Peptide activators of NRF2 pathway

NPA7, a bioengineered peptide that co-activates GC-A/cGMP and MasR/cAMP pathways, addresses the challenge of oxidative stress in chronic inflammatory conditions by activating Nrf2, reducing ROS levels and enhancing antioxidant defenses.

WO2024182044A9PCT designated stage expired Publication Date: 2025-07-03MAYO FOUNDATION FOR MEDICAL EDUCATION & RESEARCH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
PCT/US2023/085910
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-02-28
Filing Date
2023-12-26
Publication Date
2025-07-03

AI Technical Summary

Technical Problem

Chronic inflammatory conditions mediated by reactive oxygen species (ROS) cause significant physical suffering, impaired function, and diminished quality of life, with existing therapies failing to effectively reduce oxidative stress and delay disease progression.

Method used

A bioengineered peptide, NPA7, which fuses human BNP with ANG 1–7, co-activates the GC-A/cGMP and MasR/cAMP pathways, activating the redox-sensitive transcription factor Nrf2 to reduce oxidative stress and protect cells against tissue damage.

Benefits of technology

NPA7 effectively decreases ROS levels, enhances antioxidant defenses, and activates Nrf2 pathways, leading to reduced oxidative stress and favorable therapeutic outcomes in various inflammatory and neurodegenerative conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000014_0001
    Figure IMGF000014_0001
  • Figure IMGF000015_0001
    Figure IMGF000015_0001
  • Figure IMGF000036_0001
    Figure IMGF000036_0001
Patent Text Reader

Abstract

The present application provides bioengineered peptide NPA7 and its use in treating conditions responsive to activation of redox-sensitive transcription factor Nrf2, such as neurodegenerative conditions and conditions related to aging.
Need to check novelty before this filing date? Find Prior Art

Description

[0001]Attorney Docket No.07039-2196WO1 Peptide activators of Nrf2 pathway CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application Serial No. 63 / 449,046, filed February 28, 2023. The disclosure of the prior application is considered part of the disclosure of this application, and is incorporated in its entirety into this application. FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with Government support under Grant No. HL134668 awarded by the National Institutes of Health. The Government has certain rights in the invention. TECHNICAL FIELD This invention relates, e.g., to bioengineered peptide NPA7 and its use intreating conditions responsive to activation of redox-sensitive transcription factor Nrf2, such as neurodegenerative conditions and conditions related to aging. BACKGROUND Chronic inflammatory conditions, such as inflammatory diseases mediated by reactive oxygen species, adversely affect patients in terms of physical suffering and pain, impaired function, and diminished quality of life. These persistent relapsing diseases, examples of which include neurodegenerative conditions, rheumatoid arthritis, inflammatory bowel disease, ankylosing spondylitis, and psoriasis, have a significant influence on individual employment status and work-related productivity. In addition to the significant burden on patients and their families, reactive oxygen species (ROS)-mediated inflammation represents a sizable burden to society due to high healthcare and non-healthcare related costs. SUMMARY Experimental evidence has shown that excess oxidative stress is a hallmark in many disease states. Thus, therapies that reduce oxidative stress in various organs and tissues may lead to a reduction in related adverse outcomes and delay the disease progression. Recently, a bispecific peptide was reported that fuses human BNP with ANG 1–7 to create a single therapeutic peptide (NPA7) that simultaneously co-activates Attorney Docket No.07039-2196WO1 the protective GC-A / cGMP and MasR / cAMP pathways (See US9,102,707, which is incorporated herein by reference in its entirety). NPA7 possesses enhanced natriuretic, diuretic, systemic, and renal vasorelaxing and cardiac unloading properties. The present disclosure is based, at least in part, on a realization that NPA7 also possesses antioxidant effects within the organs and tissues. Without being bound by any theory, the data presented herein shows that NPA7 activates the redox-sensitive transcription factor Nrf2 which is involved in the transcriptional activation of antioxidant genes to protectthe cells against oxidative stress. Hence, this disclosure advantageously provides, e.g.,methods of treating a disease or disorder by reducing oxidative stress in affected tissues, the method including administering NPA7 (or an analog of any one of the peptide sequences described herein) to a patient identified as having such a disease or disorder. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. Methods and materials are described herein for use in the present application; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Other features and advantages of the present application will be apparent from the following detailed description and figures, and from the claims. DESCRIPTION OF DRAWINGS Figure 1 is a structural schematic of a chimeric polypeptide containing an N- terminus and ring structure of a natriuretic peptide and a C-terminus of a segment of an angiotensin polypeptide in accordance with some embodiments. The amino acid segment of an angiotensin polypeptide shown in Figure 1 (DRVYIHP; SEQ ID NO:1) can be referred to as angiotensin-(1-7) or Ang-(1-7). The N-terminus and ring structure can have the sequence of any appropriate natriuretic peptide including, withoutlimitation, ANP, BNP, CNP, DNP, and URO. “A” refers to an amino acid sequencefrom the N-terminus of a natriuretic peptide, “B” refers to an amino acid sequence from the ring structure of a natriuretic peptide, and “C” refers to an amino acid sequence of Ang(1-7), which can form the C-terminus of a chimeric polypeptide. Attorney Docket No.07039-2196WO1 Figure 2 is a structural schematic of a chimeric polypeptide (SEQ ID NO:43) containing an N-terminus and ring structure of ANP and a C-terminal Ang-(1-7) in accordance with some embodiments. The amino acid sequence of the N-terminal segment of ANP shown in Figure 2 (SLRRSS; SEQ ID NO:2) can be referred to as ANPN-term, while the amino acid sequence of the ring structure segment of ANP shown in Figure 2 (CFGGRMDRIGAQ-SGLGC; SEQ ID NO:3) can be referred to as ANPring. Figure 3 is a structural schematic of a chimeric polypeptide (SEQ ID NO:44) containing an N-terminus and ring structure of BNP and a C-terminal Ang-(1-7) in accordance with some embodiments. The amino acid sequence of the N-terminal segment of BNP shown in Figure 3 (SPKMVQGSG; SEQ ID NO:4) can be referred toas BNPN-term, while the amino acid sequence of the ring structure segment of BNPshown in Figure 3 (CFGRKM-DRISSSSGLGC; SEQ ID NO:5) can be referred to as BNPring. The chimeric polypeptide having the amino acid sequence set forth in SEQ ID NO:44 can be referred to as BNP-Ang1-7. Figure 4 is a structural schematic of a chimeric polypeptide (SEQ ID NO:45) containing an N-terminus and ring structure of CNP and a C-terminal Ang-(1-7) in accordance with some embodiments. The amino acid sequence of the N-terminalsegment of CNP shown in Figure 4 (GLSKG; SEQ ID NO:6) can be referred to asCNPN-term, while the amino acid sequence of the ring structure segment of CNP shown in Figure 4 (CFGLKLDRIG-SMSGLGC; SEQ ID NO:7) can be referred to as CNPring. The chimeric polypeptide shown in Figure 4 can be referred to as cAng or cANG. Figure 5 is a structural schematic of a chimeric polypeptide (SEQ ID NO:46) containing an N-terminus and ring structure of DNP and a C-terminal Ang-(1-7) in accordance with some embodiments. The amino acid sequence of the N-terminalsegment of DNP shown in Figure 5 (EVKYDP; SEQ ID NO:8) can be referred to asDNPN-term, while the amino acid sequence of the ring structure segment of DNP shown in Figure 5 (CFGHKIDRINHVS-NLGC; SEQ ID NO:9) can be referred to as DNPring. Figure 6 is a structural schematic of a chimeric polypeptide (SEQ ID NO:47) containing an N-terminus and ring structure of URO and a C-terminal Ang-(1-7) in accordance with some embodiments. The amino acid sequence of the N-terminal segment of URO shown in Figure 6 (TAPRSLRRSS; SEQ ID NO:10) can be referred to as URON-term, while the amino acid sequence of the ring structure segment of URO Attorney Docket No.07039-2196WO1 shown in Figure 6 (CFGG-RMDRIGAQSGLGC; SEQ ID NO:11) can be referred to as UROring. Figure 7 is a structural schematic of a chimeric polypeptide (SEQ ID NO:48) containing an N-terminus of BNP (BNPN-term), a ring structure of ANP (ANPring), and a C-terminal Ang-(1-7) in accordance with some embodiments. Figure 8 is a structural schematic of a chimeric polypeptide (SEQ ID NO:49) containing an N-terminus of CNP (CNPN-term), a ring structure of ANP (ANPring), and a C-terminal Ang-(1-7) in accordance with some embodiments. Figure 9 is a structural schematic of a chimeric polypeptide (SEQ ID NO:50) containing an N-terminus of DNP (DNPN-term), a ring structure of ANP (ANPring), and a C-terminal Ang-(1-7) in accordance with some embodiments. Figure 10 is a structural schematic of a chimeric polypeptide (SEQ ID NO:51) containing an N-terminus of URO (URON-term), a ring structure of ANP (ANPring), and a C-terminal