1440 His His Leu Phe Pro Thr Met Pro Arg His Asn Leu Asn Lys Ile Ala 465 470 475 480 cct aga gtg gag gtg ttc tgt aag aaa cac ggt ctg gtg tac gaa gac 1488 Pro Arg Val Glu Val Phe Cys Lys Lys His Gly Leu Val Tyr Glu Asp 485 490 495 gta tct att gct acc ggc act tgc aag gtt ttg aaa gca ttg aag gaa 1536 Val Ser Ile Ala Thr Gly Thr Cys Lys Val Leu Lys Ala Leu Lys Glu 500 505 510 gtc gcg gag gct gcg gca gag cag cat gct acc acc agt taa 1578 Val Ala Glu Ala Ala Ala Glu Gln His Ala Thr Thr Ser 515 520 525 <210> 24 <211> 525 <212> PRT <213> Physcomitrella patens <400> 24 Met Val Phe Ala Gly Gly Gly Gly Leu Gln Gln Gly Ser Leu Glu Glu Asn 1 5 10 15 Ile Asp Val Glu His Ile Ala Ser Met Ser Leu Phe Ser Asp Phe Phe 20 25 30 Ser Tyr Val Ser Ser Thr Val Gly Ser Trp Ser Val His Ser Ile Gln 35 40 45 Pro Leu Lys Arg Leu Thr Ser Lys Lys Arg Val Ser Glu Ser Ala Ala 50 55 60 46 Val Gln Cys Ile Ser Ala Glu Val Gln Arg Asn Ser Ser Thr Gln Gly 65 70 75 80 Thr Ala Glu Ala Leu Ala Glu Ser Val Val Lys Pro Thr Arg Arg Arg 85 90 95 Ser Ser Gln Trp Lys Lys Ser Thr His Pro Leu Ser Glu Val Ala Val 100 105 110 His Asn Lys Pro Ser Asp Cys Trp Ile Val Val Lys Asn Lys Val Tyr 115 120 125 Asp Val Ser Asn Phe Ala Asp Glu His Pro Gly Gly Ser Val Ile Ser 130 135 140 Thr Tyr Phe Gly Arg Asp Gly Thr Asp Val Phe Ser Ser Phe His Ala 145 150 155 160 Ala Ser Thr Trp Lys Ile Leu Gln Asp Phe Tyr Ile Gly Asp Val Glu 165 170 175 Arg Val Glu Pro Thr Pro Glu Leu Leu Lys Asp Phe Arg Glu Met Arg 180 185 190 Ala Leu Phe Leu Arg Glu Gln Leu Phe Lys Ser Ser Lys Leu Tyr Tyr 195 200 205 Val Met Lys Leu Leu Thr Asn Val Ala Ile Phe Ala Ala Ser Ile Ala 210 215 220 Ile Ile Cys Trp Ser Lys Thr Ile Ser Ala Val Leu Ala Ser Ala Cys 225 230 235 240 Met Met Ala Leu Cys Phe Gln Gln Cys Gly Trp Leu Ser His Asp Phe 245 250 255 Leu His Asn Gln Val Phe Glu Thr Arg Trp Leu Asn Glu Val Val Gly 260 265 270 Tyr Val Ile Gly Asn Ala Val Leu Gly Phe Ser Thr Gly Trp Trp Lys 275 280 285 Glu Lys His Asn Leu His His Ala Ala Pro Asn Glu Cys Asp Gln Thr 290 295 300 Tyr Gln Pro Ile Asp Glu Asp Ile Asp Thr Leu Pro Leu Ile Ala Trp 305 310 315 320 Ser Lys Asp Ile Leu Ala Thr Val Glu Asn Lys Thr Phe Leu Arg Ile 325 330 335 47 Leu Gln Tyr Gln His Leu Phe Phe Met Gly Leu Leu Phe Phe Ala Arg 340 345 350 Gly Ser Trp Leu Phe Trp Ser Trp Arg Tyr Thr Ser Thr Ala Val Leu 355 360 365 Ser Pro Val Asp Arg Leu Leu Glu Lys Gly Thr Val Leu Phe His Tyr 370 375 380 Phe Trp Phe Val Gly Thr Ala Cys Tyr Leu Leu Pro Gly Trp Lys Pro 385 390 395 400 Leu Val Trp Met Ala Val Thr Glu Leu Met Ser Gly Met Leu Leu Gly 405 410 415 Phe Val Phe Val Leu Ser His Asn Gly Met Glu Val Tyr Asn Ser Ser 420 425 430 Lys Glu Phe Val Ser Ala Gln Ile Val Ser Thr Arg Asp Ile Lys Gly 435 440 445 Asn Ile Phe Asn Asp Trp Phe Thr Gly Gly Leu Asn Arg Gln Ile Glu 450 455 460 His His Leu Phe Pro Thr Met Pro Arg His Asn Leu Asn Lys Ile Ala 465 470 475 480 Pro Arg Val Glu Val Phe Cys Lys Lys His Gly Leu Val Tyr Glu Asp 485 490 495 Val Ser Ile Ala Thr Gly Thr Cys Lys Val Leu Lys Ala Leu Lys Glu 500 505 510 Val Ala Glu Ala Ala Ala Glu Gln His Ala Thr Thr Ser 515 520 525 <210> 25 <211> 1332 <212> DNA <213> Caenorhabditis elegans <220> <221> CDS <222> (1)..(1332) <223> Δ6-desaturase 48 <400> 25 atg gtc gtc gac aag aat gcc tcc ggg ctt cga atg aag gtc gat ggc 48 Met Val Val Asp Lys Asn Ala Ser Gly Leu Arg Met Lys Val Asp Gly 1 5 10 15 aaa tgg ctc tac ctt agc gag gaa ttg gtg aag aaa cat cca gga gga 96 Lys Trp Leu Tyr Leu Ser Glu Glu Leu Val Lys Lys His Pro Gly Gly 20 25 30 gct gtt att gaa caa tat aga aat tcg gat gct act cat att ttc cac 144 Ala Val Ile Glu Gln Tyr Arg Asn Ser Asp Ala Thr His Ile Phe His 35 40 45 gct ttc cac gaa gga tct tct cag gct tat aag caa ctt gac ctt ctg 192 Ala Phe His Glu Gly Ser Ser Gln Ala Tyr Lys Gln Leu Asp Leu Leu 50 55 60 aaa aag cac gga gag cac gat gaa ttc ctt gag aaa caa ttg gaa aag 240 Light Light His Gly Glu His Asp Glu Phe Leu Glu Light Gln Leu Glu Light 65 70 75 80 aga ctt gac aaa gtt gat atc aat gta tca gca tat gat gtc agt gtt 288 Arg Leu Asp Lys Val Asp Ile Asn Val Ser Ala Tyr Asp Val Ser Val 85 90 95 gca caa gaa aag aaa atg gtt gaa tca ttc gaa aaa cta cga cag aag 336 Ala Gln Glu Lys Lys Met Val Glu Ser Phe Glu Lys Leu Arg Gln Lys 100 105 110 ctt cat gat gat gga tta atg aaa gca aat gaa aca tat ttc ctg ttt 384 Leu His Asp Asp Gly Leu Met Lys Ala Asn Glu Thr Tyr Phe Leu Phe 115 120 125 aaa gcg att tca aca ctt tca att atg gca ttt gca ttt tat ctt cag 432 Lys Ala Ile Ser Thr Leu Ser Ile Met Ala Phe Ala Phe Tyr Leu Gln 130 135 140 tat ctt gga tgg tat att act tct gca tgt tta tta gca ctt gca tgg 480 Tyr Leu Gly Trp Tyr Ile Thr Ser Ala Cys Leu Leu Ala Leu Ala Trp 145 150 155 160 caa caa ttc gga tgg tta aca cat gag ttc tgc cat caa cag cca aca 528 Gln Gln Phe Gly Trp Leu Thr His Glu Phe Cys His Gln Gln Pro Thr 165 170 175 aag aac aga cct ttg aat gat act att tct ttg ttc ttt ggt aat ttc 576 Lys Asn Arg Pro Leu Asn Asp Thr Ile Ser Leu Phe Phe Gly Asn Phe 180 185 190 tta caa gga ttt tca aga gat tgg tgg aag gac aag cat aac act cat 624 Leu Gln Gly Phe Ser Arg Asp Trp Trp Lys Asp Lys His Asn Thr His 195 200 205 cac gct gcc aca aat gta att gat cat gac ggt gat atc gac ttg gca 672 His Ala Ala Thr Asn Val Ile Asp His Asp Gly Asp Ile Asp Leu Ala 210 215 220 cca ctt ttc gca ttt att cca gga gat ttg tgc aag tat aag gcc agc 720 Pro Leu Phe Ala Phe Ile Pro Gly Asp Leu Cys Lys Tyr Lys Ala Ser 225 230 235 240 ttt gaa aaa gca att ctc aag att gta cca tat caa cat ctc tat ttc 768 Phe Glu Lys Ala Ile Leu Lys Ile Val Pro Tyr Gln His Leu Tyr Phe 245 250 255 acc gca atg ctt cca atg ctc cgt ttc tca tgg act ggt cag tca gtt 816 Thr Ala Met Leu Pro Met Leu Arg Phe Ser Trp Thr Gly Gln Ser Val 260 265 270 49 caa tgg gta ttc aaa gag aat caa atg gag tac aag gtc tat caa aga 864 Gln Trp Val Phe Lys Glu Asn Gln Met Glu Tyr Lys Val Tyr Gln Arg 275 280 285 aat gca ttc tgg gag caa gca aca att gtt gga cat tgg gct tgg gta 912 Val Gly His Trp Ala Trp Val Asn Ala Phe Trp Glu Gln Ala Thr Ile 290 295 300 ttc tat caa ttg ttc tta tta cca aca tgg cca ctt cgg gtt gct tat 960 Phe Tyr Gln Leu Phe Leu Leu Pro Thr Trp Pro Leu Arg Val Ala Tyr 305 310 315 320 ttc att att tca caa atg gga gga ggc ctt ttg att gct cac gta gtc 1008 Phe Ile Ile Ser Gln Met Gly Gly Gly Leu Leu Ile Ala His Val Val 325 330 335 act ttc aac cat aac tct gtt gat aag tat cca gcc aat tct cga att 1056 Thr Phe Asn His Asn Ser Val Asp Lys Tyr Pro Ala Asn Ser Arg Ile 340 345 350 tta aac aac ttc gcc gct ctt caa att ttg acc aca cgc aac atg act 1104 Leu Asn Asn Phe Ala Ala Leu Gln Ile Leu Thr Thr Arg Asn Met Thr 355 360 365 cca tct cca ttc att gat tgg ctt tgg ggt gga ctc aat tat cag atc 1152 Pro Ser Pro Phe Ile Asp Trp Leu Trp Gly Gly Leu Asn Tyr Gln Ile 370 375 380 gag cac cac ttg ttc cca aca atg cca cgt tgc aat ctg aat gct tgc 1200 Glu His His Leu Phe Pro Thr Met Pro Arg Cys Asn Leu Asn Ala Cys 385 390 395 400 gtg aaa tat gtg aaa gaa tgg tgc aaa gag aat aat ctt cct tac ctc 1248 Val Lys Tyr Val Lys Glu Trp Cys Lys Glu Asn Asn Leu Pro Tyr Leu 405 410 415 gtc gat gac tac ttt gac gga tat gca atg aat ttg caa caa ttg aaa 1296 Val Asp Asp Tyr Phe Asp Gly Tyr Ala Met Asn Leu Gln Gln Leu Lys 420 425 430 aat atg gct gag cac att caa gct aaa gct gcc taa 1332 Asn Met Ala Glu His Ile Gln Ala Lys Ala Ala 435 440 <210> 26 <211> 443 <212> PRT <213> Caenorhabditis elegans <400> 26 Met Val Val Asp Lys Asn Ala Ser Gly Leu Arg Met Lys Val Asp Gly 1 5 10 15 Lys Trp Leu Tyr Leu Ser Glu Glu Leu Val Lys Lys His Pro Gly Gly 20 25 30 Ala Val Ile Glu Gln Tyr Arg Asn Ser Asp Ala Thr His Ile Phe His 35 40 45 50 Ala Phe His Glu Gly Ser Ser Gln Ala Tyr Lys Gln Leu Asp Leu Leu 50 55 60 Light Light His Gly Glu His Asp Glu Phe Leu Glu Light Gln Leu Glu Light 65 70 75 80 Arg Leu Asp Lys Val Asp Ile Asn Val Ser Ala Tyr Asp Val Ser Val 85 90 95 Ala Gln Glu Lys Lys Met Val Glu Ser Phe Glu Lys Leu Arg Gln Lys 100 105 110 Leu His Asp Asp Gly Leu Met Lys Ala Asn Glu Thr Tyr Phe Leu Phe 115 120 125 Lys Ala Ile Ser Thr Leu Ser Ile Met Ala Phe Ala Phe Tyr Leu Gln 130 135 140 Tyr Leu Gly Trp Tyr Ile Thr Ser Ala Cys Leu Leu Ala Leu Ala Trp 145 150 155 160 Gln Gln Phe Gly Trp Leu Thr His Glu Phe Cys His Gln Gln Pro Thr 165 170 175 Lys Asn Arg Pro Leu Asn Asp Thr Ile Ser Leu Phe Phe Gly Asn Phe 180 185 190 Leu Gln Gly Phe Ser Arg Asp Trp Trp Lys Asp Lys His Asn Thr His 195 200 205 His Ala Ala Thr Asn Val Ile Asp His Asp Gly Asp Ile Asp Leu Ala 210 215 220 Pro Leu Phe Ala Phe Ile Pro Gly Asp Leu Cys Lys Tyr Lys Ala Ser 225 230 235 240 Phe Glu Lys Ala Ile Leu Lys Ile Val Pro Tyr Gln His Leu Tyr Phe 245 250 255 Thr Ala Met Leu Pro Met Leu Arg Phe Ser Trp Thr Gly Gln Ser Val 260 265 270 Gln Trp Val Phe Lys Glu Asn Gln Met Glu Tyr Lys Val Tyr Gln Arg 275 280 285 Asn Ala Phe Trp Glu Gln Ala Thr Ile Val Gly His Trp Ala Trp Val 290 295 300 Phe Tyr Gln Leu Phe Leu Leu Pro Thr Trp Pro Leu Arg Val Ala Tyr 305 310 315 320 51 Phe Ile Ile Ser Gln Met Gly Gly Gly Leu Leu Ile Ala His Val Val 325 330 335 Thr Phe Asn His Asn Ser Val Asp Lys Tyr Pro Ala Asn Ser Arg Ile 340 345 350 Leu Asn Asn Phe Ala Ala Leu Gln Ile Leu Thr Thr Arg Asn Met Thr 355 360 365 Pro Ser Pro Phe Ile Asp Trp Leu Trp Gly Gly Leu Asn Tyr Gln Ile 370 375 380 Glu His His Leu Phe Pro Thr Met Pro Arg Cys Asn Leu Asn Ala Cys 385 390 395 400 Val Lys Tyr Val Lys Glu Trp Cys Lys Glu Asn Asn Leu Pro Tyr Leu 405 410 415 Val Asp Asp Tyr Phe Asp Gly Tyr Ala Met Asn Leu Gln Gln Leu Lys 420 425 430 Asn Met Ala Glu His Ile Gln Ala Lys Ala Ala 435 440 <210> 27 <211> 873 <212> DNA <213> Physcomitrella patens <220> <221> CDS <222> (1)..(873) <223> Δ6-elongase <400> 27 atg gag gtc gtg gag aga ttc tac ggt gag ttg gat ggg aag gtc tcg 48 Met Glu Val Val Glu Arg Phe Tyr Gly Glu Leu Asp Gly Lys Val Ser 1 5 10 15 cag ggc gtg aat gca ttg ctg ggt agt ttt ggg gtg gag ttg acg gat 96 Gln Gly Val Asn Ala Leu Leu Gly Ser Phe Gly Val Glu Leu Thr Asp 20 25 30 acg ccc act acc aaa ggc ttg ccc ctc gtt gac agt ccc aca ccc atc 144 Thr Pro Thr Thr Lys Gly Leu Pro Leu Val Asp Ser Pro Thr Pro Ile 35 40 45 gtc ctc ggt gtt tct gta tac ttg act att gtc att gga ggg ctt ttg 192 52 Val Leu Gly Val Ser Val Tyr Leu Thr Ile Val Ile Gly Gly Leu Leu 50 55 60 tgg ata aag gcc agg gat ctg aaa ccg cgc gcc tcg gag cca ttt ttg 240 Trp Ile Lys Ala Arg Asp Leu Lys Pro Arg Ala Ser Glu Pro Phe Leu 65 70 75 80 ctc caa gct ttg gtg ctt gtg cac aac ctg ttc tgt ttt gcg ctc agt 288 Leu Gln Ala Leu Val Leu Val His Asn Leu Phe Cys Phe Ala Leu Ser 85 90 95 ctg tat atg tgc gtg ggc atc gct tat cag gct att acc tgg cgg tac 336 Leu Tyr Met Cys Val Gly Ile Ala Tyr Gln Ala Ile Thr Trp Arg Tyr 100 105 110 tct ctc tgg ggc aat gca tac aat cct aaa cat aaa gag atg gcg att 384 Ser Leu Trp Gly Asn Ala Tyr Asn Pro Lys His Lys Glu Met Ala Ile 115 120 125 ctg gta tac ttg ttc tac atg tct aag tac gtg gaa ttc atg gat acc 432 Leu Val Tyr Leu Phe Tyr Met Ser Lys Tyr Val Glu Phe Met Asp Thr 130 135 140 gtt atc atg ata ctg aag cgc agc acc agg caa ata agc ttc ctc cac 480 Val Ile Met Ile Leu Lys Arg Ser Thr Arg Gln Ile Ser Phe Leu His 145 150 155 160 gtt tat cat cat tct tca att tcc ctc att tgg tgg gct att gct cat 528 Val Tyr His His Ser Ser Ile Ser Leu Ile Trp Trp Ala Ile Ala His 165 170 175 cac gct cct ggc ggt gaa gca tat tgg tct gcg gct ctg aac tca gga 576 His Ala Pro Gly Gly Glu Ala Tyr Trp Ser Ala Ala Leu Asn Ser Gly 180 185 190 gtg cat gtt ctc atg tat gcg tat tac ttc ttg gct gcc tgc ctt cga 624 Val His Val Leu Met Tyr Ala Tyr Tyr Phe Leu Ala Ala Cys Leu Arg 195 200 205 agt agc cca aag tta aaa aat aag tac ctt ttt tgg ggc agg tac ttg 672 Ser Ser Pro Lys Leu Lys Asn Lys Tyr Leu Phe Trp Gly Arg Tyr Leu 210 215 220 aca caa ttc caa atg ttc cag ttt atg ctg aac tta gtg cag gct tac 720 Thr Gln Phe Gln Met Phe Gln Phe Met Leu Asn Leu Val Gln Ala Tyr 225 230 235 240 tac gac atg aaa acg aat gcg cca tat cca caa tgg ctg atc aag att 768 Tyr Asp Met Lys Thr Asn Ala Pro Tyr Pro Gln Trp Leu Ile Lys Ile 245 250 255 ttg ttc tac tac atg atc tcg ttg ctg ttt ctt ttc ggc aat ttt tac 816 Leu Phe Tyr Tyr Met Ile Ser Leu Leu Phe Leu Phe Gly Asn Phe Tyr 260 265 270 gta caa aaa tac atc aaa ccc tct gac gga aag caa aag gga gct aaa 864 Val Gln Lys Tyr Ile Lys Pro Ser Asp Gly Lys Gln Lys Gly Ala Lys 275 280 285 act gag tga 873 Thr Glu 290 <210> 28 <211> 290 53 <212> PRT <213> Physcomitrella patens <400> 28 Met Glu Val Val Glu Arg Phe Tyr Gly Glu Leu Asp Gly Lys Val Ser 1 5 10 15 Gln Gly Val Asn Ala Leu Leu Gly Ser Phe Gly Val Glu Leu Thr Asp 20 25 30 Thr Pro Thr Thr Lys Gly Leu Pro Leu Val Asp Ser Pro Thr Pro Ile 35 40 45 Val Leu Gly Val Ser Val Tyr Leu Thr Ile Val Ile Gly Gly Leu Leu 50 55 60 Trp Ile Lys Ala Arg Asp Leu Lys Pro Arg Ala Ser Glu Pro Phe Leu 65 70 75 80 Leu Gln Ala Leu Val Leu Val His Asn Leu Phe Cys Phe Ala Leu Ser 85 90 95 Leu Tyr Met Cys Val Gly Ile Ala Tyr Gln Ala Ile Thr Trp Arg Tyr 100 105 110 Ser Leu Trp Gly Asn Ala Tyr Asn Pro Lys His Lys Glu Met Ala Ile 115 120 125 Leu Val Tyr Leu Phe Tyr Met Ser Lys Tyr Val Glu Phe Met Asp Thr 130 135 140 Val Ile Met Ile Leu Lys Arg Ser Thr Arg Gln Ile Ser Phe Leu His 145 150 155 160 Val Tyr His His Ser Ser Ile Ser Leu Ile Trp Trp Ala Ile Ala His 165 170 175 His Ala Pro Gly Gly Glu Ala Tyr Trp Ser Ala Ala Leu Asn Ser Gly 180 185 190 Val His Val Leu Met Tyr Ala Tyr Tyr Phe Leu Ala Ala Cys Leu Arg 195 200 205 Ser Ser Pro Lys Leu Lys Asn Lys Tyr Leu Phe Trp Gly Arg Tyr Leu 210 215 220 Thr Gln Phe Gln Met Phe Gln Phe Met Leu Asn Leu Val Gln Ala Tyr 225 230 235 240 54TyrAspMetLysThrAsnAlaProTyrProGlnTrpLeuIleLysIle 245 250 255 LeuPheTyrTyrMetIleSerLeuLeuPheLeuPheGlyAsnPheTyr 260 265 270 ValGlnLysTyrIleLysProSerAspGlyLysGlnLysGlyAlaLys 275 280 285 ThrGlu 290 <210> 29<211> 1049<212> DNA<213> Thraustochytrium<220><221> CDS<222> (43)..(858)<223 > Δ6-elongase<400> 29gaattcggcacgagagcgcgcggagcggagacctcggccgcgatgatggagccg 54 MetMetGluPro 1 ctcgacaggtacagggcgctggcggagctcgccgcgaggtacgccagc 102LeuAspArgTyrArgAlaLeuAlaGluLeuAlaAlaArgTyrAlaSer 5 10 15 20 tcggcggccttcaagtggcaagtcacgtacgacgccaaggacagcttc 150SerAlaAlaPheLysTrpGlnValThrTyrAspAlaLysAspSerPhe 25 30 35 gtcgggcccctgggaatccgggagccgctcgggctcctggtgggctcc 198ValGlyProLeuGlyIleArgGluProLeuGlyLeuLeuValGlySer 40 45 50 gtggtcctctacctgagcctgctggccgtggtctacgcgctgcggaac 246ValValLeuTyrLeuSerLeuLeuAlaValValTyrAlaLeuArgAsn 55 60 65 taccttggcggcctcatggcgctccgcagcgtgcataacctcgggctc 294TyrLeuGlyGlyLeuMetAlaLeuArgSerValHisAsnLeuGlyLeu 70 75 80 tgcctcttctcgggcgccgtgtggatctacacgagctacctcatgatc 342CysLeuPheSerGlyAlaValT rpIleTyrThrSerTyrLeuMetIle 85 90 95 100 caggatgggcactttcgcagcctcgaggcggcaacgtgcgagccgctc 390GlnAspGlyHisPheArgSerLeuGluAlaAlaThrCysGluProLeu 105 110 115 55 aag cat ccg cac ttc cag ctc atc agc ttg ctc ttt gcg ctg tcc aag 438 Lys His Pro His Phe Gln Leu Ile Ser Leu Leu Phe Ala Leu Ser Lys 120 125 130 atc tgg gag tgg ttc gac acg gtg ctc ctc atc gtc aag ggc aac aag 486 Ile Trp Glu Trp Phe Asp Thr Val Leu Leu Ile Val Lys Gly Asn Lys 135 140 145 ctc cgc ttc ctg cac gtc ttg cac cac gcc acg acc ttt tgg ctc tac 534 Leu Arg Phe Leu His Val Leu His His Ala Thr Thr Phe Trp Leu Tyr 150 155 160 gcc atc gac cac atc ttt ctc tcg tcc atc aag tac ggc gtc gcg gtc 582 Ala Ile Asp His Ile Phe Leu Ser Ser Ile Lys Tyr Gly Val Ala Val 165 170 175 180 aat gct ttc atc cac acc gtc atg tac gcg cac tac ttc cgc cca ttc 630 Asn Ala Phe Ile His Thr Val Met Tyr Ala His Tyr Phe Arg Pro Phe 185 190 195 ccg aag ggc ttg cgc ccg ctt att acg cag ttg cag atc gtc cag ttc 678 Pro Lys Gly Leu Arg Pro Leu Ile Thr Gln Leu Gln Ile Val Gln Phe 200 205 210 att ttc agc atc ggc atc cat acc gcc att tac tgg cac tac gac tgc 726 Ile Phe Ser Ile Gly Ile His Thr Ala Ile Tyr Trp His Tyr Asp Cys 215 220 225 gag ccg ctc gtg cat acc cac ttt tgg gaa tac gtc acg ccc tac ctt 774 Glu Pro Leu Val His Thr His Phe Trp Glu Tyr Val Thr Pro Tyr Leu 230 235 240 ttc gtc gtg ccc ttc ctc atc ctc ttt ttc aat ttt tac ctg cag cag 822 Phe Val Val Pro Phe Leu Ile Leu Phe Phe Asn Phe Tyr Leu Gln Gln 245 250 255 260 tac gtc ctc gcg ccc gca aaa acc aag aag gca tag ccacgtaaca 868 Tyr Val Leu Ala Pro Ala Light Thr Light Light Ala 265 270 gtagaccagc agcgccgagg acgcgtgccg cgttatcgcg aagcacgaaa taaagaagat 928 catttgattc aacgaggcta cttgcggcca cgagaaaaaa aaaaaaaaaa aaaaaaaaaa 988 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 1048 c 1049 <210> 30 <211> 271 <212> PRT <213> Thraustochytrium <400> 30 Met Met Glu Pro Leu Asp Arg Tyr Arg Ala Leu Ala Glu Leu Ala Ala 1 5 10 15 Arg Tyr Ala Ser Ser Ala Ala Phe Lys Trp Gln Val Thr Tyr Asp Ala 20 25 30 56 Lys Asp Ser Phe Val Gly Pro Leu Gly Ile Arg Glu Pro Leu Gly Leu 35 40 45 Leu Val Gly Ser Val Val Leu Tyr Leu Ser Leu Leu Ala Val Val Tyr 50 55 60 Ala Leu Arg Asn Tyr Leu Gly Gly Leu Met Ala Leu Arg Ser Val His 65 70 75 80 Asn Leu Gly Leu Cys Leu Phe Ser Gly Ala Val Trp Ile Tyr Thr Ser 85 90 95 Tyr Leu Met Ile Gln Asp Gly His Phe Arg Ser Leu Glu Ala Ala Thr 100 105 110 Cys Glu Pro Leu Lys His Pro His Phe Gln Leu Ile Ser Leu Leu Phe 115 120 125 Ala Leu Ser Lys Ile Trp Glu Trp Phe Asp Thr Val Leu Leu Ile Val 130 135 140 Lys Gly Asn Lys Leu Arg Phe Leu His Val Leu His His Ala Thr Thr 145 150 155 160 Phe Trp Leu Tyr Ala Ile Asp His Ile Phe Leu Ser Ser Ile Lys Tyr 165 170 175 Gly Val Ala Val Asn Ala Phe Ile His Thr Val Met Tyr Ala His Tyr 180 185 190 Phe Arg Pro Phe Pro Lys Gly Leu Arg Pro Leu Ile Thr Gln Leu Gln 195 200 205 Ile Val Gln Phe Ile Phe Ser Ile Gly Ile His Thr Ala Ile Tyr Trp 210 215 220 His Tyr Asp Cys Glu Pro Leu Val His Thr His Phe Trp Glu Tyr Val 225 230 235 240 Thr Pro Tyr Leu Phe Val Val Pro Phe Leu Ile Leu Phe Phe Asn Phe 245 250 255 Tyr Leu Gln Gln Tyr Val Leu Ala Pro Ala Lys Thr Lys Lys Ala 260 265 270 <210> 31 <211> 837 <212> DNA 57 <213> Phytophthora infestans <220> <221> CDS <222> (1)..(837) <223> Δ6-elongase <400> 31 atg tcg act gag cta ctg cag agc tac tac gcg tgg gcc aac gcc acg 48 Met Ser Thr Glu Leu Leu Gln Ser Tyr Tyr Ala Trp Ala Asn Ala Thr 1 5 10 15 gag gcc aag ctg ctg gac tgg gtc gac cct gag ggc ggc tgg aag gtg 96 Glu Ala Lys Leu Leu Asp Trp Val Asp Pro Glu Gly Gly Trp Lys Val 20 25 30 cat cct atg gca gac tac ccc cta gcc aac ttc tcc agc gtc tac gcc 144 His Pro Met Ala Asp Tyr Pro Leu Ala Asn Phe Ser Ser Val Tyr Ala 35 40 45 atc tgc gtc gga tac ttg ctc ttc gta atc ​​ttc ggc acg gcc ctg atg 192 Ile Cys Val Gly Tyr Leu Leu Phe Val Ile Phe Gly Thr Ala Leu Met 50 55 60 aaa atg gga gtc ccc gcc atc aag acc agt cca tta cag ttt gtg tac 240 Lys Met Gly Val Pro Ala Ile Lys Thr Ser Pro Leu Gln Phe Val Tyr 65 70 75 80 aac ccc atc caa gtc att gcc tgc tct tat atg tgc gtg gag gcc gcc 288 Asn Pro Ile Gln Val Ile Ala Cys Ser Tyr Met Cys Val Glu Ala Ala 85 90 95 atc cag gcc tac cgc aac ggc tac acc gcc gcc ccg tgc aac gcc ttt 336 Ile Gln Ala Tyr Arg Asn Gly Tyr Thr Ala Ala Pro Cys Asn Ala Phe 100 105 110 aag tcc gac gac ccc gtc atg ggc aac gtt ctg tac ctc ttc tat ctc 384 Lys Ser Asp Asp Pro Val Met Gly Asn Val Leu Tyr Leu Phe Tyr Leu 115 120 125 tcc aag atg ctc gac ctg tgc gac aca gtc ttc att atc cta gga aag 432 Ser Lys Met Leu Asp Leu Cys Asp Thr Val Phe Ile Ile Leu Gly Lys 130 135 140 aag tgg aaa cag ctt tcc atc ttg cac gtg tac cac cac ctt acc gtg 480 Lys Trp Lys Gln Leu Ser Ile Leu His Val Tyr His His Leu Thr Val 145 150 155 160 ctt ttc gtc tac tat gtg acg ttc cgc gcc gct cag gac ggg gac tca 528 Leu Phe Val Tyr Tyr Val Thr Phe Arg Ala Ala Gln Asp Gly Asp Ser 165 170 175 tat gct acc atc gtg ctc aac ggc ttc gtg cac acc atc atg tac act 576 Tyr Ala Thr Ile Val Leu Asn Gly Phe Val His Thr Ile Met Tyr Thr 180 185 190 tac tac ttc gtc agc gcc cac acg cgc aac att tgg tgg aag aag tac 624 Tyr Tyr Phe Val Ser Ala His Thr Arg Asn Ile Trp Trp Lys Lys Tyr 195 200 205 ctc acg cgc att cag ctt atc cag ttc gtg acc atg aac gtg cag ggc 672 58LeuThrArgIleGlnLeuIleGlnPheValThrMetAsnValGlnGly 210 215 220 tacctgacctactctcgacagtgcccaggcatgcctcctaaggtgccg 720TyrLeuThrTyrSerArgGlnCysProGlyMetProProLysValPro 225 230 235 240 ctcatgtaccttgtgtacgtgcagtcactcttctggctcttcatgaat 768LeuMetTyrLeuValTyrValGlnSerLeuPheTrpLeuPheMetAsn 245 250 255 ttctacattcgcgcgtacgtgttcggccccaagaaaccggccgtggag 816PheTyrIleArgAlaTyrValPheGlyProLysLysProAlaValGlu 260 265 270 gaatcgaagaagaagttgtaa 837GluSerLysLysLysLeu 275 <210> 32<211> 278<212> PRT<213> Phytophthorainfestans<400> 32MetSerThrGluLeuLeuGlnSerTyrTyrAlaTrpAlaAsnAlaThr 1 5 10 15 GluAlaLysLeuLeuAspTrpValAspProGluGlyGlyTrpLysVal 20 25 30 HisProMetAlaAspTyrProLeuAlaAsnPheSerSerValTyrAla 35 40 45 IleCysValGlyTyrLeuLeuPheValIlePheGlyThrAlaLeuMet 50 55 60 LysMetGlyValProAlaIleLysThrSerProLeuGlnPheValTyr 65 70 75 80 AsnProIleGlnValIleAlaCysSerTyrMetCysValGluAlaAla 85 90 95 IleGlnAlaTyrArgAsnGlyTyrThrAlaAlaProCysAsnAlaPhe 100 105 110 LysSerAspAspProValMetGlyAsnValLeuTyrLeuPheTyrLeu 115 120 125 SerLysMetLe uAspLeuCysAspThrValPheIleIleLeuGlyLys 130 135 140 59 Lys Trp Lys Gln Leu Ser Ile Leu His Val Tyr His His Leu Thr Val 145 150 155 160 Leu Phe Val Tyr Tyr Val Thr Phe Arg Ala Ala Gln Asp Gly Asp Ser 165 170 175 Tyr Ala Thr Ile Val Leu Asn Gly Phe Val His Thr Ile Met Tyr Thr 180 185 190 Tyr Tyr Phe Val Ser Ala His Thr Arg Asn Ile Trp Trp Lys Lys Tyr 195 200 205 Leu Thr Arg Ile Gln Leu Ile Gln Phe Val Thr Met Asn Val Gln Gly 210 215 220 Tyr Leu Thr Tyr Ser Arg Gln Cys Pro Gly Met Pro Pro Lys Val Pro 225 230 235 240 Leu Met Tyr Leu Val Tyr Val Gln Ser Leu Phe Trp Leu Phe Met Asn 245 250 255 Phe Tyr Ile Arg Ala Tyr Val Phe Gly Pro Lys Lys Pro Ala Val Glu 260 265 270 Glu Ser Light Light Light Leu 275 <210> 33 <211> 954 <212> DNA <213> Mortierella alpina <220> <221> CDS <222> (1)..(954) <223> Δ6-elongase <400> 33 atg gcc gcc gca atc ​​ttg gac aag gtc aac ttc ggc att gat cag ccc 48 Met Ala Ala Ala Ile Leu Asp Lys Val Asn Phe Gly Ile Asp Gln Pro 1 5 10 15 ttc gga atc ​​aag ctc gac acc tac ttt gct cag gcc tat gaa ctc gtc 96 Phe Gly Ile Lys Leu Asp Thr Tyr Phe Ala Gln Ala Tyr Glu Leu Val 20 25 30 acc gga aag tcc atc gac tcc ttc gtc ttc cag gag ggc gtc acg cct 144 Thr Gly Lys Ser Ile Asp Ser Phe Val Phe Gln Glu Gly Val Thr Pro 35 40 45 60 ctc tcg acc cag aga gag gtc gcc atg tgg act atc act tac ttc gtc 192 Leu Ser Thr Gln Arg Glu Val Ala Met Trp Thr Ile Thr Tyr Phe Val 50 55 60 gtc atc ttt ggt ggt cgc cag atc atg aag agc cag gac gcc ttc aag 240 Val Ile Phe Gly Gly Arg Gln Ile Met Lys Ser Gln Asp Ala Phe Lys 65 70 75 80 ctc aag ccc ctc ttc atc ctc cac aac ttc ctc ctg acg atc gcg tcc 288 Leu Lys Pro Leu Phe Ile Leu His Asn Phe Leu Leu Thr Ile Ala Ser 85 90 95 gga tcg ctg ttg ctc ctg ttc atc gag aac ctg gtc ccc atc ctc gcc 336 Gly Ser Leu Leu Leu Leu Phe Ile Glu Asn Leu Val Pro Ile Leu Ala 100 105 110 aga aac gga ctt ttc tac gcc atc tgc gac gac ggt gcc tgg acc cag 384 Arg Asn Gly Leu Phe Tyr Ala Ile Cys Asp Asp Gly Ala Trp Thr Gln 115 120 125 cgc ctc gag ctc ctc tac tac ctc aac tac ctg gtc aag tac tgg gag 432 Arg Leu Glu Leu Leu Tyr Tyr Leu Asn Tyr Leu Val Lys Tyr Trp Glu 130 135 140 ttg gcc gac acc gtc ttt ttg gtc ctc aag aag aag cct ctt gag ttc 480 Leu Ala Asp Thr Val Phe Leu Val Leu Light Light Light Pro Leu Glu Phe 145 150 155 160 ctg cac tac ttc cac cac tcg atg acc atg gtt ctc tgc ttt gtc cag 528 Leu His Tyr Phe His His Ser Met Thr Met Val Leu Cys Phe Val Gln 165 170 175 ctt gga gga tac act tca gtg tcc tgg gtc cct att acc ctc aac ttg 576 Leu Gly Gly Tyr Thr Ser Val Ser Trp Val Pro Ile Thr Leu Asn Leu 180 185 190 act gtc cac gtc ttc atg tac tac tac tac atg cgc tcc gct gcc ggt 624 Thr Val His Val Phe Met Tyr Tyr Tyr Tyr Met Arg Ser Ala Ala Gly 195 200 205 gtt cgc atc tgg tgg aag cag tac ttg acc act ctc cag atc gtc cag 672 Val Arg Ile Trp Trp Lys Gln Tyr Leu Thr Thr Leu Gln Ile Val Gln 210 215 220 ttc gtt ctt gac ctc gga ttc atc tac ttc tgc gcc tac acc tac ttc 720 Phe Val Leu Asp Leu Gly Phe Ile Tyr Phe Cys Ala Tyr Thr Tyr Phe 225 230 235 240 gcc ttc acc tac ttc ccc tgg gct ccc aac gtc ggc aag tgc gcc ggt 768 Ala Phe Thr Tyr Phe Pro Trp Ala Pro Asn Val Gly Lys Cys Ala Gly 245 250 255 acc gag ggt gct gct ctc ttt ggc tgc gga ctc ctc tcc agc tat ctc 816 Thr Glu Gly Ala Ala Leu Phe Gly Cys Gly Leu Leu Ser Ser Tyr Leu 260 265 270 ttg ctc ttt atc aac ttc tac cgc att acc tac aat gcc aag gcc aag 864 Leu Leu Phe Ile Asn Phe Tyr Arg Ile Thr Tyr Asn Ala Lys Ala Lys 275 280 285 gca gcc aag gag cgt gga agc aac ttt acc ccc aag act gtc aag tcc 912 Ala Ala Lys Glu Arg Gly Ser Asn Phe Thr Pro Lys Thr Val Lys Ser 290 295 300 ggc gga tcg ccc aag aag ccc tcc aag agc aag cac atc taa 954 Gly Gly Ser Pro Lys Lys Pro Ser Lys Ser Lys His Ile 305 310 315 61 <210> 34 <211> 317 <212> PRT <213> Mortierella alpina <400> 34 Met Ala Ala Ala Ile Leu Asp Lys Val Asn Phe Gly Ile Asp Gln Pro 1 5 10 15 Phe Gly Ile Lys Leu Asp Thr Tyr Phe Ala Gln Ala Tyr Glu Leu Val 20 25 30 Thr Gly Lys Ser Ile Asp Ser Phe Val Phe Gln Glu Gly Val Thr Pro 35 40 45 Leu Ser Thr Gln Arg Glu Val Ala Met Trp Thr Ile Thr Tyr Phe Val 50 55 60 Val Ile Phe Gly Gly Arg Gln Ile Met Lys Ser Gln Asp Ala Phe Lys 65 70 75 80 Leu Lys Pro Leu Phe Ile Leu His Asn Phe Leu Leu Thr Ile Ala Ser 85 90 95 Gly Ser Leu Leu Leu Leu Phe Ile Glu Asn Leu Val Pro Ile Leu Ala 100 105 110 Arg Asn Gly Leu Phe Tyr Ala Ile Cys Asp Asp Gly Ala Trp Thr Gln 115 120 125 Arg Leu Glu Leu Leu Tyr Tyr Leu Asn Tyr Leu Val Lys Tyr Trp Glu 130 135 140 Leu Ala Asp Thr Val Phe Leu Val Leu Light Light Light Pro Leu Glu Phe 145 150 155 160 Leu His Tyr Phe His His Ser Met Thr Met Val Leu Cys Phe Val Gln 165 170 175 Leu Gly Gly Tyr Thr Ser Val Ser Trp Val Pro Ile Thr Leu Asn Leu 180 185 190 Thr Val His Val Phe Met Tyr Tyr Tyr Tyr Met Arg Ser Ala Ala Gly 195 200 205 Val Arg Ile Trp Trp Lys Gln Tyr Leu Thr Thr Leu Gln Ile Val Gln 210 215 220 62PheValLeuAspLeuGlyPheIleTyrPheCysAlaTyrThrTyrPhe 225 230 235 240 AlaPheThrTyrPheProTrpAlaProAsnValGlyLysCysAlaGly 245 250 255 ThrGluGlyAlaAlaLeuPheGlyCysGlyLeuLeuSerSerTyrLeu 260 265 270 LeuLeuPheIleAsnPheTyrArgIleThrTyrAsnAlaLysAlaLys 275 280 285 AlaAlaLysGluArgGlySerAsnPheThrProLysThrValLysSer 290 295 300 GlyGlySerProLysLysProSerLysSerLysHisIle 305 310 315 <210> 35<211> 957<212> DNA<213> Mortierellaalpina<220><221> CDS<222 > (1)..(957)<223> Δ6-elongase<400> 35atggagtcgattgcgccattcctcccatcaaagatgccgcaagatctg 48MetGluSerIleAlaProPheLeuProSerLysMetProGlnAspLeu 1 5 10 15 tttatggaccttgccaccgctatcggtgtccgggccgcgccctatgtc 96PheMetAspLeuAlaThrAlaIleGlyValArgAlaAlaProTyrVal 20 25 30 gatcctctcgaggccgcgctggtggcccaggccgagaagtacatcccc 144AspProLeuGluAlaAlaLeuValAlaGlnAlaGluLysTyrIlePro 35 40 45 acgattgtccatcacacgcgtgggttcctggtcgcggtggagtcgcct 192ThrIleValHisHisThrArgGlyPheLeuValAlaValGluSerPro 50 55 60 ttggcccgtgagctgccgttgatgaacccgttccacgtgctgttgatc 240LeuAlaArgGluLeuProLeuMetAsnProPheHisValLeu LeuIle 65 70 75 80 gtgctcgcttatttggtcacggtctttgtgggcatgcagatcatgaag 288 63 Val Leu Ala Tyr Leu Val Thr Val Phe Val Gly Met Gln Ile Met Lys 85 90 95 aac ttt gag cgg ttc gag gtc aag acg ttt tcg ctc ctg cac aac ttt 336 Asn Phe Glu Arg Phe Glu Val Lys Thr Phe Ser Leu Leu His Asn Phe 100 105 110 tgt ctg gtc tcg atc agc gcc tac atg tgc ggt ggg atc ctg tac gag 384 Cys Leu Val Ser Ile Ser Ala Tyr Met Cys Gly Gly Ile Leu Tyr Glu 115 120 125 gct tat cag gcc aac tat gga ctg ttt gag aac gct gct gat cat acc 432 Ala Tyr Gln Ala Asn Tyr Gly Leu Phe Glu Asn Ala Ala Asp His Thr 130 135 140 ttc aag ggt ctt cct atg gcc aag atg atc tgg ctc ttc tac ttc tcc 480 Phe Lys Gly Leu Pro Met Ala Lys Met Ile Trp Leu Phe Tyr Phe Ser 145 150 155 160 aag atc atg gag ttt gtc gac acc atg atc atg gtc ctc aag aag aac 528 Lys Ile Met Glu Phe Val Asp Thr Met Ile Met Val Leu Lys Lys Asn 165 170 175 aac cgc cag atc tcc ttc ttg cac gtt tac cac cac agc tcc atc ttc 576 Asn Arg Gln Ile Ser Phe Leu His Val Tyr His His Ser Ser Ile Phe 180 185 190 acc atc tgg tgg ttg gtc acc ttt gtt gca ccc aac ggt gaa gcc tac 624 Thr Ile Trp Trp Leu Val Thr Phe Val Ala Pro Asn Gly Glu Ala Tyr 195 200 205 ttc tct gct gcg ttg aac tcg ttc atc cat gtg atc atg tac ggc tac 672 Phe Ser Ala Ala Leu Asn Ser Phe Ile His Val Ile Met Tyr Gly Tyr 210 215 220 tac ttc ttg tcg gcc ttg ggc ttc aag cag gtg tcg ttc atc aag ttc 720 Tyr Phe Leu Ser Ala Leu Gly Phe Lys Gln Val Ser Phe Ile Lys Phe 225 230 235 240 tac atc acg cgc tcg cag atg aca cag ttc tgc atg atg tcg gtc cag 768 Tyr Ile Thr Arg Ser Gln Met Thr Gln Phe Cys Met Met Ser Val Gln 245 250 255 tct tcc tgg gac atg tac gcc atg aag gtc ctt ggc cgc ccc gga tac 816 Ser Ser Trp Asp Met Tyr Ala Met Lys Val Leu Gly Arg Pro Gly Tyr 260 265 270 ccc ttc ttc atc acg gct ctg ctt tgg ttc tac atg tgg acc atg ctc 864 Pro Phe Phe Ile Thr Ala Leu Leu Trp Phe Tyr Met Trp Thr Met Leu 275 280 285 ggt ctc ttc tac aac ttt tac aga aag aac gcc aag ttg gcc aag cag 912 Gly Leu Phe Tyr Asn Phe Tyr Arg Lys Asn Ala Lys Leu Ala Lys Gln 290 295 300 gcc aag gcc gac gct gcc aag gag aag gca agg aag ttg cag taa 957 Ala Lys Ala Asp Ala Ala Lys Glu Lys Ala Arg Lys Leu Gln 305 310 315 <210> 36 <211> 318 <212> PRT <213> Mortierella alpina 64<400> 36MetGluSerIleAlaProPheLeuProSerLysMetProGlnAspLeu 1 5 10 15 PheMetAspLeuAlaThrAlaIleGlyValArgAlaAlaProTyrVal 20 25 30 AspProLeuGluAlaAlaLeuValAlaGlnAlaGluLysTyrIlePro 35 40 45 ThrIleValHisHisThrArgGlyPheLeuValAlaValGluSerPro 50 55 60 LeuAlaArgGluLeuProLeuMetAsnProPheHisValLeuLeuIle 65 70 75 80 ValLeuAlaTyrLeuValThrValPheValGlyMetGlnIleMetLys 85 90 95 AsnPheGluArgPheGluValLysThrPheSerLeuLeuHisAsnPhe 100 105 110 CysLeuValSerIleSerAlaTyrMetCysGlyGlyIleLeuTyrGlu 115 120 125 AlaTyrGlnAlaAsnTyrGlyLeuPheGluAsnAlaAlaAspHisThr 130 135 140 PheLysGlyLeuProMetAlaLysMetIleTrpLeuPheTyrPheSer 145 150 155 160 LysIleMetGluPheValAspThrMetIleMetValLeuLysLysAsn 165 170 175 AsnArgGlnIleSerPheLeuHisValTyrHisHisSerSerIlePhe 180 185 190 ThrIleTrpTrpLeuValThrPheValAlaProAsnGlyGluAlaTyr 195 200 205 PheSerAlaAlaLeuAsnSerPheIleHisValIleMetTyrGlyTyr 210 215 220 TyrPheLeuSerAlaLeuGlyPheLysGlnValSerPheIleLysPhe 225 230 235 240 TyrIleThrArgSerGlnMetThrGlnPheCysMetMetSerValGln 245 250 255 65SerSerTrpAspMetTyrAlaMetLysValLeuGlyArgProGlyTyr 260 265 270 ProPhePheIleThrAlaLeuLeuTrpPheTyrMetTrpThrMetLeu 275 280 285 GlyLeuPheTyrAsnPheTyrArgLysAsnAlaLysLeuAlaLysGln 290 295 300 AlaLysAlaAspAlaAlaLysGluLysAlaArgLysLeuGln 305 310 315 <210> 37<211> 867<212> DNA<213> Caenorhabditiselegans<220><221> CDS<222> (1)..(867) <223> Δ6-elongase<400> 37atggctcagcatccgctcgttcaacggcttctcgatgtcaaattcgac 48MetAlaGlnHisProLeuValGlnArgLeuLeuAspValLysPheAsp 1 5 10 15 acgaaacgatttgtggctattgctactcatgggccaaagaatttccct 96ThrLysArgPheValAlaIleAlaThrHisGlyProLysAsnPhePro 20 25 30 gacgcagaaggtcgcaagttctttgctgatcactttgatgttactatt 144AspAlaGluGlyArgLysPhePheAlaAspHisPheAspValThrIle 35 40 45 caggcttcaatcctgtacatggtcgttgtgttcggaacaaaatggttc 192GlnAlaSerIleLeuTyrMetValValValPheGlyThrLysTrpPhe 50 55 60 atgcgtaatcgtcaaccattccaattgactattccactcaacatctgg 240MetArgAsnArgGlnProPheGlnLeuThrIleProLeuAsnIleTrp 65 70 75 80 aatttcatcctcgccgcattttccatcgcaggagctgtcaaaatgacc 288AsnPheIleLeuAlaAlaPheSerIleAlaGlyAlaValLysMetThr 95 90 95 66ctcttcatggcttccaaacttttcgaacttgttgacaccatcttcttg 432LeuPheMetAlaSerLysLeuPheGluLeuValAspThrIlePheLeu 130 135 140 gttctccgtaaacgtccactcatgttccttcactggtatcaccatatt 480ValLeuArgLysArgProLeuMetPheLeuHisTrpTyrHisHisIle 145 150 155 160 ctcaccatgatctacgcctggtactctcatccattgaccccaggattc 528LeuThrMetIleTyrAlaTrpTyrSerHisProLeuThrProGlyPhe 165 170 175 aacagatacggaatttatcttaactttgtcgtccacgccttcatgtac 576AsnArgTyrGlyIleTyrLeuAsnPheValValHisAlaPheMetTyr 180 185 190 tcttactacttccttcgctcgatgaagattcgcgtgccaggattcatc 624SerTyrTyrPheLeuArgSerMetLysIleArgValProGlyPheIle 195 200 205 gcccaagctatcacatctcttcaaatcgttcaattcatcatctcttgc 672AlaGlnAlaIleThrSerLeuGlnIleValGlnPheIleIleSerCys 210 215 220 gccgttcttgctcatcttggttatctcatgcacttcaccaatgccaac 720AlaValLeuAlaHisLeuGlyTyrLeuMetHisPheThrAsnAlaAsn 225 230 235 240 tgtgatttcgagccatcagtattcaagctcgcagttttcatggacaca 768CysAspPheGluProSerValPheLysLeuAlaValPheMetAspThr 245 250 255 acatacttggctcttttcgtcaacttcttcctccaatcatatgttctc 816ThrTyrLeuAlaLeuPheValAsnPhePheLeuG lnSerTyrValLeu 260 265 270 cgcggaggaaaagacaagtacaaggcagtgccaaagaagaagaacaac 864ArgGlyGlyLysAspLysTyrLysAlaValProLysLysLysAsnAsn 275 280 285 taa 867<210> 38<211> 288<212> PRT<213> Caenorhabditiselegans<400> 38MetAlaGlnHisProLeuValGlnArgLeuLeuAspValLysPheAsp 1 5 10 15 ThrLysArgPheValAlaIleAlaThrHisGlyProLysAsnPhePro 20 25 30 AspAlaGluGlyArgLysPhePheAlaAspHisPheAspValThrIle 35 40 45 67GlnAlaSerIleLeuTyrMetValValValPheGlyThrLysTrpPhe 50 55 60 MetArgAsnArgGlnProPheGlnLeuThrIleProLeuAsnIleTrp 65 70 75 80 AsnPheIleLeuAlaAlaPheSerIleAlaGlyAlaValLysMetThr 85 90 95 ProGluPhePheGlyThrIleAlaAsnLysGlyIleValAlaSerTyr 100 105 110 CysLysValPheAspPheThrLysGlyGluAsnGlyTyrTrpValTrp 115 120 125 LeuPheMetAlaSerLysLeuPheGluLeuValAspThrIlePheLeu 130 135 140 ValLeuArgLysArgProLeuMetPheLeuHisTrpTyrHisHisIle 145 150 155 160 LeuThrMetIleTyrAlaTrpTyrSerHisProLeuThrProGlyPhe 165 170 175 AsnArgTyrGlyIleTyrLeuAsnPheValValHisAlaPheMetTyr 180 185 190 SerTyrTyrPheLeuArgSerMetLysIleArgValProGlyPheIle 195 200 205 AlaGlnAlaIleThrSerLeuGlnIleValGlnPheIleIleSerCys 210 215 220 AlaValLeuAlaHisLeuGlyTyrLeuMetHisPheThrAsnAlaAsn 225 230 235 240 CYSASPPHEPLUSSERVOSERVOLYSLEUALAVALAVALPHEMETASPTHR 245 250 255 Thrtertyrleualeuphevalasnphephephephephephalnephyllnsertyrvalleu 260 265 265 270 ArgglyLYLYLYLYLYLYSASLYSLYSLYSLYSLYSLYSLYSLYSLYSLYSLYSLYSLYSLYSLYSLYSLYSASSAS 68<220><221> CDS<222> (1)..(1626)<223> Δ4-desaturase<400> 39atgttggtgctgtttggcaatttctatgtcaagcaatactcccaaaag 48MetLeuValLeuPheGlyAsnPheTyrValLysGlnTyrSerGlnLys 1 5 10 15 aacggcaagccggagaacggagccacccctgagaacggagcgaagccg 96AsnGlyLysProGluAsnGlyAlaThrProGluAsnGlyAlaLysPro 20 25 30 caaccttgcgagaacggcacggtggaaaagcgagagaatgacaccgcc 144GlnProCysGluAsnGlyThrValGluLysArgGluAsnAspThrAla 35 40 45 aacgttcggcccacccgtccagctggacccccgccggccacgtactac 192AsnValArgProThrArgProAlaGlyProProProAlaThrTyrTyr 50 55 60 gactccctggcagtgtcggggcagggcaaggagcggctgttcaccacc 240AspSerLeuAlaValSerGlyGlnGlyLysGluArgLeuPheThrThr 65 70 75 80 gatgaggtgaggcggcacatcctccccaccgatggctggctgacgtgc 288AspGluValArgArgHisIleLeuProThrAspGlyTrpLeuThrCys 85 90 95 cacgaaggagtctacgatgtcactgatttccttgccaagcaccctggt 336HisGluGlyValTyrAspValThrAspPheLeuAlaLysHisProGly 100 105 110 ggcggtgtcatcacgctgggccttggaagggactgcacaatcctcatc 384GlyGlyValIleThrLeuGlyLeuGlyArgAspCysThrIleLeuIle 115 120 125 gagtcataccaccctgctgggcgcccggacaaggtgatggagaagtac 432 GluSerTyrHisProAlaGlyArgProAspLysValMetGluLysTyr 130 135 140 cgcattggtacgctgcaggaccccaagacgttctatgcttggggagag 480ArgIleGlyThrLeuGlnAspProLysThrPheTyrAlaTrpGlyGlu 145 150 155 160 tccgatttctaccctgagttgaagcgccgggcccttgcaaggctgaag 528SerAspPheTyrProGluLeuLysArgArgAlaLeuAlaArgLeuLys 165 170 175 gaggctggtcaggcgcggcgcggcggccttggggtgaaggccctcctg 576GluAlaGlyGlnAlaArgArgGlyGlyLeuGlyValLysAlaLeuLeu 180 185 190 gtgctcaccctcttcttcgtgtcgtggtacatgtgggtggcccacaag 624ValLeuThrLeuPhePheValSerTrpTyrMetTrpValAlaHisLys 195 200 205 tccttcctctgggccgccgtctggggcttcgccggctcccacgtcggg 672SerPheLeuTrpAlaAlaValTrpGlyPheAlaGlySerHisValGly 210 215 220 69 ctg agc atc cag cac gat ggc aac cac ggc gcg ttc agc cgc aac aca 720 Leu Ser Ile Gln His Asp Gly Asn His Gly Ala Phe Ser Arg Asn Thr 225 230 235 240 ctg gtg aac cgc ctg gcg ggg tgg ggc atg gac ttg atc ggc gcg tcg 768 Leu Val Asn Arg Leu Ala Gly Trp Gly Met Asp Leu Ile Gly Ala Ser 245 250 255 tcc acg gtg tgg gag tac cag cac gtc atc ggc cac cac cag tac acc 816 Ser Thr Val Trp Glu Tyr Gln His Val Ile Gly His His Gln Tyr Thr 260 265 270 aac ctc gtg tcg gac acg cta ttc agt ctg cct gag aac gat ccg gac 864 Asn Leu Val Ser Asp Thr Leu Phe Ser Leu Pro Glu Asn Asp Pro Asp 275 280 285 gtc ttc tcc agc tac ccg ctg atg cgc atg cac ccg gat acg gcg tgg 912 Val Phe Ser Ser Tyr Pro Leu Met Arg Met His Pro Asp Thr Ala Trp 290 295 300 cag ccg cac cac cgc ttc cag cac ctg ttc gcg ttc cca ctg ttc gcc 960 Gln Pro His His Arg Phe Gln His Leu Phe Ala Phe Pro Leu Phe Ala 305 310 315 320 ctg atg aca atc ​​agc aag gtg ctg acc agc gat ttc gct gtc tgc ctc 1008 Leu Met Thr Ile Ser Lys Val Leu Thr Ser Asp Phe Ala Val Cys Leu 325 330 335 agc atg aag aag ggg tcc atc gac tgc tcc tcc agg ctc gtc cca ctg 1056 Ser Met Lys Lys Gly Ser Ile Asp Cys Ser Ser Arg Leu Val Pro Leu 340 345 350 gag ggg cag ctg ctg ttc tgg ggg gcc aag ctg gcg aac ttc ctg ttg 1104 Glu Gly Gln Leu Leu Phe Trp Gly Ala Lys Leu Ala Asn Phe Leu Leu 355 360 365 cag att gtg ttg cca tgc tac ctc cac ggg aca gct atg ggc ctg gcc 1152 Gln Ile Val Leu Pro Cys Tyr Leu His Gly Thr Ala Met Gly Leu Ala 370 375 380 ctc ttc tct gtt gct cac ctt gtg tcg ggg gag tac ctc gcg atc tgc 1200 Leu Phe Ser Val Ala His Leu Val Ser Gly Glu Tyr Leu Ala Ile Cys 385 390 395 400 ttc atc atc aac cac atc agc gag tct tgt gag ttt atg aat aca agc 1248 Phe Ile Ile Asn His Ile Ser Glu Ser Cys Glu Phe Met Asn Thr Ser 405 410 415 ttt caa acc gcc gcc cgg agg aca gag atg ctt cag gca gca cat cag 1296 Phe Gln Thr Ala Ala Arg Arg Thr Glu Met Leu Gln Ala Ala His Gln 420 425 430 gca gcg gag gcc aag aag gtg aag ccc acc cct cca ccg aac gat tgg 1344 Ala Ala Glu Ala Light Light Val Light Pro Thr Pro Pro Pro Asn Asp Trp 435 440 445 gct gtg aca cag gtc caa tgc tgc gtg aat tgg aga tca ggt ggc gtg 1392 Ala Val Thr Gln Val Gln Cys Cys Val Asn Trp Arg Ser Gly Gly Val 450 455 460 ttg gcc aat cac ctc tct gga ggc ttg aac cac cag atc gag cat cat 1440 Leu Ala Asn His Leu Ser Gly Gly Leu Asn His Gln Ile Glu His His 465 470 475 480 ctg ttc ccc agc atc tcg cat gcc aac tac ccc acc atc gcc cct gtt 1488 Leu Phe Pro Ser Ile Ser His Ala Asn Tyr Pro Thr Ile Ala Pro Val 485 490 495 70gtgaaggaggtgtgcgaggagtacgggttgccgtacaagaattacgtc 1536ValLysGluValCysGluGluTyrGlyLeuProTyrLysAsnTyrVal 500 505 510 acgttctgggatgcagtctgtggcatggttcagcacctccggttgatg 1584ThrPheTrpAspAlaValCysGlyMetValGlnHisLeuArgLeuMet 515 520 525 ggtgctccaccggtgccaacgaacggggacaaaaagtcataa 1626GlyAlaProProValProThrAsnGlyAspLysLysSer 530 535 540 <210> 40<211> 541<212> PRT<213> Euglenagracilis<400> 40MetLeuValLeuPheGlyAsnPheTyrValLysGlnTyrSerGlnLys 1 5 10 15 AsnGlyLysProGluAsnGlyAlaThrProGluAsnGlyAlaLysPro 20 25 30 GlnProCysGluAsnGlyThrValGluLysArgGluAsnAspThrAla 35 40 45 AsnValArgProThrArgProAlaGlyProProProAlaThrTyrTyr 50 55 60 AspSerLeuAlaValSerGlyGlnGlyLysGluArgLeuPheThrThr 65 70 75 80 AspGluValArgArgHisIleLeuProThrAspGlyTrpLeuThrCys 85 90 95 HisGluGlyValTyrAspValThrAspPheLeuAlaLysHisProGly 100 105 110 GlyGlyValIleThrLeuGlyLeuGlyArgAspCysThrIleLeuIle 115 120 125 GluSerTyrHisProAlaGlyArgProAspLysValMetGluLysTyr 130 135 140 ArgIleGlyThrLeuGlnAspProLysThrPheTyrAlaTrpGlyGlu 145 150 155 160 SerAspPheTyrProG luLeuLightArgArgAlaLeuAlaArgLeuLight 165 170 175 71GluAlaGlyGlnAlaArgArgGlyGlyLeuGlyValLysAlaLeuLeu 180 185 190 ValLeuThrLeuPhePheValSerTrpTyrMetTrpValAlaHisLys 195 200 205 SerPheLeuTrpAlaAlaValTrpGlyPheAlaGlySerHisValGly 210 215 220 LeuSerIleGlnHisAspGlyAsnHisGlyAlaPheSerArgAsnThr 225 230 235 240 LeuValAsnArgLeuAlaGlyTrpGlyMetAspLeuIleGlyAlaSer 245 250 255 SerThrValTrpGluTyrGlnHisValIleGlyHisHisGlnTyrThr 260 265 270 AsnLeuValSerAspThrLeuPheSerLeuProGluAsnAspProAsp 275 280 285 ValPheSerSerTyrProLeuMetArgMetHisProAspThrAlaTrp 290 295 300 GlnProHisHisArgPheGlnHisLeuPheAlaPheProLeuPheAla 305 310 315 320 LeuMetThrIleSerLysValLeuThrSerAspPheAlaValCysLeu 325 330 335 SerMetLysLysGlySerIleAspCysSerSerArgLeuValProLeu 340 345 350 GluGlyGlnLeuLeuPheTrpGlyAlaLysLeuAlaAsnPheLeuLeu 355 360 365 Glnilevalleuprocystyrleuhisgythralametglyleuala 370 375 380 LeupheservalalahisleuvalglyGlygutyrleualailaIleecys 385 390 390 395 400 PHEILEIALALSNHISILERSELESERGALALSEGALLUSCYSELCYSEGRUSCYSLUPHEMETASNSNASSERCY laLysLysValLysProThrProProProAsnAspTrp 435 440 445 72AlaValThrGlnValGlnCysCysValAsnTrpArgSerGlyGlyVal 450 455 460 LeuAlaAsnHisLeuSerGlyGlyLeuAsnHisGlnIleGluHisHis 465 470 475 480 LeuPheProSerIleSerHisAlaAsnTyrProThrIleAlaProVal 485 490 495 ValLysGluValCysGluGluTyrGlyLeuProTyrLysAsnTyrVal 500 505 510 ThrPheTrpAspAlaValCysGlyMetValGlnHisLeuArgLeuMet 515 520 525 GlyAlaProProValProThrAsnGlyAspLysLysSer 530 535 540 <210> 41<211> 1548<212> DNA<213> Thraustochytrium<220><221> CDS<222 > (1)..(1548)<223> Δ4-desaturase<400> 41atgacggtcgggtttgacgaaacggtgactatggacacggtccgcaac 48MetThrValGlyPheAspGluThrValThrMetAspThrValArgAsn 1 5 10 15 cacaacatgccggacgacgcctggtgcgcgatccacggcaccgtgtac 96HisAsnMetProAspAspAlaTrpCysAlaIleHisGlyThrValTyr 20 25 30 gacatcaccaagttcagcaaggtgcaccccggcggggacatcatcatg 144AspIleThrLysPheSerLysValHisProGlyGlyAspIleIleMet 35 40 45 ctggccgctggcaaggaggccaccatcctgttcgagacctaccacatc 192LeuAlaAlaGlyLysGluAlaThrIleLeuPheGluThrTyrHisIle 50 55 60 aagggcgtcccggacgcggtgctgcgcaagtacaaggtcggcaagctc 240LysGlyValProAspAlaValLeuArgLysTyrLysVal GlyLysLeu 65 70 75 80 ccccagggcaagaagggcgaaacgagccacatgcccaccgggctcgac 288 73ProGlnGlyLysLysGlyGluThrSerHisMetProThrGlyLeuAsp 85 90 95 tcggcctcctactactcgtgggacagcgagttttacagggtgctccgc 336SerAlaSerTyrTyrSerTrpAspSerGluPheTyrArgValLeuArg 100 105 110 gagcgcgtcgccaagaagctggccgagcccggcctcatgcagcgcgcg 384GluArgValAlaLysLysLeuAlaGluProGlyLeuMetGlnArgAla 115 120 125 cgcatggagctctgggccaaggcgatcttcctcctggcaggtttctgg 432ArgMetGluLeuTrpAlaLysAlaIlePheLeuLeuAlaGlyPheTrp 130 135 140 ggctccctttacgccatgtgcgtgctagacccgcacggcggtgccatg 480GlySerLeuTyrAlaMetCysValLeuAspProHisGlyGlyAlaMet 145 150 155 160 gtagccgccgttacgctcggcgtgttcgctgcctttgtcggaacttgc 528ValAlaAlaValThrLeuGlyValPheAlaAlaPheValGlyThrCys 165 170 175 atccagcacgacggcagccacggcgccttctccaagtcgcgattcatg 576IleGlnHisAspGlySerHisGlyAlaPheSerLysSerArgPheMet 180 185 190 aacaaggcggcgggctggaccctcgacatgatcggcgcgagtgcgatg 624AsnLysAlaAlaGlyTrpThrLeuAspMetIleGlyAlaSerAlaMet 195 200 205 acctgggagatgcagcacgttcttggccaccacccgtacaccaacctc 672ThrTrpGluMetGlnHisValLeuGlyHisHisProTyrThrAsnLeu 210 215 220 atcgagatggagaacggtttggccaaggtcaa gggcgccgacgtcgac 720IleGluMetGluAsnGlyLeuAlaLysValLysGlyAlaAspValAsp 225 230 235 240 ccgaagaaggtcgaccaggagagcgacccggacgtcttcagtacgtac 768ProLysLysValAspGlnGluSerAspProAspValPheSerThrTyr 245 250 255 ccgatgcttcgcctgcacccgtggcaccgccagcggttttaccacaag 816ProMetLeuArgLeuHisProTrpHisArgGlnArgPheTyrHisLys 260 265 270 ttccagcacctgtacgccccgtttatctttgggtctatgacgattaac 864PheGlnHisLeuTyrAlaProPheIlePheGlySerMetThrIleAsn 275 280 285 aaggtgatttcccaggatgtcggggttgtgctgcgcaagcgcctgttc 912LysValIleSerGlnAspValGlyValValLeuArgLysArgLeuPhe 290 295 300 cagatcgacgccaactgccggtatggcagcccctggtacgtggcccgc 960GlnIleAspAlaAsnCysArgTyrGlySerProTrpTyrValAlaArg 305 310 315 320 ttctggatcatgaagctcctcaccacgctctacatggtggcgcttccc 1008PheTrpIleMetLysLeuLeuThrThrLeuTyrMetValAlaLeuPro 325 330 335 atgtacatgcaggggcctgctcagggcttgaagcttttcttcatggcc 1056MetTyrMetGlnGlyProAlaGlnGlyLeuLysLeuPhePheMetAla 340 345 350 cacttcacctgcggagaggtcctcgccaccatgtttattgtcaaccac 1104 74HisPheThrCysGlyGluValLeuAlaThrMetPheIleValAsnHis 355 360 365 atcatcgagggcgtcagctacgcttccaaggacgcggtcaagggcgtc 1152IleIleGluGlyValSerTyrAlaSerLysAspAlaValLysGlyVal 370 375 380 atggctccgccgcgcactgtgcacggtgtcaccccgatgcaggtgacg 1200MetAlaProProArgThrValHisGlyValThrProMetGlnValThr 385 390 395 400 caaaaggcgctcagtgcggccgagtcggccaagtcggacgccgacaag 1248GlnLysAlaLeuSerAlaAlaGluSerAlaLysSerAspAlaAspLys 405 410 415 acgaccatgatccccctcaacgactgggccgctgtgcagtgccagacc 1296ThrThrMetIleProLeuAsnAspTrpAlaAlaValGlnCysGlnThr 420 425 430 tctgtgaactgggctgtcgggtcgtggttttggaaccacttttcgggc 1344SerValAsnTrpAlaValGlySerTrpPheTrpAsnHisPheSerGly 435 440 445 ggcctcaaccaccagattgagcaccactgcttcccccaaaacccccac 1392GlyLeuAsnHisGlnIleGluHisHisCysPheProGlnAsnProHis 450 455 460 acggtcaacgtctacatctcgggcatcgtcaaggagacctgcgaagaa 1440ThrValAsnValTyrIleSerGlyIleValLysGluThrCysGluGlu 465 470 475 480 tacggcgtgccgtaccaggctgagatcagcctcttctctgcctatttc 1488TyrGlyValProTyrGlnAlaGluIleSerLeuPheSerAlaTyrPhe 485 490 495 aagatgctgtcgcacct ccgcacgctcggcaacgaggacctcacggcc 1536LysMetLeuSerHisLeuArgThrLeuGlyAsnGluAspLeuThrAla 500 505 510 tggtccacgtga 1548TrpSerThr 515 <210> 42<211> 515<212> PRT<213> Thraustochytrium<400> 42MetThrValGlyPheAspGluThrValThrMetAspThrValArgAsn1 5 10 15 HisAsnMetProAspAspAlaTrpCysAlaIleHisGlyThrValTyr 20 25 30 AspIleThrLysPheSerLysValHisProGlyGlyAspIleIleMet 35 40 45 75LeuAlaAlaGlyLysGluAlaThrIleLeuPheGluThrTyrHisIle 50 55 60 LysGlyValProAspAlaValLeuArgLysTyrLysValGlyLysLeu 65 70 75 80 ProGlnGlyLysLysGlyGluThrSerHisMetProThrGlyLeuAsp 85 90 95 SerAlaSerTyrTyrSerTrpAspSerGluPheTyrArgValLeuArg 100 105 110 GluArgValAlaLysLysLeuAlaGluProGlyLeuMetGlnArgAla 115 120 125 ArgMetGluLeuTrpAlaLysAlaIlePheLeuLeuAlaGlyPheTrp 130 135 140 GlySerLeuTyrAlaMetCysValLeuAspProHisGlyGlyAlaMet 145 150 155 160 ValAlaAlaValThrLeuGlyValPheAlaAlaPheValGlyThrCys 165 170 175 IleGlnHisAspGlySerHisGlyAlaPheSerLysSerArgPheMet 180 185 190 AsnLysAlaAlaGlyTrpThrLeuAspMetIleGlyAlaSerAlaMet 195 200 205 ThrTrpGluMetGlnHisValLeuGlyHisHisProTyrThrAsnLeu 210 215 220 IleGluMetGluAsnGlyLeuAlaLysValLysGlyAlaAspValAsp 225 230 235 240 prolysysvalaspglngluseraspproaspvalphr0tyr 245 250 255 Prometleuargleuhisprostrephisargglnargphetyrhislys 260 265 270 PheglnhisleutyralapropheilepheLlylysermettsmetthrilsmalthrileservallevalavalhalvalavallevalavallex. gTyrGlySerProTrpTyrValAlaArg 305 310 315 320 76PheTrpIleMetLysLeuLeuThrThrLeuTyrMetValAlaLeuPro 325 330 335 MetTyrMetGlnGlyProAlaGlnGlyLeuLysLeuPhePheMetAla 340 345 350 HisPheThrCysGlyGluValLeuAlaThrMetPheIleValAsnHis 355 360 365 IleIleGluGlyValSerTyrAlaSerLysAspAlaValLysGlyVal 370 375 380 MetAlaProProArgThrValHisGlyValThrProMetGlnValThr 385 390 395 400 GlnLysAlaLeuSerAlaAlaGluSerAlaLysSerAspAlaAspLys 405 410 415 ThrThrMetIleProLeuAsnAspTrpAlaAlaValGlnCysGlnThr 420 425 430 SerValAsnTrpAlaValGlySerTrpPheTrpAsnHisPheSerGly 435 440 445 GlyLeuAsnHisGlnIleGluHisHisCysPheProGlnAsnProHis 450 455 460 ThrValAsnValTyrIleSerGlyIleValLysGluThrCysGluGlu 465 470 475 480 TyrGlyValProTyrGlnAlaGluIleSerLeuPheSerAlaTyrPhe 485 490 495 LysMetLeuSerHisLeuArgThrLeuGlyAsnGluAspLeuThrAla 500 505 510 TrpSerThr 515 <210> 43<211> 960<212> DNA<213> Thalassiosirapseudonana<220><221> CDS<222> (1)..(960) 77<223> Δ5-elongase<400> 43atggtgttgtacaatgtggcgcaagtgctgctcaatgggtggacggtg 48MetValLeuTyrAsnValAlaGlnValLeuLeuAsnGlyTrpThrVal 1 5 10 15 tatgcgattgtggatgcggtgatgaatagagaccatccgtttattgga 96TyrAlaIleValAspAlaValMetAsnArgAspHisProPheIleGly 20 25 30 agtagaagtttggttggggcggcgttgcatagtgggagctcgtatgcg 144SerArgSerLeuValGlyAlaAlaLeuHisSerGlySerSerTyrAla 35 40 45 gtgtgggttcattattgtgataagtatttggagttctttgatacgtat 192ValTrpValHisTyrCysAspLysTyrLeuGluPhePheAspThrTyr 50 55 60 tttatggtgttgagggggaaaatggaccagatggtacttggtgaagtt 240PheMetValLeuArgGlyLysMetAspGlnMetValLeuGlyGluVal 65 70 75 80 ggtggcagtgtgtggtgtggcgttggatatatggatatggagaagatg 288GlyGlySerValTrpCysGlyValGlyTyrMetAspMetGluLysMet 85 90 95 atactactcagctttggagtgcatcggtctgctcagggaacggggaag 336IleLeuLeuSerPheGlyValHisArgSerAlaGlnGlyThrGlyLys 100 105 110 gctttcaccaacaacgttaccaatccacatctcacgcttccacctcat 384AlaPheThrAsnAsnValThrAsnProHisLeuThrLeuProProHis 115 120 125 tctacaaaaacaaaaaaaacaggtctccttcctccacatctaccaccac 432SerThrLysThrLysLysGlnValSerPheLeu HisIleTyrHisHis 130 135 140 acgaccatagcgtgggcatggtggatcgccctccgcttctcccccggt 480ThrThrIleAlaTrpAlaTrpTrpIleAlaLeuArgPheSerProGly 145 150 155 160 ggagacatttacttcggggcactcctcaactccatcatccacgtcctc 528GlyAspIleTyrPheGlyAlaLeuLeuAsnSerIleIleHisValLeu 165 170 175 atgtattcctactacgcccttgccctactcaaggtcagttgtccatgg 576MetTyrSerTyrTyrAlaLeuAlaLeuLeuLysValSerCysProTrp 180 185 190 aaacgatacctgactcaagctcaattattgcaattcacaagtgtggtg 624LysArgTyrLeuThrGlnAlaGlnLeuLeuGlnPheThrSerValVal 195 200 205 gtttatacggggtgtacgggttatactcattactatcatacgaagcat 672ValTyrThrGlyCysThrGlyTyrThrHisTyrTyrHisThrLysHis 210 215 220 ggagcggatgagacacagcctagtttaggaacgtattatttctgttgt 720GlyAlaAspGluThrGlnProSerLeuGlyThrTyrTyrPheCysCys 225 230 235 240 ggagtgcaggtgtttgagatggttagtttgtttgtactcttttccatc 768GlyValGlnValPheGluMetValSerLeuPheValLeuPheSerIle 245 250 255 78ttttataaacgatcctattcgaagaagaacaagtcaggaggaaaggat 816PheTyrLysArgSerTyrSerLysLysAsnLysSerGlyGlyLysAsp 260 265 270 agcaagaagaatgatgatgggaataatgaggatcaatgtcacaaggct 864SerLysLysAsnAspAspGlyAsnAsnGluAspGlnCysHisLysAla 275 280 285 atgaaggatatatcggagggtgcgaaggaggttgtggggcatgcagcg 912MetLysAspIleSerGluGlyAlaLysGluValValGlyHisAlaAla 290 295 300 aaggatgctggaaagttggtggctacgagagtaaggtgtaaggtgtaa 960LysAspAlaGlyLysLeuValAlaThrArgValArgCysLysVal 305 310 315 <210> 44<211> 319<212> PRT<213> Thalassiosirapseudonana<400> 44MetValLeuTyrAsnValAlaGlnValLeuLeuAsnGlyTrpThrVal 1 5 10 15 TyrAlaIleValAspAlaValMetAsnArgAspHisProPheIleGly 20 25 30 SerArgSerLeuValGlyAlaAlaLeuHisSerGlySerSerTyrAla 35 40 45 ValTrpValHisTyrCysAspLysTyrLeuGluPhePheAspThrTyr 50 55 60 PheMetValLeuArgGlyLysMetAspGlnMetValLeuGlyGluVal 65 70 75 80 GlyGlySerValTrpCysGlyValGlyTyrMetAspMetGluLysMet 85 90 95 IleLeuLeuSerPheGlyValHisArgSerAlaGlnGlyThrGlyLys 100 105 110 AlaPheThrAsnAsnValThrAsnProHisLeuThrLeuProProHis 115 120 125 SerThrLysThr LysLysGlnValSerPheLeuHisIleTyrHisHis 130 135 140 ThrThrIleAlaTrpAlaTrpTrpIleAlaLeuArgPheSerProGly 145 150 155 160 79GlyAspIleTyrPheGlyAlaLeuLeuAsnSerIleIleHisValLeu 165 170 175 MetTyrSerTyrTyrAlaLeuAlaLeuLeuLysValSerCysProTrp 180 185 190 LysArgTyrLeuThrGlnAlaGlnLeuLeuGlnPheThrSerValVal 195 200 205 ValTyrThrGlyCysThrGlyTyrThrHisTyrTyrHisThrLysHis 210 215 220 GlyAlaAspGluThrGlnProSerLeuGlyThrTyrTyrPheCysCys 225 230 235 240 GlyValGlnValPheGluMetValSerLeuPheValLeuPheSerIle 245 250 255 PheTyrLysArgSerTyrSerLysLysAsnLysSerGlyGlyLysAsp 260 265 270 SerLysLysAsnAspAspGlyAsnAsnGluAspGlnCysHisLysAla 275 280 285 MetLysAspIleSerGluGlyAlaLysGluValValGlyHisAlaAla 290 295 300 LysAspAlaGlyLysLeuValAlaThrArgValArgCysLysVal 305 310 315 <210> 45<211> 819< 212> DNA<213> Thalassiosirapseudonana<220><221> CDS<222> (1)..(819)<223> Δ5-elongase<400> 45atggacgcctacaacgctgcaatggataagatcggtgccgccatcatc 48MetAspAlaTyrAsnAlaAlaMetAspLysIleGlyAlaAlaIleIle 1 5 10 15 gattggactgaggactgatcccgggatgccgatgccgatggaggaggagactgatccggggatggaggaggatggaggatggatgccgatgcc 80AspTrpSerAspProAspGlyLysPheArgAlaAspArgGluAspTrp 20 25 30 tggctctgcgacttccgtagcgccatcaccatcgccctcatctacatc 144TrpLeuCysAspPheArgSerAlaIleThrIleAlaLeuIleTyrIle 35 40 45 gccttcgtcatcctcggttccgccgtcatgcaatccctccccgcaatg 192AlaPheValIleLeuGlySerAlaValMetGlnSerLeuProAlaMet 50 55 60 gatccctaccccatcaaattcctctacaacgtctcccaaatcttcctt 240AspProTyrProIleLysPheLeuTyrAsnValSerGlnIlePheLeu 65 70 75 80 tgtgcctacatgactgtcgaggcgggatttttggcctaccgcaatgga 288CysAlaTyrMetThrValGluAlaGlyPheLeuAlaTyrArgAsnGly 85 90 95 tataccgtcatgccttgcaatcatttcaatgtgaatgatcctcccgtg 336TyrThrValMetProCysAsnHisPheAsnValAsnAspProProVal 100 105 110 gcgaatcttctttggttgttttatatttccaaggtgtgggacttttgg 384AlaAsnLeuLeuTrpLeuPheTyrIleSerLysValTrpAspPheTrp 115 120 125 gataccattttcattgtgttggggaagaagtggcgtcaattatctttc 432AspThrIlePheIleValLeuGlyLysLysTrpArgGlnLeuSerPhe 130 135 140 ttgcatgtataccatcacaccaccatctttctattctattggctgaat 480LeuHisValTyrHisHisThrThrIlePheLeuPheTyrTrpLeuAsn 145 150 155 160 gccaatgtcttgtacgatggtgacatcttccttaccatctt gctcaat 528AlaAsnValLeuTyrAspGlyAspIlePheLeuThrIleLeuLeuAsn 165 170 175 ggattcatccacacggtgatgtacacgtattacttcatctgtatgcat 576GlyPheIleHisThrValMetTyrThrTyrTyrPheIleCysMetHis 180 185 190 accaaagattccaagacgggcaagagtcttcctatatggtggaagtcg 624ThrLysAspSerLysThrGlyLysSerLeuProIleTrpTrpLysSer 195 200 205 agtttgacggcgtttcagttgttgcaattcactatcatgatgagtcag 672SerLeuThrAlaPheGlnLeuLeuGlnPheThrIleMetMetSerGln 210 215 220 gctacctaccttgtcttccacgggtgtgataaggtgtcgcttcgtatc 720AlaThrTyrLeuValPheHisGlyCysAspLysValSerLeuArgIle 225 230 235 240 acgattgtgtactttgtgtcccttttgagtttgttcttcctttttgct 768ThrIleValTyrPheValSerLeuLeuSerLeuPhePheLeuPheAla 245 250 255 cagttctttgtgcaatcatacatggcacccaaaaagaagaagagtgct 816GlnPhePheValGlnSerTyrMetAlaProLysLysLysLysSerAla 260 265 270 tag 819<210> 46 81<211> 272<212> PRT<213> Thalassiosirapseudonana<400> 46MetAspAlaTyrAsnAlaAlaMetAspLysIleGlyAlaAlaIleIle 1 5 10 15 AspTrpSerAspProAspGlyLysPheArgAlaAspArgGluAspTrp 20 25 30 TrpLeuCysAspPheArgSerAlaIleThrIleAlaLeuIleTyrIle 35 40 45 AlaPheValIleLeuGlySerAlaValMetGlnSerLeuProAlaMet 50 55 60 AspProTyrProIleLysPheLeuTyrAsnValSerGlnIlePheLeu 65 70 75 80 CysAlaTyrMetThrValGluAlaGlyPheLeuAlaTyrArgAsnGly 85 90 95 TyrThrValMetProCysAsnHisPheAsnValAsnAspProProVal 100 105 110 AlaAsnLeuLeuTrpLeuPheTyrIleSerLysValTrpAspPheTrp 115 120 125 AspThrIlePheIleValLeuGlyLysLysTrpArgGlnLeuSerPhe 130 135 140 LeuHisValTyrHisHisThrThrIlePheLeuPheTyrTrpLeuAsn 145 150 155 160 AlaAsnValLeuTyrAspGlyAspIlePheLeuThrIleLeuLeuAsn 165 170 175 GlyPheIleHisThrValMetTyrThrTyrTyrPheIleCysMetHis 180 185 190 ThrLysAspSerLysThrGlyLysSerLeuProIleTrpTrpLysSer 195 200 205 SerLeuThrAlaPheGlnLeuLeuGlnPheThrIleMetMetSerGln 210 215 220 AlaThrTyrLeuValPheHisGlyCysAspLysValSerLeuArgIle 225 230 235 240 82thrilevaltyrphevalserleuleuserleuphelepheleupheala 245 250 255 GlnphePhelvallnsertyrmetalaprolyslyssereala 260 265 265 270 <210> 47 <211> 936 <212> DNA <213> Cryphecodinium > 47atgtctgccttcatgactctcccacaggctctctccgatgtgacctcg 48MetSerAlaPheMetThrLeuProGlnAlaLeuSerAspValThrSer 1 5 10 15 gccttggtcacgctgggaaaggatgtctccagcccttcagcttttcaa 96AlaLeuValThrLeuGlyLysAspValSerSerProSerAlaPheGln 20 25 30 gctgtcactggcttctgcagggagcagtgggggattccgacagtattc 144AlaValThrGlyPheCysArgGluGlnTrpGlyIleProThrValPhe 35 40 45 tgcctgggctacttggccatggtctacgcggccagaagacccctcccg 192CysLeuGlyTyrLeuAlaMetValTyrAlaAlaArgArgProLeuPro 50 55 60 cagcacggctacatggttgcggtggaccgttgcttcgctgcttggaac 240GlnHisGlyTyrMetValAlaValAspArgCysPheAlaAlaTrpAsn 65 70 75 80 ttggctctctctgtcttcagcacttggggcttctaccacatggctgtc 288LeuAlaLeuSerValPheSerThrTrpGlyPheTyrHisMetAlaVal 85 90 95 gggctctacaacatgacagagacgaggggcttgcaattcaccatctgc 336GlyLeuTyrAsnMetThrGluThrArgGlyLeuGlnPheThrIleCys 100 1 05 110 ggttcgactggggagctcgtgcagaaccttcagactggcccaaccgct 384GlySerThrGlyGluLeuValGlnAsnLeuGlnThrGlyProThrAla 115 120 125 ctggcgctctgcctcttctgcttcagcaagatccccgagttgatggac 432LeuAlaLeuCysLeuPheCysPheSerLysIleProGluLeuMetAsp 130 135 140 acggtgtttctcatcctgaaggccaagaaggtccgcttcttgcagtgg 480 