Ang-(1-7) in accordance with some embodiments. Figure 11 is a structural schematic of a chimeric polypeptide (SEQ ID NO:52) containing an N-terminus of ANP (ANPN-term), a ring structure of BNP (BNPring), and a C-terminal Ang-(1-7) in accordance with some embodiments. Figure 12 is a structural schematic of a chimeric polypeptide (SEQ ID NO:53) containing an N-terminus of CNP (CNPN-term), a ring structure of BNP (BNPring), and a C-terminal Ang-(1-7) in accordance with some embodiments. Figure 13 is a structural schematic of a chimeric polypeptide (SEQ ID NO:54) containing an N-terminus of DNP (DNPN-term), a ring structure of BNP (BNPring), and a C-terminal Ang-(1-7) in accordance with some embodiments. Figure 14 is a structural schematic of a chimeric polypeptide (SEQ ID NO:55) containing an N-terminus of URO (URON-term), a ring structure of BNP (BNPring), and a C-terminal Ang-(1-7) in accordance with some embodiments. Figure 15 is a structural schematic of a chimeric polypeptide (SEQ ID NO:56) containing an N-terminus of ANP (ANPN-term), a ring structure of CNP (CNPring), and a C-terminal Ang-(1-7) in accordance with some embodiments. Figure 16 is a structural schematic of a chimeric polypeptide (SEQ ID NO:57) containing an N-terminus of BNP (BNPN-term), a ring structure of CNP (CNPring), and a C-terminal Ang-(1-7) in accordance with some embodiments. Attorney Docket No.07039-2196WO1 Figure 17 is a structural schematic of a chimeric polypeptide (SEQ ID NO:58) containing an N-terminus of DNP (DNPN-term), a ring structure of CNP (CNPring), and a C-terminal Ang-(1-7) in accordance with some embodiments. Figure 18 is a structural schematic of a chimeric polypeptide (SEQ ID NO:59) containing an N-terminus of URO (URON-term), a ring structure of CNP (CNPring), and a C-terminal Ang-(1-7) in accordance with some embodiments. Figure 19 is a structural schematic of a chimeric polypeptide (SEQ ID NO:60) containing an N-terminal Ang-(1-7) and a ring structure (ANPring) and C-terminus of ANP in accordance with some embodiments. The amino acid sequence of the C- terminal segment of ANP shown in Figure 19 (NSFRY; SEQ ID NO:12) can be referred to as ANPC-term. Figure 20 is a structural schematic of a chimeric polypeptide (SEQ ID NO:61) containing an N-terminal Ang-(1-7) and a ring structure (BNPring) and C-terminus of BNP in accordance with some embodiments. The amino acid sequence of the C-terminal segment of BNP shown in Figure 20 (KVLRRH; SEQ ID NO:13) can bereferred to as BNPC-term. The chimeric polypeptide having the amino acid sequence set forth in SEQ ID NO:61 can be referred to as Ang1-7BNP. Figure 21A shows that dual acting peptide NPA7 inhibits oxidative stress and mediates cardioprotection via activation of GC-A and MasR with downstream activation of Nrf2 and inhibition of KEAP1 with augmentation of GSH synthesis and PPP pathway activation. Figure 21B Amino acid sequence of NPA7. As discussed herein, NPA7 wasdesigned as a first-in-class bispecific peptide that fuses a 22-AA residue cassette of the human GC-A receptor activator BNP with the 7-AA cassette sequence of the MasR agonist Ang 1–7. Figure 22 Conceptual framework: NPA7 controls antioxidant function through GC-A and MasR mediated Nrf2 regulation leading to tissue protection (e.g., cardioprotection). Figure 23 is a structural schematic of a chimeric polypeptide (SEQ ID NO:27) containing an N-terminal Ang-(1-7) and the C-terminus of ANP (ANPC-term) without a ring structure in accordance with some embodiments. This polypeptide can be referred to as Ang-(1-7)-ANP-CT. Attorney Docket No.07039-2196WO1 Figure 24 is a structural schematic of a chimeric polypeptide (SEQ ID NO:28) containing an N-terminal Ang-(1-7) and the C-terminus of BNP (BNPC-term) without a ring structure in accordance with some embodiments. This polypeptide can be referred to as Ang-(1-7)-BNP-CT. Figure 25 is a structural schematic of a chimeric polypeptide (SEQ ID NO:29) containing an N-terminal Ang-(1-7) and the C-terminus of DNP (DNPC-term) without a ring structure in accordance with some embodiments. This polypeptide can be referred to as Ang-(1-7)-DNP-CT. The amino acid sequence of the C-terminal segment of DNPshown in Figure 25 (PSLRDPRPNAPSTSA; SEQ ID NO:30) can be referred to asDNPC-term. Figure 26 is a structural schematic of a chimeric polypeptide (SEQ ID NO:31) containing the C-terminus of ANP (ANPC-term) as an N-terminal segment followed by a C-terminal Ang-(1-7) without a ring structure in accordance with some embodiments. This polypeptide can be referred to as ANP-CT-Ang-(1-7). Figure 27 is a structural schematic of a chimeric polypeptide (SEQ ID NO:32) containing the C-terminus of BNP (BNPC-term) as an N-terminal segment followed by a C-terminal Ang-(1-7) without a ring structure in accordance with some embodiments. This polypeptide can be referred to as BNP-CT-Ang-(1-7). Figure 28 is a structural schematic of a chimeric polypeptide (SEQ ID NO:33) containing the C-terminus of DNP (DNPC-term) as an N-terminal segment followed by a C-terminal Ang-(1-7) without a ring structure in accordance with some embodiments. This polypeptide can be referred to as DNP-CT-Ang-(1-7). Figure 29 is a structural schematic of a chimeric polypeptide (SEQ ID NO:34) containing an N-terminal Ang-(1-7) and a ring structure (CNPring) with no C-terminal tail in accordance with some embodiments. This polypeptide can be referred to as Ang- (1-7)-CNPR1. Figure 30 is a structural schematic of a chimeric polypeptide (SEQ ID NO:35) containing a reverse ring structure of CNP and a C-terminal Ang-(1-7) and with no N- terminal tail in accordance with some embodiments. This polypeptide can be referred to as Ang-(1-7)-CNPR2. The amino acid sequence of the reverse ring structure segment of CNP shown in Figure 30 (CGLGSMSGIRDLKLGFC; SEQ ID NO:36) can be referred to as reverse-CNPring. Attorney Docket No.07039-2196WO1 Figure 31 is a structural schematic of a chimeric polypeptide (SEQ ID NO:37) containing an N-terminal Ang-(1-7) and a reverse ring structure (reverse-CNPring) with no C-terminal tail in accordance with some embodiments. This polypeptide can be referred to as Ang-(1-7)-CNPR3. Figure 32 is a structural schematic of a chimeric polypeptide (SEQ ID NO:38) containing a ring structure (CNPring) and a C-terminal Ang-(1-7) and with no N-terminal tail in accordance with some embodiments. This polypeptide can be referred to as Ang- (1-7)-CNPR4. Figure 33 NPA7 attenuated H2O2 induced ROS level upregulation and rescued the H2O2 induced GSH / GSSG ratio reduction in human cardiomyocytes. HCMs were pre-treated with NPA7 (10 µM), BNP (10 µM) or Ang 1-7 (10 µM) for 6 hours and then stimulated with H2O2 (400 µM ) for 20 hours. ROS level (A) and GSH / GSSG ratio (B) were measured. ***, p<0.001. Figure 34 NPA7 increase the level of key enzymes of NADPH (G6PD) and GSH (GCLC, GCLM and GSS) biosynthesis, which are essential for oxidative stress defense in human cardiomyocytes. HCMs were pre-treated with NPA7 (10 µM) for 6 hours and then stimulated with H2O2(400 µM ) for 20 hours. qPCR (A) and western blotting (B) were performed. ***, p<0.001. Figure 35 GC-A or MasR enhances the antioxidant capacity and activates Nrf2 in HCMs. A-B, HCMs were transfected with siRNAs targeting GC-A or MasR receptor or the negative control (siNC). The relative mRNA levels of GC-A (A) or MasR (B) were analyzed by real-time PCR after 48 h transfection. C-D, Relative mRNA levels of antioxidant regulation genes (G6PD, GSS, GCLM) in siNC or GC-A-knockdown (C), or MasR-knockdown (D) HCMs after 48 h transfection. E-F, western blot of master antioxidant regulator transcription factor Nrf2 and target gene G6PD in siNC or GC-A- knockdown (E), or MasR-knockdown (F) HCMs. ***P<0.001. Figure 36 In vitro action of NPA7 on generation of the second messenger of theGC-A receptor (cGMP) and MasR (cAMP). A, NPA7 generates the second messenger cGMP in HEK293 cells overexpressed with GC-A. B, NPA7 generates the second messenger cAMP in HEK293 cells overexpressed with MasR. ***P<0.001. Figure 37 NPA7 attenuated H2O2 induced ROS level upregulation in human cardiomycytes. A, NPA7 inhibited DHE staining, which represents elevated intracellular ROS levels. B, the quatification of DHE staining intensity. ***P<0.001. Attorney Docket No.07039-2196WO1 Figure 38 Cardioprotective effect of NPA7 on H2O2-induced oxidative stress by targeting GC-A and MasR through and NOX2 / ROS pathway in human cardiomyocytes. HCMs were transfected with siGC-A and siMasR for 24 hours and pre-treated with NPA7 (10 µM) for 6 hours and then stimulated with H2O2(400 µM ) for 20 hours. ROS level (A, B), cell viability (C) and NOX2 level were measured. ***, p<0.001. Figure 39 NPA7 activates p62-Keap1-Nrf2 signaling cascade in cardiomyocytes. A, HCMs were treated with NPA7 (10 µM) for 20 hours B, HCMs were pre-treated with NPA7 (10 µM) for 6 hours and then stimulated with H2O2 (400 µM ) for 20 hours. Western bloting were performed. Figure 40 shows NPA7 activation of the KEAP1-NRF2 pathway, A: HEK 293Tcells treated with PBS or NPA7 (10 µM) for 20 hours. HEK 293T cells expressing GFP- NRF2 were subjected to immunofluorescence analysis. Cell nuclei were stained with4',6-diamidino-2-phenylindole (DAPI). Scale bars, 20 µm. B: nuclear fractions ofhuman cardiomyocytes treated with NPA7 (10 µM) for 20 hours were subjected toimmunoblot analysis with antibodies against NRF2 and Lamin A / C. C: total