83ThrValPheLeuIleLeuLysAlaLysLysValArgPheLeuGlnTrp 145 150 155 160 taccaccatgccacagtcatgctcttctgttggctcgccctcgcgacg 528TyrHisHisAlaThrValMetLeuPheCysTrpLeuAlaLeuAlaThr 165 170 175 gagtacactcctggcttgtggtttgcggcgacgaactacttcgtgcac 576GluTyrThrProGlyLeuTrpPheAlaAlaThrAsnTyrPheValHis 180 185 190 tccatcatgtacatgtacttcttcctcatgaccttcaagtcggccgcg 624SerIleMetTyrMetTyrPhePheLeuMetThrPheLysSerAlaAla 195 200 205 aaggtggtgaagcccatcgcccctctcatcacagttatccagattgct 672LysValValLysProIleAlaProLeuIleThrValIleGlnIleAla 210 215 220 cagatggtctggggcctcatcgtcaacggcatcgccatcaccaccttc 720GlnMetValTrpGlyLeuIleValAsnGlyIleAlaIleThrThrPhe 225 230 235 240 ttcacgactggtgcctgccagatccagtctgtgactgtgtattcggcc 768PheThrThrGlyAlaCysGlnIleGlnSerValThrValTyrSerAla 245 250 255 atcatcatgtacgcttcgtacttctacctgttctcccagctcttcttc 816IleIleMetTyrAlaSerTyrPheTyrLeuPheSerGlnLeuPhePhe 260 265 270 gaggcccatggtgccgctggcaagaacaagaagaagttgacccgcgag 864GluAlaHisGlyAlaAlaGlyLysAsnLysLysLysLeuThrArgGlu 275 280 285 ctctctcgaaaaatctcggaggctc tcctgaacaccggtgacgaggtt 912LeuSerArgLysIleSerGluAlaLeuLeuAsnThrGlyAspGluVal 290 295 300 tccaagcacctgaaggtgaattga 936SerLysHisLeuLysValAsn 305 310 <210> 48<211> 311<212> PRT<213> Crypthecodiniumcohnii<400> 48MetSerAlaPheMetThrLeuProGlnAlaLeuSerAspValThrSer 1 5 10 15 AlaLeuValThrLeuGlyLysAspValSerSerProSerAlaPheGln 20 25 30 AlaValThrGlyPheCysArgGluGlnTrpGlyIleProThrValPhe 35 40 45 84CysLeuGlyTyrLeuAlaMetValTyrAlaAlaArgArgProLeuPro 50 55 60 GlnHisGlyTyrMetValAlaValAspArgCysPheAlaAlaTrpAsn 65 70 75 80 LeuAlaLeuSerValPheSerThrTrpGlyPheTyrHisMetAlaVal 85 90 95 GlyLeuTyrAsnMetThrGluThrArgGlyLeuGlnPheThrIleCys 100 105 110 GlySerThrGlyGluLeuValGlnAsnLeuGlnThrGlyProThrAla 115 120 125 LeuAlaLeuCysLeuPheCysPheSerLysIleProGluLeuMetAsp 130 135 140 ThrValPheLeuIleLeuLysAlaLysLysValArgPheLeuGlnTrp 145 150 155 160 TyrHisHisAlaThrValMetLeuPheCysTrpLeuAlaLeuAlaThr 165 170 175 GluTyrThrProGlyLeuTrpPheAlaAlaThrAsnTyrPheValHis 180 185 190 SerIleMetTyrMetTyrPhePheLeuMetThrPheLysSerAlaAla 195 200 205 LysValValLysProIleAlaProLeuIleThrValIleGlnIleAla 210 215 220 GlnMetValTrpGlyLeuIleValAsnGlyIleAlaIleThrThrPhe 225 230 235 Twohrglyalcysysglnsvalphrvaltic erasa 245 250 250 250 250 250 250 250 250 250 250 to iphydral heightyrial controlrolase n 305 310 85<210> 49<211> 927<212> DNA<213> Crypthecodiniumcohnii<220><221> CDS(1). actttgaaccacgacttctccagcgtcgagccattcaaagtcgtgacg 96ThrLeuAsnHisAspPheSerSerValGluProPheLysValValThr 20 25 30 cagttctgcagggaccagtgggcgatcccgacagtcttttgcatcggt 144GlnPheCysArgAspGlnTrpAlaIleProThrValPheCysIleGly 35 40 45 tacttggcaatggtctacgccacgcgaagacctatcgcgaagcacccc 192TyrLeuAlaMetValTyrAlaThrArgArgProIleAlaLysHisPro 50 55 60 tacatgtctctcgtggatcgctgctttgcggcctggaacttgggcctc 240TyrMetSerLeuValAspArgCysPheAlaAlaTrpAsnLeuGlyLeu 65 70 75 80 tcgctcttcagttgctggggcttctaccacatggcagtgggactctcc 288SerLeuPheSerCysTrpGlyPheTyrHisMetAlaValGlyLeuSer 85 90 95 cacaccacttggaatttcgggctccagttcaccatctgcggcagcacc 336HisThrThrTrpAsnPheGlyLeuGlnPheThrIleCysGlySerThr 100 105 110 acggagcttgtgaatggcttccagaagggcccggcggccctcgccctc 384ThrGluLeuValAsnGlyPheGlnLysGlyProAlaAlaLeuAlaLeu 115 120 125 at cctgttctgcttctccaagatcccggagttgggcgacaccgtcttc 432IleLeuPheCysPheSerLysIleProGluLeuGlyAspThrValPhe 130 135 140 ttgatcttgaagggaaagaaggtccgcttcttgcagtggtaccaccac 480LeuIleLeuLysGlyLysLysValArgPheLeuGlnTrpTyrHisHis 145 150 155 160 acgaccgtgatgctcttctgttggatggccttggcgactgagtacact 528ThrThrValMetLeuPheCysTrpMetAlaLeuAlaThrGluTyrThr 165 170 175 cctggattgtggttcgcggccacgaactacttcgtgcactccatcatg 576ProGlyLeuTrpPheAlaAlaThrAsnTyrPheValHisSerIleMet 180 185 190 86tacatgtacttcttcctcatgaccttcaagacggccgccggcatcatc 624TyrMetTyrPhePheLeuMetThrPheLysThrAlaAlaGlyIleIle 195 200 205 aagcccatcgcgcctctcatcaccatcatccagatctcccagatggtc 672LysProIleAlaProLeuIleThrIleIleGlnIleSerGlnMetVal 210 215 220 tggggcttggtcgtgaacgccatcgccgtcggcaccttcttcaccaca 720TrpGlyLeuValValAsnAlaIleAlaValGlyThrPhePheThrThr 225 230 235 240 ggcaactgccagatccaggcagtgacagtctactccgccatcgtgatg 768GlyAsnCysGlnIleGlnAlaValThrValTyrSerAlaIleValMet 245 250 255 tacgcctcctacttctacctcttcggccagctcttcttcgaggcccag 816TyrAlaSerTyrPheTyrLeuPheGlyGlnLeuPhePheGluAlaGln 260 265 270 ggttcggctggaaaggacaagaagaagttggcccgagagctgagccga 864GlySerAlaGlyLysAspLysLysLysLeuAlaArgGluLeuSerArg 275 280 285 aaggtctcgcgggctctcacagcaacgggcgaagaggtgtcgaagcac 912LysValSerArgAlaLeuThrAlaThrGlyGluGluValSerLysHis 290 295 300 atgaaggtgaattga 927MetLysValAsn 305 <210> 50<211> 308<212> PRT<213> Crypthecodiniumcohnii<400> 50MetAlaSerTyrGlnGlnAlaPheSerGluLeuAlaArgAlaLeuSer 1 5 10 15 ThrLeuAsnHisAspPheSerSerValGluProPheLysValValTh r 20 25 30 GlnPheCysArgAspGlnTrpAlaIleProThrValPheCysIleGly 35 40 45 TyrLeuAlaMetValTyrAlaThrArgArgProIleAlaLysHisPro 50 55 60 TyrMetSerLeuValAspArgCysPheAlaAlaTrpAsnLeuGlyLeu 65 70 75 80 SerLeuMetSerLeuValAspGlyLeu 65 75 80 87HisThrThrTrpAsnPheGlyLeuGlnPheThrIleCysGlySerThr 100 105 110 ThrGluLeuValAsnGlyPheGlnLysGlyProAlaAlaLeuAlaLeu 115 120 125 IleLeuPheCysPheSerLysIleProGluLeuGlyAspThrValPhe 130 135 140 LeuIleLeuLysGlyLysLysValArgPheLeuGlnTrpTyrHisHis 145 150 155 160 ThrThrValMetLeuPheCysTrpMetAlaLeuAlaThrGluTyrThr 165 170 175 ProGlyLeuTrpPheAlaAlaThrAsnTyrPheValHisSerIleMet 180 185 190 TyrMetTyrPhePheLeuMetThrPheLysThrAlaAlaGlyIleIle 195 200 205 LysProIleAlaProLeuIleThrIleIleGlnIleSerGlnMetVal 210 215 220 TrpGlyLeuValValAsnAlaIleAlaValGlyThrPhePheThrThr 225 230 235 240 GlyAsnCysGlnIleGlnAlaValThrValTyrSerAlaIleValMet 245 250 255 TyrAlaSerTyrPheTyrLeuPheGlyGlnLeuPhePheGluAlaGln 260 265 270 GlySerAlaGlyLysAspLysLysLysLeuAlaArgGluLeuSerArg 275 280 285 LysValSerArgAlaLeuThrAlaThrGlyGluGluValSerLysHis 290 295 300 MetLysValAsn 305 <210> 51<211> 795<212> DNA<213> Oncorhynchusmykiss 88<220><221> CDS<222> (1)..(795)<223> Δ5-elongase<400> 51atggcttcaacatggcaaagcgttcagtccatgcgccagtggatttta 48MetAlaSerThrTrpGlnSerValGlnSerMetArgGlnTrpIleLeu 1 5 10 15 gagaatggagataaaaggacagacccatggctactggtctactcccct 96GluAsnGlyAspLysArgThrAspProTrpLeuLeuValTyrSerPro 20 25 30 atgccagtggccattatattcctcctctatcttggtgtggtctgggct 144MetProValAlaIleIlePheLeuLeuTyrLeuGlyValValTrpAla 35 40 45 gggcccaagctgatgaaacgcagggaaccagttgatctcaaggctgta 192GlyProLysLeuMetLysArgArgGluProValAspLeuLysAlaVal 50 55 60 ctcattgtctacaacttcgccatggtctgcctgtctgtctacatgttc 240LeuIleValTyrAsnPheAlaMetValCysLeuSerValTyrMetPhe 65 70 75 80 catgagttcttggtcacgtccttgctgtctaactacagttacctgtgt 288HisGluPheLeuValThrSerLeuLeuSerAsnTyrSerTyrLeuCys 85 90 95 caacctgtggattacagcactagtccactggcgatgaggatggccaaa 336GlnProValAspTyrSerThrSerProLeuAlaMetArgMetAlaLys 100 105 110 gtatgctggtggtttttcttctccaaggtcatagaattggctgacacg 384ValCysTrpTrpPhePhePheSerLysValIleGluLeuAlaAspThr 115 120 125 gtgttcttcatcctgaggaagaagaacagtcagctgactttcctgcat 432Val PhePheIleLeuArgLysLysAsnSerGlnLeuThrPheLeuHis 130 135 140 gtctatcaccatggcaccatgatcttcaactggtgggcaggggtcaag 480ValTyrHisHisGlyThrMetIlePheAsnTrpTrpAlaGlyValLys 145 150 155 160 tatctggctggaggccaatcgttcttcatcggcctgctcaataccttt 528TyrLeuAlaGlyGlyGlnSerPhePheIleGlyLeuLeuAsnThrPhe 165 170 175 gtgcacatcgtgatgtactcttactacggactggctgccctggggcct 576ValHisIleValMetTyrSerTyrTyrGlyLeuAlaAlaLeuGlyPro 180 185 190 cacacgcagaagtacttatggtggaagcgctatctgacctcactgcag 624HisThrGlnLysTyrLeuTrpTrpLysArgTyrLeuThrSerLeuGln 195 200 205 ctgctccagtttgtcctgttgaccactcacactggctacaacctcttc 672LeuLeuGlnPheValLeuLeuThrThrHisThrGlyTyrAsnLeuPhe 210 215 220 actgagtgtgacttcccggactccatgaacgctgtggtgtttgcctac 720 89ThrGluCysAspPheProAspSerMetAsnAlaValValPheAlaTyr 225 230 235 240 tgtgtcagtctcattgctctcttcagcaacttctactatcagagctac 768CysValSerLeuIleAlaLeuPheSerAsnPheTyrTyrGlnSerTyr 245 250 255 ctcaacaggaagagcaagaagacataa 795LeuAsnArgLysSerLysLysThr 260 <210> 52<211> 264<212> PRT<213> Oncorhynchusmykiss<400> 52MetAlaSerThrTrpGlnSerValGlnSerMetArgGlnTrpIleLeu 1 5 10 15 GluAsnGlyAspLysArgThrAspProTrpLeuLeuValTyrSerPro 20 25 30 MetProValAlaIleIlePheLeuLeuTyrLeuGlyValValTrpAla 35 40 45 GlyProLysLeuMetLysArgArgGluProValAspLeuLysAlaVal 50 55 60 LeuIleValTyrAsnPheAlaMetValCysLeuSerValTyrMetPhe 65 70 75 80 HisGluPheLeuValThrSerLeuLeuSerAsnTyrSerTyrLeuCys 85 90 95 GlnProValAspTyrSerThrSerProLeuAlaMetArgMetAlaLys 100 105 110 ValCysTrpTrpPhePhePheSerLysValIleGluLeuAlaAspThr 115 120 125 ValPhePheIleLeuArgLysLysAsnSerGlnLeuThrPheLeuHis 130 135 140 ValTyrHisHisGlyThrMetIlePheAsnTrpTrpAlaGlyValLys 145 150 155 160 TyrLeuAlaGlyGlyGlnSerPhePheIleGlyLeuLeuAsnThrPhe 165 170 175 90ValHisIleValMetTyrSerTyrTyrGlyLeuAlaAlaLeuGlyPro 180 185 190 HisThrGlnLysTyrLeuTrpTrpLysArgTyrLeuThrSerLeuGln 195 200 205 LeuLeuGlnPheValLeuLeuThrThrHisThrGlyTyrAsnLeuPhe 210 215 220 ThrGluCysAspPheProAspSerMetAsnAlaValValPheAlaTyr 225 230 235 240 CysValSerLeuIleAlaLeuPheSerAsnPheTyrTyrGlnSerTyr 245 250 255 LeuAsnArgLysSerLysLysThr 260 <210> 53<211> 885<212> DNA<213> Oncorhynchusmykiss<220><221> CDS<222> ( 1)..(885)<223> Δ5-elongase<400> 53atggagacttttaattataaactaaacatgtacatagactcatggatg 48MetGluThrPheAsnTyrLysLeuAsnMetTyrIleAspSerTrpMet 1 5 10 15 ggtcccagagatgagcgggtacagggatggctgcttctggacaactac 96GlyProArgAspGluArgValGlnGlyTrpLeuLeuLeuAspAsnTyr 20 25 30 cctccaacctttgcactaacagtcatgtacctgctgatcgtatggatg 144ProProThrPheAlaLeuThrValMetTyrLeuLeuIleValTrpMet 35 40 45 gggcccaagtacatgagacacagacagccggtgtcttgccggggtctc 192GlyProLysTyrMetArgHisArgGlnProValSerCysArgGlyLeu 50 55 60 ctcttggtctacaatctgggcctcacgatcttgtccttctatatgttc 240LeuLeuValTyrAsnLeuGlyLeuThrIleLeuSerPheTyrMetPhe 65 70 75 80 tat gagatggtgtctgctgtgtggcacggggattataactctttttgc 288TyrGluMetValSerAlaValTrpHisGlyAspTyrAsnPhePheCys 85 90 95 91caagacacacacagtgcaggagaaaccgataccaagatcataaatgtg 336GlnAspThrHisSerAlaGlyGluThrAspThrLysIleIleAsnVal 100 105 110 ctgtggtggtactacttctccaagctcatagagtttatggataccttc 384LeuTrpTrpTyrTyrPheSerLysLeuIleGluPheMetAspThrPhe 115 120 125 ttcttcatcctgcggaagaacaaccatcaaatcacgtttctgcacatc 432PhePheIleLeuArgLysAsnAsnHisGlnIleThrPheLeuHisIle 130 135 140 taccaccatgctagcatgctcaacatctggtggttcgtcatgaactgg 480TyrHisHisAlaSerMetLeuAsnIleTrpTrpPheValMetAsnTrp 145 150 155 160 gtgccctgtggtcactcctactttggtgcctccctgaacagcttcatc 528ValProCysGlyHisSerTyrPheGlyAlaSerLeuAsnSerPheIle 165 170 175 catgtcctgatgtactcttactatgggctctctgctgtcccggccttg 576HisValLeuMetTyrSerTyrTyrGlyLeuSerAlaValProAlaLeu 180 185 190 cggccctatctatggtggaagaaatacatcacacaagtacagctgatt 624ArgProTyrLeuTrpTrpLysLysTyrIleThrGlnValGlnLeuIle 195 200 205 cagttctttttgaccatgtcccagacgatatgtgcagtcatttggcca 672GlnPhePheLeuThrMetSerGlnThrIleCysAlaValIleTrpPro 210 215 220 tgtgatttccccagagggtggctgtatttccagatattctatgtcatc 720CysAspPheProArgGlyTrpLeuTyrPheGlnIlePh eTyrValIle 225 230 235 240 acacttattgcccttttctcaaacttctacattcagacttacaagaaa 768ThrLeuIleAlaLeuPheSerAsnPheTyrIleGlnThrTyrLysLys 245 250 255 caccttgtttcacaaaagaaggagtatcatcagaatggctctgttgct 816HisLeuValSerGlnLysLysGluTyrHisGlnAsnGlySerValAla 260 265 270 tcattgaatggccatgtgaatggggtgacacccacggaaaccattaca 864SerLeuAsnGlyHisValAsnGlyValThrProThrGluThrIleThr 275 280 285 cacaggaaagtgaggggggac 885HisArgLysValArgGlyAsp 290 295 <210> 54<211> 295<212> PRT<213> Oncorhynchusmykiss<400> 54MetGluThrPheAsnTyrLysLeuAsnMetTyrIleAspSerTrpMet 1 5 10 15 92GlyProArgAspGluArgValGlnGlyTrpLeuLeuLeuAspAsnTyr 20 25 30 ProProThrPheAlaLeuThrValMetTyrLeuLeuIleValTrpMet 35 40 45 GlyProLysTyrMetArgHisArgGlnProValSerCysArgGlyLeu 50 55 60 LeuLeuValTyrAsnLeuGlyLeuThrIleLeuSerPheTyrMetPhe 65 70 75 80 TyrGluMetValSerAlaValTrpHisGlyAspTyrAsnPhePheCys 85 90 95 GlnAspThrHisSerAlaGlyGluThrAspThrLysIleIleAsnVal 100 105 110 LeuTrpTrpTyrTyrPheSerLysLeuIleGluPheMetAspThrPhe 115 120 125 PhePheIleLeuArgLysAsnAsnHisGlnIleThrPheLeuHisIle 130 135 140 TyrHisHisAlaSerMetLeuAsnIleTrpTrpPheValMetAsnTrp 145 150 155 160 ValProCysGlyHisSerTyrPheGlyAlaSerLeuAsnSerPheIle 165 170 175 HisValLeuMetTyrSerTyrTyrGlyLeuSerAlaValProAlaLeu 180 185 190 ArgProTyrLeuTrpTrpLysLysTyrIleThrGlnValGlnLeuIle 195 200 205 GlnphepheleuthroporglnTrilecysalavaliletrppro 210 215 220 CYSASPPHEPREPHEPROARGGRYTLYTRAPYRPHELPHELPHELPHEGNYREVRPPRO lThrProThrGluThrIleThr 275 280 285 93HisArgLysValArgGlyAsp 290 295 <210> 55<211> 6753<212> DNA<213> Oncorhynchusmykiss<220><221> CDS<222> (513)..(1397)<223> Δ5-elongase<400> 55acggattagaagccgccgagcgggtgacagccctccgaaggaagactctcctccgtgcgt 60cctcgtcctcaccggtcgcgttcctgaaacgcagatgtgcctcgcgccgcactgctccga 120acaataaagattctacaatactagcttttatggttatgaagaggaaaaattggcagtaac 180ctggccccacaaaccttcaaatgaacgaatcaaattaacaaccataggatgataatgcga 240ttagttttttagccttatttctggggtaattaatcagcgaagcgatgatttttgatctat 300taacagatatataaatgcaaaaactgcattaaccactttaactaatactttcaacatttt 360cggtttgtattacttcttattcaaatgtaataaaagtatcaacaaaaaattgttaatata 420cctctatactttaacgtcaaggagaaaaaaccccggatcggactactagcagctgtaata 480cgactcactatagggaatattaagcttacataatggagacttttaattataaa 533 MetGluThrPheAsnTyrLys 1 5 ctaaacatgtacatagactcatggatgggtcccagagatgagcgggta 581LeuAsnMetTyrIleAspSerTrpMetGlyProArgAspGluArgVal 10 15 20 cagggatggctgcttctggacaactaccctccaacctttgcactaaca 629GlnGlyTrpLeuLeuLeuAspAsnTyrProProThrPheAlaLeuThr 25 30 35 gtcatgtacctgctgatcgtatggatggggcccaagtacatgag acac 677ValMetTyrLeuLeuIleValTrpMetGlyProLysTyrMetArgHis 40 45 50 55 agacagccggtgtcttgccggggtctcctcttggtctacaatctgggc 725ArgGlnProValSerCysArgGlyLeuLeuLeuValTyrAsnLeuGly 60 65 70 ctcacgatcttgtccttctatatgttctatgagatggtgtctgctgtg 773LeuThrIleLeuSerPheTyrMetPheTyrGluMetValSerAlaVal 75 80 85 tggcacggggattataacttcttttgccaagacacacacagtgcagga 821 94TrpHisGlyAspTyrAsnPhePheCysGlnAspThrHisSerAlaGly 90 95 100 gaaaccgataccaagatcataaatgtgctgtggtggtactacttctcc 869GluThrAspThrLysIleIleAsnValLeuTrpTrpTyrTyrPheSer 105 110 115 aagctcatagagtttatggataccttcttcttcatcctgcggaagaac 917LysLeuIleGluPheMetAspThrPhePhePheIleLeuArgLysAsn 120 125 130 135 aaccatcaaatcacgtttctgcacatctaccaccatgctagcatgctc 965AsnHisGlnIleThrPheLeuHisIleTyrHisHisAlaSerMetLeu 140 145 150 aacatctggtggttcgtcatgaactgggtgccctgtggtcactcctac 1013AsnIleTrpTrpPheValMetAsnTrpValProCysGlyHisSerTyr 155 160 165 tttggtgcctccctgaacagcttcatccatgtcctgatgtactcttac 1061PheGlyAlaSerLeuAsnSerPheIleHisValLeuMetTyrSerTyr 170 175 180 tatgggctctctgctgtcccggccttgcggccctatctatggtggaag 1109TyrGlyLeuSerAlaValProAlaLeuArgProTyrLeuTrpTrpLys 185 190 195 aaatacatcacacaagtacagctgattcagttctttttgaccatgtcc 1157LysTyrIleThrGlnValGlnLeuIleGlnPhePheLeuThrMetSer 200 205 210 215 cagacgatatgtgcagtcatttggccatgtgatttccccagagggtgg 1205GlnThrIleCysAlaValIleTrpProCysAspPheProArgGlyTrp 220 225 230 ctgtatttccagatattctatg tcatcacacttattgcccttttctca 1253LeuTyrPheGlnIlePheTyrValIleThrLeuIleAlaLeuPheSer 235 240 245 aacttctacattcagacttacaagaaacaccttgtttcacaaaagaag 1301AsnPheTyrIleGlnThrTyrLysLysHisLeuValSerGlnLysLys 250 255 260 gagtatcatcagaatggctctgttgcttcattgaatggccatgtgaat 1349GluTyrHisGlnAsnGlySerValAlaSerLeuAsnGlyHisValAsn 265 270 275 ggggtgacacccacggaaaccattacacacaggaaagtgaggggggac 1397GlyValThrProThrGluThrIleThrHisArgLysValArgGlyAsp 280 285 290 295 tgaaggatccactagtaacggccgccagtgtgctggaattctgcagatatccagcacagt 1457ggcggccgctcgagtctagagggcccttcgaaggtaagcctatccctaaccctctcctcg 1517gtctcgattctacgcgtaccggtcatcatcaccatcaccattgagtttaaacccgctgat 1577cctagagggccgcatcatgtaattagttatgtcacgcttacattcacgccctccccccac 1637atccgctctaaccgaaaaggaaggagttagacaacctgaagtctaggtccctatttattt 1697ttttatagttatgttagtattaagaacgttatttatatttcaaatttttcttttttttct 1757gtacagacgcgtgtacgcatgtaacattatactgaaaaccttgcttgagaaggttttggg 1817acgctcgaaggctttaatttgcaagctgcggccctgcattaatgaatcggccaacgcgcg 1877gggagaggcggtttgcgtattgggcgctcttccgcttcctcg ctcactgactcgctgcgc 1937 95 tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc 1997 acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca aaagcccagg 2057 aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat 2117 cacaaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag 2177 gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga 2237 tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg 2297 tatctcagtt cggtgtaggt cgttcgctcc aagctggggct gtgtgcacga accccccgtt 2357 cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac 2417 gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc 2477 ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag gacagtattt 2537 ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc 2597 ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc 2657 agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg 2717 aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag 2777 atccttttaa attaaaatg aagttttaaa tcaatctaaa gtatatatga gtaaacttgg 2837 tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt 2897 tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga gcgcttacca 2957 tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca 3017 gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc 3077 tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatatagt 3137 ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg 3197 gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc 3257 aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg 3317 ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga 3377 tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga 3437 ccgagttgct cttgcccggc gtcaacacgg gataataccg cgccacatag cagaacttta 3497 aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg 3557 ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact 3617 ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata 3677 agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt 3737 tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa aaataaaacaa 3797 ataggggttc cgcgcacatt tccccgaaaa gtgccacctg acgtctaaga aaccattatt 3857 atcatgacat taacctataa aaataggcgt atcacgaggc cctttcgtct tcaagaaatt 3917 cggtcgaaaa aagaaaagga gagggccaag agggagggca ttggtgacta ttgagcacgt 3977 96 gagtatacgt gattaagcac acaaaggcag cttggagtat gtctgttat aatttcacag 4037 gtagttctgg tccattggtg aaagtttgcg gcttgcagag cacagaggcc gcagaatgtg 4097 ctctagattc cgatgctgac ttgctggggta ttatatgtgt gcccaataga aagagaacaa 4157 ttgacccggt tattgcaagg aaaatttcaa gtcttgtaaa agcatataaa aatagttcag 4217 gcactccgaa atacttggtt ggcgtgtttc gtaatcaacc taaggaggat gttttggctc 4277 tggtcaatga ttacggcatt gatatcgtcc aactgcacgg agatgagtcg tggcaagaat 4337 accaagagtt cctcggtttg ccagttatta aaagactcgt atttccaaaa gactgcaaca 4397 tactactcag tgcagcttca cagaaacctc attcgtttat tcccttgttt gattcagaag 4457 caggtgggac aggtgaactt ttggattgga actcgatttc tgactgggtt ggaaggcaag 4517 agagccccga gagcttacat tttatgttag ctggtggact gacgccagaa aatgttggtg 4577 atgcgcttag attaaatggc gttatggtg ttgatgtaag cggaggtgtg gagacaaatg 4637 gtgtaaaaga ctctaacaaa atagcaaatt tcgtcaaaaa tgctaagaaa taggttatta 4697 ctgagtagta tttatttaag tattgtttgt gcacttgccc tagcttatcg atgataagct 4757 gtcaaagatg agaattaatt ccacggacta tagactatac tagactcc gtctactgta 4817 cgatacactt ccgctcaggt ccttgtcctt taacgaggcc ttaccactct tttgttactc 4877 tattgatcca gctcagcaaa ggcagtgtga tctaagattc tatcttgcg atgtagtaaa 4937 actagctaga ccgagaaaga gactagaaat gcaaaaggca cttctacaat ggctgccatc 4997 attattatcc gatgtgacgc tgcagcttct caatgatatt cgaatacgct ttgaggagat 5057 acagcctaat atccgacaaa ctgttttaca gatttacgat cgtacttgtt acccatcatt 5117 gaattttgaa catccgaacc tgggagttt ccctgaaaca gatagtatat ttgaacctgt 5177 samaaatat atagtctagc gctttacgga agacaatgta tgtatttcgg ttcctggaga 5237 aactattgca tctattgcat aggtaatctt gcacgtcgca tccccggttc attttctgcg 5297 tttccatctt gcattcaat agcatatctt tgttaacgaa gcatctgtgc ttcattttgt 5357 agaacaaaaa tgcaacgcga gagcgctaat ttttcaaaca aagaatctga gctgcatttt 5417 tacagaacag aaatgcaacg cgaaagcgct attttaccaa cgaagaatct gtgcttcatt 5477 tttgtaaaac aaaaatgcaa cgcgacgaga gcgctaattt ttcaaacaaa gaatctgagc 5537 tgcattttta cagaacagaa atgcaacgcg agagcgctat tttaccaaca aagaatctat 5597 acttcttttt tgttctacaa aaatgcatcc cgagagcgct attttctaa caaagcatct 5657 tagattactt tttttctcct ttgtgcgctc tataatgcag tctcttgata actttttgca 5717 ctgtaggtcc gttaaggtta gaagaaggct actttggtgt ctattttctc ttccataaaa 5777 aaagcctgac tccacttccc gcgtttactg attactagcg aagctgcggg tgcatttttt 5837 caagataaag gcatccccga ttatattcta taccgatgtg gattgcgcat actttgtgaa 5897 cagaaagtga tagcgttgat gattcttcat tggtcagaaa attatgaacg gtttcttcta 5957 ttttgtctct atatactacg tataggaaat gtttacattt tcgtattgtt ttcgattcac 6017 97 tctatgaata gttcttacta caattttttt gtctaaagag taatactaga gataaacata 6077 aaaaatgtag aggtcgagtt tagatgcaag ttcaaggagc gaaaggtgga tgggtaggtt 6137 atatagggat atagcacaga gatatatagc aaagagatac ttttgagcaa tgtttgtgga 6197 agcggtattc gcaatgggaa gctccacccc ggttgataat cagaaaagcc ccaaaaacag 6257 gaagattgta taagcaaata tttaaattgt aaacgttaat attttgttaa aattcgcgtt 6317 aaatttttgt taaatcagct cattttttaa cgaatagccc gaaatcggca aaatccctta 6377 taaatcaaaa gaatagaccg agatagggtt gagtgttgtt ccagtttcca acaagagtcc 6437 actattaaag aacgtggact ccaacgtcaa agggcgaaaa agggtctatc agggcgatgg 6497 cccactacgt gaaccatcac cctaatcaag ttttttgggg tcgaggtgcc gtaaagcagt 6557 aaatcggaag ggtaaacgga tgcccccatt tagagcttga cggggaaagc cggcgaacgt 6617 ggcgagaaag gaagggaaga aagcgaaagg agcggggct agggcggtgg gaagtgtagg 6677 ggtcacgctg ggcgtaacca ccacacccgc cgcgcttaat ggggcgctac agggcgcgtg 6737 gggatgatcc actagt 6753 <210> 56 <211> 295 <212> PRT <213> Oncorhynchus mykiss <400> 56 Met Glu Thr Phe Asn Tyr Lys Leu Asn Met Tyr Ile Asp Ser Trp Met 1 5 10 15 Gly Pro Arg Asp Glu Arg Val Gln Gly Trp Leu Leu Leu Asp Asn Tyr 20 25 30 Pro Pro Thr Phe Ala Leu Thr Val Met Tyr Leu Leu Ile Val Trp Met 35 40 45 Gly Pro Lys Tyr Met Arg His Arg Gln Pro Val Ser Cys Arg Gly Leu 50 55 60 Leu Leu Val Tyr Asn Leu Gly Leu Thr Ile Leu Ser Phe Tyr Met Phe 65 70 75 80 Tyr Glu Met Val Ser Ala Val Trp His Gly Asp Tyr Asn Phe Phe Cys 85 90 95 Gln Asp Thr His Ser Ala Gly Glu Thr Asp Thr Lys Ile Ile Asn Val 100 105 110 98LeuTrpTrpTyrTyrPheSerLysLeuIleGluPheMetAspThrPhe 115 120 125 PhePheIleLeuArgLysAsnAsnHisGlnIleThrPheLeuHisIle 130 135 140 TyrHisHisAlaSerMetLeuAsnIleTrpTrpPheValMetAsnTrp 145 150 155 160 ValProCysGlyHisSerTyrPheGlyAlaSerLeuAsnSerPheIle 165 170 175 HisValLeuMetTyrSerTyrTyrGlyLeuSerAlaValProAlaLeu 180 185 190 ArgProTyrLeuTrpTrpLysLysTyrIleThrGlnValGlnLeuIle 195 200 205 GlnPhePheLeuThrMetSerGlnThrIleCysAlaValIleTrpPro 210 215 220 CysAspPheProArgGlyTrpLeuTyrPheGlnIlePheTyrValIle 225 230 235 240 ThrLeuIleAlaLeuPheSerAsnPheTyrIleGlnThrTyrLysLys 245 250 255 HisLeuValSerGlnLysLysGluTyrHisGlnAsnGlySerValAla 260 265 270 SerLeuAsnGlyHisValAsnGlyValThrProThrGluThrIleThr 275 280 285 HisArgLysValArgGlyAsp 290 295 < 210> 57<211> 6645<212> DNA<213> Oncorhynchusmykiss<220><221> CDS<222> (513)..(1304)<223> Δ5-elongase 99<400> 57acggattagaagccgccgagcgggtgacagccctccgaaggaagactctcctccgtgcgt 60cctcgtcctcaccggtcgcgttcctgaaacgcagatgtgcctcgcgccgcactgctccga 120acaataaagattctacaatactagcttttatggttatgaagaggaaaaattggcagtaac 180ctggccccacaaaccttcaaatgaacgaatcaaattaacaaccataggatgataatgcga 240ttagttttttagccttatttctggggtaattaatcagcgaagcgatgatttttgatctat 300taacagatatataaatgcaaaaactgcattaaccactttaactaatactttcaacatttt 360cggtttgtattacttcttattcaaatgtaataaaagtatcaacaaaaaattgttaatata 420cctctatactttaacgtcaaggagaaaaaaccccggatcggactactagcagctgtaata 480cgactcactatagggaatattaagcttacataatggcttcaacatggcaaagc 533 MetAlaSerThrTrpGlnSer 1 5 gttcagtccatgcgccagtggattttagagaatggagataaaaggaca 581ValGlnSerMetArgGlnTrpIleLeuGluAsnGlyAspLysArgThr 10 15 20 gacccatggctactggtctactcccctatgccagtggccattatattc 629AspProTrpLeuLeuValTyrSerProMetProValAlaIleIlePhe 25 30 35 ctcctctatcttggtgtggtctgggctgggcccaagctgatgaaacgc 677LeuLeuTyrLeuGlyValValTrpAlaGlyProLysLeuMetLysArg 40 45 50 55 agggaaccagttgatctcaaggctgtactcattgtctacaacttcgcc 725ArgGluProV alAspLeuLysAlaValLeuIleValTyrAsnPheAla 60 65 70 atggtctgcctgtctgtctacatgttccatgagttcttggtcacgtcc 773MetValCysLeuSerValTyrMetPheHisGluPheLeuValThrSer 75 80 85 ttgctgtctaactacagttacctgtgtcaacctgtggattacagcact 821LeuLeuSerAsnTyrSerTyrLeuCysGlnProValAspTyrSerThr 90 95 100 agtccactggcgatgaggatggccaaagtatgctggtggtttttcttc 869SerProLeuAlaMetArgMetAlaLysValCysTrpTrpPhePhePhe 105 110 115 tccaaggtcatagaattggctgacacggtgttcttcatcctgaggaag 917SerLysValIleGluLeuAlaAspThrValPhePheIleLeuArgLys 120 125 130 135 aagaacagtcagctgactttcctgcatgtctatcaccatggcaccatg 965LysAsnSerGlnLeuThrPheLeuHisValTyrHisHisGlyThrMet 140 145 150 atcttcaactggtgggcaggggtcaagtatctggctggaggccaatcg 1013IlePheAsnTrpTrpAlaGlyValLysTyrLeuAlaGlyGlyGlnSer 155 160 165 ttcttcatcggcctgctcaatacctttgtgcacatcgtgatgtactct 1061PhePheIleGlyLeuLeuAsnThrPheValHisIleValMetTyrSer 170 175 180 tactacggactggctgccctggggcctcacacgcagaagtacttatgg 1109TyrTyrGlyLeuAlaAlaLeuGlyProHisThrGlnLysTyrLeuTrp 185 190 195 100 tgg aag cgc tat ctg acc tca ctg cag ctg ctc cag ttt gtc ctg ttg 1157 Trp Lys Arg Tyr Leu Thr Ser Leu Gln Leu Leu Gln Phe Val Leu Leu 200 205 210 215 acc act cac act ggc tac aac ctc ttc act gag tgt gac ttc ccg gac 1205 Thr Thr His Thr Gly Tyr Asn Leu Phe Thr Glu Cys Asp Phe Pro Asp 220 225 230 tcc atg aac gct gct gtg gtg ttt gcc tac tgt gtc agt ctc att gct ctc 1253 Ser Met Asn Ala Val Val Phe Ala Tyr Cys Val Ser Leu Ile Ala Leu 235 240 245 ttc agc aac ttc tac tat cag agc tac ctc aac agg aag agc aag aag 1301 Phe Ser Donkey Phe Tyr Tyr Gln Ser Tyr Leu Donkey Arg Light Ser Light Light 250 255 260 aca taaggatcca ctagtaacgg ccgccagtgt gctgggaattc tgcagatatc 1354 Thr catcacactg gcggccgctc gagcatgcat ctagagggcc gcatcatgta attagttatg 1414 tcacgcttac attcacgccc tccccccaca tccgctctaa ccgaaaagga aggagttaga 1474 caacctgaag tctaggtccc tatttatttt tttatagtta tgttagtatt aagaacgtta 1534 tttatatttc aaatttttct ttttttctg tacagacgcg tgtacgcatg taacattata 1594 ctgaaaacct tgcttgagaa ggttttggga cgctcgaagg ctttaatttg cggccctgca 1654 ttaatgaatc ggccaacgcg cggggagagg cggtttgcgt attgggcgct cttccgcttc 1714 ctcgctcact gactcgctgc gctcggtcgt tcggctgcgg cgagcggtat cagctcactc 1774 aaaggcggta atacggttat ccacagaatc aggggataac gcaggaaaga acatgtgagc 1834 aaaaggccag caaaagccca ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag 1894 gctccgcccc cctgacgagc atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc 1954 gacaggacta taaagatacc aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt 2014 tccgaccctg ccgcttaccg gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct 2074 ttctcatagc tcacgctgta ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg 2134 ctgtgtgcac gaaccccccg ttcagcccga ccgctgcgcc ttatccggta actatcgtct 2194 tgagtccaac ccggtaagac acgacttatc gccactggca gcagccactg gtaacaggat 2254 tagcagagcg aggtatgtag gcggtgctac agagttcttg aagtggtggc ctaactacgg 2314 ctacactaga aggacagtat ttggtatctg cgctctgctg aagccagtta ccttcggaaa 2374 aagagttggt agctcttgat ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt 2434 ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc 2494 tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt 2554 atcaaaaagg atcttcacct agatcctttt aaattaaaaa tgaagtttta aatcaatcta 2614 aagtatat gagtaaactt ggtctgacag ttaccaatgc ttaatcagtg aggcacctat 2674 ctcagcgatc tgtctatttc gttcatccat agttgcctga ctccccgtcg tgtagataac 2734 tacgatacgg gagcgcttac catctggccc cagtgctgca atgataccgc gagacccacg 2794 101 ctcaccggct ccagatttat cagcaataaa ccagccagcc ggaagggccg agcgcagaag 2854 tggtcctgca actttatccg cctcattca gtctattaat tgttgccggg aagctagagt 2914 aagtagttcg ccagttaata gtttgcgcaa cgttgttggc attgctacag gcatcgtggt 2974 gtcactctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat caaggcgagt 3034 tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt 3094 cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc ataattctct 3154 tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa ccaagtcatt 3214 ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaatac gggataatag 3274 tgtatcacat agcagaactt taaaagtgct catcattgga aaacgttctt cggggcgaaa 3334 actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc gtgcacccaa 3394 ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa caggaaggca 3454 aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca tactcttcct 3514 ttttcaatgg gtaataactg atataattaa attgaagctc taatttgtga gtttagtata 3574 catgcattta cttataatac agtttttag ttttgctggc cgcatcttct caaatatgct 3634 tcccagcctg cttttctgta acgttcaccc tctaccttag catcccttcc ctttgcaaat 3694 agtcctcttc caacaataat aatgtcagat cctgtagaga ccacatcatc cacggttcta 3754 tactgttgac ccaatgcgtc tcccttgtca tctaaaccca caccgggtgt cataatcaac 3814 caatcgtaac cttcatctct tccacccatg tctctttgag caataaagcc gataacaaaa 3874 tctttgtcgc tcttcgcaat gtcaacagta cccttagtat attctccagt agatagggag 3934 cccttgcatg acaattctgc taacatcaaa aggcctctag gttcctttgt tacttcttct 3994 gccgcctgct tcaaaccgct aacaatacct gggcccacca caccgtgtgc attcgtaatg 4054 tctgcccatt ctgctattct gtatacaccc gcagagtact gcaatttgac tgtattacca 4114 atgtcagcaa attttctgtc ttcgaagagt aaaaaattgt acttggcgga taatgccttt 4174 agcggcttaa ctgtgccctc catggaaaaa tcagtcaaga tatccacatg tgtttttagt 4234 aaacaaattt tgggacctaa tgcttcaact aactccagta attccttggt ggtacgaaca 4294 tccaatgaag cacacaagtt tgtttgcttt tcgtgcatga tattaaatag cttggcagca 4354 acaggactag gatgagtagc agcacgttcc ttatatgtag ctttcgacat gatttatctt 4414 cgtttcctgc aggttttgt tctgtgcagt tgggttaaga atactgggca atttcatgtt 4474 tcttcaacac tacatatgcg tatatatacc aatctaagtc tgtgctcctt ccttcgttct 4534 tccttctgtt cggagattac cgaatcaaaa aaatttcaaa gaaaccgaaa tcaaaaaaaa 4594 gaataaaaaa aaaatgatga attgaattga aaagctagct tatcgatgat aagctgtcaa 4654 agatgagaat taattccacg gactatagac tatactagat actccgtcta ctgtacgata 4714 cacttccgct caggtccttg tcctttaacg aggccttacc actcttttgt tactctattg 4774 atccagctca gcaaaggcag tgtgatctaa gattctatct tcgcgatgta gtaaaactag 4834 102 ctagaccgag aaagagacta gaaatgcaaa aggcacttct acaatggctg ccatcattat 4894 tatccgatgt gacgctgcag cttctcaatg atattcgaat acgctttgag gagatacagc 4954 ctaatatccg acaaactgtt ttacagattt acgatcgtac ttgttaccca tcattgaatt 5014 ttgaacatcc gaacctggga gttttccctg aaacagatag tatatttgaa cctgtataat 5074 aatatatagt ctagcgcttt acggaagaca atgtatgtat ttcggttcct ggagaaacta 5134 ttgcatctat tgcataggta atcttgcacg tcgcatcccc ggttcatttt ctgcgtttcc 5194 atcttgcact tcaatagcat atctttgtta acgaagcatc tgtgcttcat tttgtagaac 5254 aaaaatgcaa cgcgagagcg ctaatttttc aaacaaagaa tctgagctgc atttttacag 5314 aacagaaatg caacgcgaaa gcgctatttt accaacgaag aatctgtgct tcatttttgt 5374 aaaacaaaaa tgcaacgcga cgagagcgct aatttttcaa acaaagaatc tgagctgcat 5434 ttttacagaa cagaaatgca acgcgagagc gctattttac caacaaagaa tctatacttc 5494 ttttttgttc tacaaaaatg catcccgaga gcgctatttt tctaacaaag catcttagat 5554 tacttttttt ctcctttgtg cgctctataa tgcagtctct tgataacttt ttgcactgta 5614 ggtccgttaa ggttagaaga aggctacttt ggtgtctatt ttctcttcca taaaaaaagc 5674 ctgactccac ttcccgcgtt tactgattac tagcgaagct gcgggtgcat tttttcaaga 5734 taaaggcatc cccgattata ttctataccg atgtggattg cgcatacttt gtgaacagaa 5794 agtgatagcg ttgatgattc ttcattggtc agaaaattat gaacggtttc ttctattttg 5854 tctctatata ctacgtatag gaaatgttta cattttcgta ttgttttcga ttcactctat 5914 gaatagttct tactacaatt tttttgtcta aagagtaata ctagagataa acataaaaaa 5974 tgtagaggtc gagtttagat gcaagttcaa ggagcgaaag gtggatgggt aggttatata 6034 gggatatagc acagagatat atagcaaaga gatacttttg agcaatgttt gtggaagcgg 6094 tattcgcaat gggaagctcc accccggttg ataatcagaa aagccccaaa aacaggaaga 6154 ttgtataagc aaatatttaa attgtaaacg ttaatatttt gttaaaattc gcgttaaatt 6214 tttgttaaat cagctcattt tttaacgaat agcccgaaat cggcaaaatc ccttataaat 6274 caaaagaata gaccgagata gggttgagtg ttgttccagt ttccaacaag agtccactat 6334 taaagaacgt ggactccaac gtcaaagggc gaaaaagggt ctatcagggc gatggcccac 6394 tacgtgaacc atcaccctaa tcaagttttt tggggtcgag gtgccgtaaa gcagtaaatc 6454 ggaagggtaa acggatgccc ccattagag cttgacgggg aaagccggcg aacgtggcga 6514 gaaaggaagg gaagaaagcg aaaggagcgg gggctagggc ggtgggaagt gtaggggtca 6574 cgctgggcgt aaccaccaca cccgccgcgc ttaatggggc gctacagggc gcgtggggat 6634 gatccactag t 6645 <210> 58 <211> 264 103<212> PRT<213> Oncorhynchusmykiss<400> 58MetAlaSerThrTrpGlnSerValGlnSerMetArgGlnTrpIleLeu 1 5 10 15 GluAsnGlyAspLysArgThrAspProTrpLeuLeuValTyrSerPro 20 25 30 MetProValAlaIleIlePheLeuLeuTyrLeuGlyValValTrpAla 35 40 45 GlyProLysLeuMetLysArgArgGluProValAspLeuLysAlaVal 50 55 60 LeuIleValTyrAsnPheAlaMetValCysLeuSerValTyrMetPhe 65 70 75 80 HisGluPheLeuValThrSerLeuLeuSerAsnTyrSerTyrLeuCys 85 90 95 GlnProValAspTyrSerThrSerProLeuAlaMetArgMetAlaLys 100 105 110 ValCysTrpTrpPhePhePheSerLysValIleGluLeuAlaAspThr 115 120 125 ValPhePheIleLeuArgLysLysAsnSerGlnLeuThrPheLeuHis 130 135 140 ValTyrHisHisGlyThrMetIlePheAsnTrpTrpAlaGlyValLys 145 150 155 160 TyrLeuAlaGlyGlyGlnSerPhePheIleGlyLeuLeuAsnThrPhe 165 170 175 ValHisIleValMetTyrSerTyrTyrGlyLeuAlaAlaLeuGlyPro 180 185 190 HisThrGlnLysTyrLeuTrpTrpLysArgTyrLeuThrSerLeuGln 195 200 205 LeuLeuGlnPheValLeuLeuThrThrHisThrGlyTyrAsnLeuPhe 210 215 220 ThrGluCysAspPheProAspSerMetAsnAlaValValPheAlaTyr 225 230 235 240 104CysValSerLeuIleAlaLeuPheSerAsnPheTyrTyrGlnSerTyr 245 250 255 LeuAsnArgLysSerLysLysThr 260 <210> 59<211> 1077<212> DNA<213> Thalassiosirapseudonana<220><221> CDS<222> (1)..(1077)<223> Δ5-elongase<400> 59atgtgctcatcaccgccgtcacaatccaaaacaacatccctcctagca 48MetCysSerSerProProSerGlnSerLysThrThrSerLeuLeuAla 1 5 10 15 cggtacaccaccgccgccctcctcctcctcaccctcacaacatggtgc 96ArgTyrThrThrAlaAlaLeuLeuLeuLeuThrLeuThrThrTrpCys 20 25 30 cacttcgccttcccagccgccaccgccacacccggcctcaccgccgaa 144HisPheAlaPheProAlaAlaThrAlaThrProGlyLeuThrAlaGlu 35 40 45 atgcactcctacaaagtcccactcggtctcaccgtattctacctgctg 192MetHisSerTyrLysValProLeuGlyLeuThrValPheTyrLeuLeu 50 55 60 agtctaccgtcactaaagtacgttacggacaactaccttgccaaaaag 240SerLeuProSerLeuLysTyrValThrAspAsnTyrLeuAlaLysLys 65 70 75 80 tatgatatgaagtcactcctaacggaatcaatggtgttgtacaatgtg 288TyrAspMetLysSerLeuLeuThrGluSerMetValLeuTyrAsnVal 85 90 95 gcgcaagtgctgctcaatgggtggacggtgtatgcgattgtggatgcg 336AlaGlnValLeuLeuAsnGlyTrpThrValTyrAlaIleValAspAla 100 105 110 gtgatgaatagagaccatcc gtttattggaagtagaagtttggttggg 384ValMetAsnArgAspHisProPheIleGlySerArgSerLeuValGly 115 120 125 gcggcgttgcatagtgggagctcgtatgcggtgtgggttcattattgt 432AlaAlaLeuHisSerGlySerSerTyrAlaValTrpValHisTyrCys 130 135 140 gataagtatttggagttctttgatacgtattttatggtgttgaggggg 480AspLysTyrLeuGluPhePheAspThrTyrPheMetValLeuArgGly 145 150 155 160 105aaaatggaccaggtctccttcctccacatctaccaccacacgaccata 528LysMetAspGlnValSerPheLeuHisIleTyrHisHisThrThrIle 165 170 175 gcgtgggcatggtggatcgccctccgcttctcccccggtggagacatt 576AlaTrpAlaTrpTrpIleAlaLeuArgPheSerProGlyGlyAspIle 180 185 190 tacttcggggcactcctcaactccatcatccacgtcctcatgtattcc 624TyrPheGlyAlaLeuLeuAsnSerIleIleHisValLeuMetTyrSer 195 200 205 tactacgcccttgccctactcaaggtcagttgtccatggaaacgatac 672TyrTyrAlaLeuAlaLeuLeuLysValSerCysProTrpLysArgTyr 210 215 220 ctgactcaagctcaattattgcaattcacaagtgtggtggtttatacg 720LeuThrGlnAlaGlnLeuLeuGlnPheThrSerValValValTyrThr 225 230 235 240 gggtgtacgggttatactcattactatcatacgaagcatggagcggat 768GlyCysThrGlyTyrThrHisTyrTyrHisThrLysHisGlyAlaAsp 245 250 255 gagacacagcctagtttaggaacgtattatttctgttgtggagtgcag 816GluThrGlnProSerLeuGlyThrTyrTyrPheCysCysGlyValGln 260 265 270 gtgtttgagatggttagtttgtttgtactcttttccatcttttataaa 864ValPheGluMetValSerLeuPheValLeuPheSerIlePheTyrLys 275 280 285 cgatcctattcgaagaagaacaagtcaggaggaaaggatagcaagaag 912ArgSerTyrSerLysLysAsnLysSerGlyGlyLysA spSerLysLys 290 295 300 aatgatgatgggaataatgaggatcaatgtcacaaggctatgaaggat 960AsnAspAspGlyAsnAsnGluAspGlnCysHisLysAlaMetLysAsp 305 310 315 320 atatcggagggtgcgaaggaggttgtggggcatgcagcgaaggatgct 1008IleSerGluGlyAlaLysGluValValGlyHisAlaAlaLysAspAla 325 330 335 ggaaagttggtggctacggcgagtaaggctgtaaagaggaagggaact 1056GlyLysLeuValAlaThrAlaSerLysAlaValLysArgLysGlyThr 340 345 350 cgtgttactggtgccatgtag 1077ArgValThrGlyAlaMet 355 <210> 60<211> 358<212> PRT<213> Thalassiosirapseudonana<400> 60MetCysSerSerProProSerGlnSerLysThrThrSerLeuLeuAla 1 5 10 15 106ArgTyrThrThrAlaAlaLeuLeuLeuLeuThrLeuThrThrTrpCys 20 25 30 HisPheAlaPheProAlaAlaThrAlaThrProGlyLeuThrAlaGlu 35 40 45 MetHisSerTyrLysValProLeuGlyLeuThrValPheTyrLeuLeu 50 55 60 SerLeuProSerLeuLysTyrValThrAspAsnTyrLeuAlaLysLys 65 70 75 80 TyrAspMetLysSerLeuLeuThrGluSerMetValLeuTyrAsnVal 85 90 95 AlaGlnValLeuLeuAsnGlyTrpThrValTyrAlaIleValAspAla 100 105 110 ValMetAsnArgAspHisProPheIleGlySerArgSerLeuValGly 115 120 125 AlaAlaLeuHisSerGlySerSerTyrAlaValTrpValHisTyrCys 130 135 140 AspLysTyrLeuGluPhePheAspThrTyrPheMetValLeuArgGly 145 150 155 160 LysMetAspGlnValSerPheLeuHisIleTyrHisHisThrThrIle 165 170 175 AlaTrpAlaTrpTrpIleAlaLeuArgPheSerProGlyGlyAspIle 180 185 190 TyrPheGlyAlaLeuLeuAsnSerIleIleHisValLeuMetTyrSer 195 200 205 TyrTyrAlaLeuAlaLeuLeuLysValSerCysProTrpLysArgTyr 210 215 220 LeuThrGlnAlaGlnLeuLeuGlnPheThrSerValValValTyrThr 225 230 235 240 GlyCysThrGlyTyrThrHisTyrTyrHisThrLysHisGlyAlaAsp 245 250 255 GluThrGlnProSerLeuGlyThrTyrTyrPheCysCysGlyValGln 260 265 270 ValPheGluMetValSerLeuPheV alLeuPheSerIlePheTyrLys 275 280 285 107ArgSerTyrSerLysLysAsnLysSerGlyGlyLysAspSerLysLys 290 295 300 AsnAspAspGlyAsnAsnGluAspGlnCysHisLysAlaMetLysAsp 305 310 315 320 IleSerGluGlyAlaLysGluValValGlyHisAlaAlaLysAspAla 325 330 335 GlyLysLeuValAlaThrAlaSerLysAlaValLysArgLysGlyThr 340 345 350 ArgValThrGlyAlaMet 355 <210> 61<211> 933<212> DNA<213> Thalassiosirapseudonana<220><221> CDS<222> (1).. (933)<223> Δ5-elongase<400> 61atgcactcctacaaagtcccactcggtctcaccgtattctacctgctg 48MetHisSerTyrLysValProLeuGlyLeuThrValPheTyrLeuLeu 1 5 10 15 agtctaccgtcactaaagtacgttacggacaactaccttgccaaaaag 96SerLeuProSerLeuLysTyrValThrAspAsnTyrLeuAlaLysLys 20 25 30 tatgatatgaagtcactcctaacggaatcaatggtgttgtacaatgtg 144TyrAspMetLysSerLeuLeuThrGluSerMetValLeuTyrAsnVal 35 40 45 gcgcaagtgctgctcaatgggtggacggtgtatgcgattgtggatgcg 192AlaGlnValLeuLeuAsnGlyTrpThrValTyrAlaIleValAspAla 50 55 60 gtgatgaatagagaccatccgtttattggaagtagaagtttggttggg 240ValMetAsnArgAspHisProPheIleGlySerArgSerLeuValGly 65 70 75 80 gcggcgttgcatagtgggagctcgtatgcggtgtgggttcattattgt 288AlaAlaLeuHis SerGlySerSerTyrAlaValTrpValHisTyrCys 85 90 95 gataagtatttggagttctttgatacgtattttatggtgttgagggg 336 108AspLysTyrLeuGluPhePheAspThrTyrPheMetValLeuArgGly 100 105 110 aaaatggaccaggtctccttcctccacatctaccaccacacgaccata 384LysMetAspGlnValSerPheLeuHisIleTyrHisHisThrThrIle 115 120 125 gcgtgggcatggtggatcgccctccgcttctcccccggtggagacatt 432AlaTrpAlaTrpTrpIleAlaLeuArgPheSerProGlyGlyAspIle 130 135 140 tacttcggggcactcctcaactccatcatccacgtcctcatgtattcc 480TyrPheGlyAlaLeuLeuAsnSerIleIleHisValLeuMetTyrSer 145 150 155 160 tactacgcccttgccctactcaaggtcagttgtccatggaaacgatac 528TyrTyrAlaLeuAlaLeuLeuLysValSerCysProTrpLysArgTyr 165 170 175 ctgactcaagctcaattattgcaattcacaagtgtggtggtttatacg 576LeuThrGlnAlaGlnLeuLeuGlnPheThrSerValValValTyrThr 180 185 190 gggtgtacgggttatactcattactatcatacgaagcatggagcggat 624GlyCysThrGlyTyrThrHisTyrTyrHisThrLysHisGlyAlaAsp 195 200 205 gagacacagcctagtttaggaacgtattatttctgttgtggagtgcag 672GluThrGlnProSerLeuGlyThrTyrTyrPheCysCysGlyValGln 210 215 220 gtgtttgagatggttagtttgtttgtactcttttccatcttttataaa 720ValPheGluMetValSerLeuPheValLeuPheSerIlePheTyrLys 225 230 235 240 cgatcctattcgaagaagaacaag tcaggaggaaaggatagcaagaag 768ArgSerTyrSerLysLysAsnLysSerGlyGlyLysAspSerLysLys 245 250 255 aatgatgatgggaataatgaggatcaatgtcacaaggctatgaaggat 816AsnAspAspGlyAsnAsnGluAspGlnCysHisLysAlaMetLysAsp 260 265 270 atatcggagggtgcgaaggaggttgtggggcatgcagcgaaggatgct 864IleSerGluGlyAlaLysGluValValGlyHisAlaAlaLysAspAla 275 280 285 ggaaagttggtggctacggcgagtaaggctgtaaagaggaagggaact 912GlyLysLeuValAlaThrAlaSerLysAlaValLysArgLysGlyThr 290 295 300 cgtgttactggtgccatgtag 933ArgValThrGlyAlaMet 305 310 <210> 62<211> 310<212> PRT<213> Thalassiosirapseudonana<400> 62 109MetHisSerTyrLysValProLeuGlyLeuThrValPheTyrLeuLeu 1 5 10 15 SerLeuProSerLeuLysTyrValThrAspAsnTyrLeuAlaLysLys 20 25 30 TyrAspMetLysSerLeuLeuThrGluSerMetValLeuTyrAsnVal 35 40 45 AlaGlnValLeuLeuAsnGlyTrpThrValTyrAlaIleValAspAla 50 55 60 ValMetAsnArgAspHisProPheIleGlySerArgSerLeuValGly 65 70 75 80 AlaAlaLeuHisSerGlySerSerTyrAlaValTrpValHisTyrCys 85 90 95 AspLysTyrLeuGluPhePheAspThrTyrPheMetValLeuArgGly 100 105 110 LysMetAspGlnValSerPheLeuHisIleTyrHisHisThrThrIle 115 120 125 AlaTrpAlaTrpTrpIleAlaLeuArgPheSerProGlyGlyAspIle 130 135 140 TyrPheGlyAlaLeuLeuAsnSerIleIleHisValLeuMetTyrSer 145 150 155 160 TyrTyrAlaLeuAlaLeuLeuLysValSerCysProTrpLysArgTyr 165 170 175 LeuThrGlnAlaGlnLeuLeuGlnPheThrSerValValValTyrThr 180 185 190 glycysthrgytyrthrHiRTyrhisthisthisthisglyalaaspa 195 200 205 GluthrglnSerleuglythrythrythrythrythrythryTriphrphecysgly choice selection 210 215 220 PUBLICE CLUDSLETVALLERLEPHEVALLUSUPTALLUPTERUSPETYSERKEGRIGSPETYSERKEKEKEKEKESCYSCYSCYSGLY CysHisLysAlaMetLysAsp 260 265 270 110ilesergluglyalysgluval electionLyhisalaalysaspala 275 280 285 GlylesleuvalalathralathralaSllysalavallysarglysarglythr 290 295 295 300 Argvalthrglyamet 305 310 <211. 2133 <213 <212>> DNAS elongase<400> 63atgcactcctacaaagtcccactcggtctcaccgtattctacctgctg 48MetHisSerTyrLysValProLeuGlyLeuThrValPheTyrLeuLeu 1 5 10 15 agtctaccgtcactaaagtacgttacggacaactaccttgccaaaaag 96SerLeuProSerLeuLysTyrValThrAspAsnTyrLeuAlaLysLys 20 25 30 tatgatatgaagtcactcctaacggaatcaatggtgttgtacaatgtg 144TyrAspMetLysSerLeuLeuThrGluSerMetValLeuTyrAsnVal 35 40 45 gcgcaagtgctgctcaatgggtggacggtgtatgcgattgtggatgcg 192AlaGlnValLeuLeuAsnGlyTrpThrValTyrAlaIleValAspAla 50 55 60 gtgatgaatagagaccatccgtttattggaagtagaagtttggttggg 240ValMetAsnArgAspHisProPheIleGlySerArgSerLeuValGly 65 70 75 80 gcggcgttgcatagtgggagctcgtatgcggtgtgggttcattattgt 288AlaAlaLeuHisSerGlySerSerTyrAlaValTrpValHisTyrCys 85 90 95 gataagtatttggagttctttgatacgtattttatggtgttgaggggg 336AspLysTyrLeuGluPhePheAsp ThrTyrPheMetValLeuArgGly 100 105 110 aaaatggaccaggtctccttcctccacatctaccaccacacgaccata 384LysMetAspGlnValSerPheLeuHisIleTyrHisHisThrThrIle 115 120 125 gcgtgggcatggtggatcgccctccgcttctccccccggtggagacatt 432AlaTrpAlaTrpTrpIleAlaLeuArgPhespIGly30130135Gly3015 111tacttcggggcactcctcaactccatcatccacgtcctcatgtattcc 480TyrPheGlyAlaLeuLeuAsnSerIleIleHisValLeuMetTyrSer 145 150 155 160 tactacgcccttgccctactcaaggtcagttgtccatggaaacgatac 528TyrTyrAlaLeuAlaLeuLeuLysValSerCysProTrpLysArgTyr 165 170 175 ctgactcaagctcaattattgcaattcacaagtgtggtggtttatacg 576LeuThrGlnAlaGlnLeuLeuGlnPheThrSerValValValTyrThr 180 185 190 gggtgtacgggttatactcattactatcatacgaagcatggagcggat 624GlyCysThrGlyTyrThrHisTyrTyrHisThrLysHisGlyAlaAsp 195 200 205 gagacacagcctagtttaggaacgtattatttctgttgtggagtgcag 672GluThrGlnProSerLeuGlyThrTyrTyrPheCysCysGlyValGln 210 215 220 gtgtttgagatggttagtttgtttgtactcttttccatcttttataaa 720ValPheGluMetValSerLeuPheValLeuPheSerIlePheTyrLys 225 230 235 240 cgatcctattcgaagaagaacaagtcaggaggaaaggatagcaagaag 768ArgSerTyrSerLysLysAsnLysSerGlyGlyLysAspSerLysLys 245 250 255 aatgatgatgggaataatgaggatcaatgtcacaaggctatgaaggat 816AsnAspAspGlyAsnAsnGluAspGlnCysHisLysAlaMetLysAsp 260 265 270 atatcggagggtgcgaaggaggttgtggggcatgcagcgaaggatgct 864IleSerGluGlyAlaLysGluValValGlyHis AlaAlaLysAspAla 275 280 285 ggaaagttggtggctacggcgagtaaggctgtaaagaggaagggaact 912GlyLysLeuValAlaThrAlaSerLysAlaValLysArgLysGlyThr 290 295 300 cgtgttactggtgccatgtag 933ArgValThrGlyAlaMet 305 310 <210> 64<211> 310<212> PRT<213> Thalassiosirapseudonana<400> 64MetHisSerTyrLysValProLeuGlyLeuThrValPheTyrLeuLeu 1 5 10 15 SerLeuProSerLeuLysTyrValThrAspAsnTyrLeuAlaLysLys 20 25 30 TyrAspMetLysSerLeuLeuThrGluSerMetValLeuTyrAsnVal 35 40 45 112AlaGlnValLeuLeuAsnGlyTrpThrValTyrAlaIleValAspAla 50 55 60 ValMetAsnArgAspHisProPheIleGlySerArgSerLeuValGly 65 70 75 80 AlaAlaLeuHisSerGlySerSerTyrAlaValTrpValHisTyrCys 85 90 95 AspLysTyrLeuGluPhePheAspThrTyrPheMetValLeuArgGly 100 105 110 LysMetAspGlnValSerPheLeuHisIleTyrHisHisThrThrIle 115 120 125 AlaTrpAlaTrpTrpIleAlaLeuArgPheSerProGlyGlyAspIle 130 135 140 TyrPheGlyAlaLeuLeuAsnSerIleIleHisValLeuMetTyrSer 145 150 155 160 TyrTyrAlaLeuAlaLeuLeuLysValSerCysProTrpLysArgTyr 165 170 175 LeuThrGlnAlaGlnLeuLeuGlnPheThrSerValValValTyrThr 180 185 190 GlyCysThrGlyTyrThrHisTyrTyrHisThrLysHisGlyAlaAsp 195 200 205 GluThrGlnProSerLeuGlyThrTyrTyrPheCysCysGlyValGln 210 215 220 ValPheGluMetValSerLeuPheValLeuPheSerIlePheTyrLys 225 230 235 240 ArgSerTyrSerLysLysAsnLysSerGlyGlyLysAspSerLysLys 245 250 255 AsnAspAspGlyAsnAsnGluAspGlnCysHisLysAlaMetLysAsp 260 265 270 IleSerGluGlyAlaLysGluValValGlyHisAlaAlaLysAspAla 275 280 285 GlyLysLeuValAlaThrAlaSerLysAlaValLysArgLysGlyThr 290 295 300 ArgValThrGlyAlaMet 305 310 113<210> 65<211> 825<212> DNA<213> Thraustochytriumaureum<220><221> CDS<222> (1)..(825)<223> Δ5-elongase<400> 65atgacgagcaacatgagcgcgtggggcgtcgccgtcgaccagacgcag 48MetThrSerAsnMetSerAlaTrpGlynThrSerAlaTrpGly15151515AspGl caggtcgtcgaccagatcatgggcggcgccgagccgtacaagctgaca 96GlnValValAspGlnIleMetGlyGlyAlaGluProTyrLysLeuThr 20 25 30 gaagggcgcatgacgaacgtcgagacgatgctggcgatcgagtgcggc 144GluGlyArgMetThrAsnValGluThrMetLeuAlaIleGluCysGly 35 40 45 tacgccgccatgctgctgttcctgaccccgatcatgaagcaggccgag 192TyrAlaAlaMetLeuLeuPheLeuThrProIleMetLysGlnAlaGlu 50 55 60 aagcccttcgagctcaagtccttcaagctcgcccacaacctgttcctg 240LysProPheGluLeuLysSerPheLysLeuAlaHisAsnLeuPheLeu 65 70 75 80 ttcgtcctgtccgcctacatgtgcctcgagaccgtccgccaggcctac 288PheValLeuSerAlaTyrMetCysLeuGluThrValArgGlnAlaTyr 85 90 95 cttgcgggctactcggtgttcggcaacgacatggagaagggcagcgag 336LeuAlaGlyTyrSerValPheGlyAsnAspMetGluLysGlySerGlu 100 105 110 ccgcacgcgcacggcatggcccaaatcgtgtggatcttttacgtgtcc 384ProHisAlaHisGlyMetAlaGlnIleValTrpIlePheTyrValSer 115 120 125 aaggcgtacgagttcgtggacacgctgatcatgatcctgtgcaaaaag 432LysAlaTyrGluPheValAspThrLeuIleMetIleLeuCysLysLys 130 135 140 ttcaaccaggtctccgtcctgcacgtgtaccaccacgccaccatcttt 480PheAsnGlnValSerValLeuHisValTyrHisHisAlaThrIlePhe 145 150 155 160 gctatctggtttatgatcgccaagtacgccccgggcggcgacgcatac 528AlaIleTrpPheMetIleAlaLysTyrAlaProGlyGlyAspAlaTyr 165 170 175 tttagcgtcatcctgaactcgttcgtgcacaccgtcatgtacgcgtac 576 114PheSerValIleLeuAsnSerPheValHisThrValMetTyrAlaTyr 180 185 190 tacttcttctcgtcgcagggcttcgggttcgtcaagccgatcaagccg 624TyrPhePheSerSerGlnGlyPheGlyPheValLysProIleLysPro 195 200 205 tacatcacctcgctgcagatgacgcagttcatggcgatgctcgtgcag 672TyrIleThrSerLeuGlnMetThrGlnPheMetAlaMetLeuValGln 210 215 220 tcgctgtacgactacctttacccgtgcgactacccgcaggggctcgtc 720SerLeuTyrAspTyrLeuTyrProCysAspTyrProGlnGlyLeuVal 225 230 235 240 aagctcctcggcgtgtacatgctcaccctgcttgcgctcttcggcaac 768LysLeuLeuGlyValTyrMetLeuThrLeuLeuAlaLeuPheGlyAsn 245 250 255 tttttcgtgcagagctacctcaagaagtcgaacaagcccaaggccaag 816PhePheValGlnSerTyrLeuLysLysSerAsnLysProLysAlaLys 260 265 270 tcggcctaa 825SerAla <210> 66<211> 274<212> PRT<213> Thraustochytriumaureum<400 > 66MetThrSerAsnMetSerAlaTrpGlyValAlaValAspGlnThrGln 1 5 10 15 GlnValValAspGlnIleMetGlyGlyAlaGluProTyrLysLeuThr 20 25 30 GluGlyArgMetThrAsnValGluThrMetLeuAlaIleGluCysGly 35 40 45 TyrAlaAlaMetLeuLeuPheLeuThrProIleMetLysGlnAlaGlu 50 55 60 LysProPheGluLeuLysSerPheLysLeuAlaHisAsnLeuPheLeu 65 70 75 80 PheValLeuSerAlaTyrMetCysLeuGluThrValArgGlnAlaTyr 85 90 95 LeuAlaGlyTyrSerValPheGlyAsnAspMetGluLysGlySerGlu 100 105 110 115ProHisAlaHisGlyMetAlaGlnIleValTrpIlePheTyrValSer 115 120 125 LysAlaTyrGluPheValAspThrLeuIleMetIleLeuCysLysLys 130 135 140 PheAsnGlnValSerValLeuHisValTyrHisHisAlaThrIlePhe 145 150 155 160 AlaIleTrpPheMetIleAlaLysTyrAlaProGlyGlyAspAlaTyr 165 170 175 PheSerValIleLeuAsnSerPheValHisThrValMetTyrAlaTyr 180 185 190 TyrPhePheSerSerGlnGlyPheGlyPheValLysProIleLysPro 195 200 205 TyrIleThrSerLeuGlnMetThrGlnPheMetAlaMetLeuValGln 210 215 220 SerLeuTyrAspTyrLeuTyrProCysAspTyrProGlnGlyLeuVal 225 230 235 240 LysLeuLeuGlyValTyrMetLeuThrLeuLeuAlaLeuPheGlyAsn 245 250 255 PhePheValGlnSerTyrLeuLysLysSerAsnLysProLysAlaLys 260 265 270 SerAla <210> 67<211> 903<212> DNA<213> Ostreococcustauri<220><221> CDS(1). 116gcgtacgcgacgtacgcctacgcctttgagtggtcgcacgcgaatggc 96AlaTyrAlaThrTyrAlaTyrAlaPheGluTrpSerHisAlaAsnGly 20 25 30 atcgacaacgtcgacgcgcgcgagtggatcggtgcgctgtcgttgagg 144IleAspAsnValAspAlaArgGluTrpIleGlyAlaLeuSerLeuArg 35 40 45 ctcccggcgatcgcgacgacgatgtacctgttgttctgcctggtcgga 192LeuProAlaIleAlaThrThrMetTyrLeuLeuPheCysLeuValGly 50 55 60 ccgaggttgatggcgaagcgcgaggcgttcgacccgaaggggttcatg 240ProArgLeuMetAlaLysArgGluAlaPheAspProLysGlyPheMet 65 70 75 80 ctggcgtacaatgcgtatcagacggcgttcaacgtcgtcgtgctcggg 288LeuAlaTyrAsnAlaTyrGlnThrAlaPheAsnValValValLeuGly 85 90 95 atgttcgcgcgagagatctcggggctggggcagcccgtgtgggggtca 336MetPheAlaArgGluIleSerGlyLeuGlyGlnProValTrpGlySer 100 105 110 accatgccgtggagcgatagaaaatcgtttaagatcctcctcggggtg 384ThrMetProTrpSerAspArgLysSerPheLysIleLeuLeuGlyVal 115 120 125 tggttgcactacaacaaccaatatttggagctattggacactgtgttc 432TrpLeuHisTyrAsnAsnGlnTyrLeuGluLeuLeuAspThrValPhe 130 135 140 atggttgcgcgcaagaagacgaagcagttgagcttcttgcacgtttat 480MetValAlaArgLysLysThrLysGlnLeuSerPheLeuHisValTyr 145 1 50 155 160 catcacgccctgttgatctgggcgtggtggttggtgtgtcacttgatg 528HisHisAlaLeuLeuIleTrpAlaTrpTrpLeuValCysHisLeuMet 165 170 175 gccacgaacgattgtatcgatgcctacttcggcgcggcgtgcaactcg 576AlaThrAsnAspCysIleAspAlaTyrPheGlyAlaAlaCysAsnSer 180 185 190 ttcattcacatcgtgatgtactcgtattatctcatgtcggcgctcggc 624PheIleHisIleValMetTyrSerTyrTyrLeuMetSerAlaLeuGly 195 200 205 attcgatgcccgtggaagcgatacatcacccaggctcaaatgctccaa 672IleArgCysProTrpLysArgTyrIleThrGlnAlaGlnMetLeuGln 210 215 220 ttcgtcattgtcttcgcgcacgccgtgttcgtgctgcgtcagaagcac 720PheValIleValPheAlaHisAlaValPheValLeuArgGlnLysHis 225 230 235 240 tgcccggtcacccttccttgggcgcaaatgttcgtcatgacgaacatg 768CysProValThrLeuProTrpAlaGlnMetPheValMetThrAsnMet 245 250 255 ctcgtgctcttcgggaacttctacctcaaggcgtactcgaacaagtcg 816LeuValLeuPheGlyAsnPheTyrLeuLysAlaTyrSerAsnLysSer 260 265 270 cgcggcgacggcgcgagttccgtgaaaccagccgagaccacgcgcgcg 864ArgGlyAspGlyAlaSerSerValLysProAlaGluThrThrArgAla 275 280 285 117cccagcgtgcgacgcacgcgatctcgaaaaattgactaa 903ProSerValArgArgThrArgSerArgLysIleAsp 290 295 300 <210> 68<211> 300<212> PRT<213> Ostreococcustauri<400> 68MetSerAlaSerGlyAlaLeuLeuProAlaIleAlaPheAlaAlaTyr 1 5 10 15 AlaTyrAlaThrTyrAlaTyrAlaPheGluTrpSerHisAlaAsnGly 20 25 30 IleAspAsnValAspAlaArgGluTrpIleGlyAlaLeuSerLeuArg 35 40 45 LeuProAlaIleAlaThrThrMetTyrLeuLeuPheCysLeuValGly 50 55 60 ProArgLeuMetAlaLysArgGluAlaPheAspProLysGlyPheMet 65 70 75 80 LeuAlaTyrAsnAlaTyrGlnThrAlaPheAsnValValValLeuGly 85 90 95 MetPheAlaArgGluIleSerGlyLeuGlyGlnProValTrpGlySer 100 105 110 ThrMetProTrpSerAspArgLysSerPheLysIleLeuLeuGlyVal 115 120 125 TrpLeuHisTyrAsnAsnGlnTyrLeuGluLeuLeuAspThrValPhe 130 135 140 MetValAlaArgLysLysThrLysGlnLeuSerPheLeuHisValTyr 145 150 155 160 HisHisAlaLeuLeuIleTrpAlaTrpTrpLeuValCysHisLeuMet 165 170 175 AlaThrAsnAspCysIleAspAlaTyrPheGlyAlaAlaCysAsnSer 180 185 190 PheIleHisIleValMetTyrSerTyrTyrLeuMetSerAlaLeuGly 195 200 205 118IleArgCysProTrpLysArgTyrIleThrGlnAlaGlnMetLeuGln 210 215 220 PheValIleValPheAlaHisAlaValPheValLeuArgGlnLysHis 225 230 235 240 CysProValThrLeuProTrpAlaGlnMetPheValMetThrAsnMet 245 250 255 LeuValLeuPheGlyAsnPheTyrLeuLysAlaTyrSerAsnLysSer 260 265 270 ArgGlyAspGlyAlaSerSerValLysProAlaGluThrThrArgAla 275 280 285 ProSerValArgArgThrArgSerArgLysIleAsp 290 295 300 <210> 69<211> 879<212> DNA<213> Ostreococcustauri<220><221> CDS<222 > (1)..