RNAisolated from HCMs treated as described in (B) was subjected to quantitative qRT-PCRanalysis for the mRNAs of G6PD, SOD2, GPX1, GSS, GCLM and GCLC. D: HCMswere treated with NPA7 (10 µM) for the indicated times. Lysates of HCMs weresubjected to immunoblot analysis with antibodies against KEAP1, and -actin (loadingcontrol). E: densitometric analysis of KEAP1 immunoblots obtained in (D). F: totalRNA isolated from cells treated as described was subjected to qRT-PCR analysis forthe mRNA levels of KEAP1. **P 0.05. ***P 0.001..Figure 41 shows that p62 is required for NPA7-induced KEAP1 degradationand NRF2 activation. A-B: HCMs were transfected with control siRNA (Ctrl) or GC-A siRNA (A) or MasR siRNA (B), the cells were lysed and subjected to immunoblotanalysis with antibodies against p-p62, KEAP1, NRF2 and -actin. C: HCMs weretreated with NPA7 (10 µM) for the indicated times. Lysates of HCMs were subjectedto western blot analysis with antibodies against p-p62, and -actin. D: HCMs pre-treated with PBS or NPA7 (10 µM) for 6 hours followed by 400 µM hydrogen peroxide (H2O2) for 20 hours were subjected to western blot analysis with antibodies against p- Attorney Docket No.07039-2196WO1p62, and -actin. E: HCMs transfected with control siRNA (siCtrl) or p62 siRNA weretreated with PBS or NPA7 (10 uM) for 20 h. The cells were lysed and subjected towestern blot analysis with antibodies against KEAP1, p62, and -actin. F:quantification analysis of KEAP1 western blot obtained in (E). G-H: qRT-PCRanalysis of mRNA levels of KEAP1 (G), G6PD, SOD2, GPX1, GSS and GCLC (H). Data are presented as the means ± SEM from three independent experiments. **P0.05. ***P 0.001.Figure 42 shows that NPA7 inhibits oxidative stress in left ventricle of spontaneously hypertensive rat (SHR). A-B: Dihydroethidium (5 M DHE) fluorescent staining (red) detection of ROS(A) and quantification of average fluorescence intensity by ImageJ (B) in slices of leftventricle of 14-week-old Wistar rats or SHR infusion with saline or NPA7. C: Lysatesof left ventricle of 14-week-old Wistar rats or SHR infusion with saline or NPA7 were subjected to immunoblot analysis with antibodies against KEAP1, and b-actin (loadingcontrol). D: qRT-PCR analysis of mRNA levels of Nox2 and p67 in left ventricle. Dataare presented as the means ± SEM from three independent experiments. **P 0.05.Figure 43 shows that NPA7 inhibits oxidative stress in liver and lung of spontaneously hypertensive rat (SHR). A-D: Dihydroethidium (5 M DHE) fluorescent staining (red) detection of ROSlevels (A, C) and quantification of average fluorescence intensity by ImageJ (B, D) inslices of liver (A, B) and lung (C, D) of 14-week-old Wistar rats or spontaneouslyhypertensive rats (SHR) infusion with saline or NPA7. Scale bar=50 m. Data arepresented as the means ± SEM from three independent experiments. Figure 44 shows the percentage (%) decrease of DHE fluorescence caused byNPA7 in left ventricle, liver and lung of SHR Data are presented as the means ± SEMfrom three independent experiments. Figure 45 shows the timeline for the Acute Study Protocol in Wistar Kyoto rats(WKYs) or Spontaneously Hypertensive Rats (SHRs) Attorney Docket No.07039-2196WO1 DETAILED DESCRIPTION Oxidative stress often results in tissue damage, immune cell activation, and systemic inflammation. Thus, oxidative stress is viewed as an important driver in the pathophysiology of a wide array of diseases (e.g., hypertension and its progression to heart failure). Thus, therapies that reduce oxidative stress lead to a reduction adverse outcomes. NPA7 is a first-in-class bispecific peptide that fuses human BNP with ANG 1–7 to create a single therapeutic peptide that simultaneously co-activates the protective GC-A / cGMP and MasR / cAMP pathways. Data presented herein revealed during H2O2induced oxidative stress, treatment with NPA7 decreased the level of reactive oxygen species (ROS) and NADPH oxidase 2 (NOX2), the enzyme responsible for ROS formation. Moreover, NPA7 elevated glutathione (GSH), an essential antioxidant molecule. Without being bound by theory or speculation, it is believed that NPA7 plays a role in protecting against oxidative stress via Nrf2 activation through GC-A / Mas receptors. NPA7 is a dual GC-A / MasR activator which co-activates, in one molecular entity, two molecular pathways leading to Nrf2 activation. These antioxidant actions of this peptide reduce oxidative stress leading to favorable therapeutic outcome in disease states where oxidative stress is implicated in pathology. Compounds This document provides methods and materials related to peptides and the use of peptides to treat conditions various inflammatory conditions. For example, this document provides chimeric polypeptides having at least one amino acid segment (e.g., N-terminus tail, ring structure, reverse ring structure, C-terminus tail, or a combination thereof) of a natriuretic peptide (e.g., ANP, BNP, CNP, URO, or DNP) and an amino acid segment of an angiotensin polypeptide (e.g., Ang-(1-7), Ang-(1-8), or Ang-(1-9)). ). For example, a chimeric polypeptide provided herein can include the sequence set forth in SEQ ID NO:1. In some cases, a chimeric polypeptide provided herein can include a full length angiotensin polypeptide (e.g., a full length human angiotensin polypeptide). For example, a chimeric polypeptide provided herein can include the following sequence: DRVYIHPFHL (SEQ ID NO:14). A chimeric polypeptide provided herein can include a ring structure of anatriuretic peptide. Examples of ring structures include, without limitation, ANP ring,BNPring, CNPring, DNPring, and UROring. In some cases, an ANPring, BNPring, CNPring, Attorney Docket No.07039-2196WO1 DNPring, or UROring having one or more (e.g., one, two, three, four, five, six, or more) amino acid additions, subtractions, or substitutions can be used. For example, an ANPring or BNPring having two amino acid substitutions can be used as a ring structure of a chimeric polypeptide provided herein. In some cases, a chimeric polypeptide provided herein includes a reverse ring structure of a natriuretic peptide. Examples of reverse ring structures include, without limitation, reverse-ANPring (CGLGSQAGIRDMRGGFC; SEQ ID NO:39), reverse- BNPring(CGLGSSSSIRDMKRGFC; SEQ ID NO:40), reverse-CNPring, reverse- DNPring (CGLNSVHNIRDIKHGFC; SEQ ID NO:41), and reverse-UROring(CGLGSQAGIRDMRGGFC; SEQ ID NO:42). In some cases, a reverse-ANPring,reverse-BNPring, reverse-CNPring, reverse-DNPring, or reverse-UROring having one or more (e.g., one, two, three, four, five, six, or more) amino acid additions, subtractions, or substitutions can be used. For example, a reverse-ANPringor reverse-BNPringhaving two amino acid substitutions can be used as a ring structure of a chimeric polypeptide provided herein. In some cases, a chimeric polypeptide provided herein can include any appropriate amino acid segment of an angiotensin polypeptide either as an N-terminal portion or as a C-terminal portion with respect to a ring structure or reverse ring structure for those polypeptides containing such a ring structure or reverse ring structure. For example, a chimeric polypeptide provided herein can include an amino acid segment of an angiotensin polypeptide (e.g., Ang-(1-7)) followed by a ring structure and optionally a C-terminus of a natriuretic peptide (e.g., ANPC-term, BNPC-term, or DNPC-term). In some cases, an optional N-terminus of a natriuretic peptide (e.g., ANPN-term or BNPN-term) can be followed by a ring structure of a natriuretic peptide and an amino acid segment of an angiotensin polypeptide (e.g., Ang-(1-7)). In some cases, a chimeric polypeptide provided herein can include any appropriate amino acid segment of an angiotensin polypeptide either as an N-terminal portion or as a C-terminal portion attached to an N-terminus (e.g., ANPN-term, BNPN-term, CNPN-term, DNPN-term, or URON-term) or C-terminus of a natriuretic peptide (e.g., ANPC-term,BNPC-term, or DNPC-term) without a ring or reverse ring structure. For example, a chimeric polypeptide provided herein can include an amino acid segment of an angiotensin polypeptide (e.g., Ang-(1-7)) followed by a C-terminus of a natriuretic peptide (e.g., ANPC-term or BNPC-term) without a ring or reverse ring structure. In some Attorney Docket No.07039-2196WO1 cases, a C-terminus of a natriuretic peptide (e.g., ANPC-term or BNPC-term) can be followed by an amino acid segment of an angiotensin polypeptide (e.g., Ang-(1-7)) without a ring or reverse ring structure. With reference to Figure 1, a chimeric polypeptide provided herein can include an N-terminus and ring structure of a natriuretic peptide and a C-terminal Ang-(1-7). In some cases, the N-terminus and ring structure can be of the same natriuretic peptide (see, e.g., Figures 2-6) or of different natriuretic peptides (see, e.g., Figure 7-18). For example, a chimeric polypeptide provided herein can have BNPN-termfollowed by BNPring followed by Ang-(1-7) as shown in Figure 3 or can have ANPN-term followed byBNPring followed by Ang-(1-7) as shown in Figure 11. In some cases, a chimericpolypeptide provided herein can include an N-terminal Ang-(1-7) followed by a ring structure and C-terminus of a natriuretic peptide as shown in Figures 19 and 20. some cases, an N-terminus, ring structure, reverse ring structure, and / or C- terminus of an NP included in a chimeric polypeptide provided herein can include a variant (e.g., a substitution, addition, or deletion) at one or more positions (e.g., one, two, three, four, five, six, seven, eight, nine, or ten positions). Such variant NP sequences, e.g., those having one or more amino acid substitutions relative to a native NP amino acid sequence, can be prepared and modified as described herein. Amino acid substitutions can be made, in some cases, by selecting substitutions that do not differ significantly in their effect on maintaining (a) the structure of the peptide backbone in the area of the substitution, (b) the charge or hydrophobicity of themolecule at the target site, or (c) the bulk of the side chain. For example, naturallyoccurring residues can be divided into groups based on side-chain properties: (1) hydrophobic amino acids (norleucine, methionine, alanine, valine, leucine, and isoleucine); (2) neutral hydrophilic amino acids (cysteine, serine, and threonine); (3) acidic amino acids (aspartic acid and glutamic acid); (4) basic amino acids (asparagine, glutamine, histidine, lysine, and arginine); (5) amino acids that influence chain orientation (glycine and proline); and (6) aromatic amino acids (tryptophan, tyrosine, and phenylalanine). Substitutions made within these groups can be considered conservative substitutions. Non-limiting examples of useful substitutions include, without limitation, substitution of valine for alanine, lysine for arginine, glutamine for asparagine, glutamic acid for aspartic acid, serine for cysteine, asparagine for glutamine, aspartic acid for glutamic acid, proline for glycine, arginine for histidine, Attorney Docket No.07039-2196WO1 leucine for isoleucine, isoleucine for leucine, arginine for lysine, leucine for methionine, leucine for phenyalanine, glycine for proline, threonine for serine, serine for threonine, tyrosine for tryptophan, phenylalanine for tyrosine, and / or leucine for valine. Examples of variant N-terminal portions of NP sequences that can be used to make a chimeric polypeptide provided herein include, without limitation, SAPRSLRRSS (SEQ ID NO:15), TVPRSLRRSS (SEQ ID NO:16), TAGRSLRRSS (SEQ ID NO:17), TAPKSLRRSS (SEQ ID NO:18), TLRRSS (SEQ ID NO:19), SIRRSS (SEQ ID NO:20), SLKRSS (SEQ ID NO:21), and SLRKSS (SEQ ID NO:22). Examples of variant C-terminal portions of NP sequences that can be used to make a chimeric polypeptide provided herein include, without limitation, KVLRRR (SEQ ID NO:23), KVLRKH (SEQ ID NO:24), KVLKRH (SEQ ID NO:25), and KVIRRH (SEQ ID NO:26). Further examples of conservative substitutions that can be made at any position within an NP amino acid sequence used to make a chimeric polypeptide provided herein include, without limitation, those set forth in Table 1. Table 1. Examples of conservative amino acid substitutions. Original Residue Exemplary substitutionse Attorney Docket No.07039-2196WO1 Ser ThrThr SereIn so eric polypeptide provided he titutions. Non- conservative substitutions typically entail exchanging a member of one of the classes described above for a member of another class. Such production can be desirable to provide large quantities or alternative embodiments of such compounds. Whether an amino acid change results in a functional polypeptide can readily be determined by assaying the specific activity of the peptide variant. A chimeric polypeptide provided herein can have any appropriate sequence. For example, a polypeptide can include the sequences set forth in SEQ ID NOs:2, 3, and 1. In some cases, a chimeric polypeptide provided herein can contain (a) an amino acid sequence that aligns to the sequence set forth in SEQ ID NO:1 with three or less (e.g., two or less, one, or zero) amino acid additions, deletions, substitutions, or combinations thereof and (b) an amino acid sequence that aligns to the sequence of ANPring, BNPring, CNPring, DNPring, or UROring with five or less (e.g., four or less, three or less, two or less, one, or zero) amino acid additions, deletions, substitutions, or combinations thereof. In some cases, a chimeric polypeptide provided herein can contain (a) an amino acid sequence that aligns to the sequence set forth in SEQ ID NO:1 with three or less (e.g., two or less, one, or zero) amino acid additions, deletions, substitutions, or combinations thereof followed by (b) an amino acid sequence that aligns to the sequence of ANPring, BNPring, CNPring, DNPring, or UROring with five or less (e.g., four or less, three or less, two or less, one, or zero) amino acid additions, deletions, substitutions, or combinations thereof followed by (c) an amino acid sequence that aligns to the sequence of ANPC-term, BNPC-term, or a DNPC-termsequence with five or less (e.g., four or less, three or less, two or less, one, or zero) amino acid additions, deletions, substitutions, or combinations thereof. In some cases, a chimeric polypeptide provided herein can contain (a) an amino acid sequence that aligns to the sequence of ANPN-term, BNPN-term, CNPN-term, DNPN-term, or URON-term with five or less (e.g., four or less, three or less, two or less, one, or zero) amino acid additions, deletions, substitutions, or Attorney Docket No.07039-2196WO1 combinations thereof followed by (b) an amino acid sequence that aligns to the sequence of ANPring, BNPring, CNPring, DNPring, or UROringwith five or less (e.g., four or less, three or less, two or less, one, or zero) amino acid additions, deletions, substitutions, or combinations thereof followed by an amino acid sequence that aligns to the sequence set forth in SEQ ID NO:1 with three or less (e.g., two or less, one, or zero) amino acid additions, deletions, substitutions, or combinations. A polypeptide provided herein can have any appropriate length. For example, a polypeptide provided herein can be between 20 and 55 (e.g., between 24 and 55, between 24 and 45, between 25 and 45, between 26 and 44, between 27 and 43, between 28 and 42, between 29 and 41, between 30 and 40, between 31 and 39, between 23 and 35, between 25 and 30, or between 30 and 35) amino acid residues in length. It will beappreciated that a polypeptide with a length of 20 or 55 amino acid residues is apolypeptide with a length between 20 and 55 amino acid residues. Chimeric polypeptides provided herein as well as polypeptides containing a variant NP sequence with conservative and / or non-conservative substitutions (e.g., withrespect to a natural ANP, BNP, CNP, DNP, or URO), fragments of ANP, BNP, CNP,DNP, or URO, or fragments of such variants can be assessed for biological activityusing any suitable assay including, without limitation, those described herein. In some embodiments, a chimeric polypeptide provided herein can be cyclic due to disulfide bonds between cysteine residues (see, e.g., the structures depicted in Figures 1-20). In some embodiments, a sulfhydryl group on a cysteine residue can be replaced with an alternative group (e.g., -CH2CH2-). To replace a sulfhydryl group with a -CH2- group, for example, a cysteine residue can be replaced by alpha-aminobutyric acid. Such cyclic analog polypeptides can be generated, for example, as describedelsewhere (Lebl and Hruby, Tetrahedron Lett., 25:2067 (1984) and U.S. Patent No.4,161,521). In some cases, ester or amide bridges can be formed by reacting the OH of serine or threonine with the carboxyl group of aspartic acid or glutamic acid to yield a bridge having the structure -CH2CO2CH2-. In some cases, an amide can be obtained by reacting the side chain of lysine with aspartic acid or glutamic acid to yield a bridge having the structure -CH2C(O)NH(CH)4-. Methods for synthesis of these bridges aredescribed elsewhere (see, e.g., Schiller et al., Biochem. Biophy. Res. Comm., 127:558(1985), and Schiller et al. Int. J. Peptide Protein Res., 25:171 (1985)). Other bridge- Attorney Docket No.07039-2196WO1 forming amino acid residues and reactions are provided in, for example, U.S. Pat. No. 4,935,492. In some cases, peptide analogs that include non-peptidyl bonds can be used to link amino acid residues of a chimeric polypeptide provided herein as describedelsewhere (See, e.g., Spatola et al., Life Sci., 38:1243 (1986); Spatola, Vega Data, 1(3)(1983); Morley, Trends Pharm. Sci., 463-468 (1980); Hudson et al., Int. J. Pept. Prot.Res., 14:177 (1979); Spatola, in Chemistry and Biochemistry of Amino Acid Peptidesand Proteins, B. Weinstein, ed., Marcel Dekker, New York, p. 267 (1983); Hann, J.Chem. Soc. Perkin Trans., 1:307 (1982); Almquist et al., J. Med. Chem.23:1392 (1980);Jennings-White et al., Tetrahedron Lett., 23:2533 (1982); European Patent ApplicationEP 45665; Holladay et al., Tetrahedron Lett., 24:4401 (1983); and Hruby, Life Sci.,31:189 (1982). In some cases, a chimeric polypeptide provided herein can have an amino acid sequence with at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) sequence identity to a reference sequence (e.g., SEQ ID NO:1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, or 61). Percent sequence identity is calculated by determining the number of matched positions in aligned amino acid sequences (target amino acid sequence aligned to an identified amino acid sequence), dividing the number of matched positions by the number of amino acids of the identified amino acid sequence (e.g., SEQ ID NO:3), and multiplying by 100. A matched position refers to a position in which identical amino acids occur at the same position in aligned amino acid sequences. Percent sequence identity also can be