(879)<223> Δ6-elongase<400> 69atgagtggcttacgtgcacccaactttttacacagattctggacaaag 48MetSerGlyLeuArgAlaProAsnPheLeuHisArgPheTrpThrLys 1 5 10 15 tgggactacgcgatttccaaagtcgtcttcacgtgtgccgacagtttt 96TrpAspTyrAlaIleSerLysValValPheThrCysAlaAspSerPhe 20 25 30 cagtgggacatcgggccagtgagttcgagtacggcgcatttacccgcc 144GlnTrpAspIleGlyProValSerSerSerThrAlaHisLeuProAla 35 40 45 attgaatcccctaccccactggtgactagcctcttgttctacttagtc 192IleGluSerProThrProLeuValThrSerLeuLeuPheTyrLeuVal 50 55 60 acagttttcttgtggtatggtcgtttaaccaggagttcagacaagaaa 240ThrValPheLeuTrpTyrGlyArgLeuThrArgSerSerAspLy sLys 65 70 75 80 attagagagcctacgtggttaagaagattcataatatgtcataatgcg 288 119IleArgGluProThrTrpLeuArgArgPheIleIleCysHisAsnAla 85 90 95 ttcttgatagtcctcagtctttacatgtgccttggttgtgtggcccaa 336PheLeuIleValLeuSerLeuTyrMetCysLeuGlyCysValAlaGln 100 105 110 gcgtatcagaatggatatactttatggggtaatgaattcaaggccacg 384AlaTyrGlnAsnGlyTyrThrLeuTrpGlyAsnGluPheLysAlaThr 115 120 125 gaaactcagcttgctctctacatttacattttttacgtaagtaaaata 432GluThrGlnLeuAlaLeuTyrIleTyrIlePheTyrValSerLysIle 130 135 140 tacgagtttgtagatacttacattatgcttctcaagaataacttgcgg 480TyrGluPheValAspThrTyrIleMetLeuLeuLysAsnAsnLeuArg 145 150 155 160 caagtaagtttcctacacatttatcaccacagcacgatttcctttatt 528GlnValSerPheLeuHisIleTyrHisHisSerThrIleSerPheIle 165 170 175 tggtggatcattgctcggagggctccgggtggtgatgcttacttcagc 576TrpTrpIleIleAlaArgArgAlaProGlyGlyAspAlaTyrPheSer 180 185 190 gcggccttgaactcatgggtacacgtgtgcatgtacacctattatcta 624AlaAlaLeuAsnSerTrpValHisValCysMetTyrThrTyrTyrLeu 195 200 205 ttatcaacccttattggaaaagaagatcctaagcgttccaactacctt 672LeuSerThrLeuIleGlyLysGluAspProLysArgSerAsnTyrLeu 210 215 220 tggtggggtcgccacctaacgcaaatgcaga tgcttcagtttttcttc 720TrpTrpGlyArgHisLeuThrGlnMetGlnMetLeuGlnPhePhePhe 225 230 235 240 aacgtacttcaagcgttgtactgcgcttcgttctctacgtatcccaag 768AsnValLeuGlnAlaLeuTyrCysAlaSerPheSerThrTyrProLys 245 250 255 tttttgtccaaaattctgctcgtctatatgatgagccttctcggcttg 816PheLeuSerLysIleLeuLeuValTyrMetMetSerLeuLeuGlyLeu 260 265 270 tttgggcatttctactattccaagcacatagcagcagctaagctccag 864PheGlyHisPheTyrTyrSerLysHisIleAlaAlaAlaLysLeuGln 275 280 285 aaaaaacagcagtga 879LysLysGlnGln 290 <210> 70<211> 292<212> PRT<213> Ostreococcustauri<400> 70 120MetSerGlyLeuArgAlaProAsnPheLeuHisArgPheTrpThrLys 1 5 10 15 TrpAspTyrAlaIleSerLysValValPheThrCysAlaAspSerPhe 20 25 30 GlnTrpAspIleGlyProValSerSerSerThrAlaHisLeuProAla 35 40 45 IleGluSerProThrProLeuValThrSerLeuLeuPheTyrLeuVal 50 55 60 ThrValPheLeuTrpTyrGlyArgLeuThrArgSerSerAspLysLys 65 70 75 80 IleArgGluProThrTrpLeuArgArgPheIleIleCysHisAsnAla 85 90 95 PheLeuIleValLeuSerLeuTyrMetCysLeuGlyCysValAlaGln 100 105 110 AlaTyrGlnAsnGlyTyrThrLeuTrpGlyAsnGluPheLysAlaThr 115 120 125 GluThrGlnLeuAlaLeuTyrIleTyrIlePheTyrValSerLysIle 130 135 140 TyrGluPheValAspThrTyrIleMetLeuLeuLysAsnAsnLeuArg 145 150 155 160 GlnValSerPheLeuHisIleTyrHisHisSerThrIleSerPheIle 165 170 175 TrpTrpIleIleAlaArgArgAlaProGlyGlyAspAlaTyrPheSer 180 185 190 alaalaleuasnsertrpvalhisvalcysmetyrthrTyrleu 195 200 205 Leusthrleuilegllyllyluaspprolysargserasntyrleu 210 215 220 trptrpglyarghisleuthrlyshisleuthrlygshrlyglnsphephephe MetMetSerLeuLeuGlyLeu 260 265 270 121pheglyhisphetyrser Lights HisilealaalalySleugln 275 280 285 Lights GLNGN 290 <210> 71 <211> 1362 <212> DNA <213> Primulafarinosa <220> <221> CDS <222> (1) 48MetAlaAsnLysSerProProAsnProLysThrGlyTyrIleThrSer 1 5 10 15 tcagacctgaaatcccacaacaaggcaggtgacctatggatatcaatc 96SerAspLeuLysSerHisAsnLysAlaGlyAspLeuTrpIleSerIle 20 25 30 cacggccaagtctacgacgtgtcctcttgggccgcccttcatccgggg 144HisGlyGlnValTyrAspValSerSerTrpAlaAlaLeuHisProGly 35 40 45 ggcactgcccctctcatggcccttgcaggacacgacgtgaccgatgct 192GlyThrAlaProLeuMetAlaLeuAlaGlyHisAspValThrAspAla 50 55 60 ttcctcgcgtaccatcccccttccactgcccgtctcctccctcctctc 240PheLeuAlaTyrHisProProSerThrAlaArgLeuLeuProProLeu 65 70 75 80 tctaccaacctccttcttcaaaaccactccgtctcccccacctcctca 288SerThrAsnLeuLeuLeuGlnAsnHisSerValSerProThrSerSer 85 90 95 gactaccgcaaactcctcgacaacttccataaacatggccttttccgc 336AspTyrArgLysLeuLeuAspAsnPheHisLysHisGlyLeuPheArg 100 105 110 gccaggggccacactgcttacgccaccttcgtcttcat gatagcgatg 384AlaArgGlyHisThrAlaTyrAlaThrPheValPheMetIleAlaMet 115 120 125 tttctaatgagcgtgactggagtcctttgcagcgacagtgcgtgggtc 432PheLeuMetSerValThrGlyValLeuCysSerAspSerAlaTrpVal 130 135 140 catttggctagcggcggagcaatggggttcgcctggatccaatgcgga 480HisLeuAlaSerGlyGlyAlaMetGlyPheAlaTrpIleGlnCysGly 145 150 155 160 122tggataggtcacgactctgggcattaccggattatgtctgacaggaaa 528TrpIleGlyHisAspSerGlyHisTyrArgIleMetSerAspArgLys 165 170 175 tggaactggttcgcgcaaatcctaagcacaaactgcctccaggggatt 576TrpAsnTrpPheAlaGlnIleLeuSerThrAsnCysLeuGlnGlyIle 180 185 190 agtatcgggtggtggaagtggaaccataatgcgcaccacatcgcttgc 624SerIleGlyTrpTrpLysTrpAsnHisAsnAlaHisHisIleAlaCys 195 200 205 aatagcctggattacgaccccgacctccagtatatccctttgctcgtc 672AsnSerLeuAspTyrAspProAspLeuGlnTyrIleProLeuLeuVal 210 215 220 gtctcccccaagttcttcaactcccttacttctcgtttctacgacaag 720ValSerProLysPhePheAsnSerLeuThrSerArgPheTyrAspLys 225 230 235 240 aagctgaacttcgacggcgtgtcgaggtttctggtttgctaccagcac 768LysLeuAsnPheAspGlyValSerArgPheLeuValCysTyrGlnHis 245 250 255 tggacgttttatccggtcatgtgtgtcgctaggctgaacatgctcgcg 816TrpThrPheTyrProValMetCysValAlaArgLeuAsnMetLeuAla 260 265 270 cagtcatttataacgcttttctcgagtagggaggtgtgccatagggcg 864GlnSerPheIleThrLeuPheSerSerArgGluValCysHisArgAla 275 280 285 caagaggttttcggacttgccgtgttttgggtttggtttccgctttta 912GlnGluValPheGlyLeuAlaValPheTrpValTrpP heProLeuLeu 290 295 300 ctttcttgtttacctaattggggcgagaggattatgtttttgcttgcg 960LeuSerCysLeuProAsnTrpGlyGluArgIleMetPheLeuLeuAla 305 310 315 320 agctattccgttacggggatacaacacgtgcagttcagcttgaaccat 1008SerTyrSerValThrGlyIleGlnHisValGlnPheSerLeuAsnHis 325 330 335 ttttcttcggacgtctatgtgggcccgccagtaggtaatgactggttc 1056PheSerSerAspValTyrValGlyProProValGlyAsnAspTrpPhe 340 345 350 aagaaacagactgccgggacacttaacatatcgtgcccggcgtggatg 1104LysLysGlnThrAlaGlyThrLeuAsnIleSerCysProAlaTrpMet 355 360 365 gattggttccatggcgggttacagtttcaggtcgagcaccacttgttt 1152AspTrpPheHisGlyGlyLeuGlnPheGlnValGluHisHisLeuPhe 370 375 380 ccgcggatgcctaggggtcagtttaggaagatttctccttttgtgagg 1200ProArgMetProArgGlyGlnPheArgLysIleSerProPheValArg 385 390 395 400 gatttgtgtaagaaacacaacttgccttacaatatcgcgtcttttact 1248AspLeuCysLysLysHisAsnLeuProTyrAsnIleAlaSerPheThr 405 410 415 aaagcgaatgtgtttacgcttaagacgctgagaaatacggccattgag 1296LysAlaAsnValPheThrLeuLysThrLeuArgAsnThrAlaIleGlu 420 425 430 123gctcgggacctctctaatccgctcccaaagaatatggtgtgggaagct 1344AlaArgAspLeuSerAsnProLeuProLysAsnMetValTrpGluAla 435 440 445 cttaaaactctcgggtga 1362LeuLysThrLeuGly 450 <210> 72<211> 453<212> PRT<213> Primulafarinosa<400> 72MetAlaAsnLysSerProProAsnProLysThrGlyTyrIleThrSer 1 5 10 15 SerAspLeuLysSerHisAsnLysAlaGlyAspLeuTrpIleSerIle 20 25 30 HisGlyGlnValTyrAspValSerSerTrpAlaAlaLeuHisProGly 35 40 45 GlyThrAlaProLeuMetAlaLeuAlaGlyHisAspValThrAspAla 50 55 60 PheLeuAlaTyrHisProProSerThrAlaArgLeuLeuProProLeu 65 70 75 80 SerThrAsnLeuLeuLeuGlnAsnHisSerValSerProThrSerSer 85 90 95 AspTyrArgLysLeuLeuAspAsnPheHisLysHisGlyLeuPheArg 100 105 110 AlaArgGlyHisThrAlaTyrAlaThrPheValPheMetIleAlaMet 115 120 125 PheLeuMetSerValThrGlyValLeuCysSerAspSerAlaTrpVal 130 135 140 HisLeuAlaSerGlyGlyAlaMetGlyPheAlaTrpIleGlnCysGly 145 150 155 160 TrpIleGlyHisAspSerGlyHisTyrArgIleMetSerAspArgLys 165 170 175 TrpAsnTrpPheAlaGlnIleLeuSerThrAsnCysLeuGlnGlyIle 180 185 190 124SerIleGlyTrpTrpLysTrpAsnHisAsnAlaHisHisIleAlaCys 195 200 205 AsnSerLeuAspTyrAspProAspLeuGlnTyrIleProLeuLeuVal 210 215 220 ValSerProLysPhePheAsnSerLeuThrSerArgPheTyrAspLys 225 230 235 240 LysLeuAsnPheAspGlyValSerArgPheLeuValCysTyrGlnHis 245 250 255 TrpThrPheTyrProValMetCysValAlaArgLeuAsnMetLeuAla 260 265 270 GlnSerPheIleThrLeuPheSerSerArgGluValCysHisArgAla 275 280 285 GlnGluValPheGlyLeuAlaValPheTrpValTrpPheProLeuLeu 290 295 300 LeuSerCysLeuProAsnTrpGlyGluArgIleMetPheLeuLeuAla 305 310 315 320 SerTyrSerValThrGlyIleGlnHisValGlnPheSerLeuAsnHis 325 330 335 PheSerSerAspValTyrValGlyProProValGlyAsnAspTrpPhe 340 345 350 LysLysGlnThrAlaGlyThrLeuAsnIleSerCysProAlaTrpMet 355 360 365 AspTrpPheHisGlyGlyLeuGlnPheGlnValGluHisHisLeuPhe 370 375 380 ProArgMetProArgGlyGlnPheArgLysIleSerProPheValArg 385 390 395 400 AspLeuCysLysLysHisAsnLeuProTyrAsnIleAlaSerPheThr 405 410 415 LysAlaAsnValPheThrLeuLysThrLeuArgAsnThrAlaIleGlu 420 425 430 AlaArgAspLeuSerAsnProLeuThr544Lys445Glu445AlanGlu3Pro4Lys4Alan LeuGly 450 125<210> 73<211> 1362<212> DNA<213> Primulavialii<220><221> CDS<222> (1)..(1362)<223> Δ6-desaturase<400> 73atggctaacaaatctccaccaaaaccccaaaacaggtcatattaccagc 48MetAlaAsnLysSerProAsnProLysThrGly15550TyrIleThrSer tcagacctgaaagggcacaacaaagcaggagacctatggatatcaatc 96SerAspLeuLysGlyHisAsnLysAlaGlyAspLeuTrpIleSerIle 20 25 30 cacggggaggtatacgacgtgtcctcgtgggccggccttcacccgggg 144HisGlyGluValTyrAspValSerSerTrpAlaGlyLeuHisProGly 35 40 45 ggcagtgcccccctcatggccctcgcaggacacgacgtaaccgacgct 192GlySerAlaProLeuMetAlaLeuAlaGlyHisAspValThrAspAla 50 55 60 tttctagcgtatcatcctccttctaccgcccgcctcctccctcccctc 240PheLeuAlaTyrHisProProSerThrAlaArgLeuLeuProProLeu 65 70 75 80 tccaccaacctcctccttcaaaaccactccgtctcccccacctcctct 288SerThrAsnLeuLeuLeuGlnAsnHisSerValSerProThrSerSer 85 90 95 gactaccgcaaactcctccacaacttccataaaattggtatgttccgc 336AspTyrArgLysLeuLeuHisAsnPheHisLysIleGlyMetPheArg 100 105 110 gccaggggccacactgcttacgccaccttcgtcatcatgatagtgatg 384AlaArgGlyHisThrAlaTyrAlaThrPheValIleMetIleValMet 115 120 125 tttct aacgagcgtgaccggagtcctttgcagcgacagtgcgtgggtc 432PheLeuThrSerValThrGlyValLeuCysSerAspSerAlaTrpVal 130 135 140 catctggctagcggcgcagcaatggggttcgcctggatccagtgcgga 480HisLeuAlaSerGlyAlaAlaMetGlyPheAlaTrpIleGlnCysGly 145 150 155 160 tggataggtcacgactctgggcattaccggattatgtctgacaggaaa 528TrpIleGlyHisAspSerGlyHisTyrArgIleMetSerAspArgLys 165 170 175 tggaactggttcgcgcaggtcctgagcacaaactgcctccaggggatc 576 126TrpAsnTrpPheAlaGlnValLeuSerThrAsnCysLeuGlnGlyIle 180 185 190 agtatcgggtggtggaagtggaaccataacgcccaccacattgcttgc 624SerIleGlyTrpTrpLysTrpAsnHisAsnAlaHisHisIleAlaCys 195 200 205 aatagcctggactacgaccccgacctccagtatatccctttgctcgtg 672AsnSerLeuAspTyrAspProAspLeuGlnTyrIleProLeuLeuVal 210 215 220 gtctcccccaagttcttcaactcccttacttctcgtttctacgacaag 720ValSerProLysPhePheAsnSerLeuThrSerArgPheTyrAspLys 225 230 235 240 aagctgaatttcgacggcgtgtcaaggtttctggtttgctaccagcac 768LysLeuAsnPheAspGlyValSerArgPheLeuValCysTyrGlnHis 245 250 255 tggacgttttatccagtcatgtgtgtcgctaggctaaacatgatcgca 816TrpThrPheTyrProValMetCysValAlaArgLeuAsnMetIleAla 260 265 270 cagtcgtttataacgcttttctcgagcagggaggtgggtcatagggcg 864GlnSerPheIleThrLeuPheSerSerArgGluValGlyHisArgAla 275 280 285 caagagattttcggacttgctgtgttttgggtttggtttccgctcctg 912GlnGluIlePheGlyLeuAlaValPheTrpValTrpPheProLeuLeu 290 295 300 ctctcttgcttacctaattggagcgagaggattatgtttctgctagcg 960LeuSerCysLeuProAsnTrpSerGluArgIleMetPheLeuLeuAla 305 310 315 320 agctattccgttacggggatacag cacgtgcagttcagcttgaaccat 1008SerTyrSerValThrGlyIleGlnHisValGlnPheSerLeuAsnHis 325 330 335 ttttcttcggacgtctacgtgggcccgccagtagctaacgactggttc 1056PheSerSerAspValTyrValGlyProProValAlaAsnAspTrpPhe 340 345 350 aagaaacagactgctgggacacttaacatatcgtgcccggcgtggatg 1104LysLysGlnThrAlaGlyThrLeuAsnIleSerCysProAlaTrpMet 355 360 365 gactggttccatggcgggttgcagtttcaggtcgagcaccacttgttt 1152AspTrpPheHisGlyGlyLeuGlnPheGlnValGluHisHisLeuPhe 370 375 380 ccgcggatgcctaggggtcagtttaggaagatttctccttttgtgagg 1200ProArgMetProArgGlyGlnPheArgLysIleSerProPheValArg 385 390 395 400 gatttgtgtaagaaacacaacttgccttacaatatcgcgtcttttact 1248AspLeuCysLysLysHisAsnLeuProTyrAsnIleAlaSerPheThr 405 410 415 aaagcaaacgtgttgacgcttaagacgctgagaaatacggccattgag 1296LysAlaAsnValLeuThrLeuLysThrLeuArgAsnThrAlaIleGlu 420 425 430 gctcgggacctctctaatccgaccccaaagaatatggtgtgggaagcc 1344AlaArgAspLeuSerAsnProThrProLysAsnMetValTrpGluAla 435 440 445 gtccacacacacggctag 1362 127ValHisThrHisGly 450 <210> 74<211> 453<212> PRT<213> Primulavialii<400> 74MetAlaAsnLysSerProProAsnProLysThrGlyTyrIleThrSer 1 5 10 15 SerAspLeuLysGlyHisAsnLysAlaGlyAspLeuTrpIleSerIle 20 25 30 HisGlyGluValTyrAspValSerSerTrpAlaGlyLeuHisProGly 35 40 45 GlySerAlaProLeuMetAlaLeuAlaGlyHisAspValThrAspAla 50 55 60 PheLeuAlaTyrHisProProSerThrAlaArgLeuLeuProProLeu 65 70 75 80 SerThrAsnLeuLeuLeuGlnAsnHisSerValSerProThrSerSer 85 90 95 AspTyrArgLysLeuLeuHisAsnPheHisLysIleGlyMetPheArg 100 105 110 AlaArgGlyHisThrAlaTyrAlaThrPheValIleMetIleValMet 115 120 125 PheLeuThrSerValThrGlyValLeuCysSerAspSerAlaTrpVal 130 135 140 HisLeuAlaSerGlyAlaAlaMetGlyPheAlaTrpIleGlnCysGly 145 150 155 160 TrpIleGlyHisAspSerGlyHisTyrArgIleMetSerAspArgLys 165 170 175 TrpAsnTrpPheAlaGlnValLeuSerThrAsnCysLeuGlnGlyIle 180 185 190 SerIleGlyTrpTrpLysTrpAsnHisAsnAlaHisHisIleAlaCys 195 200 205 128AsnSerLeuAspTyrAspProAspLeuGlnTyrIleProLeuLeuVal 210 215 220 ValSerProLysPhePheAsnSerLeuThrSerArgPheTyrAspLys 225 230 235 240 LysLeuAsnPheAspGlyValSerArgPheLeuValCysTyrGlnHis 245 250 255 TrpThrPheTyrProValMetCysValAlaArgLeuAsnMetIleAla 260 265 270 GlnSerPheIleThrLeuPheSerSerArgGluValGlyHisArgAla 275 280 285 GlnGluIlePheGlyLeuAlaValPheTrpValTrpPheProLeuLeu 290 295 300 LeuSerCysLeuProAsnTrpSerGluArgIleMetPheLeuLeuAla 305 310 315 320 SerTyrSerValThrGlyIleGlnHisValGlnPheSerLeuAsnHis 325 330 335 PheSerSerAspValTyrValGlyProProValAlaAsnAspTrpPhe 340 345 350 LysLysGlnThrAlaGlyThrLeuAsnIleSerCysProAlaTrpMet 355 360 365 AspTrpPheHisGlyGlyLeuGlnPheGlnValGluHisHisLeuPhe 370 375 380 ProArgMetProArgGlyGlnPheArgLysIleSerProPheValArg 385 390 395 400 AspLeuCysLysLysHisAsnLeuProTyrAsnIleAlaSerPheThr 405 410 415 LysAlaAsnValLeuThrLeuLysThrLeuArgAsnThrAlaIleGlu 420 425 430 AlaArgAspLeuSerAsnProThrProLysAsnMetValTrpGluAla 435 440 445 ValHisThrHisGly 450 1>913>7 <520 129<212> DNA<213> Ostreococcustauri<220><221> CDS<222> (1)..(903)<223> Δ5-elongase<400> 75atgagcgcctccggtgcgctgctgcccgcgatcgcgtccgccgcgtac 48MetSerAlaSerGlyAlaLeuLeuProAlaIleAlaSerAlaAlaTyr 1 5 10 15 gcgtacgcgacgtacgcctacgcctttgagtggtcgcacgcgaatggc 96AlaTyrAlaThrTyrAlaTyrAlaPheGluTrpSerHisAlaAsnGly 20 25 30 atcgacaacgtcgacgcgcgcgagtggatcggtgcgctgtcgttgagg 144IleAspAsnValAspAlaArgGluTrpIleGlyAlaLeuSerLeuArg 35 40 45 ctcccggcgatcgcgacgacgatgtacctgttgttctgcctggtcgga 192LeuProAlaIleAlaThrThrMetTyrLeuLeuPheCysLeuValGly 50 55 60 ccgaggttgatggcgaagcgcgaggcgttcgacccgaaggggttcatg 240ProArgLeuMetAlaLysArgGluAlaPheAspProLysGlyPheMet 65 70 75 80 ctggcgtacaatgcgtatcagacggcgttcaacgtcgtcgtgctcggg 288LeuAlaTyrAsnAlaTyrGlnThrAlaPheAsnValValValLeuGly 85 90 95 atgttcgcgcgagagatctcggggctggggcagcccgtgtgggggtca 336MetPheAlaArgGluIleSerGlyLeuGlyGlnProValTrpGlySer 100 105 110 accatgccgtggagcgatagaaaatcgtttaagatcctcctcggggtg 384ThrMetProTrpSerAspArgLysSerPheLysIleLeuLeuGlyVal 115 120 125 tggttgcactacaacaacaaat atttggagctattggacactgtgttc 432TrpLeuHisTyrAsnAsnLysTyrLeuGluLeuLeuAspThrValPhe 130 135 140 atggttgcgcgcaagaagacgaagcagttgagcttcttgcacgtttat 480MetValAlaArgLysLysThrLysGlnLeuSerPheLeuHisValTyr 145 150 155 160 catcacgccctgttgatctgggcgtggtggttggtgtgtcacttgatg 528HisHisAlaLeuLeuIleTrpAlaTrpTrpLeuValCysHisLeuMet 165 170 175 gccacgaacgattgtatcgatgcctacttcggcgcggcgtgcaactcg 576AlaThrAsnAspCysIleAspAlaTyrPheGlyAlaAlaCysAsnSer 180 185 190 ttcattcacatcgtgatgtactcgtattatctcatgtcggcgctcggc 624PheIleHisIleValMetTyrSerTyrTyrLeuMetSerAlaLeuGly 195 200 205 130attcgatgcccgtggaagcgatacatcacccaggctcaaatgctccaa 672IleArgCysProTrpLysArgTyrIleThrGlnAlaGlnMetLeuGln 210 215 220 ttcgtcattgtcttcgcgcacgccgtgttcgtgctgcgtcagaagcac 720PheValIleValPheAlaHisAlaValPheValLeuArgGlnLysHis 225 230 235 240 tgcccggtcacccttccttgggcgcaaatgttcgtcatgacgaacatg 768CysProValThrLeuProTrpAlaGlnMetPheValMetThrAsnMet 245 250 255 ctcgtgctcttcgggaacttctacctcaaggcgtactcgaacaagtcg 816LeuValLeuPheGlyAsnPheTyrLeuLysAlaTyrSerAsnLysSer 260 265 270 cgcggcgacggcgcgagttccgtgaaaccagccgagaccacgcgcgcg 864ArgGlyAspGlyAlaSerSerValLysProAlaGluThrThrArgAla 275 280 285 cccagcgtgcgacgcacgcgatctcgaaaaattgactaa 903ProSerValArgArgThrArgSerArgLysIleAsp 290 295 300 <210> 76<211> 300<212> PRT<213> Ostreococcustauri<400> 76 -meter -solaraserglyalalaLualaeala -alaseralaalatyr 1 5 10 15 Alatyralathralatyralatyralatyralapheglutrpserhisalaasngly 20 25 30 IleaSpasnvalaspalaargglutrpilglyalalalalaxerleuarg 35 40 45 40 45 40 45 40 45 40 45 40 45 40 45 40 45 40 45 40 45 40 45 40 45 Leproalhallaelhaulhallyhallyhallyhallythallythallythallythallythallythallythallythallythallythallythallythallythallythallythallytalaxaxalaxa. et 65 70 75 80 LeuAlaTyrAsnAlaTyrGlnThrAlaPheAsnValValValLeuGly 85 90 95 MetPheAlaArgGluIleSerGlyLeuGlyGlnProValTrpGlySer 100 105 110 ThrMetProTrpSerAspArgLysSerPheLysIleLeuLeuGlyVal 115 120 125 131TrpLeuHisTyrAsnAsnLysTyrLeuGluLeuLeuAspThrValPhe 130 135 140 MetValAlaArgLysLysThrLysGlnLeuSerPheLeuHisValTyr 145 150 155 160 HisHisAlaLeuLeuIleTrpAlaTrpTrpLeuValCysHisLeuMet 165 170 175 AlaThrAsnAspCysIleAspAlaTyrPheGlyAlaAlaCysAsnSer 180 185 190 PheIleHisIleValMetTyrSerTyrTyrLeuMetSerAlaLeuGly 195 200 205 IleArgCysProTrpLysArgTyrIleThrGlnAlaGlnMetLeuGln 210 215 220 PheValIleValPheAlaHisAlaValPheValLeuArgGlnLysHis 225 230 235 240 CysProValThrLeuProTrpAlaGlnMetPheValMetThrAsnMet 245 250 255 LeuValLeuPheGlyAsnPheTyrLeuLysAlaTyrSerAsnLysSer 260 265 270 ArgGlyAspGlyAlaSerSerValLysProAlaGluThrThrArgAla 275 280 285 ProSerValArgArgThrArgSerArgLysIleAsp 290 295 300 <210> 77 <211> 903<212> DNA<213> Ostreococcustauri<220><221> CDS<222> (1)..(903)<223> Δ5-elongase<400> 77atgagcgcctccggtgcgctgctgcccgcgatcgcgttcgccgcgtac 48 132MetSerAlaSerGlyAlaLeuLeuProAlaIleAlaPheAlaAlaTyr 1 5 10 15 gcgtacgcgacgtacgcctacgcctttgagtggtcgcacgcgaatggc 96AlaTyrAlaThrTyrAlaTyrAlaPheGluTrpSerHisAlaAsnGly 20 25 30 atcgacaacgtcgacgcgcgcgagtggatcggtgcgctgtcgttgagg 144IleAspAsnValAspAlaArgGluTrpIleGlyAlaLeuSerLeuArg 35 40 45 ctcccggcgatcgcgacgacgatgtacctgttgttctgcctggtcgga 192LeuProAlaIleAlaThrThrMetTyrLeuLeuPheCysLeuValGly 50 55 60 ccgaggttgatggcgaagcgcgaggcgttcgacccgaaggggttcatg 240ProArgLeuMetAlaLysArgGluAlaPheAspProLysGlyPheMet 65 70 75 80 ctggcgtacaatgcgtatcagacggcgttcaacgtcgtcgtgctcggg 288LeuAlaTyrAsnAlaTyrGlnThrAlaPheAsnValValValLeuGly 85 90 95 atgttcgcgcgagagatctcggggctggggcagcccgtgtgggggtca 336MetPheAlaArgGluIleSerGlyLeuGlyGlnProValTrpGlySer 100 105 110 accatgccgtggagcgatagaaaatcgtttaagatcctcctcggggtg 384ThrMetProTrpSerAspArgLysSerPheLysIleLeuLeuGlyVal 115 120 125 tggttgcactacaacaacaaatatttggagctattggacactgtgttc 432TrpLeuHisTyrAsnAsnLysTyrLeuGluLeuLeuAspThrValPhe 130 135 140 atggttgcgcgcaagaagacgaagcagttgagcttcttgcacgttta t 480MetValAlaArgLysLysThrLysGlnLeuSerPheLeuHisValTyr 145 150 155 160 catcacgccctgttgatctgggcgtggtggttggtgtgtcacttgatg 528HisHisAlaLeuLeuIleTrpAlaTrpTrpLeuValCysHisLeuMet 165 170 175 gccacgaacgattgtatcgatgcctacttcggcgcggcgtgcaactcg 576AlaThrAsnAspCysIleAspAlaTyrPheGlyAlaAlaCysAsnSer 180 185 190 ttcattcacatcgtgatgtactcgtattatctcatgtcggcgctcggc 624PheIleHisIleValMetTyrSerTyrTyrLeuMetSerAlaLeuGly 195 200 205 attcgatgcccgtggaagcgatacatcacccaggctcaaatgctccaa 672IleArgCysProTrpLysArgTyrIleThrGlnAlaGlnMetLeuGln 210 215 220 ttcgtcattgtcttcgcgcacgccgtgttcgtgctgcgtcagaagcac 720PheValIleValPheAlaHisAlaValPheValLeuArgGlnLysHis 225 230 235 240 tgcccggtcacccttccttgggcgcaaatgttcgtcatgacgaacatg 768CysProValThrLeuProTrpAlaGlnMetPheValMetThrAsnMet 245 250 255 ctcgtgctcttcgggaacttctacctcaaggcgtactcgaacaagtcg 816LeuValLeuPheGlyAsnPheTyrLeuLysAlaTyrSerAsnLysSer 260 265 270 cgcggcgacggcgcgagttccgtgaaaccagccgagaccacgcgcgcg 864 133ArgGlyAspGlyAlaSerSerValLysProAlaGluThrThrArgAla 275 280 285 cccagcgtgcgacgcacgcgatctcgaaaaattgactaa 903ProSerValArgArgThrArgSerArgLysIleAsp 290 295 300 <210> 78<211> 300<212> PRT<213> Ostreococcustauri<400> 78MetSerAlaSerGlyAlaLeuLeuProAlaIleAlaPheAlaAlaTyr 1 5 10 15 AlaTyrAlaThrTyrAlaTyrAlaPheGluTrpSerHisAlaAsnGly 20 25 30 IleAspAsnValAspAlaArgGluTrpIleGlyAlaLeuSerLeuArg 35 40 45 LeuProAlaIleAlaThrThrMetTyrLeuLeuPheCysLeuValGly 50 55 60 ProArgLeuMetAlaLysArgGluAlaPheAspProLysGlyPheMet 65 70 75 80 LeuAlaTyrAsnAlaTyrGlnThrAlaPheAsnValValValLeuGly 85 90 95 MetPheAlaArgGluIleSerGlyLeuGlyGlnProValTrpGlySer 100 105 110 ThrMetProTrpSerAspArgLysSerPheLysIleLeuLeuGlyVal 115 120 125 TrpLeuHisTyrAsnAsnLysTyrLeuGluLeuLeuAspThrValPhe 130 135 140 MetValAlaArgLysLysThrLysGlnLeuSerPheLeuHisValTyr 145 150 155 160 HisHisAlaLeuLeuIleTrpAlaTrpTrpLeuValCysHisLeuMet 165 170 175 AlaThrAsnAspCysIleAspAlaTyrPheGlyAlaAlaCysAsnSer 180 185 190 134PheIleHisIleValMetTyrSerTyrTyrLeuMetSerAlaLeuGly 195 200 205 IleArgCysProTrpLysArgTyrIleThrGlnAlaGlnMetLeuGln 210 215 220 PheValIleValPheAlaHisAlaValPheValLeuArgGlnLysHis 225 230 235 240 CysProValThrLeuProTrpAlaGlnMetPheValMetThrAsnMet 245 250 255 LeuValLeuPheGlyAsnPheTyrLeuLysAlaTyrSerAsnLysSer 260 265 270 ArgGlyAspGlyAlaSerSerValLysProAlaGluThrThrArgAla 275 280 285 ProSerValArgArgThrArgSerArgLysIleAsp 290 295 300 <210> 79<211> 903<212> DNA<213> Ostreococcustauri<220><221 > CDS<222> (1)..(903)<223> Δ5-elongase<400> 79atgagcgcctccggtgcgctgctgcccgcgatcgcgtccgccgcgtac 48MetSerAlaSerGlyAlaLeuLeuProAlaIleAlaSerAlaAlaTyr 1 5 10 15 gcgtacgcgacgtacgcctacgcctttgagtggtcgcacgcgaatggc 96AlaTyrAlaThrTyrAlaTyrAlaPheGluTrpSerHisAlaAsnGly 20 25 30 atcgacaacgtcgacgcgcgcgagtggatcggtgcgctgtcgttgagg 144IleAspAsnValAspAlaArgGluTrpIleGlyAlaLeuSerLeuArg 35 40 45 ctcccggcgatcgcgacgacgatgtacctgttgttctgcctggtcgga 192LeuProAlaIleAlaThrThrMetTyrLeuLeuPheCysLeuValGly 50 55 60 ccgaggttgatggcgaagcgcgaggcgttcgaccc gaaggggttcatg 240ProArgLeuMetAlaLysArgGluAlaPheAspProLysGlyPheMet 65 70 75 80 135ctggcgtacaatgcgtatcagacggcgttcaacgtcgtcgtgctcggg 288LeuAlaTyrAsnAlaTyrGlnThrAlaPheAsnValValValLeuGly 85 90 95 atgttcgcgcgagagatctcggggctggggcagcccgtgtgggggtca 336MetPheAlaArgGluIleSerGlyLeuGlyGlnProValTrpGlySer 100 105 110 accatgccgtggagcgatagaaaatcgtttaagatcctcctcggggtg 384ThrMetProTrpSerAspArgLysSerPheLysIleLeuLeuGlyVal 115 120 125 tggttgcactacaacaaccaatatttggagctattggacactgtgttc 432TrpLeuHisTyrAsnAsnGlnTyrLeuGluLeuLeuAspThrValPhe 130 135 140 atggttgcgcgcaagaagacgaagcagttgagcttcttgcacgtttat 480MetValAlaArgLysLysThrLysGlnLeuSerPheLeuHisValTyr 145 150 155 160 catcacgccctgttgatctgggcgtggtggttggtgtgtcacttgatg 528HisHisAlaLeuLeuIleTrpAlaTrpTrpLeuValCysHisLeuMet 165 170 175 gccacgaacgattgtatcgatgcctacttcggcgcggcgtgcaactcg 576AlaThrAsnAspCysIleAspAlaTyrPheGlyAlaAlaCysAsnSer 180 185 190 ttcattcacatcgtgatgtactcgtattatctcatgtcggcgctcggc 624PheIleHisIleValMetTyrSerTyrTyrLeuMetSerAlaLeuGly 195 200 205 attcgatgcccgtggaagcgatacatcacccaggctcaaatgctccaa 672IleArgCysProTrpLysArgTyrIleThrGlnAlaGlnM etLeuGln 210 215 220 ttcgtcattgtcttcgcgcacgccgtgttcgtgctgcgtcagaagcac 720PheValIleValPheAlaHisAlaValPheValLeuArgGlnLysHis 225 230 235 240 tgcccggtcacccttccttgggcgcaaatgttcgtcatgacgaacatg 768CysProValThrLeuProTrpAlaGlnMetPheValMetThrAsnMet 245 250 255 ctcgtgctcttcgggaacttctacctcaaggcgtactcgaacaagtcg 816LeuValLeuPheGlyAsnPheTyrLeuLysAlaTyrSerAsnLysSer 260 265 270 cgcggcgacggcgcgagttccgtgaaaccagccgagaccacgcgcgcg 864ArgGlyAspGlyAlaSerSerValLysProAlaGluThrThrArgAla 275 280 285 cccagcgtgcgacgcacgcgatctcgaaaaattgactaa 903ProSerValArgArgThrArgSerArgLysIleAsp 290 295 300 <210> 80<211> 300<212> PRT<213> Ostreococcustauri 136<400> 80MetSerAlaSerGlyAlaLeuLeuProAlaIleAlaSerAlaAlaTyr 1 5 10 15 AlaTyrAlaThrTyrAlaTyrAlaPheGluTrpSerHisAlaAsnGly 20 25 30 IleAspAsnValAspAlaArgGluTrpIleGlyAlaLeuSerLeuArg 35 40 45 LeuProAlaIleAlaThrThrMetTyrLeuLeuPheCysLeuValGly 50 55 60 ProArgLeuMetAlaLysArgGluAlaPheAspProLysGlyPheMet 65 70 75 80 LeuAlaTyrAsnAlaTyrGlnThrAlaPheAsnValValValLeuGly 85 90 95 MetPheAlaArgGluIleSerGlyLeuGlyGlnProValTrpGlySer 100 105 110 ThrMetProTrpSerAspArgLysSerPheLysIleLeuLeuGlyVal 115 120 125 TrpLeuHisTyrAsnAsnGlnTyrLeuGluLeuLeuAspThrValPhe 130 135 140 MetValAlaArgLysLysThrLysGlnLeuSerPheLeuHisValTyr 145 150 155 160 HisHisAlaLeuLeuIleTrpAlaTrpTrpLeuValCysHisLeuMet 165 170 175 AlaThrAsnAspCysIleAspAlaTyrPheGlyAlaAlaCysAsnSer 180 185 190 PheIleHisIleValMetTyrSerTyrTyrLeuMetSerAlaLeuGly 195 200 205 IleArgCysProTrpLysArgTyrIleThrGlnAlaGlnMetLeuGln 210 215 220 PheValIleValPheAlaHisAlaValPheValLeuArgGlnLysHis 225 230 235 240 CysProValThrLeuProTrpAlaGlnMetPheValMetThrAsnMet 245 250 255 LeuValLeuPheGlyAsnP HETYRLEULYS ALATIRSERASNLYS 260 265 270 137ArgGlyAspGlyAlaSerSerValLysProAlaGluThrThrArgAla 275 280 285 ProSerValArgArgThrArgSerArgLysIleAsp 290 295 300 <210> 81<211> 879<212> DNA<213> Ostreococcustauri<220><221> CDS<222> (1)..(879)<00<223>40<223> Δelongase > 81atgagtggcttacgtgcacccaactttttacacagattctggacaaag 48MetSerGlyLeuArgAlaProAsnPheLeuHisArgPheTrpThrLys 1 5 10 15 tgggactacgcgatttccaaagtcgtcttcacgtgtgccgacagtttt 96TrpAspTyrAlaIleSerLysValValPheThrCysAlaAspSerPhe 20 25 30 cagtgggacatcgggccagtgagttcgagtacggcgcatttacccgcc 144GlnTrpAspIleGlyProValSerSerSerThrAlaHisLeuProAla 35 40 45 attgaatcccctaccccactggtgactagcctcttgttctacttagtc 192IleGluSerProThrProLeuValThrSerLeuLeuPheTyrLeuVal 50 55 60 acagttttcttgtggtatggtcgtttaaccaggagttcagacaagaaa 240ThrValPheLeuTrpTyrGlyArgLeuThrArgSerSerAspLysLys 65 70 75 80 attagagagcctacgtggttaagaagattcataatatgtcataatgcg 288IleArgGluProThrTrpLeuArgArgPheIleIleCysHisAsnAla 85 90 95 ttcttgatagtcctcagtctttacatgtgccttggttgtgtggcccaa 336PheLeuIleValLeuSerLeuTyrMetCysLeuGlyCysValAlaGln 100 105 110 gcgtatca gaatggatatactttatggggtaatgaattcaaggccacg 384AlaTyrGlnAsnGlyTyrThrLeuTrpGlyAsnGluPheLysAlaThr 115 120 125 gaaactcagcttgctctctacatttacatttttacgtaagtaaaata 432GluThrGlnLeuAlaLeuTyrIleTyrIlePheTyrValSerLysIle 130 135 140 taccatagatcatactttgctttgcttcatactggt430 138TyrGluPheValAspThrTyrIleMetLeuLeuLysAsnAsnLeuArg 145 150 155 160 caagtaagattcctacacacttatcaccacagcacgatttcctttatt 528GlnValArgPheLeuHisThrTyrHisHisSerThrIleSerPheIle 165 170 175 tggtggatcattgctcggagggctccgggtggtgatgcttacttcagc 576TrpTrpIleIleAlaArgArgAlaProGlyGlyAspAlaTyrPheSer 180 185 190 gcggccttgaactcatgggtacacgtgtgcatgtacacctattatcta 624AlaAlaLeuAsnSerTrpValHisValCysMetTyrThrTyrTyrLeu 195 200 205 ttatcaacccttattggaaaagaagatcctaagcgttccaactacctt 672LeuSerThrLeuIleGlyLysGluAspProLysArgSerAsnTyrLeu 210 215 220 tggtggggtcgccacctaacgcaaatgcagatgcttcagtttttcttc 720TrpTrpGlyArgHisLeuThrGlnMetGlnMetLeuGlnPhePhePhe 225 230 235 240 aacgtacttcaagcgttgtactgcgcttcgttctctacgtatcccaag 768AsnValLeuGlnAlaLeuTyrCysAlaSerPheSerThrTyrProLys 245 250 255 tttttgtccaaaattctgctcgtctatatgatgagccttctcggcttg 816PheLeuSerLysIleLeuLeuValTyrMetMetSerLeuLeuGlyLeu 260 265 270 tttgggcatttctactattccaagcacatagcagcagctaagctccag 864PheGlyHisPheTyrTyrSerLysHisIleAlaAlaAlaLysLeuGln 275 280 285 aaaaaacagcagtga 879LysLy sGlnGln 290 <210> 82<211> 292<212> PRT<213> Ostreococcustauri<400> 82MetSerGlyLeuArgAlaProAsnPheLeuHisArgPheTrpThrLys 1 5 10 15 TrpAspTyrAlaIleSerLysValValPheThrCysAlaAspSerPhe 20 25 30 GlnTrpAspIleGlyProValSerSerSerThrAlaHisLeuProAla 35 40 45 IleGluSerProThrProLeuValThrSerLeuLeuPheTyrLeuVal 50 55 60 139ThrValPheLeuTrpTyrGlyArgLeuThrArgSerSerAspLysLys 65 70 75 80 IleArgGluProThrTrpLeuArgArgPheIleIleCysHisAsnAla 85 90 95 PheLeuIleValLeuSerLeuTyrMetCysLeuGlyCysValAlaGln 100 105 110 AlaTyrGlnAsnGlyTyrThrLeuTrpGlyAsnGluPheLysAlaThr 115 120 125 GluThrGlnLeuAlaLeuTyrIleTyrIlePheTyrValSerLysIle 130 135 140 TyrGluPheValAspThrTyrIleMetLeuLeuLysAsnAsnLeuArg 145 150 155 160 GlnValArgPheLeuHisThrTyrHisHisSerThrIleSerPheIle 165 170 175 TrpTrpIleIleAlaArgArgAlaProGlyGlyAspAlaTyrPheSer 180 185 190 AlaAlaLeuAsnSerTrpValHisValCysMetTyrThrTyrTyrLeu 195 200 205 LeuSerThrLeuIleGlyLysGluAspProLysArgSerAsnTyrLeu 210 215 220 TrpTrpGlyArgHisLeuThrGlnMetGlnMetLeuGlnPhePhePhe 225 230 235 240 AsnValLeuGlnAlaLeuTyrCysAlaSerPheSerThrTyrProLys 245 250 255 PheLeuSerLysIleLeuLeuValTyrMetMetSerLeuLeuGlyLeu 260 265 270 PheGlyHisPheTyrTyrSerLysHisIleAlaAlaAlaLysLeuGln 275 280 285 LysLysGlnGln 290 <210> 83<211> 831<212> DNA<213> Thraustochytrium sp. 140<220><221> CDS<222> (1)..(831)<223> Δ5-elongase<400> 83atggacgtcgtcgagcagcaatggcgccgcttcgtggacgccgtggac 48MetAspValValGluGlnGlnTrpArgArgPheValAspAlaValAsp 1 5 10 15 aacggaatcgtggagttcatggagcatgagaagcccaacaagctgaac 96AsnGlyIleValGluPheMetGluHisGluLysProAsnLysLeuAsn 20 25 30 gagggcaagctcttcacctcgaccgaggagatgatggcgcttatcgtc 144GluGlyLysLeuPheThrSerThrGluGluMetMetAlaLeuIleVal 35 40 45 ggctacctggcgttcgtggtcctcgggtccgccttcatgaaggccttt 192GlyTyrLeuAlaPheValValLeuGlySerAlaPheMetLysAlaPhe 50 55 60 gtcgataagcctttcgagctcaagttcctcaagctcgtgcacaacatc 240ValAspLysProPheGluLeuLysPheLeuLysLeuValHisAsnIle 65 70 75 80 ttcctcaccggtctgtccatgtacatggccaccgagtgcgcgcgccag 288PheLeuThrGlyLeuSerMetTyrMetAlaThrGluCysAlaArgGln 85 90 95 gcatacctcggcggctacaagctctttggcaacccgatggagaagggc 336AlaTyrLeuGlyGlyTyrLysLeuPheGlyAsnProMetGluLysGly 100 105 110 accgagtcgcacgccccgggcatggccaacatcatctacatcttctac 384ThrGluSerHisAlaProGlyMetAlaAsnIleIleTyrIlePheTyr 115 120 125 gtgagcaagttcctcgaattcctcgacaccgtcttcatgatcctcggc 432Va lSerLysPheLeuGluPheLeuAspThrValPheMetIleLeuGly 130 135 140 aagaagtggaagcagctcagctttctccacgtctaccaccacgcgagc 480LysLysTrpLysGlnLeuSerPheLeuHisValTyrHisHisAlaSer 145 150 155 160 atcagcttcatctggggcatcatcgcccgcttcgcgcccggtggcgac 528IleSerPheIleTrpGlyIleIleAlaArgPheAlaProGlyGlyAsp 165 170 175 gcctacttctctaccatcctcaacagcagcgtgcatgtcgtgctctac 576AlaTyrPheSerThrIleLeuAsnSerSerValHisValValLeuTyr 180 185 190 ggctactacgcctcgaccaccctcggctacaccttcatgcgcccgctg 624GlyTyrTyrAlaSerThrThrLeuGlyTyrThrPheMetArgProLeu 195 200 205 cgcccgtacattaccaccattcagctcacgcagttcatggccatggtc 672ArgProTyrIleThrThrIleGlnLeuThrGlnPheMetAlaMetVal 210 215 220 141gtccagtccgtctatgactactacaacccctgcgactacccgcagccc 720ValGlnSerValTyrAspTyrTyrAsnProCysAspTyrProGlnPro 225 230 235 240 ctcgtcaagctgctcttctggtacatgctcaccatgctcggcctcttc 768LeuValLysLeuLeuPheTrpTyrMetLeuThrMetLeuGlyLeuPhe 245 250 255 ggcaacttcttcgtgcagcagtacctcaagcccaaggcgcccaagaag 816GlyAsnPhePheValGlnGlnTyrLeuLysProLysAlaProLysLys 260 265 270 cagaagaccatctaa 831GlnLysThrIle 275 <210> 84<211> 276<212> PRT<213> Thraustochytriumsp.<400> 84MetAspValValGluGlnGlnTrpArgArgPheValAspAlaValAsp 1 5 10 15 AsnGlyIleValGluPheMetGluHisGluLysProAsnLysLeuAsn 20 25 30 GluGlyLysLeuPheThrSerThrGluGluMetMetAlaLeuIleVal 35 40 45 GlyTyrLeuAlaPheValValLeuGlySerAlaPheMetLysAlaPhe 50 55 60 ValAspLysProPheGluLeuLysPheLeuLysLeuValHisAsnIle 65 70 75 80 PheLeuThrGlyLeuSerMetTyrMetAlaThrGluCysAlaArgGln 85 90 95 AlaTyrLeuGlyGlyTyrLysLeuPheGlyAsnProMetGluLysGly 100 105 110 ThrGluSerHisAlaProGlyMetAlaAsnIleIleTyrIlePheTyr 115 120 125 ValSerLysPheLeuGluPheLeuAspThrValPheMetIleLeuGly 130 135 140 LysLysTrpLysGlnLeuSerPhe LeuHisValTyrHisHisAlaser 145 150 155 160 142IleSerPheIleTrpGlyIleIleAlaArgPheAlaProGlyGlyAsp 165 170 175 AlaTyrPheSerThrIleLeuAsnSerSerValHisValValLeuTyr 180 185 190 GlyTyrTyrAlaSerThrThrLeuGlyTyrThrPheMetArgProLeu 195 200 205 ArgProTyrIleThrThrIleGlnLeuThrGlnPheMetAlaMetVal 210 215 220 ValGlnSerValTyrAspTyrTyrAsnProCysAspTyrProGlnPro 225 230 235 240 LeuValLysLeuLeuPheTrpTyrMetLeuThrMetLeuGlyLeuPhe 245 250 255 GlyAsnPhePheValGlnGlnTyrLeuLysProLysAlaProLysLys 260 265 270 GlnLysThrIle 275 <210> 85<211> 1077<212> DNA<213> Thalassiosirapseudonana<220> <221> CDS<222> (1)..(1077)<223> Δ5-elongase<400> 85atgtgctcaccaccgccgtcacaatccaaaacaacatccctcctagca 48MetCysSerProProProSerGlnSerLysThrThrSerLeuLeuAla 1 5 10 15 cggtacaccaccgccgccctcctcctcctcaccctcacaacgtggtgc 96ArgTyrThrThrAlaAlaLeuLeuLeuLeuThrLeuThrThrTrpCys 20 25 30 cacttcgccttcccagccgccaccgccacacccggcctcaccgccgaa 144HisPheAlaPheProAlaAlaThrAlaThrProGlyLeuThrAlaGlu 35 40 45 atgcactcctacaaagtcccactcggtctcaccgtattctacctgctg 192 143MetHisSerTyrLysValProLeuGlyLeuThrValPheTyrLeuLeu 50 55 60 agtctaccgtcactaaagtacgttacggacaactaccttgccaaaaag 240SerLeuProSerLeuLysTyrValThrAspAsnTyrLeuAlaLysLys 65 70 75 80 tatgatatgaagtcactcctgacggaatcaatggtgttgtacaatgtg 288TyrAspMetLysSerLeuLeuThrGluSerMetValLeuTyrAsnVal 85 90 95 gcgcaagtgctgctcaatgggtggacggtgtatgcgattgtggatgcg 336AlaGlnValLeuLeuAsnGlyTrpThrValTyrAlaIleValAspAla 100 105 110 gtgatgaatagagaccatccttttattggaagtagaagtttggttggg 384ValMetAsnArgAspHisProPheIleGlySerArgSerLeuValGly 115 120 125 gcggcgttgcatagtgggagctcgtatgcggtgtgggttcattattgt 432AlaAlaLeuHisSerGlySerSerTyrAlaValTrpValHisTyrCys 130 135 140 gataagtatttggagttctttgatacgtattttatggtgttgaggggg 480AspLysTyrLeuGluPhePheAspThrTyrPheMetValLeuArgGly 145 150 155 160 aaaatggaccaggtctccttcctccacatctaccaccacacgaccata 528LysMetAspGlnValSerPheLeuHisIleTyrHisHisThrThrIle 165 170 175 gcgtgggcatggtggatcgccctccgcttctcccccggcggagacatt 576AlaTrpAlaTrpTrpIleAlaLeuArgPheSerProGlyGlyAspIle 180 185 190 tacttcggggcactcctcaactccatcatccacg tcctcatgtattcc 624TyrPheGlyAlaLeuLeuAsnSerIleIleHisValLeuMetTyrSer 195 200 205 tactacgcccttgccctactcaaggtcagttgtccatggaaacgatac 672TyrTyrAlaLeuAlaLeuLeuLysValSerCysProTrpLysArgTyr 210 215 220 ttgactcaagctcaattattgcaattcacaagtgtggtggtttatacg 720LeuThrGlnAlaGlnLeuLeuGlnPheThrSerValValValTyrThr 225 230 235 240 gggtgtacgggttatactcattactatcatacgaagcatggagcggat 768GlyCysThrGlyTyrThrHisTyrTyrHisThrLysHisGlyAlaAsp 245 250 255 gagacacagcctagtttaggaacgtattatttctgttgtggagtgcag 816GluThrGlnProSerLeuGlyThrTyrTyrPheCysCysGlyValGln 260 265 270 gtgtttgagatggttagtttgtttgtactcttttccatcttttataaa 864ValPheGluMetValSerLeuPheValLeuPheSerIlePheTyrLys 275 280 285 cgatcctattcgaagaagaacaagtcaggaggaaaggatagcaagaag 912ArgSerTyrSerLysLysAsnLysSerGlyGlyLysAspSerLysLys 290 295 300 aatgatgatgggaataatgaggatcaatgtcacaaggctatgaaggat 960AsnAspAspGlyAsnAsnGluAspGlnCysHisLysAlaMetLysAsp 305 310 315 320 atatcggagggtgcgaaggaggttgtggggcatgcagcgaaggatgct 1008 144IleSerGluGlyAlaLysGluValValGlyHisAlaAlaLysAspAla 325 330 335 ggaaagttggtggctacggcgagtaaggctgtaaagaggaagggaact 1056GlyLysLeuValAlaThrAlaSerLysAlaValLysArgLysGlyThr 340 345 350 cgtgttactggtgccatgtag 1077ArgValThrGlyAlaMet 355 <210> 86<211> 358<212> PRT<213> Thalassiosirapseudonana<400> 86MetCysSerProProProSerGlnSerLysThrThrSerLeuLeuAla 1 5 10 15 ArgTyrThrThrAlaAlaLeuLeuLeuLeuThrLeuThrThrTrpCys 20 25 30 HisPheAlaPheProAlaAlaThrAlaThrProGlyLeuThrAlaGlu 35 40 45 MetHisSerTyrLysValProLeuGlyLeuThrValPheTyrLeuLeu 50 55 60 SerLeuProSerLeuLysTyrValThrAspAsnTyrLeuAlaLysLys 65 70 75 80 TyrAspMetLysSerLeuLeuThrGluSerMetValLeuTyrAsnVal 85 90 95 AlaGlnValLeuLeuAsnGlyTrpThrValTyrAlaIleValAspAla 100 105 110 ValMetAsnArgAspHisProPheIleGlySerArgSerLeuValGly 115 120 125 AlaAlaLeuHisSerGlySerSerTyrAlaValTrpValHisTyrCys 130 135 140 AspLysTyrLeuGluPhePheAspThrTyrPheMetValLeuArgGly 145 150 155 160 LysMetAspGlnValSerPheLeuHisIleTyrHisHisThrThrIle 165 170 175 145AlaTrpAlaTrpTrpIleAlaLeuArgPheSerProGlyGlyAspIle 180 185 190 TyrPheGlyAlaLeuLeuAsnSerIleIleHisValLeuMetTyrSer 195 200 205 TyrTyrAlaLeuAlaLeuLeuLysValSerCysProTrpLysArgTyr 210 215 220 LeuThrGlnAlaGlnLeuLeuGlnPheThrSerValValValTyrThr 225 230 235 240 GlyCysThrGlyTyrThrHisTyrTyrHisThrLysHisGlyAlaAsp 245 250 255 GluThrGlnProSerLeuGlyThrTyrTyrPheCysCysGlyValGln 260 265 270 ValPheGluMetValSerLeuPheValLeuPheSerIlePheTyrLys 275 280 285 ArgSerTyrSerLysLysAsnLysSerGlyGlyLysAspSerLysLys 290 295 300 AsnAspAspGlyAsnAsnGluAspGlnCysHisLysAlaMetLysAsp 305 310 315 320 IleSerGluGlyAlaLysGluValValGlyHisAlaAlaLysAspAla 325 330 335 GlyLysLeuValAlaThrAlaSerLysAlaValLysArgLysGlyThr 340 345 350 ArgValThrGlyAlaMet 355 <210 > 87<211> 1086<212> DNA<213> Phytophthorainfestans<220><221> CDS<222> (1)..(1086)<223> ω3-desaturase 146<400> 87atggcgacgaaggaggcgtatgtgttccccactctgacggagatcaag 48MetAlaThrLysGluAlaTyrValPheProThrLeuThrGluIleLys 1 5 10 15 cggtcgctacctaaagactgtttcgaggcttcggtgcctctgtcgctc 96ArgSerLeuProLysAspCysPheGluAlaSerValProLeuSerLeu 20 25 30 tactacaccgtgcgttgtctggtgatcgcggtggctctaaccttcggt 144TyrTyrThrValArgCysLeuValIleAlaValAlaLeuThrPheGly 35 40 45 ctcaactacgctcgcgctctgcccgaggtcgagagcttctgggctctg 192LeuAsnTyrAlaArgAlaLeuProGluValGluSerPheTrpAlaLeu 50 55 60 gacgccgcactctgcacgggctacatcttgctgcagggcatcgtgttc 240AspAlaAlaLeuCysThrGlyTyrIleLeuLeuGlnGlyIleValPhe 65 70 75 80 tggggcttcttcacggtgggccacgatgccggccacggcgccttctcg 288TrpGlyPhePheThrValGlyHisAspAlaGlyHisGlyAlaPheSer 85 90 95 cgctaccacctgcttaacttcgtggtgggcactttcatgcactcgctc 336ArgTyrHisLeuLeuAsnPheValValGlyThrPheMetHisSerLeu 100 105 110 atcctcacgcccttcgagtcgtggaagctcacgcaccgtcaccaccac 384IleLeuThrProPheGluSerTrpLysLeuThrHisArgHisHisHis 115 120 125 aagaacacgggcaacattgaccgtgacgaggtcttctacccgcaacgc 432LysAsnThrGlyAsnIleAspArgAspGluValPheTyrProGlnArg 130 135 140 aaggccgacgaccacccgctgtctcgcaacctgattctggcgctcggg 480LysAlaAspAspHisProLeuSerArgAsnLeuIleLeuAlaLeuGly 145 150 155 160 gcagcgtggctcgcctatttggtcgagggcttccctcctcgtaaggtc 528AlaAlaTrpLeuAlaTyrLeuValGluGlyPheProProArgLysVal 165 170 175 aaccacttcaacccgttcgagcctctgttcgtgcgtcaggtgtcagct 576AsnHisPheAsnProPheGluProLeuPheValArgGlnValSerAla 180 185 190 gtggtaatctctcttctcgcccacttcttcgtggccggactctccatc 624ValValIleSerLeuLeuAlaHisPhePheValAlaGlyLeuSerIle 195 200 205 tatctgagcctccagctgggccttaagacgatggcaatctactactat 672TyrLeuSerLeuGlnLeuGlyLeuLysThrMetAlaIleTyrTyrTyr 210 215 220 ggacctgtttttgtgttcggcagcatgctggtcattaccaccttccta 720GlyProValPheValPheGlySerMetLeuValIleThrThrPheLeu 225 230 235 240 caccacaatgatgaggagaccccatggtacgccgactcggagtggacg 768HisHisAsnAspGluGluThrProTrpTyrAlaAspSerGluTrpThr 245 250 255 tacgtcaagggcaacctctcgtccgtggaccgatcgtacggcgcgctc 816TyrValLysGlyAsnLeuSerSerValAspArgSerTyrGlyAlaLeu 260 265 270 147attgacaacctgagccacaacatcggcacgcaccagatccaccacctt 864IleAspAsnLeuSerHisAsnIleGlyThrHisGlnIleHisHisLeu 275 280 285 ttccctatcattccgcactacaaactcaagaaagccactgcggccttc 912PheProIleIleProHisTyrLysLeuLysLysAlaThrAlaAlaPhe 290 295 300 caccaggctttccctgagctcgtgcgcaagagcgacgagccaattatc 960HisGlnAlaPheProGluLeuValArgLysSerAspGluProIleIle 305 310 315 320 aaggctttcttccgggttggacgtctctacgcaaactacggcgttgtg 1008LysAlaPhePheArgValGlyArgLeuTyrAlaAsnTyrGlyValVal 325 330 335 gaccaggaggcgaagctcttcacgctaaaggaagccaaggcggcgacc 1056AspGlnGluAlaLysLeuPheThrLeuLysGluAlaLysAlaAlaThr 340 345 350 gaggcggcggccaagaccaagtccacgtaa 1086GluAlaAlaAlaLysThrLysSerThr 355 360 <210> 88<211> 361<212> PRT<213> Phytophthorainfestans<400> 88MetAlaThrLysGluAlaTyrValPheProThrLeuThrGluIleLys 1 5 10 15 ArgSerLeuProLysAspCysPheGluAlaSerValProLeuSerLeu 20 25 30 TyrTyrThrValArgCysLeuValIleAlaValAlaLeuThrPheGly 35 40 45 LeuAsnTyrAlaArgAlaLeuProGluValGluSerPheTrpAlaLeu 50 55 60 AspAlaAlaLeuCysThrGlyTyrIleLeuLeuGl70 75 60 ValnGly TrpGlyPhePheThrValGlyHisAspAlaGlyHisGlyAlaPheSer 85 90 95 ArgTyrHisLeuLeuAsnPheValValGlyThrPheMetHisSerLeu 100 105 110 IleLeuThrProPheGluSerTrpLysLeuThrHisArgHisHisHis 115 120 125 148LysAsnThrGlyAsnIleAspArgAspGluValPheTyrProGlnArg 130 135 140 LysAlaAspAspHisProLeuSerArgAsnLeuIleLeuAlaLeuGly 145 150 155 160 AlaAlaTrpLeuAlaTyrLeuValGluGlyPheProProArgLysVal 165 170 175 AsnHisPheAsnProPheGluProLeuPheValArgGlnValSerAla 180 185 190 ValValIleSerLeuLeuAlaHisPhePheValAlaGlyLeuSerIle 195 200 205 TyrLeuSerLeuGlnLeuGlyLeuLysThrMetAlaIleTyrTyrTyr 210 215 220 GlyProValPheValPheGlySerMetLeuValIleThrThrPheLeu 225 230 235 240 HisHisAsnAspGluGluThrProTrpTyrAlaAspSerGluTrpThr 245 250 255 TyrValLysGlyAsnLeuSerSerValAspArgSerTyrGlyAlaLeu 260 265 270 IleAspAsnLeuSerHisAsnIleGlyThrHisGlnIleHisHisLeu 275 280 285 PheProIleIleProHisTyrLysLeuLysLysAlaThrAlaAlaPhe 290 295 300 HisGlnAlaPheProGluLeuValArgLysSerAspGluProIleIle 305 310 315 320 LysAlaPhePheArgValGlyArgLeuTyrAlaAsnTyrGlyValVal 325 330 335 AspGlnGluAlaLysLeuPheThrLeuLysGluAlaLysAlaAlaThr 340 345 350 GluAlaAlaAlaLysThrLysSerThr 355 360 <210> 89<211> 1371<212> DNA 149<213> Ostreococcustauri<220><221> CDS<222> (1)..(1371)<223> Δ6-desaturase<400> 89atgtgcgtggagacggaaaataacgatgggatccccacggtggagatc 48MetCysValGluThrGluAsnAsnAspGlyIleProThrValGluIle 1 5 10 15 gcgttcgacggtgagcgcgagcgggcggaggcaaacgtgaagctgtcc 96AlaPheAspGlyGluArgGluArgAlaGluAlaAsnValLysLeuSer 20 25 30 gcggagaagatggagccggcggcgctggcgaagacgttcgcgaggcgg 144AlaGluLysMetGluProAlaAlaLeuAlaLysThrPheAlaArgArg 35 40 45 tacgtcgtgatcgagggggtggagtacgatgtgacggattttaagcac 192TyrValValIleGluGlyValGluTyrAspValThrAspPheLysHis 50 55 60 ccgggaggaacggttattttctatgcgttgtcaaacaccggggcggac 240ProGlyGlyThrValIlePheTyrAlaLeuSerAsnThrGlyAlaAsp 65 70 75 80 gcgacggaagcgttcaaggagtttcatcatcggtcgagaaaggcgagg 288AlaThrGluAlaPheLysGluPheHisHisArgSerArgLysAlaArg 85 90 95 aaagccttggcggcgctcccgtctcgaccggccaagacggccaaggtg 336LysAlaLeuAlaAlaLeuProSerArgProAlaLysThrAlaLysVal 100 105 110 gacgacgcggagatgctccaagatttcgccaagtggcggaaagaattg 384AspAspAlaGluMetLeuGlnAspPheAlaLysTrpArgLysGluLeu 115 120 125 gagagagatggattcttcaagccctctc cggcgcacgtggcgtatcgc 432GluArgAspGlyPhePheLysProSerProAlaHisValAlaTyrArg 130 135 140 ttcgccgagctcgcggcgatgtacgctctcgggacgtacctgatgtac 480PheAlaGluLeuAlaAlaMetTyrAlaLeuGlyThrTyrLeuMetTyr 145 150 155 160 gctcgatacgtcgtctcctcggtgctcgtgtacgcttgctttttcggc 528AlaArgTyrValValSerSerValLeuValTyrAlaCysPhePheGly 165 170 175 gcccgatgcggttgggtgcagcacgagggcggacacagctcgctgacg 576AlaArgCysGlyTrpValGlnHisGluGlyGlyHisSerSerLeuThr 180 185 190 ggcaacatttggtgggacaagcgcatccaggccttcacagccgggttc 624GlyAsnIleTrpTrpAspLysArgIleGlnAlaPheThrAlaGlyPhe 195 200 205 ggtctcgccggtagcggcgacatgtggaactcgatgcacaacaagcat 672 150GlyLeuAlaGlySerGlyAspMetTrpAsnSerMetHisAsnLysHis 210 215 220 cacgcgacgcctcaaaaggttcgtcacgacatggatctggacaccacc 720HisAlaThrProGlnLysValArgHisAspMetAspLeuAspThrThr 225 230 235 240 cccgcggtggcgttcttcaacaccgcggtggaagacaatcgtccccgt 768ProAlaValAlaPhePheAsnThrAlaValGluAspAsnArgProArg 245 250 255 ggctttagcaagtactggttgcgccttcaggcgtggaccttcatcccc 816GlyPheSerLysTyrTrpLeuArgLeuGlnAlaTrpThrPheIlePro 260 265 270 gtgacgtccggcttggtgctccttttctggatgtttttcctccacccc 864ValThrSerGlyLeuValLeuLeuPheTrpMetPhePheLeuHisPro 275 280 285 tccaaggctttgaagggtggcaagtacgaagagttggtgtggatgctc 912SerLysAlaLeuLysGlyGlyLysTyrGluGluLeuValTrpMetLeu 290 295 300 gccgcgcacgtcatccgcacgtggacgatcaaggcggtgaccggattc 960AlaAlaHisValIleArgThrTrpThrIleLysAlaValThrGlyPhe 305 310 315 320 accgcgatgcagtcctacggcttatttttggcgacgagctgggtgagc 1008ThrAlaMetGlnSerTyrGlyLeuPheLeuAlaThrSerTrpValSer 325 330 335 ggctgctatctgtttgcacacttctccacgtcgcacacgcacctggat 1056GlyCysTyrLeuPheAlaHisPheSerThrSerHisThrHisLeuAsp 340 345 350 gtggtgcccgcggacgagcatc tctcctgggttcgatacgccgtcgat 1104ValValProAlaAspGluHisLeuSerTrpValArgTyrAlaValAsp 355 360 365 cacacgatcgacatcgatccgagtcaaggttgggtgaactggttgatg 1152HisThrIleAspIleAspProSerGlnGlyTrpValAsnTrpLeuMet 370 375 380 ggctacctcaactgccaagtcatccaccacctctttccgagcatgccg 1200GlyTyrLeuAsnCysGlnValIleHisHisLeuPheProSerMetPro 385 390 395 400 cagttccgccagcccgaggtatctcgccgcttcgtcgcctttgcgaaa 1248GlnPheArgGlnProGluValSerArgArgPheValAlaPheAlaLys 405 410 415 aagtggaacctcaactacaaggtcatgacctacgccggtgcgtggaag 1296LysTrpAsnLeuAsnTyrLysValMetThrTyrAlaGlyAlaTrpLys 420 425 430 gcaacgctcggaaacctcgacaacgtgggtaagcactactacgtgcac 1344AlaThrLeuGlyAsnLeuAspAsnValGlyLysHisTyrTyrValHis 435 440 445 ggccaacactccggaaagacggcgtaa 1371GlyGlnHisSerGlyLysThrAla 450 455 <210> 90<211> 456 151<212> PRT<213> Ostreococcustauri<400> 90MetCysValGluThrGluAsnAsnAspGlyIleProThrValGluIle 1 5 10 15 AlaPheAspGlyGluArgGluArgAlaGluAlaAsnValLysLeuSer 20 25 30 AlaGluLysMetGluProAlaAlaLeuAlaLysThrPheAlaArgArg 35 40 45 TyrValValIleGluGlyValGluTyrAspValThrAspPheLysHis 50 55 60 ProGlyGlyThrValIlePheTyrAlaLeuSerAsnThrGlyAlaAsp 65 70 75 80 AlaThrGluAlaPheLysGluPheHisHisArgSerArgLysAlaArg 85 90 95 LysAlaLeuAlaAlaLeuProSerArgProAlaLysThrAlaLysVal 100 105 110 AspAspAlaGluMetLeuGlnAspPheAlaLysTrpArgLysGluLeu 115 120 125 GluArgAspGlyPhePheLysProSerProAlaHisValAlaTyrArg 130 135 140 PheAlaGluLeuAlaAlaMetTyrAlaLeuGlyThrTyrLeuMetTyr 145 150 155 160 AlaArgTyrValValSerSerValLeuValTyrAlaCysPhePheGly 165 170 175 AlaArgCysGlyTrpValGlnHisGluGlyGlyHisSerSerLeuThr 180 185 190 GlyAsnIleTrpTrpAspLysArgIleGlnAlaPheThrAlaGlyPhe 195 200 205 GlyLeuAlaGlySerGlyAspMetTrpAsnSerMetHisAsnLysHis 210 215 220 HisAlaThrProGlnLysValArgHisAspMetAspLeuAspThrThr 225 230 235 240 152ProAlaValAlaPhePheAsnThrAlaValGluAspAsnArgProArg 245 250 255 GlyPheSerLysTyrTrpLeuArgLeuGlnAlaTrpThrPheIlePro 260 265 270 ValThrSerGlyLeuValLeuLeuPheTrpMetPhePheLeuHisPro 275 280 285 SerLysAlaLeuLysGlyGlyLysTyrGluGluLeuValTrpMetLeu 290 295 300 AlaAlaHisValIleArgThrTrpThrIleLysAlaValThrGlyPhe 305 310 315 320 ThrAlaMetGlnSerTyrGlyLeuPheLeuAlaThrSerTrpValSer 325 330 335 GlyCysTyrLeuPheAlaHisPheSerThrSerHisThrHisLeuAsp 340 345 350 ValValProAlaAspGluHisLeuSerTrpValArgTyrAlaValAsp 355 360 365 HisThrIleAspIleAspProSerGlnGlyTrpValAsnTrpLeuMet 370 375 380 GlyTyrLeuAsnCysGlnValIleHisHisLeuPheProSerMetPro 385 390 395 400 GlnPheArgGlnProGluValSerArgArgPheValAlaPheAlaLys 405 410 415 LysTrpAsnLeuAsnTyrLysValMetThrTyrAlaGlyAlaTrpLys 420 425 430 AlaThrLeuGlyAsnLeuAspAsnValGlyLysHisTyrTyrValHis 435 440 445 GlyGlnHisSerGlyLysThrAla 450 455 <210> 91<211> 606<212> DNA<213> Ostreococcus tauri<220> 153<221> CDS<222> (1)..(606)<223> Δ5-desaturase<400> 91atgtacggtttgctatcgctcaagtcgtgcttcgtcgacgatttcaac 48MetTyrGlyLeuLeuSerLeuLysSerCysPheValAspAspPheAsn 1 5 10 15 gcctacttctccggacgcatcggctgggtcaaggtgatgaagttcacc 96AlaTyrPheSerGlyArgIleGlyTrpValLysValMetLysPheThr 20 25 30 cgcggcgaggcgatcgcattttggggcaccaagctcttgtgggccgcg 144ArgGlyGluAlaIleAlaPheTrpGlyThrLysLeuLeuTrpAlaAla 35 40 45 tattacctcgcgttgccgctaaagatgtcgcatcggccgctcggagaa 192TyrTyrLeuAlaLeuProLeuLysMetSerHisArgProLeuGlyGlu 50 55 60 ctcctcgcactctgggccgtcaccgagttcgtcaccggatggctgttg 240LeuLeuAlaLeuTrpAlaValThrGluPheValThrGlyTrpLeuLeu 65 70 75 80 gcgttcatgttccaagtcgcccacgtcgtcggcgaggttcacttcttc 288AlaPheMetPheGlnValAlaHisValValGlyGluValHisPhePhe 85 90 95 accctcgacgcgaagaaccgcgtgaacttgggatggggagaggcacag 336ThrLeuAspAlaLysAsnArgValAsnLeuGlyTrpGlyGluAlaGln 100 105 110 ctcatgtcgagcgcggatttcgcccacggatccaagttttggacgcac 384LeuMetSerSerAlaAspPheAlaHisGlySerLysPheTrpThrHis 115 120 125 ttctccggaggcttaaactaccaagtcgtccaccatctcttcccgggc 432PheSe rGlyGlyLeuAsnTyrGlnValValHisHisLeuPheProGly 130 135 140 gtctgccacgtgcactatcccgcgctcgcgccaattattaaggcggca 480ValCysHisValHisTyrProAlaLeuAlaProIleIleLysAlaAla 145 150 155 160 gctgagaagcacggcctccactaccagatttaccccacgttttggtcc 528AlaGluLysHisGlyLeuHisTyrGlnIleTyrProThrPheTrpSer 165 170 175 gccctgcgcgcgcacttccggcacctcgccaacgtcggccgcgccgcg 576AlaLeuArgAlaHisPheArgHisLeuAlaAsnValGlyArgAlaAla 180 185 190 tacgtaccgtccctccaaaccgtcggatga 606TyrValProSerLeuGlnThrValGly 195 200 <210> 92<211> 201<212> PRT 154<213> Ostreococcustauri<400> 92MetTyrGlyLeuLeuSerLeuLysSerCysPheValAspAspPheAsn 1 5 10 15 AlaTyrPheSerGlyArgIleGlyTrpValLysValMetLysPheThr 20 25 30 ArgGlyGluAlaIleAlaPheTrpGlyThrLysLeuLeuTrpAlaAla 35 40 45 TyrTyrLeuAlaLeuProLeuLysMetSerHisArgProLeuGlyGlu 50 55 60 LeuLeuAlaLeuTrpAlaValThrGluPheValThrGlyTrpLeuLeu 65 70 75 80 AlaPheMetPheGlnValAlaHisValValGlyGluValHisPhePhe 85 90 95 ThrLeuAspAlaLysAsnArgValAsnLeuGlyTrpGlyGluAlaGln 100 105 110 LeuMetSerSerAlaAspPheAlaHisGlySerLysPheTrpThrHis 115 120 125 PheSerGlyGlyLeuAsnTyrGlnValValHisHisLeuPheProGly 130 135 140 ValCysHisValHisTyrProAlaLeuAlaProIleIleLysAlaAla 145 150 155 160 AlaGluLysHisGlyLeuHisTyrGlnIleTyrProThrPheTrpSer 165 170 175 AlaLeuArgAlaHisPheArgHisLeuAlaAsnValGlyArgAlaAla 180 185 190 TyrValProSerLeuGlnThrValGly 195 200 <210> 93<211> 714<212> Ostretauricoccus DNA<213> 155<220><221> CDS<222> (1)..(714)<223> Δ5-desaturase<400> 93atggtgagccatcactcgtactgtaacgacgcggatttggatcaggat 48MetValSerHisHisSerTyrCysAsnAspAlaAspLeuAspGlnAsp 1 5 10 15 gtgtacaccgcactgccgctcctgcgcctggacccgtctcaggagttg 96ValTyrThrAlaLeuProLeuLeuArgLeuAspProSerGlnGluLeu 20 25 30 aagtggtttcatcgataccaggcgttttacgccccgctcatgtggccg 144LysTrpPheHisArgTyrGlnAlaPheTyrAlaProLeuMetTrpPro 35 40 45 tttttgtggctcgcggcgcagtttggcgacgcgcagaacatcctgatc 192PheLeuTrpLeuAlaAlaGlnPheGlyAspAlaGlnAsnIleLeuIle 50 55 60 gaccgagcgtcgccgggcgtcgcgtacaagggattgatggcgaacgag 240AspArgAlaSerProGlyValAlaTyrLysGlyLeuMetAlaAsnGlu 65 70 75 80 gtcgcgctgtacgttctcggtaaggttttacactttggtcttctcctc 288ValAlaLeuTyrValLeuGlyLysValLeuHisPheGlyLeuLeuLeu 85 90 95 ggcgttcctgcgtacttgcacggattgtccaacgcgatcgttccattc 336GlyValProAlaTyrLeuHisGlyLeuSerAsnAlaIleValProPhe 100 105 110 ttggcgtacggcgcattcggctccttcgtcctgtgctggttcttcatc 384LeuAlaTyrGlyAlaPheGlySerPheValLeuCysTrpPhePheIle 115 120 125 gtcagccataacctcgaagcgctgacacccgttaaccttaacaagtcc 432 ValSerHisAsnLeuGluAlaLeuThrProValAsnLeuAsnLysSer 130 135 140 acgaagaacgactggggggcgtggcagatcgagacatcggcgtcttgg 480ThrLysAsnAspTrpGlyAlaTrpGlnIleGluThrSerAlaSerTrp 145 150 155 160 ggcaacgcgttctggagcttcttctctggaggtctgaacctgcaaatc 528GlyAsnAlaPheTrpSerPhePheSerGlyGlyLeuAsnLeuGlnIle 165 170 175 gagcaccacctcttcccgggcatggcgcacaacctgtacccgaagatg 576GluHisHisLeuPheProGlyMetAlaHisAsnLeuTyrProLysMet 180 185 190 gtgccgatcatcaaggacgagtgtgcgaaagcgggcgttcgctacacc 624ValProIleIleLysAspGluCysAlaLysAlaGlyValArgTyrThr 195 200 205 ggttacggtggctacaccggcctgctcccgatcacccgcgacatgttc 672GlyTyrGlyGlyTyrThrGlyLeuLeuProIleThrArgAspMetPhe 210 215 220 tcctacctccataagtgtggccgaacggcgaaactagcctaa 714 156SerTyrLeuHisLysCysGlyArgThrAlaLysLeuAla 225 230 235 <210> 94<211> 237<212> PRT<213> Ostreococcustauri<400> 94MetValSerHisHisSerTyrCysAsnAspAlaAspLeuAspGlnAsp 1 5 10 15 ValTyrThrAlaLeuProLeuLeuArgLeuAspProSerGlnGluLeu 20 25 30 LysTrpPheHisArgTyrGlnAlaPheTyrAlaProLeuMetTrpPro 35 40 45 PheLeuTrpLeuAlaAlaGlnPheGlyAspAlaGlnAsnIleLeuIle 50 55 60 AspArgAlaSerProGlyValAlaTyrLysGlyLeuMetAlaAsnGlu 65 70 75 80 ValAlaLeuTyrValLeuGlyLysValLeuHisPheGlyLeuLeuLeu 85 90 95 GlyValProAlaTyrLeuHisGlyLeuSerAsnAlaIleValProPhe 100 105 110 LeuAlaTyrGlyAlaPheGlySerPheValLeuCysTrpPhePheIle 115 120 125 ValSerHisAsnLeuGluAlaLeuThrProValAsnLeuAsnLysSer 130 135 140 ThrLysAsnAspTrpGlyAlaTrpGlnIleGluThrSerAlaSerTrp 145 150 155 160 GlyAsnAlaPheTrpSerPhePheSerGlyGlyLeuAsnLeuGlnIle 165 170 175 GluHisHisLeuPheProGlyMetAlaHisAsnLeuTyrProLysMet 180 185 190 ValProIleIleLysAspGluCysAlaLysAlaGlyValArgTyrThr 195 200 205 157GlyTyrGlyGlyTyrThrGlyLeuLeuProIleThrArgAspMetPhe 210 215 220 SerTyrLeuHisLysCysGlyArgThrAlaLysLeuAla 225 230 235 <210> 95<211>1611<212> DNA<213> Ostreococcustauri<220><221> CDS<402>Δ402(1-31) Δsaturase. > 95atgtacctcggacgcggccgtctcgagagcgggacgacgcgagggatg 48MetTyrLeuGlyArgGlyArgLeuGluSerGlyThrThrArgGlyMet 1 5 10 15 atgcggacgcacgcgcggcgaccgtcgacgacgtcgaatccgtgcgcg 96MetArgThrHisAlaArgArgProSerThrThrSerAsnProCysAla 20 25 30 cggtcacgcgtgcgtaagacgacggagcgatcgctcgcgcgagtgcga 144ArgSerArgValArgLysThrThrGluArgSerLeuAlaArgValArg 35 40 45 cgatcgacgagtgagaagggaagcgcgctcgtgctcgagcgagagagc 192ArgSerThrSerGluLysGlySerAlaLeuValLeuGluArgGluSer 50 55 60 gaacgggagaaggaggagggagggaaagcgcgagcggagggattgcga 240GluArgGluLysGluGluGlyGlyLysAlaArgAlaGluGlyLeuArg 65 70 75 80 ttccaacgcccggacgtcgccgcgccggggggagcggatccttggaac 288PheGlnArgProAspValAlaAlaProGlyGlyAlaAspProTrpAsn 85 90 95 gacgagaagtggacaaagaccaagtggacggtattcagagacgtcgcg 336AspGluLysTrpThrLysThrLysTrpThrValPheArgAspValAla 100 105 110 ta cgatctcgatcctttcttcgctcgacaccccggaggagactggctc 384TyrAspLeuAspProPhePheAlaArgHisProGlyGlyAspTrpLeu 115 120 125 ctgaacttggccgtgggacgagactgcaccgcgctcatcgaatcctat 432LeuAsnLeuAlaValGlyArgAspCysThrAlaLeuIleGluSerTyr 130 135 140 cacttgcgaccagaggtggcgacggctcgtttcagaatgctgcccaaa 480HisLeuArgProGluValAlaThrAlaArgPheArgMetLeuProLys 145 150 155 160 158ctcgaggattttcccgtcgaggccgtgcccaagtccccgagaccgaac 528LeuGluAspPheProValGluAlaValProLysSerProArgProAsn 165 170 175 gattcgccgttatacaacaacattcgcaaccgagtccgcgaagagctc 576AspSerProLeuTyrAsnAsnIleArgAsnArgValArgGluGluLeu 180 185 190 ttcccagaggagggaaagaatatgcacagacagggcggcgaccacggc 624PheProGluGluGlyLysAsnMetHisArgGlnGlyGlyAspHisGly 195 200 205 gacggtgacgattctgggtttcgccgccttttgcttatgccgtgtacc 672AspGlyAspAspSerGlyPheArgArgLeuLeuLeuMetProCysThr 210 215 220 tattcccttccgggggttcctttccggctgcctcctcgggtctcgcgg 720TyrSerLeuProGlyValProPheArgLeuProProArgValSerArg 225 230 235 240 gggcgtggattggtctcacgattcaggcactgcgccaaccacggcgcg 768GlyArgGlyLeuValSerArgPheArgHisCysAlaAsnHisGlyAla 245 250 255 atgtctccttcgccggccgttaacggcgtcctcggtttgacgaacgat 816MetSerProSerProAlaValAsnGlyValLeuGlyLeuThrAsnAsp 260 265 270 ctcatcggcggctcgtccttgatgtggagatatcaccaccaagtcagc 864LeuIleGlyGlySerSerLeuMetTrpArgTyrHisHisGlnValSer 275 280 285 caccacattcattgcaacgacaacgccatggatcaagacgtgtacacg 912HisHisIleHisCysAsnAspAsnAlaMetAspGlnA spValTyrThr 290 295 300 gcgatgccattattgcgtttcgacgctcgccggcccaagtcctggtac 960AlaMetProLeuLeuArgPheAspAlaArgArgProLysSerTrpTyr 305 310 315 320 catcgcttccagcagtggtacatgtttttagcgttcccgttgttgcag 1008HisArgPheGlnGlnTrpTyrMetPheLeuAlaPheProLeuLeuGln 325 330 335 gttgccttccaagtcggagacattgccgcactgttcacgcgtgatacc 1056ValAlaPheGlnValGlyAspIleAlaAlaLeuPheThrArgAspThr 340 345 350 gaaggcgctaagcttcacggggcgacgacgtgggagcttaccacggtt 1104GluGlyAlaLysLeuHisGlyAlaThrThrTrpGluLeuThrThrVal 355 360 365 gtcctcggtaagattgtgcacttcggtcttttgttggggccgttgatg 1152ValLeuGlyLysIleValHisPheGlyLeuLeuLeuGlyProLeuMet 370 375 380 aaccacgcggtgagttctgttttgctggggatcgtcggtttcatggcg 1200AsnHisAlaValSerSerValLeuLeuGlyIleValGlyPheMetAla 385 390 395 400 tgccaaggtatagttctggcgtgcacgtttgctgtgagtcacaatgtc 1248CysGlnGlyIleValLeuAlaCysThrPheAlaValSerHisAsnVal 405 410 415 gcggaggcgaagatacctgaggacaccggaggagaagcctgggagaga 1296AlaGluAlaLysIleProGluAspThrGlyGlyGluAlaTrpGluArg 420 425 430 159gattggggtgtccagcagttggtgactagcgccgactggggtggaaag 1344AspTrpGlyValGlnGlnLeuValThrSerAlaAspTrpGlyGlyLys 435 440 445 ataggtaacttcttcacgggtggcctcaacttgcaagttgagcaccac 1392IleGlyAsnPhePheThrGlyGlyLeuAsnLeuGlnValGluHisHis 450 455 460 ttgtttccggcgatttgcttcgtccactacccggacatcgcgaagatc 1440LeuPheProAlaIleCysPheValHisTyrProAspIleAlaLysIle 465 470 475 480 gtgaaggaagaagcggccaagctcaacatcccttacgcgtcttacagg 1488ValLysGluGluAlaAlaLysLeuAsnIleProTyrAlaSerTyrArg 485 490 495 actcttcctggtattttcgtccaattctggagatttatgaaggacatg 1536ThrLeuProGlyIlePheValGlnPheTrpArgPheMetLysAspMet 500 505 510 ggcacggctgagcaaattggtgaagttccattgccgaagattcccaac 1584GlyThrAlaGluGlnIleGlyGluValProLeuProLysIleProAsn 515 520 525 ccgcagctcgcgccgaagctcgcttag 1611ProGlnLeuAlaProLysLeuAla 530 535 <210> 96<211> 536<212> PRT<213> Ostreococcustauri<400> 96MetTyrLeuGlyArgGlyArgLeuGluSerGlyThrThrArgGlyMet 1 5 10 15 MetArgThrHisAlaArgArgProSerThrThrSerAsnProCysAla 20 25 30 ArgSerArgValArgLysThrGluArgSerLeuAlaArgValArg 35 40 45 ArgSerThrSer GluLysGlySerAlaLeuValLeuGluArgGluSer 50 55 60 GluArgGluLysGluGluGlyGlyLysAlaArgAlaGluGlyLeuArg 65 70 75 80 PheGlnArgProAspValAlaAlaProGlyGlyAlaAspProTrpAsn 85 90 95 AspGluLysTrpThrLysThrLysTrpThrValPheArgAspValAla 100 105 110 160TyrAspLeuAspProPhePheAlaArgHisProGlyGlyAspTrpLeu 115 120 125 LeuAsnLeuAlaValGlyArgAspCysThrAlaLeuIleGluSerTyr 130 135 140 HisLeuArgProGluValAlaThrAlaArgPheArgMetLeuProLys 145 150 155 160 LeuGluAspPheProValGluAlaValProLysSerProArgProAsn 165 170 175 AspSerProLeuTyrAsnAsnIleArgAsnArgValArgGluGluLeu 180 185 190 PheProGluGluGlyLysAsnMetHisArgGlnGlyGlyAspHisGly 195 200 205 AspGlyAspAspSerGlyPheArgArgLeuLeuLeuMetProCysThr 210 215 220 TyrSerLeuProGlyValProPheArgLeuProProArgValSerArg 225 230 235 240 GlyArgGlyLeuValSerArgPheArgHisCysAlaAsnHisGlyAla 245 250 255 MetSerProSerProAlaValAsnGlyValLeuGlyLeuThrAsnAsp 260 265 270 LeuIleGlyGlySerSerLeuMetTrpArgTyrHisHisGlnValSer 275 280 285 HisHisIleHisCysAsnAspAsnAlaMetAspGlnAspValTyrThr 290 295 300 AlametproleuleuggpheaPalaargargargrysertrptyr 305 310 315 320 HisargpheglntrptyrptyphelephelephonePheleualapheproleule owl 325 330 335 Valalaphegln selection 5 LysIleValHisPheGlyLeuLeuLeuGlyProLeuMet 370 375 380 161AsnHisAlaValSerSerValLeuLeuGlyIleValGlyPheMetAla 385 390 395 400 CysGlnGlyIleValLeuAlaCysThrPheAlaValSerHisAsnVal 405 410 415 AlaGluAlaLysIleProGluAspThrGlyGlyGluAlaTrpGluArg 420 425 430 AspTrpGlyValGlnGlnLeuValThrSerAlaAspTrpGlyGlyLys 435 440 445 IleGlyAsnPhePheThrGlyGlyLeuAsnLeuGlnValGluHisHis 450 455 460 LeuPheProAlaIleCysPheValHisTyrProAspIleAlaLysIle 465 470 475 480 ValLysGluGluAlaAlaLysLeuAsnIleProTyrAlaSerTyrArg 485 490 495 ThrLeuProGlyIlePheValGlnPheTrpArgPheMetLysAspMet 500 505 510 GlyThrAlaGluGlnIleGlyGluValProLeuProLysIleProAsn 515 520 525 ProGlnLeuAlaProLysLeuAla 530 535 <210> 97<211> 1455< 212> DNA<213> Thalassiosirapseudonana<220><221> CDS<222> (1)..