determined for any nucleic acid sequence. Percent sequence identity is determined by comparing a target amino acid sequence to the identified amino acid sequence (e.g., SEQ ID NO:3) using the BLAST 2 Sequences (Bl2seq) program from the stand-alone version of BLASTZ containing BLASTN version 2.0.14 and BLASTP version 2.0.14. This stand-alone version of BLASTZ can be obtained on the World Wide Web from Fish & Richardson’s web site (fr.com / blast) or the U.S. government’s National Center for Biotechnology Information web site (ncbi.nlm.nih.gov). Instructions explaining how to use the Bl2seq program can be found in the readme file accompanying BLASTZ. Attorney Docket No.07039-2196WO1 Bl2seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. To compare two nucleic acid sequences, the options are set as follows: -i is set to a file containing the first nucleicacid sequence to be compared (e.g., C:\seq1.txt); -j is set to a file containing the secondnucleic acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastn; -o is set toany desired file name (e.g., C:\output.txt); -q is set to -1; -r is set to 2; and all otheroptions are left at their default setting. The following command will generate an output file containing a comparison between two sequences: C:\Bl2seq -i c:\seq1.txt -j c:\seq2.txt -p blastn -o c:\output.txt -q -1 -r 2. If the target sequence shares homology with any portion of the identified sequence, then the designated output file will present those regions of homology as aligned sequences. If the target sequence does not share homology with any portion of the identified sequence, then the designated output file will not present aligned sequences. For example, if (1) a target sequence is compared to the sequence set forth in SEQ ID NO:3 and (2) the Bl2seq program presents the target sequence aligned with a region of the sequence set forth in SEQ ID NO:3 with the number of matches being 15, then the amino acid target sequence has a percent identity to SEQ ID NO:3 that is 88.2 (i.e., 15 ÷ 17 x 100 = 88.2). It is noted that the percent identity value is rounded to the nearest tenth. For example, 78.11, 78.12, 78.13, and 78.14 are rounded down to 78.1, while 78.15, 78.16, 78.17, 78.18, and 78.19 are rounded up to 78.2. It also is noted that the length value will always be an integer. A chimeric polypeptide provided herein can be produced using any suitable method, including solid phase synthesis, and can be generated using manual techniques or automated techniques (e.g., using an Applied BioSystems (Foster City, CA) Peptide Synthesizer or a Biosearch Inc. (San Rafael, CA) automatic peptide synthesizer). Disulfide bonds between cysteine residues can be introduced by mild oxidation of the linear polypeptides using KCN as described elsewhere (U.S. Patent No.4,757,048). In some cases, a chimeric polypeptide provided herein can be produced recombinantly, as described herein. In some cases, a chimeric polypeptide provided herein can be a substantially pure polypeptide. As used herein, the term “substantially pure” with reference to a polypeptide means that the polypeptide is substantially free of other polypeptides, Attorney Docket No.07039-2196WO1 lipids, carbohydrates, and nucleic acid. In some cases, a substantially pure polypeptide can be a polypeptide that is at least 60 percent pure or is any chemically synthesized polypeptide. A substantially pure polypeptide can be at least about 60, 65, 70, 75, 80, 85, 90, 95, or 99 percent pure. Typically, a substantially pure polypeptide will yield a single major band on a non-reducing polyacrylamide gel. Salts of carboxyl groups of a chimeric polypeptide provided herein can be prepared by contacting the polypeptide with one or more equivalents of a desired base such as, for example, a metallic hydroxide base (e.g., sodium hydroxide), a metal carbonate or bicarbonate base (e.g., sodium carbonate or sodium bicarbonate), or an amine base (e.g., triethylamine, triethanolamine, and the like). Acid addition salts of a chimeric polypeptide provided herein can be prepared by contacting the polypeptide with one or more equivalents of an inorganic or organic acid (e.g., hydrochloric acid). Esters of carboxyl groups of a chimeric polypeptide provided herein can be prepared using any suitable means for converting a carboxylic acid or precursor to an ester. For example, one method for preparing esters of a chimeric polypeptide provided herein, when using the Merrifield synthesis technique, is to cleave the completed polypeptide from the resin in the presence of the desired alcohol under either basic or acidic conditions, depending upon the resin. The C-terminal end of the polypeptide then can be directly esterified when freed from the resin, without isolation of the free acid. Amides of a chimeric polypeptide provided herein can be prepared using techniques for converting a carboxylic acid group or precursor to an amide. One method for amide formation at the C-terminal carboxyl group includes cleaving the polypeptide from a solid support with an appropriate amine, or cleaving in the presence of an alcohol, yielding an ester, followed by aminolysis with the desired amine. N-acyl derivatives of an amino group of a chimeric polypeptide provided herein can be prepared by utilizing an N-acyl protected amino acid for the final condensation, or by acylating a protected or unprotected polypeptide. O-acyl derivatives can be prepared for example, by acylation of a free hydroxy peptide or peptide resin. Either acylation may be carried out using standard acylating reagent such as acyl halides, anhydrides, acyl imidazoles, and the like. Both N- and O-acylation may be carried out together, if desired. Attorney Docket No.07039-2196WO1 In some cases, a chimeric polypeptide provided herein can be modified bylinkage to a polymer such as polyethylene glycol (PEG), or by fusion to another polypeptide such as albumin, for example. For example, one or more PEG moieties can be conjugated to a chimeric polypeptide provided herein via lysine residues. Linkage to PEG or another suitable polymer, or fusion to albumin or another suitable polypeptide can result in a modified chimeric polypeptide having an increased half life as compared to an unmodified chimeric polypeptide. Without being bound by a particular mechanism, an increased serum half life can result from reduced proteolytic degradation, immune recognition, or cell scavanging of the modified chimeric polypeptide. Any appropriate method can be used to modify a chimeric polypeptide by linkage to PEG (also referred to as “PEGylation”) or other polymers including, withoutlimitation, those described elsewhere (U.S. Patent No. 6,884,780; Cataliotti et al.,Trends Cardiovasc. Med., 17:10-14 (2007); Veronese and Mero, BioDrugs, 22:315-329(2008); Miller et al., Bioconjugate Chem., 17:267-274 (2006); and Veronese and Pasut,Drug Discov. Today, 10:1451-1458 (2005). Examples of methods for modifying a chimeric polypeptide by fusion to albumin include, without limitation, those describedelsewhere (U.S. Patent Publication No. 20040086976, and Wang et al., Pharm. Res.,21:2105-2111 (2004)). The polypeptide comprises, or consists essentially of, in an order from amino terminus to carboxy terminus, (a) the sequence set forth in SEQ ID NO:2 or the sequence set forth in SEQ ID NO:2 with no more than three additions, subtractions, or substitutions, (b) the sequence set forth in SEQ ID NO:3 or the sequence set forth in SEQ ID NO:3 with no more than five additions, subtractions, or substitutions, and (c) the sequence set forth in SEQ ID NO:1 or the sequence set forth in SEQ ID NO:1 with no more than two additions, subtractions, or substitutions. The polypeptide comprises, or consists essentially of, in an order from amino terminus to carboxy terminus, (a) the sequence set forth in SEQ ID NO:4 or the sequence set forth in SEQ ID NO:4 with no more than three additions, subtractions, or substitutions, (b) the sequence set forth in SEQ ID NO:5 or the sequence set forth in SEQ ID NO:5 with no more than five additions, subtractions, or substitutions, and (c) the sequence set forth in SEQ ID NO:1 or the sequence set forth in SEQ ID NO:1 with no more than two additions, subtractions, or substitutions. Attorney Docket No.07039-2196WO1 The polypeptide comprises, or consists essentially of, in an order from amino terminus to carboxy terminus, (a) the sequence set forth in SEQ ID NO:6 or the sequence set forth in SEQ ID NO:6 with no more than three additions, subtractions, or substitutions, (b) the sequence set forth in SEQ ID NO:7 or the sequence set forth in SEQ ID NO:7 with no more than five additions, subtractions, or substitutions, and (c) the sequence set forth in SEQ ID NO:1 or the sequence set forth in SEQ ID NO:1 with no more than two additions, subtractions, or substitutions. The polypeptide comprises, or consists essentially of, in an order from amino terminus to carboxy terminus, (a) the sequence set forth in SEQ ID NO:8 or the sequence set forth in SEQ ID NO:8 with no more than three additions, subtractions, or substitutions, (b) the sequence set forth in SEQ ID NO:9 or the sequence set forth in SEQ ID NO:9 with no more than five additions, subtractions, or substitutions, and (c) the sequence set forth in SEQ ID NO:1 or the sequence set forth in SEQ ID NO:1 with no more than two additions, subtractions, or substitutions. The polypeptide comprises, or