(1455)<223> Δ6-desaturase<400> 97atgggaaaaggaggagacgcagccgcagctaccaagcgtagtggagca 48MetGlyLysGlyGlyAspAlaAlaAlaAlaThrLysArgSerGlyAla 1 5 10 15 ttgaaagcaggactgagggagcggaggagggagcgagggagcgagggagcgagggaggaggagggaggaggagg 162LeuLysLeuAlaGluLysProGlnLysTyrThrTrpGlnGluValLys 20 25 30 aagcacatcacccccgacgatgcctgggtagtccaccaaaacaaagtc 144LysHisIleThrProAspAspAlaTrpValValHisGlnAsnLysVal 35 40 45 tacgacgtctccaactggtacgaccaccccggtggagccgtggtgttc 192TyrAspValSerAsnTrpTyrAspHisProGlyGlyAlaValValPhe 50 55 60 acccacgccggagacgacatgacggacatcttcgccgccttccacgcc 240ThrHisAlaGlyAspAspMetThrAspIlePheAlaAlaPheHisAla 65 70 75 80 caaggctctcaggccatgatgaagaagttttacattggagatttgatt 288GlnGlySerGlnAlaMetMetLysLysPheTyrIleGlyAspLeuIle 85 90 95 ccggagagtgtggagcataaggatcaaagacagttggatttcgagaag 336ProGluSerValGluHisLysAspGlnArgGlnLeuAspPheGluLys 100 105 110 ggatatcgtgatttacgggccaagcttgtcatgatggggatgttcaag 384GlyTyrArgAspLeuArgAlaLysLeuValMetMetGlyMetPheLys 115 120 125 tcgagtaagatgtattatgcatacaagtgctcgttcaatatgtgcatg 432SerSerLysMetTyrTyrAlaTyrLysCysSerPheAsnMetCysMet 130 135 140 tggttggtggcggtggccatggtgtactactcggacagtttggcaatg 480TrpLeuValAlaValAlaMetValTyrTyrSerAspSerLeuAlaMet 145 150 155 160 cacattggatcggctctcttgttgggattgttctggcagc agtgtgga 528HisIleGlySerAlaLeuLeuLeuGlyLeuPheTrpGlnGlnCysGly 165 170 175 tggcttgcgcacgactttcttcaccaccaagtctttaagcaacgaaag 576TrpLeuAlaHisAspPheLeuHisHisGlnValPheLysGlnArgLys 180 185 190 tacggagatctcgttggcatcttttggggagatctcatgcaggggttc 624TyrGlyAspLeuValGlyIlePheTrpGlyAspLeuMetGlnGlyPhe 195 200 205 tcgatgcagtggtggaagaacaagcacaatggccaccatgctgttccc 672SerMetGlnTrpTrpLysAsnLysHisAsnGlyHisHisAlaValPro 210 215 220 aacttgcacaactcttccttggacagtcaggatggtgatcccgatatt 720AsnLeuHisAsnSerSerLeuAspSerGlnAspGlyAspProAspIle 225 230 235 240 gataccatgccactccttgcttggagtctcaagcaggctcagagtttc 768AspThrMetProLeuLeuAlaTrpSerLeuLysGlnAlaGlnSerPhe 245 250 255 agagagatcaataagggaaaggacagtaccttcgtcaagtacgctatc 816ArgGluIleAsnLysGlyLysAspSerThrPheValLysTyrAlaIle 260 265 270 aaattccaggcattcacatacttccccatcctcctcttggctcgcatc 864LysPheGlnAlaPheThrTyrPheProIleLeuLeuLeuAlaArgIle 275 280 285 tcttggttgaatgaatccttcaaaactgcattcggactcggagctgcc 912 163SerTrpLeuAsnGluSerPheLysThrAlaPheGlyLeuGlyAlaAla 290 295 300 tcggagaatgccaagttggagttggagaagcgtggacttcagtaccca 960SerGluAsnAlaLysLeuGluLeuGluLysArgGlyLeuGlnTyrPro 305 310 315 320 cttttggagaagcttggaatcacccttcattacacttggatgttcgtc 1008LeuLeuGluLysLeuGlyIleThrLeuHisTyrThrTrpMetPheVal 325 330 335 ctctcttccggatttggaaggtggtctcttccatattccatcatgtat 1056LeuSerSerGlyPheGlyArgTrpSerLeuProTyrSerIleMetTyr 340 345 350 ttcttcactgccacatgctcctcgggacttttcctcgcattggtcttt 1104PhePheThrAlaThrCysSerSerGlyLeuPheLeuAlaLeuValPhe 355 360 365 ggattgggacacaacggtatgtcagtgtacgatgccaccacccgacct 1152GlyLeuGlyHisAsnGlyMetSerValTyrAspAlaThrThrArgPro 370 375 380 gacttctggcaactccaagtcaccactacacgtaacatcattggtgga 1200AspPheTrpGlnLeuGlnValThrThrThrArgAsnIleIleGlyGly 385 390 395 400 cacggcattccccaattctttgtggattggttctgcggtggattgcaa 1248HisGlyIleProGlnPhePheValAspTrpPheCysGlyGlyLeuGln 405 410 415 taccaagtggatcaccacctcttccccatgatgcctagaaacaatatc 1296TyrGlnValAspHisHisLeuPheProMetMetProArgAsnAsnIle 420 425 430 gcgaaatgccacaagct tgtggagtcattctgtaaggagtggggtgtg 1344AlaLysCysHisLysLeuValGluSerPheCysLysGluTrpGlyVal 435 440 445 aagtaccatgaggccgatatgtgggatggtaccgtggaagtgttgcaa 1392LysTyrHisGluAlaAspMetTrpAspGlyThrValGluValLeuGln 450 455 460 catctctccaaggtgtcggatgatttccttgtggagatggtgaaggat 1440HisLeuSerLysValSerAspAspPheLeuValGluMetValLysAsp 465 470 475 480 ttccctgccatgtaa 1455PheProAlaMet <210> 98<211> 484<212> PRT<213> Thalassiosirapseudonana<400> 98MetGlyLysGlyGlyAspAlaAlaAlaAlaThrLysArgSerGlyAla 1 5 10 15 164LeuLysLeuAlaGluLysProGlnLysTyrThrTrpGlnGluValLys 20 25 30 LysHisIleThrProAspAspAlaTrpValValHisGlnAsnLysVal 35 40 45 TyrAspValSerAsnTrpTyrAspHisProGlyGlyAlaValValPhe 50 55 60 ThrHisAlaGlyAspAspMetThrAspIlePheAlaAlaPheHisAla 65 70 75 80 GlnGlySerGlnAlaMetMetLysLysPheTyrIleGlyAspLeuIle 85 90 95 ProGluSerValGluHisLysAspGlnArgGlnLeuAspPheGluLys 100 105 110 GlyTyrArgAspLeuArgAlaLysLeuValMetMetGlyMetPheLys 115 120 125 SerSerLysMetTyrTyrAlaTyrLysCysSerPheAsnMetCysMet 130 135 140 TrpLeuValAlaValAlaMetValTyrTyrSerAspSerLeuAlaMet 145 150 155 160 HisIleGlySerAlaLeuLeuLeuGlyLeuPheTrpGlnGlnCysGly 165 170 175 TrpLeuAlaHisAspPheLeuHisHisGlnValPheLysGlnArgLys 180 185 190 TyrGlyAspLeuValGlyIlePheTrpGlyAspLeuMetGlnGlyPhe 195 200 205 SERNETGLNTTRPTRPRYSNYSNGYSNGLOSSNGRESTAGROSNOSNGALAVALPOSN 210 215 220 Asnleuhisasnserserserleuaspsservproaspeprospile 225 230 235 240 ASPTHRMEPPROLUALATRPSLULSULULEULATRPSERLESHOLYSLOSLOSLYSGERSGERSGERSLERKEGISSERLOSLOSELULSULSLOSLOSELULSULSULSULSULSULSULSULSULSLOSLOSESPE roIleLeuLeuLeuAlaArgIle 275 280 285 165SerTrpLeuAsnGluSerPheLysThrAlaPheGlyLeuGlyAlaAla 290 295 300 SerGluAsnAlaLysLeuGluLeuGluLysArgGlyLeuGlnTyrPro 305 310 315 320 LeuLeuGluLysLeuGlyIleThrLeuHisTyrThrTrpMetPheVal 325 330 335 LeuSerSerGlyPheGlyArgTrpSerLeuProTyrSerIleMetTyr 340 345 350 PhePheThrAlaThrCysSerSerGlyLeuPheLeuAlaLeuValPhe 355 360 365 GlyLeuGlyHisAsnGlyMetSerValTyrAspAlaThrThrArgPro 370 375 380 AspPheTrpGlnLeuGlnValThrThrThrArgAsnIleIleGlyGly 385 390 395 400 HisGlyIleProGlnPhePheValAspTrpPheCysGlyGlyLeuGln 405 410 415 TyrGlnValAspHisHisLeuPheProMetMetProArgAsnAsnIle 420 425 430 AlaLysCysHisLysLeuValGluSerPheCysLysGluTrpGlyVal 435 440 445 LysTyrHisGluAlaAspMetTrpAspGlyThrValGluValLeuGln 450 455 460 HisLeuSerLysValSerAspAspPheLeuValGluMetValLysAsp 465 470 475 480 PheProAlaMet <210> 99<211> 1431<212> DNA<213> Thalassiosirapseudonana<220><221> CDS<222> (1)..(1431) 166<223> Δ5-desaturase<400> 99atgccccccaacgccgatatctcccgcatccgcaaccgcatccccacc 48MetProProAsnAlaAspIleSerArgIleArgAsnArgIleProThr 1 5 10 15 aaaacaggtaccgttgcctctgccgacaacaacgaccccgccacccaa 96LysThrGlyThrValAlaSerAlaAspAsnAsnAspProAlaThrGln 20 25 30 tccgtccgaaccctcaaatctctcaagggcaacgaggtcgtcatcaac 144SerValArgThrLeuLysSerLeuLysGlyAsnGluValValIleAsn 35 40 45 ggcacaatttatgacattgctgactttgtccatcctggaggagaggtt 192GlyThrIleTyrAspIleAlaAspPheValHisProGlyGlyGluVal 50 55 60 gtcaagttctttggtgggaatgatgttactattcagtataatatgatt 240ValLysPhePheGlyGlyAsnAspValThrIleGlnTyrAsnMetIle 65 70 75 80 catccgtatcatacggggaaacatctggagaagatgaaggctgttgga 288HisProTyrHisThrGlyLysHisLeuGluLysMetLysAlaValGly 85 90 95 aaggttgtagattggcagtcggactacaagttcgacaccccctttgaa 336LysValValAspTrpGlnSerAspTyrLysPheAspThrProPheGlu 100 105 110 cgagagatcaaatcagaagtgttcaagatcgtacgtcgcgggcgtgag 384ArgGluIleLysSerGluValPheLysIleValArgArgGlyArgGlu 115 120 125 ttcggcacaacaggctacttctccgtgcctttttctacatcgctctc 432PheGlyThrThrGlyTyrPheLeuArgAla PhePheTyrIleAlaLeu 130 135 140 ttcttcaccatgcaatacactttcgccacatgcaccaccttcaccacc 480PhePheThrMetGlnTyrThrPheAlaThrCysThrThrPheThrThr 145 150 155 160 tacgatcactggtatcagagtggtgtattcatcgcaattgtgtttggt 528TyrAspHisTrpTyrGlnSerGlyValPheIleAlaIleValPheGly 165 170 175 atttcacaggcattcattgggttgaatgtccagcacgatgccaatcac 576IleSerGlnAlaPheIleGlyLeuAsnValGlnHisAspAlaAsnHis 180 185 190 ggagctgccagtaagcgtccctgggtgaatgacttgttgggatttgga 624GlyAlaAlaSerLysArgProTrpValAsnAspLeuLeuGlyPheGly 195 200 205 acggatttgattggatctaacaaatggaattggatggcacagcattgg 672ThrAspLeuIleGlySerAsnLysTrpAsnTrpMetAlaGlnHisTrp 210 215 220 actcatcacgcttacactaaccatagtgagaaggatcccgatagcttc 720ThrHisHisAlaTyrThrAsnHisSerGluLysAspProAspSerPhe 225 230 235 240 agctcggaacctatgtttgcattcaatgactatcccattggacacccg 768SerSerGluProMetPheAlaPheAsnAspTyrProIleGlyHisPro 245 250 255 167aagagaaagtggtggcataggttccagggagggtacttcctcttcatg 816LysArgLysTrpTrpHisArgPheGlnGlyGlyTyrPheLeuPheMet 260 265 270 cttggactttactggctctcgactgtattcaatccgcaattcattgat 864LeuGlyLeuTyrTrpLeuSerThrValPheAsnProGlnPheIleAsp 275 280 285 cttcgtcaacgtggggctcagtacgtcggaattcaaatggagaatgat 912LeuArgGlnArgGlyAlaGlnTyrValGlyIleGlnMetGluAsnAsp 290 295 300 ttcattgtcaagaggaggaagtacgccgttgcattgaggatgatgtac 960PheIleValLysArgArgLysTyrAlaValAlaLeuArgMetMetTyr 305 310 315 320 atttacttgaacattgtcagccccttcatgaacaatggtttgagctgg 1008IleTyrLeuAsnIleValSerProPheMetAsnAsnGlyLeuSerTrp 325 330 335 tctacctttggaatcatcatgttgatgggaatcagcgagagtctcact 1056SerThrPheGlyIleIleMetLeuMetGlyIleSerGluSerLeuThr 340 345 350 ctcagtgtgctcttctcgttgtctcacaacttcatcaattcggatcgt 1104LeuSerValLeuPheSerLeuSerHisAsnPheIleAsnSerAspArg 355 360 365 gatcctacggctgacttcaaaaagaccggagaacaagtgtgctggttc 1152AspProThrAlaAspPheLysLysThrGlyGluGlnValCysTrpPhe 370 375 380 aagtcgcaggtggagacttcgtctacctatgggggttttatttccgga 1200LysSerGlnValGluThrSerSerThrTyrGl yGlyPheIleSerGly 385 390 395 400 tgtcttacgggaggactcaactttcaggtggaacatcatctctttccc 1248CysLeuThrGlyGlyLeuAsnPheGlnValGluHisHisLeuPhePro 405 410 415 cgtatgagcagtgcttggtatccttacattgcacctacggttcgtgag 1296ArgMetSerSerAlaTrpTyrProTyrIleAlaProThrValArgGlu 420 425 430 gtttgcaagaagcacggggtgaactacgcttattatccttggattggg 1344ValCysLysLysHisGlyValAsnTyrAlaTyrTyrProTrpIleGly 435 440 445 cagaatttggtatcaacattcaaatacatgcatcgcgctggtagtgga 1392GlnAsnLeuValSerThrPheLysTyrMetHisArgAlaGlySerGly 450 455 460 gccaactgggagctcaagccgttgtctggaagtgcctaa 1431AlaAsnTrpGluLeuLysProLeuSerGlySerAla 465 470 475 <210> 100<211> 476<212> PRT<213> Thalassiosirapseudonana 168<400> 100MetProProAsnAlaAspIleSerArgIleArgAsnArgIleProThr 1 5 10 15 LysThrGlyThrValAlaSerAlaAspAsnAsnAspProAlaThrGln 20 25 30 SerValArgThrLeuLysSerLeuLysGlyAsnGluValValIleAsn 35 40 45 GlyThrIleTyrAspIleAlaAspPheValHisProGlyGlyGluVal 50 55 60 ValLysPhePheGlyGlyAsnAspValThrIleGlnTyrAsnMetIle 65 70 75 80 HisProTyrHisThrGlyLysHisLeuGluLysMetLysAlaValGly 85 90 95 LysValValAspTrpGlnSerAspTyrLysPheAspThrProPheGlu 100 105 110 ArgGluIleLysSerGluValPheLysIleValArgArgGlyArgGlu 115 120 125 PheGlyThrThrGlyTyrPheLeuArgAlaPhePheTyrIleAlaLeu 130 135 140 PhePheThrMetGlnTyrThrPheAlaThrCysThrThrPheThrThr 145 150 155 160 TyrAspHisTrpTyrGlnSerGlyValPheIleAlaIleValPheGly 165 170 175 IleSerGlnAlaPheIleGlyLeuAsnValGlnHisAspAlaAsnHis 180 185 190 GlyAlaAlaSerLysArgProTrpValAsnAspLeuLeuGlyPheGly 195 200 205 ThrAspLeuIleGlySerAsnLysTrpAsnTrpMetAlaGlnHisTrp 210 215 220 ThrHisHisAlaTyrThrAsnHisSerGluLysAspProAspSerPhe 225 230 235 240 SerSerGluProMetPheAlaPheAsnAspTyrProIleGlyHisPro 245 250 255 LysArgLysTrpTrpHis ArgPheGlnGlyGlyTyrPheLeuPheMet 260 265 270 169LeuGlyLeuTyrTrpLeuSerThrValPheAsnProGlnPheIleAsp 275 280 285 LeuArgGlnArgGlyAlaGlnTyrValGlyIleGlnMetGluAsnAsp 290 295 300 PheIleValLysArgArgLysTyrAlaValAlaLeuArgMetMetTyr 305 310 315 320 IleTyrLeuAsnIleValSerProPheMetAsnAsnGlyLeuSerTrp 325 330 335 SerThrPheGlyIleIleMetLeuMetGlyIleSerGluSerLeuThr 340 345 350 LeuSerValLeuPheSerLeuSerHisAsnPheIleAsnSerAspArg 355 360 365 AspProThrAlaAspPheLysLysThrGlyGluGlnValCysTrpPhe 370 375 380 LysSerGlnValGluThrSerSerThrTyrGlyGlyPheIleSerGly 385 390 395 400 CysLeuThrGlyGlyLeuAsnPheGlnValGluHisHisLeuPhePro 405 410 415 ArgMetSerSerAlaTrpTyrProTyrIleAlaProThrValArgGlu 420 425 430 ValCysLysLysHisGlyValAsnTyrAlaTyrTyrProTrpIleGly 435 440 445 GlnAsnLeuValSerThrPheLysTyrMetHisArgAlaGlySerGly 450 455 460 AlaAsnTrpGluLeuLysProLeuSerGlySerAla 465 470 475 <210> 101<211> 1449<212> DNA<213> Thalassiosirapseudonana<220><221> CDS 170<222> (1)..(1449)<223> Δ5-desaturase<400> 101atgccacccaacgccgaggtcaaaaacctccgttcacgttccatccca 48MetProProAsnAlaGluValLysAsnLeuArgSerArgSerIlePro 1 5 10 15 acgaagaagtccagttcatcgtcatccaccgcgaacgacgatccggct 96ThrLysLysSerSerSerSerSerSerThrAlaAsnAspAspProAla 20 25 30 acccaatccacctcacctgtgaaccgaaccctcaagtctttgaatgga 144ThrGlnSerThrSerProValAsnArgThrLeuLysSerLeuAsnGly 35 40 45 aacgaaatagctattgacggtgtcatctatgatattgatggctttgtc 192AsnGluIleAlaIleAspGlyValIleTyrAspIleAspGlyPheVal 50 55 60 catcctggaggagaggttattagcttctttggaggcaacgatgtgact 240HisProGlyGlyGluValIleSerPhePheGlyGlyAsnAspValThr 65 70 75 80 gtacagtacaaaatgattcatccgtatcataatagtaagcatctcgag 288ValGlnTyrLysMetIleHisProTyrHisAsnSerLysHisLeuGlu 85 90 95 aagatgagagccgttggaaagattgcagactactccacagagtacaag 336LysMetArgAlaValGlyLysIleAlaAspTyrSerThrGluTyrLys 100 105 110 ttcgacacaccctttgaacgagagatcaaatccgaagtgttcaaaatc 384PheAspThrProPheGluArgGluIleLysSerGluValPheLysIle 115 120 125 gtccgtcgaggacgtgaattcggtacaacaggatatttcctccgtgcc 432ValArgArgGly ArgGluPheGlyThrThrGlyTyrPheLeuArgAla 130 135 140 ttcttctacattgctctcttcttcaccatgcaatacaccttcgccaca 480PhePheTyrIleAlaLeuPhePheThrMetGlnTyrThrPheAlaThr 145 150 155 160 tgcactaccttcaccacctacgatcattggtatcaaagtggtgtattc 528CysThrThrPheThrThrTyrAspHisTrpTyrGlnSerGlyValPhe 165 170 175 atcgccattgtgtttggtatctcacaagctttcattgggttgaatgta 576IleAlaIleValPheGlyIleSerGlnAlaPheIleGlyLeuAsnVal 180 185 190 caacatgatgccaatcacggagctgctagcaaacgaccttgggtgaat 624GlnHisAspAlaAsnHisGlyAlaAlaSerLysArgProTrpValAsn 195 200 205 gatctccttggatctggagctgatctcatcggtggatgcaaatggaac 672AspLeuLeuGlySerGlyAlaAspLeuIleGlyGlyCysLysTrpAsn 210 215 220 tggttggctcagcattggactcatcatgcgtataccaatcacgctgat 720TrpLeuAlaGlnHisTrpThrHisHisAlaTyrThrAsnHisAlaAsp 225 230 235 240 aaagatcctgatagctttagttccgagccggtcttcaactttaacgat 768 171LysAspProAspSerPheSerSerGluProValPheAsnPheAsnAsp 245 250 255 tatcccattggtcaccccaaaagaaagtggtggcataggttccaaggg 816TyrProIleGlyHisProLysArgLysTrpTrpHisArgPheGlnGly 260 265 270 ctctacttcctaatcatgctgagtttctattgggtatcgatggtattc 864LeuTyrPheLeuIleMetLeuSerPheTyrTrpValSerMetValPhe 275 280 285 aacccacaagttatcgacctccgtcatgctggagctgcctacgttgga 912AsnProGlnValIleAspLeuArgHisAlaGlyAlaAlaTyrValGly 290 295 300 tttcagatggagaacgactttatcgtcaaacggagaaagtatgcaatg 960PheGlnMetGluAsnAspPheIleValLysArgArgLysTyrAlaMet 305 310 315 320 gcacttcgtgcaatgtacttctatttcaacatctattgtccgattgtc 1008AlaLeuArgAlaMetTyrPheTyrPheAsnIleTyrCysProIleVal 325 330 335 aacaatggattgacttggtcgacagttggaatcatcctcttaatggga 1056AsnAsnGlyLeuThrTrpSerThrValGlyIleIleLeuLeuMetGly 340 345 350 gttagcgaaagcttcatgctctccggtctattcgtactctcacacaac 1104ValSerGluSerPheMetLeuSerGlyLeuPheValLeuSerHisAsn 355 360 365 tttgaaaattccgaacgtgatcctacctctgagtatcgcaagactggt 1152PheGluAsnSerGluArgAspProThrSerGluTyrArgLysThrGly 370 375 380 gagcaagtatgttggttcaagtct caagtggagacttcttctacctac 1200GluGlnValCysTrpPheLysSerGlnValGluThrSerSerThrTyr 385 390 395 400 ggaggtatcgttgctgggtgtctcactggtggactcaactttcaagtg 1248GlyGlyIleValAlaGlyCysLeuThrGlyGlyLeuAsnPheGlnVal 405 410 415 gagcatcatttgttcccgaggatgagcagtgcttggtatcctttcatc 1296GluHisHisLeuPheProArgMetSerSerAlaTrpTyrProPheIle 420 425 430 gcgccgaaggttagagagatttgtaagaagcatggagttagatacgct 1344AlaProLysValArgGluIleCysLysLysHisGlyValArgTyrAla 435 440 445 tactatccgtacatctggcagaacttgcattctaccgtgagttacatg 1392TyrTyrProTyrIleTrpGlnAsnLeuHisSerThrValSerTyrMet 450 455 460 catgggacgggaacgggagctagatgggagcttcagccgttgtctgga 1440HisGlyThrGlyThrGlyAlaArgTrpGluLeuGlnProLeuSerGly 465 470 475 480 agggcgtag 1449ArgAla <210> 102<211> 482 172<212> PRT<213> Thalassiosirapseudonana<400> 102MetProProAsnAlaGluValLysAsnLeuArgSerArgSerIlePro 1 5 10 15 ThrLysLysSerSerSerSerSerSerThrAlaAsnAspAspProAla 20 25 30 ThrGlnSerThrSerProValAsnArgThrLeuLysSerLeuAsnGly 35 40 45 AsnGluIleAlaIleAspGlyValIleTyrAspIleAspGlyPheVal 50 55 60 HisProGlyGlyGluValIleSerPhePheGlyGlyAsnAspValThr 65 70 75 80 ValGlnTyrLysMetIleHisProTyrHisAsnSerLysHisLeuGlu 85 90 95 LysMetArgAlaValGlyLysIleAlaAspTyrSerThrGluTyrLys 100 105 110 PheAspThrProPheGluArgGluIleLysSerGluValPheLysIle 115 120 125 ValArgArgGlyArgGluPheGlyThrThrGlyTyrPheLeuArgAla 130 135 140 PhePheTyrIleAlaLeuPhePheThrMetGlnTyrThrPheAlaThr 145 150 155 160 CysThrThrPheThrThrTyrAspHisTrpTyrGlnSerGlyValPhe 165 170 175 IleAlaIleValPheGlyIleSerGlnAlaPheIleGlyLeuAsnVal 180 185 190 GlnHisAspAlaAsnHisGlyAlaAlaSerLysArgProTrpValAsn 195 200 205 AspLeuLeuGlySerGlyAlaAspLeuIleGlyGlyCysLysTrpAsn 210 215 220 TrpLeuAlaGlnHisTrpThrHisHisAlaTyrThrAsnHisAlaAsp 225 230 235 240 173LysAspProAspSerPheSerSerGluProValPheAsnPheAsnAsp 245 250 255 TyrProIleGlyHisProLysArgLysTrpTrpHisArgPheGlnGly 260 265 270 LeuTyrPheLeuIleMetLeuSerPheTyrTrpValSerMetValPhe 275 280 285 AsnProGlnValIleAspLeuArgHisAlaGlyAlaAlaTyrValGly 290 295 300 PheGlnMetGluAsnAspPheIleValLysArgArgLysTyrAlaMet 305 310 315 320 AlaLeuArgAlaMetTyrPheTyrPheAsnIleTyrCysProIleVal 325 330 335 AsnAsnGlyLeuThrTrpSerThrValGlyIleIleLeuLeuMetGly 340 345 350 ValSerGluSerPheMetLeuSerGlyLeuPheValLeuSerHisAsn 355 360 365 PheGluAsnSerGluArgAspProThrSerGluTyrArgLysThrGly 370 375 380 GluGlnValCysTrpPheLysSerGlnValGluThrSerSerThrTyr 385 390 395 400 GlyGlyIleValAlaGlyCysLeuThrGlyGlyLeuAsnPheGlnVal 405 410 415 GluHisHisLeuPheProArgMetSerSerAlaTrpTyrProPheIle 420 425 430 AlaProLysValArgGluIleCysLysLysHisGlyValArgTyrAla 435 440 445 TyrTyrProTyrIleTrpGlnAsnLeuHisSerThrValSerTyrMet 450 455 460 HisGlyThrGlyThrGlyAlaArgTrpGluLeuGlnProLeuSerGly 465 470 475 480 ArgAla <210<12> 10 3 174<212> DNA<213> Thalassiosirapseudonana<220><221> CDS<222> (1)..(1512)<223> Δ4-desaturase<400> 103atgtgcaacggcaacctcccagcatccaccgcacagctcaagtccacc 48MetCysAsnGlyAsnLeuProAlaSerThrAlaGlnLeuLysSerThr 1 5 10 15 tcgaagccccagcagcaacatgagcatcgcaccatctccaagtccgag 96SerLysProGlnGlnGlnHisGluHisArgThrIleSerLysSerGlu 20 25 30 ctcgcccaacacaacacgcccaaatcagcatggtgtgccgtccactcc 144LeuAlaGlnHisAsnThrProLysSerAlaTrpCysAlaValHisSer 35 40 45 actcccgccaccgacccatcccactccaacaacaaacaacacgcacac 192ThrProAlaThrAspProSerHisSerAsnAsnLysGlnHisAlaHis 50 55 60 ctagtcctcgacattaccgactttgcgtcccgccatccagggggagac 240LeuValLeuAspIleThrAspPheAlaSerArgHisProGlyGlyAsp 65 70 75 80 ctcatcctcctcgcttccggcaaagacgcctcggtgctgtttgaaaca 288LeuIleLeuLeuAlaSerGlyLysAspAlaSerValLeuPheGluThr 85 90 95 taccatccacgtggagttccgacgtctctcattcaaaagctgcagatt 336TyrHisProArgGlyValProThrSerLeuIleGlnLysLeuGlnIle 100 105 110 ggagtgatggaggaggaggcgtttcgggattcgttttacagttggact 384GlyValMetGluGluGluAlaPheArgAspSerPheTyrSerTrpThr 115 120 125 gattctgacttt tatactgtgttgaagaggagggttgtggagcggttg 432AspSerAspPheTyrThrValLeuLysArgArgValValGluArgLeu 130 135 140 gaggagagggggttggacaggaggggatcgaaagagatttggatcaag 480GluGluArgGlyLeuAspArgArgGlySerLysGluIleTrpIleLys 145 150 155 160 gctttgttcttgttggttggattttggtactgtttgtacaagatgtat 528AlaLeuPheLeuLeuValGlyPheTrpTyrCysLeuTyrLysMetTyr 165 170 175 actacgtcggatatcgatcagtacggtattgccattgcctattctatt 576ThrThrSerAspIleAspGlnTyrGlyIleAlaIleAlaTyrSerIle 180 185 190 ggaatgggaacctttgcggcattcatcggcacgtgtattcaacacgat 624GlyMetGlyThrPheAlaAlaPheIleGlyThrCysIleGlnHisAsp 195 200 205 175ggaaatcacggtgcattcgctcagaacaagttactcaacaagttggct 672GlyAsnHisGlyAlaPheAlaGlnAsnLysLeuLeuAsnLysLeuAla 210 215 220 gggtggacgttggatatgattggtgcgagtgcgtttacgtgggagctt 720GlyTrpThrLeuAspMetIleGlyAlaSerAlaPheThrTrpGluLeu 225 230 235 240 cagcacatgctggggcatcatccatatacgaatgtgttggatggggtg 768GlnHisMetLeuGlyHisHisProTyrThrAsnValLeuAspGlyVal 245 250 255 gaggaggagaggaaggagaggggggaggatgttgctttggaagaaaag 816GluGluGluArgLysGluArgGlyGluAspValAlaLeuGluGluLys 260 265 270 gatcaggattttgaagttgccacatccggacgattatatcatattgat 864AspGlnAspPheGluValAlaThrSerGlyArgLeuTyrHisIleAsp 275 280 285 gccaatgtacgttatggttcggtatggaatgtcatgaggttttgggct 912AlaAsnValArgTyrGlySerValTrpAsnValMetArgPheTrpAla 290 295 300 atgaaggtcattacgatgggatatatgatgggattaccaatctacttt 960MetLysValIleThrMetGlyTyrMetMetGlyLeuProIleTyrPhe 305 310 315 320 catggagtactgaggggagttggattgtttgttattgggcatttggcg 1008HisGlyValLeuArgGlyValGlyLeuPheValIleGlyHisLeuAla 325 330 335 tgtggagagttgttggcgacgatgtttattgtgaatcacgtcattgag 1056CysGlyGluLeuLeuAlaThrMetPheIleV alAsnHisValIleGlu 340 345 350 ggtgtgagttatggaacgaaggatttggttggtggtgcgagtcatgta 1104GlyValSerTyrGlyThrLysAspLeuValGlyGlyAlaSerHisVal 355 360 365 gatgagaagaagattgtcaagccaacgactgtattgggagatacacca 1152AspGluLysLysIleValLysProThrThrValLeuGlyAspThrPro 370 375 380 atggtaaagactcgcgaggaggcattgaaaagcaacagcaataacaac 1200MetValLysThrArgGluGluAlaLeuLysSerAsnSerAsnAsnAsn 385 390 395 400 aagaagaagggagagaagaactcggtaccatccgttccattcaacgac 1248LysLysLysGlyGluLysAsnSerValProSerValProPheAsnAsp 405 410 415 tgggcagcagtccaatgccagacctccgtgaattggtctccaggctca 1296TrpAlaAlaValGlnCysGlnThrSerValAsnTrpSerProGlySer 420 425 430 tggttctggaatcacttttctgggggactctctcatcagattgagcat 1344TrpPheTrpAsnHisPheSerGlyGlyLeuSerHisGlnIleGluHis 435 440 445 cacttgttccccagcatttgtcatacaaactactgtcatatccaggat 1392HisLeuPheProSerIleCysHisThrAsnTyrCysHisIleGlnAsp 450 455 460 gttgtggagagtacgtgtgctgagtacggagttccgtatcagagtgag 1440ValValGluSerThrCysAlaGluTyrGlyValProTyrGlnSerGlu 465 470 475 480 176agtaatttgtttgttgcttatggaaagatgattagtcatttgaagttt 1488SerAsnLeuPheValAlaTyrGlyLysMetIleSerHisLeuLysPhe 485 490 495 ttgggtaaagccaagtgtgagtag 1512LeuGlyLysAlaLysCysGlu 500 <210> 104<211> 503<212> PRT<213> Thalassiosirapseudonana<400>104MetCysAsnGlyAsnLeuProAlaSerThrAlaGlnLeuLysSerThr 1 5 10 15 SerLysProGlnGlnGlnHisGluHisArgThrIleSerLysSerGlu 20 25 30 LeuAlaGlnHisAsnThrProLysSerAlaTrpCysAlaValHisSer 35 40 45 ThrProAlaThrAspProSerHisSerAsnAsnLysGlnHisAlaHis 50 55 60 LeuValLeuAspIleThrAspPheAlaSerArgHisProGlyGlyAsp 65 70 75 80 LeuIleLeuLeuAlaSerGlyLysAspAlaSerValLeuPheGluThr 85 90 95 TyrHisProArgGlyValProThrSerLeuIleGlnLysLeuGlnIle 100 105 110 GlyValMetGluGluGluAlaPheArgAspSerPheTyrSerTrpThr 115 120 125 AspSerAspPheTyrThrValLeuLysArgArgValValGluArgLeu 130 135 140 GluGluArgGlyLeuAspArgArgGlySerLysGluIleTrpIleLys 145 150 155 160 AlaLeuPheLeuLeuValGlyPheTrpTyrCysLeuTyrLysMetTyr 165 170 175 ThrThrSerAspIleAspGlnTyrGlyIleAlaIleAlaTyrSerIle 180 185 190 177GlyMetGlyThrPheAlaAlaPheIleGlyThrCysIleGlnHisAsp 195 200 205 GlyAsnHisGlyAlaPheAlaGlnAsnLysLeuLeuAsnLysLeuAla 210 215 220 GlyTrpThrLeuAspMetIleGlyAlaSerAlaPheThrTrpGluLeu 225 230 235 240 GlnHisMetLeuGlyHisHisProTyrThrAsnValLeuAspGlyVal 245 250 255 GluGluGluArgLysGluArgGlyGluAspValAlaLeuGluGluLys 260 265 270 AspGlnAspPheGluValAlaThrSerGlyArgLeuTyrHisIleAsp 275 280 285 AlaAsnValArgTyrGlySerValTrpAsnValMetArgPheTrpAla 290 295 300 MetLysValIleThrMetGlyTyrMetMetGlyLeuProIleTyrPhe 305 310 315 320 HisGlyValLeuArgGlyValGlyLeuPheValIleGlyHisLeuAla 325 330 335 CysGlyGluLeuLeuAlaThrMetPheIleValAsnHisValIleGlu 340 345 350 GlyValSerTyrGlyThrLysAspLeuValGlyGlyAlaSerHisVal 355 360 365 AspGluLysLysIleValLysProThrThrValLeuGlyAspThrPro 370 375 380 Metvallystthrarggluglualealulysserasnerasnasnensn 385 390 395 400 Lightslight GLYGLYSSNSERNSERNSERSSERVALSERVALPSERVALPHEASNASP 405 410 415 Trpalaala -cyskysglncysglnssarvalasvalasntreproglyser 420 425 425 425 425 425 425 430 ProSerIleCysHisThrAsnTyrCysHisIleGlnAsp 450 455 460 178ValValGluSerThrCysAlaGluTyrGlyValProTyrGlnSerGlu 465 470 475 480 SerAsnLeuPheValAlaTyrGlyLysMetIleSerHisLeuLysPhe 485 490 495 LeuGlyLysAlaLysCysGlu 500 <210> 105<211> 1257<212> DNA<213> Thalassiosirapseudonana <220><221> CDS<222> (1)..(1257)<223> ω3- desaturase<400> 105atgtacagattaacatccaccttcctcatcgcattggcattctcctcc 48MetTyrArgLeuThrSerThrPheLeuIleAlaLeuAlaPheSerSer 1 5 10 15 tccatcaatgccttctctccacaacggccaccacgtactatcaccaaa 96SerIleAsnAlaPheSerProGlnArgProProArgThrIleThrLys 20 25 30 agtaaagtccaaagcaccgtgctacccataccgaccaaggatgatctg 144SerLysValGlnSerThrValLeuProIleProThrLysAspAspLeu 35 40 45 aactttctccaaccacaactcgatgagaatgatctctacctcgacgat 192AsnPheLeuGlnProGlnLeuAspGluAsnAspLeuTyrLeuAspAsp 50 55 60 gtcaacactccaccaagagcaggtaccatcatgaagatgttgccgaag 240ValAsnThrProProArgAlaGlyThrIleMetLysMetLeuProLys 65 70 75 80 gaaacgttcaacattgatacagcaacttcattgggttactttggtatg 288GluThrPheAsnIleAspThrAlaThrSerLeuGlyTyrPheGlyMet 85 90 95 gatatggcagcggttgtatcgtccatgacgttgctaaatgctattgta 336AspMetAlaAlaVa lValSerSerMetThrLeuLeuAsnAlaIleVal 100 105 110 acttcggatcagtaccatgctcttccacttctctccaagcagcaaca 384ThrSerAspGlnTyrHisAlaLeuProLeuProLeuGlnAlaAlaThr 115 120 125 gtgattccctttcagctattggctggttcgccatgtggtgtatgtgg 432 179ValIleProPheGlnLeuLeuAlaGlyPheAlaMetTrpCysMetTrp 130 135 140 tgcattggacacgatgctggacattctactgtttcgaagacaaagtgg 480CysIleGlyHisAspAlaGlyHisSerThrValSerLysThrLysTrp 145 150 155 160 atcaaccgagtcgttggtgaagtggctcattctgttgtttgtctcacg 528IleAsnArgValValGlyGluValAlaHisSerValValCysLeuThr 165 170 175 ccgttcgtgccttggcagatgtcgcataggaaacaccatttgaatcac 576ProPheValProTrpGlnMetSerHisArgLysHisHisLeuAsnHis 180 185 190 aatcatattgaaaaggactactctcataagtggtacagtcgcgacgag 624AsnHisIleGluLysAspTyrSerHisLysTrpTyrSerArgAspGlu 195 200 205 tttgatgatatcccacaactctataagacatttggctacaacccaaga 672PheAspAspIleProGlnLeuTyrLysThrPheGlyTyrAsnProArg 210 215 220 atgatgcaacttccattcctctacttcatgtatcttgcattgggaatt 720MetMetGlnLeuProPheLeuTyrPheMetTyrLeuAlaLeuGlyIle 225 230 235 240 ccagatggtgggcatgttgtgttctacggaagaatgtgggaaggagtg 768ProAspGlyGlyHisValValPheTyrGlyArgMetTrpGluGlyVal 245 250 255 tcattgcagaagaagtttgatgctgctatttctgtggccgtatcatgt 816SerLeuGlnLysLysPheAspAlaAlaIleSerValAlaValSerCys 260 265 270 gcaactgctggatcgctttggatg aatatgggtacagcagacttcacg 864AlaThrAlaGlySerLeuTrpMetAsnMetGlyThrAlaAspPheThr 275 280 285 gtggtatgcatggttccttggctagttctatcgtggtggctcttcatg 912ValValCysMetValProTrpLeuValLeuSerTrpTrpLeuPheMet 290 295 300 gtaacataccttcagcatcattcagaagacggaaagctatacactgat 960ValThrTyrLeuGlnHisHisSerGluAspGlyLysLeuTyrThrAsp 305 310 315 320 gaaacgtttacatttgaaaagggagccttcgagaccgtggatcgttcg 1008GluThrPheThrPheGluLysGlyAlaPheGluThrValAspArgSer 325 330 335 tacggcaagttgatcaaccgaatgtcgcatcacatgatggacggtcac 1056TyrGlyLysLeuIleAsnArgMetSerHisHisMetMetAspGlyHis 340 345 350 gtggtgcaccacttgttctttgaacgtgtacctcactacagattagag 1104ValValHisHisLeuPhePheGluArgValProHisTyrArgLeuGlu 355 360 365 gcagctaccgaagctcttgtgaaaggaatggatgaaacgggacagaaa 1152AlaAlaThrGluAlaLeuValLysGlyMetAspGluThrGlyGlnLys 370 375 380 catttgtacaaatacattgatactcctgatttcaatgccgagattgtc 1200HisLeuTyrLysTyrIleAspThrProAspPheAsnAlaGluIleVal 385 390 395 400 aacggatttcgcgacaattggttccttgttgaagaggagaacatcaaa 1248 180AsnGlyPheArgAspAsnTrpPheLeuValGluGluGluAsnIleLys 405 410 415 agggagtag 1257ArgGlu <210> 106<211> 418<212> PRT<213> Thalassiosirapseudonana <400> 106MetTyrArgLeuThrSerThrPheLeuIleAlaLeuAlaPheSerSer 1 5 10 15 SerIleAsnAlaPheSerProGlnArgProProArgThrIleThrLys 20 25 30 SerLysValGlnSerThrValLeuProIleProThrLysAspAspLeu 35 40 45 AsnPheLeuGlnProGlnLeuAspGluAsnAspLeuTyrLeuAspAsp 50 55 60 ValAsnThrProProArgAlaGlyThrIleMetLysMetLeuProLys 65 70 75 80 GluThrPheAsnIleAspThrAlaThrSerLeuGlyTyrPheGlyMet 85 90 95 AspMetAlaAlaValValSerSerMetThrLeuLeuAsnAlaIleVal 100 105 110 ThrSerAspGlnTyrHisAlaLeuProLeuProLeuGlnAlaAlaThr 115 120 125 ValIleProPheGlnLeuLeuAlaGlyPheAlaMetTrpCysMetTrp 130 135 140 CysIleGlyHisAspAlaGlyHisSerThrValSerLysThrLysTrp 145 150 155 160 IleAsnArgValValGlyGluValAlaHisSerValValCysLeuThr 165 170 175 ProPheValProTrpGlnMetSerHisArgLysHisHisLeuAsnHis 180 185 190 181AsnHisIleGluLysAspTyrSerHisLysTrpTyrSerArgAspGlu 195 200 205 PheAspAspIleProGlnLeuTyrLysThrPheGlyTyrAsnProArg 210 215 220 MetMetGlnLeuProPheLeuTyrPheMetTyrLeuAlaLeuGlyIle 225 230 235 240 ProAspGlyGlyHisValValPheTyrGlyArgMetTrpGluGlyVal 245 250 255 SerLeuGlnLysLysPheAspAlaAlaIleSerValAlaValSerCys 260 265 270 AlaThrAlaGlySerLeuTrpMetAsnMetGlyThrAlaAspPheThr 275 280 285 ValValCysMetValProTrpLeuValLeuSerTrpTrpLeuPheMet 290 295 300 ValThrTyrLeuGlnHisHisSerGluAspGlyLysLeuTyrThrAsp 305 310 315 320 GluThrPheThrPheGluLysGlyAlaPheGluThrValAspArgSer 325 330 335 TyrGlyLysLeuIleAsnArgMetSerHisHisMetMetAspGlyHis 340 345 350 ValValHisHisLeuPhePheGluArgValProHisTyrArgLeuGlu 355 360 365 AlaAlaThrGluAlaLeuValLysGlyMetAspGluThrGlyGlnLys 370 375 380 HisLeuTyrLysTyrIleAspThrProAspPheAsnAlaGluIleVal 385 390 395 400 AsnGlyPheArgAspAsnTrpPheLeuValGluGluGluAsnIleLys 405 410 415 ArgGlu <210> 107<211> 1086<212> DNA<213> Ostreococcus tauri 182<220><221> CDS<222> (1)..(1086)<223> Δ12-desaturase<400> 107atgcaggagggggtgcgaaacattccgaacgagtgctttgagacggga 48MetGlnGluGlyValArgAsnIleProAsnGluCysPheGluThrGly 1 5 10 15 catcttgaaagaccctggcgttccggccggtgtgggcgcgatcccggt 96HisLeuGluArgProTrpArgSerGlyArgCysGlyArgAspProGly 20 25 30 tcgaattggggcgctggcttccgctttttttcgctcaaggggttttgg 144SerAsnTrpGlyAlaGlyPheArgPhePheSerLeuLysGlyPheTrp 35 40 45 tggccggcgtggtgggcgtacgcgttcgtgacggggacggcggccact 192TrpProAlaTrpTrpAlaTyrAlaPheValThrGlyThrAlaAlaThr 50 55 60 gggtgttgggtcgccgcgcacgagtgcgggcacggcgcgttcagcgat 240GlyCysTrpValAlaAlaHisGluCysGlyHisGlyAlaPheSerAsp 65 70 75 80 aacaagacgttgcaagatgcggttggatacgtgttgcactcgttgctc 288AsnLysThrLeuGlnAspAlaValGlyTyrValLeuHisSerLeuLeu 85 90 95 ttggtgccgtacttttcttggcagcgatcacacgcggtgcatcactcg 336LeuValProTyrPheSerTrpGlnArgSerHisAlaValHisHisSer 100 105 110 aggacgaatcacgttcttgagggcgagacgcacgtgccggcgcgcttg 384ArgThrAsnHisValLeuGluGlyGluThrHisValProAlaArgLeu 115 120 125 gggacggaagacgccaacgtcgtgttcaagcttcgcgaattgatcggt 432GlyThrGluAspAlaAsnValValPheLysLeuArgGluLeuIleGly 130 135 140 gaagggccgttcacgtttttcaacctcgtcggcgtcttcgcgctcgga 480GluGlyProPheThrPhePheAsnLeuValGlyValPheAlaLeuGly 145 150 155 160 tggccgatttacttgctcaccggcgcgagcggcggaccggtgcgcggt 528TrpProIleTyrLeuLeuThrGlyAlaSerGlyGlyProValArgGly 165 170 175 aacacgaaccacttcttacccttcatgggcgagaaaggtaagcacgcg 576AsnThrAsnHisPheLeuProPheMetGlyGluLysGlyLysHisAla 180 185 190 ctgttcccgggtaagtgggcgaagaaggtgtggcagtctgacatcggc 624LeuPheProGlyLysTrpAlaLysLysValTrpGlnSerAspIleGly 195 200 205 gttgttgccgtcctgggcgcgctcgcggcttgggcggcgcacagcggg 672ValValAlaValLeuGlyAlaLeuAlaAlaTrpAlaAlaHisSerGly 210 215 220 183attgccacagtgatggcactctacgtcggcccgtacatggtgaccaac 720IleAlaThrValMetAlaLeuTyrValGlyProTyrMetValThrAsn 225 230 235 240 ttttggctcgtcttgtacacgtggttacagcacaccgacgttgacgtg 768PheTrpLeuValLeuTyrThrTrpLeuGlnHisThrAspValAspVal 245 250 255 ccgcacttcgagggcgacgattggaacttggtcaagggggcattcatg 816ProHisPheGluGlyAspAspTrpAsnLeuValLysGlyAlaPheMet 260 265 270 acgatcgatcgcccgtacggcccagtttttgatttcttgcaccaccgc 864ThrIleAspArgProTyrGlyProValPheAspPheLeuHisHisArg 275 280 285 atcggcagcacgcacgtcgcgcaccacatcaacacaccattcccgcat 912IleGlySerThrHisValAlaHisHisIleAsnThrProPheProHis 290 295 300 tacaaggctcaaatggcgacggatgcgctaaaggaggcgtatcccgac 960TyrLysAlaGlnMetAlaThrAspAlaLeuLysGluAlaTyrProAsp 305 310 315 320 ctctacctttacgatccaactccgatcgcgaccgctacgtggcgcgtg 1008LeuTyrLeuTyrAspProThrProIleAlaThrAlaThrTrpArgVal 325 330 335 gggagcaagtgcatcgccgtcgtgaagaagggagacgaatgggtgttc 1056GlySerLysCysIleAlaValValLysLysGlyAspGluTrpValPhe 340 345 350 acggataagcaactcccggtcgcggcgtga 1086ThrAspLysGlnLeuProValAlaAla 355 360 <210> 108 <21 1> 361<212> PRT<213> Ostreococcustauri<400> 108MetGlnGluGlyValArgAsnIleProAsnGluCysPheGluThrGly 1 5 10 15 HisLeuGluArgProTrpArgSerGlyArgCysGlyArgAspProGly 20 25 30 SerAsnTrpGlyAlaGlyPheArgPhePheSerLeuLysGlyPheTrp 35 40 45 TrpProAlaTrpTrpAlaTyrAlaPheValThrGlyThrAlaAlaThr 50 55 60 GlyCysTrpValAlaAlaHisGluCysGlyHisGlyAlaPheSerAsp 65 70 75 80 184AsnLysThrLeuGlnAspAlaValGlyTyrValLeuHisSerLeuLeu 85 90 95 LeuValProTyrPheSerTrpGlnArgSerHisAlaValHisHisSer 100 105 110 ArgThrAsnHisValLeuGluGlyGluThrHisValProAlaArgLeu 115 120 125 GlyThrGluAspAlaAsnValValPheLysLeuArgGluLeuIleGly 130 135 140 GluGlyProPheThrPhePheAsnLeuValGlyValPheAlaLeuGly 145 150 155 160 TrpProIleTyrLeuLeuThrGlyAlaSerGlyGlyProValArgGly 165 170 175 AsnThrAsnHisPheLeuProPheMetGlyGluLysGlyLysHisAla 180 185 190 LeuPheProGlyLysTrpAlaLysLysValTrpGlnSerAspIleGly 195 200 205 ValValAlaValLeuGlyAlaLeuAlaAlaTrpAlaAlaHisSerGly 210 215 220 IleAlaThrValMetAlaLeuTyrValGlyProTyrMetValThrAsn 225 230 235 240 PheTrpLeuValLeuTyrThrTrpLeuGlnHisThrAspValAspVal 245 250 255 ProHisPheGluGlyAspAspTrpAsnLeuValLysGlyAlaPheMet 260 265 270 Thrileas Parg ProtyrkprovalpheSppheleuhishisarg 275 280 285 IleglyserthisvalalalahishisileassnThrophepropheprohis 290 295 300 Tyrlysaltaltalatalatalatalatalatalatala -Palhalspalalehalynspaltaltala -5 310 310 310 315 315 315 310 315 310 315 310 310 315 310 315 310 310 310 310 310 310 310 310 310 310 310 310 310 310 310 310 31 IleAlaValValLysLysGlyAspGluTrpValPhe 340 345 350 185ThrAspLysGlnLeuProValAlaAla 355 360 <210> 109<211> 1305<212> DNA<213> Thalassiosirapseudonana<220><221> CDS<222> (1)..(1305)<223> Δ12-desaturase<400> 109atgggaaagggaggaagatcagtaacccgcgctcaaacagcagaaaag 48MetGlyLysGlyGlyArgSerValThrArgAlaGlnThrAlaGluLys 1 5 10 15 tcagcacacaccatccaaaccttcaccgacggccgatgggtctccccc 96SerAlaHisThrIleGlnThrPheThrAspGlyArgTrpValSerPro 20 25 30 tacaaccccctcgcaaaagatgcacctgaactcccctccaagggtgaa 144TyrAsnProLeuAlaLysAspAlaProGluLeuProSerLysGlyGlu 35 40 45 atcaaggcggtcatccccaaagagtgcttcgaacgaagctacctccac 192IleLysAlaValIleProLysGluCysPheGluArgSerTyrLeuHis 50 55 60 tccatgtacttcgtcctccgtgacaccgtcatggccgtggcctgcgcc 240SerMetTyrPheValLeuArgAspThrValMetAlaValAlaCysAla 65 70 75 80 tacatcgcccactcaacgctctccaccgatattccctccgagttactg 288TyrIleAlaHisSerThrLeuSerThrAspIleProSerGluLeuLeu 85 90 95 agcgtggacgcactcaaatggttcctcggatggaacacctacgccttt 336SerValAspAlaLeuLysTrpPheLeuGlyTrpAsnThrTyrAlaPhe 100 105 110 tggatggggtgcattctcaccggacactgggtcctagcccatgaatgt 384TrpMetGlyCysIleLe uThrGlyHisTrpValLeuAlaHisGluCys 115 120 125 ggacatggtgcattctctccctctcagacgtttaatgacttttggggg 432GlyHisGlyAlaPheSerProSerGlnThrPheAsnAspPheTrpGly 130 135 140 ttcattatgcatcaggcggtgttggttccgtatttcgcctggcagtac 480PheIleMetHisGlnAlaValLeuValProTyrPheAlaTrpGlnTyr 145 150 155 160 tctcatgcgaagcatcatcgacgtaccaacaacattatggatggggag 528 186SerHisAlaLysHisHisArgArgThrAsnAsnIleMetAspGlyGlu 165 170 175 agccatgtgcccaatatcgccaaggaaatgggattgaacgagaagaat 576SerHisValProAsnIleAlaLysGluMetGlyLeuAsnGluLysAsn 180 185 190 gagcgcagtggaggatatgccgccattcatgaggctattggagatgga 624GluArgSerGlyGlyTyrAlaAlaIleHisGluAlaIleGlyAspGly 195 200 205 ccctttgcgatgtttcaaatctttgctcacttggtgatcgggtggcct 672ProPheAlaMetPheGlnIlePheAlaHisLeuValIleGlyTrpPro 210 215 220 atttacttgatgggatttgcttccactggacgtctcggtcaggatggg 720IleTyrLeuMetGlyPheAlaSerThrGlyArgLeuGlyGlnAspGly 225 230 235 240 aaggaacttcaggctggagagatcatcgaccattaccgtccttggagt 768LysGluLeuGlnAlaGlyGluIleIleAspHisTyrArgProTrpSer 245 250 255 aagatgttccccaccaagttgcgattcaaaattgctctttcgacactt 816LysMetPheProThrLysLeuArgPheLysIleAlaLeuSerThrLeu 260 265 270 ggagtgattgccgcctgggttgggttgtactttgctgcacaagagtat 864GlyValIleAlaAlaTrpValGlyLeuTyrPheAlaAlaGlnGluTyr 275 280 285 ggagtcttgcccgtggttctttggtacattggcccactcatgtggaat 912GlyValLeuProValValLeuTrpTyrIleGlyProLeuMetTrpAsn 290 295 300 caggcgtggcttgtgctctacacttggc ttcagcacaatgatccctcc 960GlnAlaTrpLeuValLeuTyrThrTrpLeuGlnHisAsnAspProSer 305 310 315 320 gtgcctcaatatggaagtgacgaatggacatgggtcaagggagctttg 1008ValProGlnTyrGlySerAspGluTrpThrTrpValLysGlyAlaLeu 325 330 335 tcgacgattgatcgcccgtatggtatctttgacttcttccatcacaag 1056SerThrIleAspArgProTyrGlyIlePheAspPhePheHisHisLys 340 345 350 attggaagcactcacgtagctcatcatttgttccacgagatgccattt 1104IleGlySerThrHisValAlaHisHisLeuPheHisGluMetProPhe 355 360 365 tacaaggcggatgtggctactgcgtcgatcaagggtttcttggagccg 1152TyrLysAlaAspValAlaThrAlaSerIleLysGlyPheLeuGluPro 370 375 380 aagggactttacaactatgatccaacgccttggtatgtggccatgtgg 1200LysGlyLeuTyrAsnTyrAspProThrProTrpTyrValAlaMetTrp 385 390 395 400 agggtggccaagacttgtcattatattgaggatgtggatggagttcag 1248ArgValAlaLysThrCysHisTyrIleGluAspValAspGlyValGln 405 410 415 tattataagagtttggaggatgtgcctttgaagaaggatgccaagaag 1296TyrTyrLysSerLeuGluAspValProLeuLysLysAspAlaLysLys 420 425 430 tctgattag 1305 187SerAsp <210> 110<211> 434<212> PRT<213> Thalassiosirapseudonana<400> 110MetGlyLysGlyGlyArgSerValThrArgAlaGlnThrAlaGluLys 1 5 10 15 SerAlaHisThrIleGlnThrPheThrAspGlyArgTrpValSerPro 20 25 30 TyrAsnProLeuAlaLysAspAlaProGluLeuProSerLysGlyGlu 35 40 45 IleLysAlaValIleProLysGluCysPheGluArgSerTyrLeuHis 50 55 60 SerMetTyrPheValLeuArgAspThrValMetAlaValAlaCysAla 65 70 75 80 TyrIleAlaHisSerThrLeuSerThrAspIleProSerGluLeuLeu 85 90 95 SerValAspAlaLeuLysTrpPheLeuGlyTrpAsnThrTyrAlaPhe 100 105 110 TrpMetGlyCysIleLeuThrGlyHisTrpValLeuAlaHisGluCys 115 120 125 GlyHisGlyAlaPheSerProSerGlnThrPheAsnAspPheTrpGly 130 135 140 PheIleMetHisGlnAlaValLeuValProTyrPheAlaTrpGlnTyr 145 150 155 160 SerHisAlaLysHisHisArgArgThrAsnAsnIleMetAspGlyGlu 165 170 175 SerHisValProAsnIleAlaLysGluMetGlyLeuAsnGluLysAsn 180 185 190 GluArgSerGlyGlyTyrAlaAlaIleHisGluAlaIleGlyAspGly 195 200 205 188ProPheAlaMetPheGlnIlePheAlaHisLeuValIleGlyTrpPro 210 215 220 IleTyrLeuMetGlyPheAlaSerThrGlyArgLeuGlyGlnAspGly 225 230 235 240 LysGluLeuGlnAlaGlyGluIleIleAspHisTyrArgProTrpSer 245 250 255 LysMetPheProThrLysLeuArgPheLysIleAlaLeuSerThrLeu 260 265 270 GlyValIleAlaAlaTrpValGlyLeuTyrPheAlaAlaGlnGluTyr 275 280 285 GlyValLeuProValValLeuTrpTyrIleGlyProLeuMetTrpAsn 290 295 300 GlnAlaTrpLeuValLeuTyrThrTrpLeuGlnHisAsnAspProSer 305 310 315 320 ValProGlnTyrGlySerAspGluTrpThrTrpValLysGlyAlaLeu 325 330 335 SerThrIleAspArgProTyrGlyIlePheAspPhePheHisHisLys 340 345 350 IleGlySerThrHisValAlaHisHisLeuPheHisGluMetProPhe 355 360 365 TyrLysAlaAspValAlaThrAlaSerIleLysGlyPheLeuGluPro 370 375 380 LysGlyLeuTyrAsnTyrAspProThrProTrpTyrValAlaMetTrp 385 390 395 400 ArgValAlaLysThrCysHisTyrIleGluAspValAspGlyValGln 405 410 415 TyrTyrLysSerLeuGluAspValProLeuLysAspAlaLysLys 420 425 430 SerAsp <210> 111<211> 879<212> DNA<213> Ostreococcus tauri 189<220><221> CDS<222> (1)..(879)<223> Δ6-elongase<400> 111atgagtggcttacgtgcacccaactttttacacagattctggacaaag 48MetSerGlyLeuArgAlaProAsnPheLeuHisArgPheTrpThrLys 1 5 10 15 tgggactacgcgatttccaaagtcgtcttcacgtgtgccgacagtttt 96TrpAspTyrAlaIleSerLysValValPheThrCysAlaAspSerPhe 20 25 30 cagtgggacatcgggccagtgagttcgagtacggcgcatttacccgcc 144GlnTrpAspIleGlyProValSerSerSerThrAlaHisLeuProAla 35 40 45 attgaatcccctaccccactggtgactagcctcttgttctacttagtc 192IleGluSerProThrProLeuValThrSerLeuLeuPheTyrLeuVal 50 55 60 acagttttcttgtggtatggtcgtttaaccaggagttcagacaagaaa 240ThrValPheLeuTrpTyrGlyArgLeuThrArgSerSerAspLysLys 65 70 75 80 attagagagcctacgtggttaagaagattcataatatgtcataatgcg 288IleArgGluProThrTrpLeuArgArgPheIleIleCysHisAsnAla 85 90 95 ttcttgatagtcctcagtctttacatgtgccttggttgtgtggcccaa 336PheLeuIleValLeuSerLeuTyrMetCysLeuGlyCysValAlaGln 100 105 110 gcgtatcagaatggatatactttatggggtaatgaattcaaggccacg 384AlaTyrGlnAsnGlyTyrThrLeuTrpGlyAsnGluPheLysAlaThr 115 120 125 gaaactcagcttgctctctacatttacattttttacgtaagtaaaata 432G luThrGlnLeuAlaLeuTyrIleTyrIlePheTyrValSerLysIle 130 135 140 tacgagtttgtagatacttacattatgcttctcaagaataacttgcgg 480TyrGluPheValAspThrTyrIleMetLeuLeuLysAsnAsnLeuArg 145 150 155 160 caagtaagtttcctacacatttatcaccacagcacgatttcctttatt 528GlnValSerPheLeuHisIleTyrHisHisSerThrIleSerPheIle 165 170 175 tggtggatcattgctcggagggctccgggtggtgatgcttacttcagc 576TrpTrpIleIleAlaArgArgAlaProGlyGlyAspAlaTyrPheSer 180 185 190 gcggccttgaactcatgggtacacgtgtgcatgtacacctattatcta 624AlaAlaLeuAsnSerTrpValHisValCysMetTyrThrTyrTyrLeu 195 200 205 ttatcaacccttattggaaaagaagatcctaagcgttccaactacctt 672LeuSerThrLeuIleGlyLysGluAspProLysArgSerAsnTyrLeu 210 215 220 190tggtggggtcgccacctaacgcaaatgcagatgcttcagtttttcttc 720TrpTrpGlyArgHisLeuThrGlnMetGlnMetLeuGlnPhePhePhe 225 230 235 240 aacgtacttcaagcgttgtactgcgcttcgttctctacgtatcccaag 768AsnValLeuGlnAlaLeuTyrCysAlaSerPheSerThrTyrProLys 245 250 255 tttttgtccaaaattctgctcgtctatatgatgagccttctcggcttg 816PheLeuSerLysIleLeuLeuValTyrMetMetSerLeuLeuGlyLeu 260 265 270 tttgggcatttctactattccaagcacatagcagcagctaagctccag 864PheGlyHisPheTyrTyrSerLysHisIleAlaAlaAlaLysLeuGln 275 280 285 aaaaaacagcagtga 879LysLysGlnGln 290 <210> 112<211> 292<212> PRT<213> Ostreococcustauri<400> 112MetSerGlyLeuArgAlaProAsnPheLeuHisArgPheTrpThrLys 1 5 10 15 TrpAspTyrAlaIleSerLysValValPheThrCysAlaAspSerPhe 20 25 30 GlnTrpAspIleGlyProValSerSerSerThrAlaHisLeuProAla 35 40 45 IleGluSerProThrProLeuValThrSerLeuLeuPheTyrLeuVal 50 55 60 ThrValPheLeuTrpTyrGlyArgLeuThrArgSerSerAspLysLys 65 70 75 80 IleArgGluProThrTrpLeuArgArgPheIleIleCysHisAsnAla 85 90 95 PheLeuIleValLeuSerLeuTyrMetCysLeuGlyCysValAlaGln 100 105 110 AlaTyrGlnAsnGlyTyrThrLeuTrpGlyAsn GluPheLysAlaThr 115 120 125 GluThrGlnLeuAlaLeuTyrIleTyrIlePheTyrValSerLysIle 130 135 140 191TyrGluPheValAspThrTyrIleMetLeuLeuLysAsnAsnLeuArg 145 150 155 160 GlnValSerPheLeuHisIleTyrHisHisSerThrIleSerPheIle 165 170 175 TrpTrpIleIleAlaArgArgAlaProGlyGlyAspAlaTyrPheSer 180 185 190 AlaAlaLeuAsnSerTrpValHisValCysMetTyrThrTyrTyrLeu 195 200 205 LeuSerThrLeuIleGlyLysGluAspProLysArgSerAsnTyrLeu 210 215 220 TrpTrpGlyArgHisLeuThrGlnMetGlnMetLeuGlnPhePhePhe 225 230 235 240 AsnValLeuGlnAlaLeuTyrCysAlaSerPheSerThrTyrProLys 245 250 255 PheLeuSerLysIleLeuLeuValTyrMetMetSerLeuLeuGlyLeu 260 265 270 PheGlyHisPheTyrTyrSerLysHisIleAlaAlaAlaLysLeuGln 275 280 285 LysLysGlnGln 290 <210> 113<211> 903<212 > DNA<213> Ostreococcustauri<220><221> CDS<222> (1)..(903)<223> Δ5-elongase<400> 113atgagcgctccggtgcgctgctgcccgcgatcgcgttcgccgcgtac 48MetSerAlaSerGlyAlaLeuLeuProAlaIleAlaPheAlaAlaTyr 1 5 10 15 gcgtacgcgacgtacgcctcgctt6gagtggtcgca9 192AlaTyrAlaThrTyrAlaTyrAlaPheGluTrpSerHisAlaAsnGly 20 25 30 atcgacaacgtcgacgcgcgcgagtggatcggtgcgctgtcgttgagg 144IleAspAsnValAspAlaArgGluTrpIleGlyAlaLeuSerLeuArg 35 40 45 ctcccggcgatcgcgacgacgatgtacctgttgttctgcctggtcgga 192LeuProAlaIleAlaThrThrMetTyrLeuLeuPheCysLeuValGly 50 55 60 ccgaggttgatggcgaagcgcgaggcgttcgacccgaaggggttcatg 240ProArgLeuMetAlaLysArgGluAlaPheAspProLysGlyPheMet 65 70 75 80 ctggcgtacaatgcgtatcagacggcgttcaacgtcgtcgtgctcggg 288LeuAlaTyrAsnAlaTyrGlnThrAlaPheAsnValValValLeuGly 85 90 95 atgttcgcgcgagagatctcggggctggggcagcccgtgtgggggtca 336MetPheAlaArgGluIleSerGlyLeuGlyGlnProValTrpGlySer 100 105 110 accatgccgtggagcgatagaaaatcgtttaagatcctcctcggggtg 384ThrMetProTrpSerAspArgLysSerPheLysIleLeuLeuGlyVal 115 120 125 tggttgcactacaacaacaaatatttggagctattggacactgtgttc 432TrpLeuHisTyrAsnAsnLysTyrLeuGluLeuLeuAspThrValPhe 130 135 140 atggttgcgcgcaagaagacgaagcagttgagcttcttgcacgtttat 480MetValAlaArgLysLysThrLysGlnLeuSerPheLeuHisValTyr 145 150 155 160 catcacgccctgttgatctgggcgtggtggttggtgtgtc acttgatg 528HisHisAlaLeuLeuIleTrpAlaTrpTrpLeuValCysHisLeuMet 165 170 175 gccacgaacgattgtatcgatgcctacttcggcgcggcgtgcaactcg 576AlaThrAsnAspCysIleAspAlaTyrPheGlyAlaAlaCysAsnSer 180 185 190 ttcattcacatcgtgatgtactcgtattatctcatgtcggcgctcggc 624PheIleHisIleValMetTyrSerTyrTyrLeuMetSerAlaLeuGly 195 200 205 attcgatgcccgtggaagcgatacatcacccaggctcaaatgctccaa 672IleArgCysProTrpLysArgTyrIleThrGlnAlaGlnMetLeuGln 210 215 220 ttcgtcattgtcttcgcgcacgccgtgttcgtgctgcgtcagaagcac 720PheValIleValPheAlaHisAlaValPheValLeuArgGlnLysHis 225 230 235 240 tgcccggtcacccttccttgggcgcaaatgttcgtcatgacgaacatg 768CysProValThrLeuProTrpAlaGlnMetPheValMetThrAsnMet 245 250 255 ctcgtgctcttcgggaacttctacctcaaggcgtactcgaacaagtcg 816LeuValLeuPheGlyAsnPheTyrLeuLysAlaTyrSerAsnLysSer 260 265 270 cgcggcgacggcgcgagttccgtgaaaccagccgagaccacgcgcgcg 864ArgGlyAspGlyAlaSerSerValLysProAlaGluThrThrArgAla 275 280 285 cccagcgtgcgacgcacgcgatctcgaaaaattgactaa 903 193ProSerValArgArgThrArgSerArgLysIleAsp 290 295 300 <210> 114<211> 300<212> PRT<213> Ostreococcustauri<400> 114MetSerAlaSerGlyAlaLeuLeuProAlaIleAlaPheAlaAlaTyr 1 5 10 15 AlaTyrAlaThrTyrAlaTyrAlaPheGluTrpSerHisAlaAsnGly 20 25 30 IleAspAsnValAspAlaArgGluTrpIleGlyAlaLeuSerLeuArg 35 40 45 LeuProAlaIleAlaThrThrMetTyrLeuLeuPheCysLeuValGly 50 55 60 ProArgLeuMetAlaLysArgGluAlaPheAspProLysGlyPheMet 65 70 75 80 LeuAlaTyrAsnAlaTyrGlnThrAlaPheAsnValValValLeuGly 85 90 95 MetPheAlaArgGluIleSerGlyLeuGlyGlnProValTrpGlySer 100 105 110 ThrMetProTrpSerAspArgLysSerPheLysIleLeuLeuGlyVal 115 120 125 TrpLeuHisTyrAsnAsnLysTyrLeuGluLeuLeuAspThrValPhe 130 135 140 MetValAlaArgLysLysThrLysGlnLeuSerPheLeuHisValTyr 145 150 155 160 HisHisAlaLeuLeuIleTrpAlaTrpTrpLeuValCysHisLeuMet 165 170 175 AlaThrAsnAspCysIleAspAlaTyrPheGlyAlaAlaCysAsnSer 180 185 190 PheIleHisIleValMetTyrSerTyrTyrLeuMetSerAlaLeuGly 195 200 205 194IleArgCysProTrpLysArgTyrIleThrGlnAlaGlnMetLeuGln 210 215 220 PheValIleValPheAlaHisAlaValPheValLeuArgGlnLysHis 225 230 235 240 CysProValThrLeuProTrpAlaGlnMetPheValMetThrAsnMet 245 250 255 LeuValLeuPheGlyAsnPheTyrLeuLysAlaTyrSerAsnLysSer 260 265 270 ArgGlyAspGlyAlaSerSerValLysProAlaGluThrThrArgAla 275 280 285 ProSerValArgArgThrArgSerArgLysIleAsp 290 295 300 <210> 115<211> 13<212> PRT<213> Consensus<220><221> MISC_FEATURE<222 > (1)..(13)<223> Xaainthesequenceatposition2,3,4,6,7,8and9hasthemeaning giveninTableA.<400> 115AsnXaaXaaXaaHisXaaXaaMetTyrXaaTyrTyrXaa 1 5 10 <210> 116<211> 10<212> PRT<213> consensus ><221> MISC_FEATURE<222> (1)..(10)<223> Xaaatposition3,4,5and6inthesequencehasthemeaninggivenin TableA. 195<400> 116HisHisXaaXaaXaaXaaTrpAlaTrpTrp 1 5 10 <210> 117<211> 909<212> DNA<213> Xenopuslaevis<220><221> CDS<222> (1)..(909)<223> Δ5-elongase<400 > 117atggccttcaaggagctcacatcaagggcagtgctcctgtatgatgaa 48MetAlaPheLysGluLeuThrSerArgAlaValLeuLeuTyrAspGlu 1 5 10 15 tggattaaagatgctgatcctagggttgaagactggccactcatgtcc 96TrpIleLysAspAlaAspProArgValGluAspTrpProLeuMetSer 20 25 30 tctcctatcctacaaaccatcatcatcggcgcttacatctactttgtc 144SerProIleLeuGlnThrIleIleIleGlyAlaTyrIleTyrPheVal 35 40 45 acatcattgggcccaaggatcatggagaacaggaagccgtttgctctg 192ThrSerLeuGlyProArgIleMetGluAsnArgLysProPheAlaLeu 50 55 60 aaggagatcatggcatgttacaacttattcatggttctgttttctgtg 240LysGluIleMetAlaCysTyrAsnLeuPheMetValLeuPheSerVal 65 70 75 80 tacatgtgctatgagtttctcatgtcgggctgggctactggatattcc 288TyrMetCysTyrGluPheLeuMetSerGlyTrpAlaThrGlyTyrSer 85 90 95 tttagatgtgacattgttgactactctcagtcacctcaggcgttacgg 336PheArgCysAspIleValAspTyrSerGlnSerProGlnAlaLeuArg 100 105 110 atggcctggacctgctggctcttctatttttcaaagttcattgaatta 384MetAlaTrpThrCysTrpLeu PheTyrPheSerLysPheIleGluLeu 115 120 125 ttagacactgttttctttgtgctgcgtaagaagaacagccagattaca 432LeuAspThrValPhePheValLeuArgLysAsnSerGlnIleThr 130 135 140 ttcctgcacgtctatcaccactccattatgccttggacgtggtggttt 480 196PheLeuHisValTyrHisHisSerIleMetProTrpThrTrpTrpPhe 145 150 155 160 ggagtcaaatttgctccaggtggtttgggcacattccatgcactggtg 528GlyValLysPheAlaProGlyGlyLeuGlyThrPheHisAlaLeuVal 165 170 175 aactgtgtggtccatgttatcatgtacagctactacggcctgtcagcc 576AsnCysValValHisValIleMetTyrSerTyrTyrGlyLeuSerAla 180 185 190 ttggggcctgcctaccagaagtacctgtggtggaaaaagtacatgacg 624LeuGlyProAlaTyrGlnLysTyrLeuTrpTrpLysLysTyrMetThr 195 200 205 tctatccaactgacccagttcttgatggttacttttcacatcggccag 672SerIleGlnLeuThrGlnPheLeuMetValThrPheHisIleGlyGln 210 215 220 ttcttcttcatggagaattgcccgtaccagtatcccgtcttcttgtat 720PhePhePheMetGluAsnCysProTyrGlnTyrProValPheLeuTyr 225 230 235 240 gtcatttggctgtacgggttcgttttcttaatcttgttcctcaacttc 768ValIleTrpLeuTyrGlyPheValPheLeuIleLeuPheLeuAsnPhe 245 250 255 tggttccacgcttacatcaaaggacagaggctgccgaaagccgtccaa 816TrpPheHisAlaTyrIleLysGlyGlnArgLeuProLysAlaValGln 260 265 270 aatggccactgcaagaacaacaacaaccaagaaaacacttggtgcaag 864AsnGlyHisCysLysAsnAsnAsnAsnGlnGluAsnThrTrpCysLys 275 280 285 aacaaaaaccagaaaaacggtgca ttgaaaagcaaaaaccattga 909AsnLysAsnGlnLysAsnGlyAlaLeuLysSerLysAsnHis 290 295 300 <210> 118<211> 302<212> PRT<213> Xenopuslaevis<400> 118MetAlaPheLysGluLeuThrSerArgAlaValLeuLeuTyrAspGlu 1 5 10 15 TrpIleLysAspAlaAspProArgValGluAspTrpProLeuMetSer 20 25 30 SerProIleLeuGlnThrIleIleIleGlyAlaTyrIleTyrPheVal 35 40 45 ThrSerLeuGlyProArgIleMetGluAsnArgLysProPheAlaLeu 50 55 60 197LysGluIleMetAlaCysTyrAsnLeuPheMetValLeuPheSerVal 65 70 75 80 TyrMetCysTyrGluPheLeuMetSerGlyTrpAlaThrGlyTyrSer 85 90 95 PheArgCysAspIleValAspTyrSerGlnSerProGlnAlaLeuArg 100 105 110 MetAlaTrpThrCysTrpLeuPheTyrPheSerLysPheIleGluLeu 115 120 125 LeuAspThrValPhePheValLeuArgLysLysAsnSerGlnIleThr 130 135 140 PheLeuHisValTyrHisHisSerIleMetProTrpThrTrpTrpPhe 145 150 155 160 GlyValLysPheAlaProGlyGlyLeuGlyThrPheHisAlaLeuVal 165 170 175 AsnCysValValHisValIleMetTyrSerTyrTyrGlyLeuSerAla 180 185 190 LeuGlyProAlaTyrGlnLysTyrLeuTrpTrpLysLysTyrMetThr 195 200 205 SerIleGlnLeuThrGlnPheLeuMetValThrPheHisIleGlyGln 210 215 220 PhePhePheMetGluAsnCysProTyrGlnTyrProValPheLeuTyr 225 230 235 240 ValIleTrpLeuTyrGlyPheValPheLeuIleLeuPheLeuAsnPhe 245 250 255 TrpphehisalatyrillyLyglnargleuxal election choice 260 265 270 AsnglyhiscyscysasasnasnasnasnasnnasnnasnnasnnasnnasnnasnnasnnasnnasnasnasnasnasnasnasnasnasnasnasnasnasnasnasnasnnasnnasnnasnnasnnasnnasnnasnnasnnasnnasnluasnTthrpcyslys 275 280 285 Asnlysasnsnsnsnglytalthais 198<220><221> CDS<222>(1)..(870)<223> Δ5-elongase<400> 119atggacgtacttcatcgtttcttaggattctacgaatggacgctgact 48MetAspValLeuHisArgPheLeuGlyPheTyrGluTrpThrLeuThr 1 5 10 15 ttcgcggacccccgagtggcaaaatggcctttaatagaaaaccccctt 96PheAlaAspProArgValAlaLysTrpProLeuIleGluAsnProLeu 20 25 30 cctacaattgctattgtgttgctgtacctggcgtttgttctgtatatt 144ProThrIleAlaIleValLeuLeuTyrLeuAlaPheValLeuTyrIle 35 40 45 gggccgcgttttatgcgaaaaagagcaccagttgactttggtttattc 192GlyProArgPheMetArgLysArgAlaProValAspPheGlyLeuPhe 50 55 60 ctccctggatataactttgctttggttgcattaaattattatatcctg 240LeuProGlyTyrAsnPheAlaLeuValAlaLeuAsnTyrTyrIleLeu 65 70 75 80 caagaagtggtcactgggagttatggggctgggtatgatttggtttgc 288GlnGluValValThrGlySerTyrGlyAlaGlyTyrAspLeuValCys 85 90 95 acaccacttcgaagtgattcctacgatcccaatgaaatgaaggttgca 336ThrProLeuArgSerAspSerTyrAspProAsnGluMetLysValAla 100 105 110 aacgctgtatggtggtattatgtatccaagataatagagttgtttgat 384AsnAlaValTrpTrpTyrTyrValSerLysIleIleGluLeuPheAsp 115 120 125 actgtgttgttcactctacgcaaacgagaccgacaagtaactttcctt 432Th rValLeuPheThrLeuArgLysArgAspArgGlnValThrPheLeu 130 135 140 catgtttatcaccattctaccatgcccctgttgtggtggattggggca 480HisValTyrHisHisSerThrMetProLeuLeuTrpTrpIleGlyAla 145 150 155 160 aagtgggtgcctggtgggcaatcatttgttggcatcatactgaactcc 528LysTrpValProGlyGlyGlnSerPheValGlyIleIleLeuAsnSer 165 170 175 agtgttcatgttatcatgtatacgtactatggattgtcagccttgggg 576SerValHisValIleMetTyrThrTyrTyrGlyLeuSerAlaLeuGly 180 185 190 cctcacatgcagaagtttctatggtggaagaaatatatcacaatgttg 624ProHisMetGlnLysPheLeuTrpTrpLysLysTyrIleThrMetLeu 195 200 205 caactggttcaatttgttcttgccatctaccatactgctcgatcattg 672GlnLeuValGlnPheValLeuAlaIleTyrHisThrAlaArgSerLeu 210 215 220 199tacgttaaatgtccctcgcctgtttggatgcactgggcacttatcttg 720TyrValLysCysProSerProValTrpMetHisTrpAlaLeuIleLeu 225 230 235 240 tacgctttctcattcattttgcttttctcaaacttctacatgcatgcc 768TyrAlaPheSerPheIleLeuLeuPheSerAsnPheTyrMetHisAla 245 250 255 tatatcaagaaatcaagaaaagggaaagagaatggcagtcgaggaaaa 816TyrIleLysLysSerArgLysGlyLysGluAsnGlySerArgGlyLys 260 265 270 ggtggtgtaagtaatggaaaggaaaagctgcacgctaatggtaaaacc 864GlyGlyValSerAsnGlyLysGluLysLeuHisAlaAsnGlyLysThr 275 280 285 gattaa 870Asp <210> 120<211> 289<212> PRT<213> Cionaintestinalis<400> 120MetAspValLeuHisArgPheLeuGlyPheTyrGluTrpThrLeuThr 1 5 10 15 PheAlaAspProArgValAlaLysTrpProLeuIleGluAsnProLeu 20 25 30 ProThrIleAlaIleValLeuLeuTyrLeuAlaPheValLeuTyrIle 35 40 45 GlyProArgPheMetArgLysArgAlaProValAspPheGlyLeuPhe 50 55 60 LeuProGlyTyrAsnPheAlaLeuValAlaLeuAsnTyrTyrIleLeu 65 70 75 80 GlnGluValValThrGlySerTyrGlyAlaGlyTyrAspLeuValCys 85 90 95 ThrProLeuArgSerAspSerTyrAspProAsnGluMetLysValAla 100 105 110 AsnAlaValTrpTrpTyrTyrValSerLysIleIleGluLeuPheAsp 115 12 0 125 ThrValLeuPheThrLeuArgLysArgAspArgGlnValThrPheLeu 130 135 140 200HisValTyrHisHisSerThrMetProLeuLeuTrpTrpIleGlyAla 145 150 155 160 LysTrpValProGlyGlyGlnSerPheValGlyIleIleLeuAsnSer 165 170 175 SerValHisValIleMetTyrThrTyrTyrGlyLeuSerAlaLeuGly 180 185 190 ProHisMetGlnLysPheLeuTrpTrpLysLysTyrIleThrMetLeu 195 200 205 GlnLeuValGlnPheValLeuAlaIleTyrHisThrAlaArgSerLeu 210 215 220 TyrValLysCysProSerProValTrpMetHisTrpAlaLeuIleLeu 225 230 235 240 TyrAlaPheSerPheIleLeuLeuPheSerAsnPheTyrMetHisAla 245 250 255 TyrIleLysLysSerArgLysGlyLysGluAsnGlySerArgGlyLys 260 265 270 GlyGlyValSerAsnGlyLysGluLysLeuHisAlaAsnGlyLysThr 275 280 285 Asp <210> 121<211> 30<212> DNA<213> Primer<220><221> misc_feature<222> (1)..(30)<223> <400> 121aggatccatggccttcaaggagctcacatc 30<210> 122 201 <211> 35 <212> DNA <213> Primer <220> <221> misc_feature <222> (1)..(35) <223> <400> 122 cctcgagtca atggtttttg cttttcaatg caccg 35 <210> 123 <211> 25 <212> DNA <213> Primer <220> <221> misc_feature <222> (1)..(25) <223> <400> 123 taagcttatg gacgtacttc atcgt 25 <210> 124 <211> 26 <212> DNA <213> Primer <220> <221> misc_feature <222> (1)..(26) <223> <400> 124 tcagatcttt aatcggtttt accatt 26 202 <210> 125 <211> 34 <212> DNA <213> Primer <220> <221> misc_feature <222> (1)..(34) <223> <400> 125 gcggccgcac catggccttc aggagctca catc 34 <210> 126 <211> 38 <212> DNA <213> Primer <220> <221> misc_feature <222> (1)..(38) <223> <400> 126 gcggccgcct tcaatggttt ttgcttttca atgcaccg 38 <210> 127 <211> 29 <212> DNA <213> Primer <220> <221> misc_feature <222> (1)..(29) <223> 203 <400> 127 gcggccgcac catggacgta cttcatcgt 29 <210> 128 <211> 27 <212> DNA <213> Primer <220> <221> misc_feature <222> (1)..(27) <223> <400> 128 gcggccgctt taatcggttt taccatt 27 <210> 129 <211> 60 <212> DNA <213> Primer <220> <221> misc_feature <222> (1)..(60) <223> <400> 129 gtcgacccgc ggactagtgg gccctctaga cccggggat ccggatctgc tggctatgaa 60 <210> 130 <211> 60 <212> DNA <213> Primer <220> <221> misc_feature 204<222> (1) .(789)<223> Δ5-elongase<400> 131atgctgggggccatcgcggacgtcgtgctccgggggcccgccgcattc 48MetLeuGlyAlaIleAlaAspValValLeuArgGlyProAlaAlaPhe 1 5 10 15 cactgggaccctgccaccaccccgctcgcatcgatcgtcagcccctgt 96HisTrpAspProAlaThrThrProLeuAlaSerIleValSerProCys 20 25 30 gtggcctccgtggcgtacctgggggccatcgggctgctgaagcgccgc 144ValAlaSerValAlaTyrLeuGlyAlaIleGlyLeuLeuLysArgArg 35 40 45 actggaccggaggtccgctccaagcccttcgagctgctacacaacggg 192ThrGlyProGluValArgSerLysProPheGluLeuLeuHisAsnGly 50 55 60 ctgctggtgggctggtccctcgtggtgctgctcgggacgctgtacggc 240LeuLeuValGlyTrpSerLeuValValLeuLeuGlyThrLeuTyrGly 65 70 75 80 gcgttccagcgcgtgcaggaggacggccggggggtgcaggccctcctg 288AlaPheGlnArgValGlnGluAspGlyArgGlyValGlnAlaLeuLeu 85 90 95 tgcacccagcggccaccatctcagatctgggacggcccggtggggtac 336CysThrGlnArgProProSerGlnIleTrpAspGlyProValGlyTyr 100 105 110 ttcacgtacctcttctacctcgcga agtactgggagctggcggacact 384PheThrTyrLeuPheTyrLeuAlaAlaLysTyrTrpGluLeuAlaAspThr 115 120 125 gtcatcctcgccctccgccagaagcccaccatccccctccacgtctac 432ValIleLeuAlaLeuArgGlnLysProThrIleProLeuHisValTyr 130 135 140 catcacgccgtcatgctgttcatct40gcccccccagt 205HisHisAlaValMetLeuPheIleValTrpSerTrpPheAlaHisPro 145 150 155 160 tggctcgaggggagctggtggtgctccctggtcaactctttcatccac 528TrpLeuGluGlySerTrpTrpCysSerLeuValAsnSerPheIleHis 165 170 175 acggtgatgtactcgtactacaccctgacggtggttggcatcaaccct 576ThrValMetTyrSerTyrTyrThrLeuThrValValGlyIleAsnPro 180 185 190 tggtggaagaagtggatgaccaccatgcagatcatccagttcatcacg 624TrpTrpLysLysTrpMetThrThrMetGlnIleIleGlnPheIleThr 195 200 205 ggctgcgtgtacgtcatggcgttcttcggcctatattatgccggggcg 672GlyCysValTyrValMetAlaPhePheGlyLeuTyrTyrAlaGlyAla 210 215 220 ggctgcacctccaacgtgtacactgcctggttctcgatgggggtcaac 720GlyCysThrSerAsnValTyrThrAlaTrpPheSerMetGlyValAsn 225 230 235 240 ctcagctttctgtggctcttcgctcttttcttccgccggtcatacagc 768LeuSerPheLeuTrpLeuPheAlaLeuPhePheArgArgSerTyrSer 245 250 255 aaacctagccggaaggagtag 789LysProSerArgLysGlu 260 <210> 132<211> 262<212> PRT<213> Euglenagracilis<400> 132MetLeuGlyAlaIleAlaAspValValLeuArgGlyProAlaAlaPhe 1 5 10 15 HisTrpAspProAlaThrThrProLeuAlaSerIleValSerProCys 20 25 30 ValAlaSerValAlaTyrLeuGlyAlaI leGlyLeuLeuLysArgArg 35 40 45 ThrGlyProGluValArgSerLysProPheGluLeuLeuHisAsnGly 50 55 60 LeuLeuValGlyTrpSerLeuValValLeuLeuGlyThrLeuTyrGly 65 70 75 80 AlaPheGlnArgValGlnGluAspGlyArgGlyValGlnAlaLeuLeu 85 90 9 206CysThrGlnArgProProSerGlnIleTrpAspGlyProValGlyTyr 100 105 110 PheThrTyrLeuPheTyrLeuAlaLysTyrTrpGluLeuAlaAspThr 115 120 125 ValIleLeuAlaLeuArgGlnLysProThrIleProLeuHisValTyr 130 135 140 HisHisAlaValMetLeuPheIleValTrpSerTrpPheAlaHisPro 145 150 155 160 TrpLeuGluGlySerTrpTrpCysSerLeuValAsnSerPheIleHis 165 170 175 ThrValMetTyrSerTyrTyrThrLeuThrValValGlyIleAsnPro 180 185 190 TrpTrpLysLysTrpMetThrThrMetGlnIleIleGlnPheIleThr 195 200 205 GlyCysValTyrValMetAlaPhePheGlyLeuTyrTyrAlaGlyAla 210 215 220 GlyCysThrSerAsnValTyrThrAlaTrpPheSerMetGlyValAsn 225 230 235 240 LeuSerPheLeuTrpLeuPheAlaLeuPhePheArgArgSerTyrSer 245 250 255 LysProSerArgLysGlu 260 <210> 133<211 > 789<212> DNA<213> Euglenagracilis<220><221> CDS<222> (1)..(789)<223> Δ5-elongase<400> 133atgctgggggccatcgcggacgtcgtgctccggggcccgccgcattc 48MetLeuGlyAlaIleAlaAspValLeuArgGlyProAlaAlaPhe 1 5 10 15 207cactgggaccctgccaccaccccgctcgcatcgatcgtcagcccctgt 96HisTrpAspProAlaThrThrProLeuAlaSerIleValSerProCys 20 25 30 gtggcctccgtggcgtacctgggggccatcgggctgctgaagcgccgc 144ValAlaSerValAlaTyrLeuGlyAlaIleGlyLeuLeuLysArgArg 35 40 45 actggaccggaggtccgctccaagcccttcgagctgctacacaacggg 192ThrGlyProGluValArgSerLysProPheGluLeuLeuHisAsnGly 50 55 60 ctgctggtgggctggtccctcgtggtgctgctcgggacgctgtacggc 240LeuLeuValGlyTrpSerLeuValValLeuLeuGlyThrLeuTyrGly 65 70 75 80 gcgtaccagcgcgtgcaggaggacggccggggggtgcaggccctgctg 288AlaTyrGlnArgValGlnGluAspGlyArgGlyValGlnAlaLeuLeu 85 90 95 tgcacccagcggccaccatctcagatctgggacggcccggtggggtac 336CysThrGlnArgProProSerGlnIleTrpAspGlyProValGlyTyr 100 105 110 ttcacgtaccttttctacctcgcgaagtactgggagctggtggacact 384PheThrTyrLeuPheTyrLeuAlaLysTyrTrpGluLeuValAspThr 115 120 1...