consists essentially of, in an order from amino terminus to carboxy terminus, (a) the sequence set forth in SEQ ID NO:10 or the sequence set forth in SEQ ID NO:10 with no more than three additions, subtractions, or substitutions, (b) the sequence set forth in SEQ ID NO:11 or the sequence set forth in SEQ ID NO:11 with no more than five additions, subtractions, or substitutions, and (c) the sequence set forth in SEQ ID NO:1 or the sequence set forth in SEQ ID NO:1 with no more than two additions, subtractions, or substitutions. The polypeptide comprises, or consists essentially of, in an order from amino terminus to carboxy terminus, (a) the sequence set forth in SEQ ID NO:1 or the sequence set forth in SEQ ID NO:1 with no more than two additions, subtractions, or substitutions, (b) the sequence set forth in SEQ ID NO:2 or the sequence set forth in SEQ ID NO:2 with no more than five additions, subtractions, or substitutions, and (c) the sequence set forth in SEQ ID NO:12 or the sequence set forth in SEQ ID NO:12 with no more than two additions, subtractions, or substitutions. The polypeptide comprises, or consists essentially of, in an order from amino terminus to carboxy terminus, (a) the sequence set forth in SEQ ID NO:1 or the sequence set forth in SEQ ID NO:1 with no more than two additions, subtractions, or substitutions, and (b) the sequence set forth in SEQ ID NO:12 or the sequence set forth in SEQ ID NO:12 with no more than two additions, subtractions, or substitutions. Attorney Docket No.07039-2196WO1 The polypeptide comprises, or consists essentially of, in an order from amino terminus to carboxy terminus, (a) the sequence set forth in SEQ ID NO:1 or the sequence set forth in SEQ ID NO:1 with no more than two additions, subtractions, or substitutions, and (b) the sequence set forth in SEQ ID NO:13 or the sequence set forth in SEQ ID NO:13 with no more than two additions, subtractions, or substitutions. The polypeptide comprises, or consists essentially of, in an order from amino terminus to carboxy terminus, (a) the sequence set forth in SEQ ID NO:1 or the sequence set forth in SEQ ID NO:1 with no more than two additions, subtractions, or substitutions, and (b) the sequence set forth in SEQ ID NO:30 or the sequence set forth in SEQ ID NO:30 with no more than five additions, subtractions, or substitutions. The polypeptide comprises, or consists essentially of, in an order from amino terminus to carboxy terminus, (a) the sequence set forth in SEQ ID NO:12 or the sequence set forth in SEQ ID NO:12 with no more than two additions, subtractions, or substitutions, and (b) the sequence set forth in SEQ ID NO:1 or the sequence set forth in SEQ ID NO:1 with no more than two additions, subtractions, or substitutions. The polypeptide comprises, or consists essentially of, in an order from amino terminus to carboxy terminus, (a) the sequence set forth in SEQ ID NO:13 or the sequence set forth in SEQ ID NO:13 with no more than two additions, subtractions, or substitutions, and (b) the sequence set forth in SEQ ID NO:1 or the sequence set forth in SEQ ID NO:1 with no more than two additions, subtractions, or substitutions. The polypeptide comprises, or consists essentially of, in an order from amino terminus to carboxy terminus, (a) the sequence set forth in SEQ ID NO:30 or the sequence set forth in SEQ ID NO:30 with no more than five additions, subtractions, or substitutions, and (b) the sequence set forth in SEQ ID NO:1 or the sequence set forth in SEQ ID NO:1 with no more than two additions, subtractions, or substitutions. The polypeptide comprises, in an order from amino terminus to carboxy terminus (a) the sequence set forth in SEQ ID NO:1 or the sequence set forth in SEQID NO:1 with no more than two additions, subtractions, or substitutions, and (b) thesequence set forth in SEQ ID NO:7 or the sequence set forth in SEQ ID NO:7 with no more than five additions, subtractions, or substitutions. The polypeptide comprises, or consists essentially of, in an order from aminoterminus to carboxy terminus, (a) the sequence set forth in SEQ ID NO:36 or thesequence set forth in SEQ ID NO:36 with no more than five additions, subtractions, or Attorney Docket No.07039-2196WO1 substitutions, and (b) the sequence set forth in SEQ ID NO:1 or the sequence set forth in SEQ ID NO:1 with no more than two additions, subtractions, or substitutions. The polypeptide comprises, or consists essentially of, in an order from amino terminus to carboxy terminus, (a) the sequence set forth in SEQ ID NO:1 or the sequence set forth in SEQ ID NO:1 with no more than two additions, subtractions, or substitutions, and (b) the sequence set forth in SEQ ID NO:36 or the sequence set forth in SEQ ID NO:36 with no more than five additions, subtractions, or substitutions. The polypeptide comprises, or consists essentially of, in an order from amino terminus to carboxy terminus, (a) the sequence set forth in SEQ ID NO:7 or the sequence set forth in SEQ ID NO:7 with no more than five additions, subtractions, or substitutions, and (b) the sequence set forth in SEQ ID NO:1 or the sequence set forth in SEQ ID NO:1 with no more than two additions, subtractions, or substitutions. The polypeptide comprises, or consists essentially of, in an order from amino terminus to carboxy terminus, (a) the sequence set forth in SEQ ID NO:2, the sequenceset forth in SEQ ID NO:4, the sequence set forth in SEQ ID NO:6, the sequence setforth in SEQ ID NO:8, the sequence set forth in SEQ ID NO:10, the sequence set forth in SEQ ID NO:2 with no more than three additions, subtractions, or substitutions, the sequence set forth in SEQ ID NO:4 with no more than three additions, subtractions, or substitutions, the sequence set forth in SEQ ID NO:6 with no more than three additions, subtractions, or substitutions, the sequence set forth in SEQ ID NO:8 with no more than three additions, subtractions, or substitutions, or the sequence set forth in SEQ ID NO:10 with no more than three additions, subtractions, or substitutions, (b) thesequence set forth in SEQ ID NO:3, the sequence set forth in SEQ ID NO:5, thesequence set forth in SEQ ID NO:7, the sequence set forth in SEQ ID NO:9, thesequence set forth in SEQ ID NO:11, the sequence set forth in SEQ ID NO:3 with no more than five additions, subtractions, or substitutions, the sequence set forth in SEQ ID NO:5 with no more than five additions, subtractions, or substitutions, the sequence set forth in SEQ ID NO:7 with no more than five additions, subtractions, or substitutions, the sequence set forth in SEQ ID NO:9 with no more than five additions, subtractions, or substitutions, or the sequence set forth in SEQ ID NO:11 with no more than five additions, subtractions, or substitutions, and (c) the sequence set forth in SEQ ID NO:1 or the sequence set forth in SEQ ID NO:1 with no more than two additions, subtractions, or substitutions. Attorney Docket No.07039-2196WO1 The polypeptide can comprise the sequence set forth in SEQ ID NO:2, 4, 6, 8, or 10. The polypeptide can comprise the sequence set forth in SEQ ID NO:3, 5, 7, 9,or 11. The polypeptide can comprise the sequence set forth in SEQ ID NO:1. Thepolypeptide can comprise the sequence set forth in SEQ ID NO:43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, or 59 with no more than five additions, subtractions, or substitutions. The polypeptide can be from 17 to 50 amino acid residues, from 17 to 45 amino acid residues, from 17 to 40 amino acid residues, from 17 to 35 amino acid residues, from 10 to 14 amino acid residues, from 10 to 16 amino acid residues, from 19 to 25 amino acid residues, from 20 to 28 amino acid residues, from 20 to 50 amino acid residues, from 25 to 50 amino acid residues, from 20 to 45 amino acid residues, from 20 to 40 amino acid residues, from 20 to 35 amino acid residues, from 25 to 45 amino acid residues, from 25 to 40 amino acid residues, or from 25 to 35 amino acid residues, in length. In some embodiments, the present disclosure provides NPA7 peptide as shown, e.g., in figure 21B, with no more than two additions, subtractions, or substitutions. Methods of use In some embodiments, this disclosure provides methods for treating diseases, disorders, or conditions in which oxidative stress is implicated in pathology. In some embodiments, this disclosure provides methods for treating diseases, disorders, orconditions which are responsive to activation of Nrf2 pathway (e.g., reduction ofoxidative stress by activation of Nrf2 pathway). In some embodiments, the oxidative stress is in an organ or tissue selected from epithelial tissue, mucosal tissue, connective tissue, muscle tissue, skin tissue, fibrous tissue, vascular tissue, and nervous tissue. In some embodiments, the organ or tissue affected by the oxidative stress is selected from lung, stomach, intestines, liver, bladder, gallbladder, eye, skin, gland (e.g., pancreas, thyroid, prostate, or adrenal), brain, colon, lymph node, spleen, muscle, or bone. In some embodiments, the organ or tissue affected by the oxidative stress is heart, blood vessel, and / or kidney. In some embodiments, the organ or tissue affected by the oxidative stress is not heart, blood vessel, and / or kidney. In some embodiments, the present disclosure provides a method of protecting an organ or tissue from oxidative damage (e.g., any of the organs described herein). Any of the methods of this disclosure may comprise administering to a subject (e.g., subject in need to treatment) a Attorney Docket No.07039-2196WO1 therapeutically effective amount of a polypeptide of this disclosure, or a pharmaceutically acceptable salt thereof (e.g., NPA7). In some embodiments, the method includes a step of identifying a subject as having the disorder or condition. In one example, the method includes diagnosing a subject with the disorder or condition or identifying a subject as being diagnosed with the disorder or condition. In some embodiments, the step of identifying the subject is carried out before the step of administering the peptide or the polypeptide (e.g., NPA7) to the subject. In some embodiments, provided herein is a method of treating a disease, disorder, or condition responsive to reduction of oxidative stress in an organ or tissue affected by pathology of the disease, disorder, or condition, the method comprising: (i) identifying a subject diagnosed with the disease, disorder, or conditionresponsive to reduction of oxidative stress in the organ or tissue affected by pathology of the disease, disorder, or condition, wherein the organ or tissue affected by the oxidative stress is selected from lung, stomach, intestines, liver, bladder, gallbladder, eye, skin, gland brain, colon, lymph node, spleen, muscle, and bone; and (ii) after (i), administering to the subject a therapeutically effective amount of apolypeptide NPA7 with no more than two additions, subtractions, or substitutions, or a pharmaceutically acceptable salt thereof. In some embodiments, provided herein is a method of activating a KEAP1-NRF2 pathway in a subject,. the method comprising administering to the subject a therapeutically effective amount of a polypeptide NPA7 with no more than two additions, subtractions, or substitutions, or a pharmaceutically acceptable salt thereof. In some embodiments, provided herein is a method of inducing KEAP1 degradation and NRF2 activation in a subject, the method comprising administering to the subject a therapeutically effective amount of a polypeptide NPA7 with no more than two additions, subtractions, or substitutions, or a pharmaceutically acceptable salt thereof. In some embodiments, provided herein is a method of inhibiting oxidative stress in a subject, Attorney Docket No.07039-2196WO1 the method comprising administering to the subject a therapeutically effective amount of a polypeptide NPA7 with no more than two additions, subtractions, or substitutions, or a pharmaceutically acceptable salt thereof. In some more particular embodiments, the method is a method of inhibiting oxidative stress in the left ventricle of the subject. In some more particular embodiments, the method is a method of inhibiting oxidative stress in the liver of the subject. In some more particular embodiments, the method is a method of inhibiting oxidative stress in the lung of the subject. In some embodiments, the disease or disorder is an inflammatory disease (e.g., in which oxidative stress is implicated in pathology) is selected from the group diabetes (e.g., diabetes mellitus, type 2 diabetes), cancer, rheumatoid arthritis, colitis, ulcerative colitis, asthma, allergic asthma, fatty liver disease, obesity, insulin resistance, inflammatory diseases of the liver and gut, steatohepatitis, liver inflammation, autoimmune diseases, atherosclerosis, hyperlipidemia, dyslipidemia, rhinitis, conjunctivitis, oral inflammation, thyroid disease, lung disease, inflammatory bowel disease (IBD), Crohn’s disease, ankylosing spondylitis, psoriasis, and chronic obstructive airways disease. In some embodiments, the disease or disorder is a neurodegenerative disorder selected from Alzheimer’s disease, Parkinson’s disease, Motor neuron disease, dementia, dementia associated with Alzheimer’s disease, dementia with Lewy bodies, mild cognitive impairment (MCI), a memory impairment, amyotrophic lateral sclerosis, multiple sclerosis, multiple system atrophy epilepsy, Bell’s palsy, and cerebral palsy. In some embodiments, the disorder is a disorder associated with aging selected from age-related anxiety, anemia, arteriosclerosis, balance disorder, bone marrow failure, breathlessness, cachexia, chronic infection, cirrhosis, deafness, emphysema, failure to thrive, frailty, gastrointestinal ulcer, generalized anxiety disorder, gout, hair loss, hearing loss, hepatic insufficiency, high fat, hypercholesterolemia, hyperglycemia, hyperhomocysteinemia, hyperlipidemia, immunosenescence, impaired mobility, loss of appetite, loss of bone density, loss of sense of taste, metabolic syndrome, muscle loss, muscle wasting, muscular dystrophy, organ dysfunction, osteoporosis, peripheral artery disease, peripheral vascular disease, pneumonia secondary to impaired immune function, pulmonary disease, pulmonary emphysema, pulmonary fibrosis, reduced fitness, scoliosis, spinal stenosis, syndrome X, tinnitus, urinary incontinence, vertebral Attorney Docket No.07039-2196WO1 fracture, weight loss, osteoarthritis, rheumatoid arthritis, sarcopenia, hypertension, atherosclerosis, interstitial lung disease, age-related decline in cognitive function, age- related decline in cardiopulmonary function, age-related decline in muscle strength, age-related decline in vision, and age-related decline in hearing. In some embodiments, the cancer is selected from bladder cancer, brain cancer, breast cancer, colorectal cancer, cervical cancer, gastrointestinal cancer, genitourinary cancer, head and neck cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cancer, skin cancer, and testicular cancer. In some embodiments, suitable examples of cancers treatable or preventable by the compounds and methods of this disclosure include bladder cancer, blood vessel cancer, brain cancer, breast cancer, colorectal cancer, cervical cancer, gastrointestinal cancer, genitourinary cancer, head and neck cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cancer, skin cancer, and testicular cancer. In some embodiments, the cancer is selected from sarcoma, angiosarcoma, fibrosarcoma, rhabdomyosarcoma, liposarcoma, myxoma, rhabdomyoma, fibroma, lipoma, teratoma, lung cancer, bronchogenic carcinoma squamous cell, undifferentiated small cell, undifferentiated large cell, adenocarcinoma, alveolar bronchiolar carcinoma, bronchial adenoma, sarcoma, lymphoma, chondromatous hamartoma, mesothelioma, gastrointestinal cancer, cancer of the esophagus, squamous cell carcinoma, adenocarcinoma, lymphoma, cancer of the stomach, carcinoma, lymphoma, leiomyosarcoma, cancer of the pancreas, ductal adenocarcinoma, insulinoma, glucagonoma, gastrinoma, carcinoid tumor, vipoma, cancer of the small bowel, adenocarcinoma, lymphoma, carcinoid tumors, Kaposi’s sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma, fibroma, cancer of the large bowel or colon, tubular adenoma, villous adenoma, hamartoma, leiomyoma, genitourinary tract cancer , cancer of the kidney adenocarcinoma, Wilm’s tumor (nephroblastoma), cancer of the bladder, cancer of the urethra, squamous cell carcinoma, transitional cell carcinoma, cancer of the prostate, cancer of the testis, seminoma, teratoma, embryonal carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, interstitial cell carcinoma, fibroma, fibroadenoma, adenomatoid tumors, lipoma, liver cancer, hepatoma hepatocellular carcinoma, cholangiocarcinoma, hepatoblastoma, angiosarcoma, hepatocellular adenoma, hemangioma, bone cancer, osteogenic sarcoma (osteosarcoma), fibrosarcoma, malignant fibrous histiocytoma, chondrosarcoma, Ewing’s sarcoma, malignant lymphoma (reticulum cell sarcoma), Attorney Docket No.07039-2196WO1 malignant giant cell tumor, chordoma, osteochrondroma (osteocartilaginous exostoses), benign chondroma, chondromyxofibroma, osteoid osteoma giant cell tumor, nervous system cancer, cancer of the skull, osteoma, hemangioma, granuloma, xanthoma, osteitis deformans, cancer of the meninges meningioma, meningiosarcoma, gliomatosis, cancer of the brain, astrocytoma, medulloblastoma, glioma, ependymoma, germinoma (pinealoma), glioblastoma multiforme, oligodendroglioma, schwannoma, retinoblastoma, congenital tumors, cancer of the spinal cord, neurofibroma, meningioma, glioma, sarcoma, gynecological cancer, cancer of the uterus, endometrial carcinoma, cancer of the cervix, cervical carcinoma, pre tumor cervical dysplasia, cancer of the ovaries, ovarian carcinoma, serous cystadenocarcinoma, mucinous cystadenocarcinoma, unclassified carcinoma, granulosa-theca cell tumor, Sertoli Leydig cell tumor, dysgerminoma, malignant teratoma, cancer of the vulva, squamous cell carcinoma, intraepithelial carcinoma, adenocarcinoma, fibrosarcoma, melanoma, cancer of the vagina, clear cell carcinoma, squamous cell carcinoma, botryoid sarcoma, embryonal rhabdomyosarcoma, cancer of the fallopian tubes, hematologic cancer, cancer of the blood, lymphoma, leukemia, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL), chronic lymphoblastic leukemia, chronic lymphocytic leukemia, myeloproliferative diseases, multiple myeloma, myelodysplastic syndrome, Hodgkin’s lymphoma, non-Hodgkin’s lymphoma (malignant lymphoma), Waldenstrom’s macroglobulinemia, skin cancer, malignant melanoma, basal cell carcinoma, squamous cell carcinoma, Kaposi’s sarcoma, moles dysplastic nevi, lipoma, angioma, dermatofibroma, keloids, adrenal gland cancer, and neuroblastoma. Compositions, formulations, and routes of administration A chimeric peptide (e.g., polypeptide) provided herein (e.g., a chimeric peptide or polypeptide as set forth in any one of Figures 2-20, 21B, and 23-32), can be incorporated into a composition for administration to a mammal. Methods for formulating and subsequently administering therapeutic compositions are well known to those in the art. Dosages typically are dependent on the responsiveness of the subject to the compound, with the course of treatment lasting from several days to several months, or until a suitable response is achieved. Persons of ordinary skill in the art routinely determine optimum dosages, dosing methodologies, and repetition rates. Attorney Docket No.07039-2196WO1 Optimum dosages can vary depending on the relative potency of a chimeric polypeptide, and generally can be estimated based on the EC50found to be effective inin vitro and / or in vivo animal models. Compositions containing a chimeric polypeptideprovided herein or a nucleic acid provided herein may be given once or more daily, weekly, monthly, or even less often, or can be administered continuously for a period of time (e.g., hours, days, or weeks). For example, a chimeric polypeptide provided herein or a composition containing a chimeric polypeptide provided herein can be administered to a patient at a dose of at least about 0.01 ng polypeptide / kg to about 100mg polypeptide / kg of body mass at or about the time of reperfusion, or can beadministered continuously as an infusion beginning at or about the time of reperfusion and continuing for one to seven days (e.g., at a dose of about 0.01 ngpolypeptide / kg / minute to about 0.5 g polypeptide / kg / minute).The chimeric polypeptides or nucleic acids can be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecular structures, ormixtures of compounds such as, for example, liposomes, receptor or cell targetedmolecules, or oral, topical or other formulations for assisting in uptake, distribution and / or absorption. In some embodiments, a composition can contain a chimeric polypeptide provided herein in combination with a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include, for example, pharmaceutically acceptable solvents, suspending agents, or any other pharmacologically inert vehicles for delivering antibodies to a subject. Pharmaceutically acceptable carriers can be liquid or solid, and can be selected with the planned manner of administration in mind so as to provide for the desired bulk, consistency, and other pertinent transport and chemical properties, when combined with one or more therapeutic compounds and any other components of a given pharmaceutical composition. Typical pharmaceutically acceptable carriers include, without limitation: water; saline solution; binding agents (e.g., polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose or dextrose and other sugars, gelatin, or calcium sulfate); lubricants (e.g., starch, polyethylene glycol, or sodium acetate); disintegrates (e.g., starch or sodium starch glycolate); and wetting agents (e.g., sodium lauryl sulfate). Pharmaceutical compositions containing a chimeric polypeptide provided herein can be administered by a number of methods, depending upon whether local or Attorney Docket No.07039-2196WO1 systemic treatment is desired. Administration can be, for example, parenteral (e.g., by subcutaneous, intrathecal, intraventricular, intramuscular, or intraperitoneal injection, or by intravenous (i.v.) drip); oral; topical (e.g., transdermal, sublingual, ophthalmic, or intranasal); or pulmonary (e.g., by inhalation or insufflation of powders or aerosols), orcan occur by a combination of such methods. Administration can be rapid (e.g., byinjection) or can occur over a period of time (e.g., by slow infusion or administration of slow release formulations). Compositions and formulations for parenteral, intrathecal or intraventricular administration include sterile aqueous solutions (e.g., sterile physiological saline), which also can contain buffers, diluents and other suitable additives (e.g., penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers). Compositions and formulations for oral administration include, for example, powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Such compositions also can incorporate thickeners, flavoring agents, diluents, emulsifiers, dispersing aids, or binders. Pharmaceutical compositions include, but are not limited to, solutions, emulsions, aqueous suspensions, and liposome-containing formulations. These compositions can be generated from a variety of components that include, for example, preformed liquids, self-emulsifying solids and self-emulsifying semisolids. Emulsion formulations are particularly useful for oral delivery of therapeutic compositions due to their ease of formulation and efficacy of solubilization, absorption, and bioavailability. Liposomes can be particularly useful due to their specificity and the duration of action they offer from the standpoint of drug delivery. Compositions additionally can contain other adjunct components conventionally found in pharmaceutical compositions. Thus, the compositions also can include compatible, pharmaceutically active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or additional materials useful in physically formulating various dosage forms of the compositions, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents, and stabilizers. Furthermore, the composition can be mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings, penetration enhancers, and aromatic substances. When added, however, such materials should not unduly interfere Attorney Docket No.07039-2196WO1 with the biological activities of the other components within the compositions (e.g., a chimeric polypeptide provided herein). In some cases, a chimeric polypeptide provided herein can be formulated as a sustained release dosage form. In some cases, coatings, envelopes, or protective matrices can be formulated to contain one or more of the chimeric polypeptides provided herein. Such coatings, envelopes, and protective matrices can be used to coat indwelling devices such as stents, catheters, and peritoneal dialysis tubing. In some cases, a chimeric polypeptide provided herein can be incorporated into a polymeric substances, liposomes, microemulsions, microparticles, nanoparticles, or waxes. Pharmaceutical formulations as disclosed herein, which can be presented conveniently in unit dosage form, can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association an active ingredient (e.g., a chimeric polypeptide provided herein) with the desired pharmaceutical carrier(s). Typically, the formulations can be prepared by uniformly and intimately bringing an active ingredient into association with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product. Formulations can be sterilized if desired, provided that the method of sterilization does not interfere with the effectiveness of the molecules(s) contained in the formulation (e.g., a chimeric polypeptide provided herein). In some embodiments, a chimeric polypeptide provided herein or a composition containing a chimeric polypeptide provided herein can be administered at a dose of at least about 0.01 ng polypeptide / kg to about 100 mg polypeptide / kg of body mass (e.g., about 10 ng polypeptide / kg to about 50 mg polypeptide / kg, about 20 ng polypeptide / kg to about 10 mg polypeptide / kg, about 0.1 ng polypeptide / kg to about 20 ng polypeptide / kg, about 3 ng polypeptide / kg to about 10 ng polypeptide / kg, or about 50ng polypeptide / kg to about 100 g / kg) of body mass, although other dosages also mayprovide beneficial results. In some cases, a chimeric polypeptide provided herein or a composition containing a chimeric polypeptide provided herein can be administered as a continuous intravenous infusion beginning at or about the time of reperfusion (i.e., at the time the occluded artery is opened), and continuing for one to seven days (e.g., one, two, three, four, five, six, or seven days). Such a composition can be administered at a dose of, for example, about 0.1 ng polypeptide / kg / minute to about 500 ng polypeptide / kg / minute (e.g., about 0.5 ng polypeptide / kg / minute, about 1 ng Attorney Docket No.07039-2196WO1 polypeptide / kg / minute, about 2 ng polypeptide / kg / minute, about 3 ng polypeptide / kg / minute, about 5 ng polypeptide / kg / minute, about 7.5 ng polypeptide / kg / minute, about 10 ng polypeptide / kg / minute, about 12.5 ng polypeptide / kg / minute, about 15 ng polypeptide / kg / minute, about 20 ng polypeptide / kg / minute, about 25 ng polypeptide / kg / minute, about 30 ng polypeptide / kg / minute, about 50 ng polypeptide / kg / minute, about 100 ng polypeptide / kg / minute, or about 300 ng polypeptide / kg / minute). In some embodiments, a chimeric polypeptide provided herein or a composition containing a chimeric polypeptide provided herein can be administered before reperfusion (e.g., about one hour prior to reperfusion), either as one or more individual doses or as a continuous infusion beginning about one hour prior to reperfusion). For example, a composition can be administered beginning about one hour, about 45 minutes, about 30minutes, or about 15 minutes prior to reperfusion. In some cases, a chimericpolypeptide provided herein or a composition containing a chimeric polypeptide provided herein can be administered after reperfusion (e.g., within about ten hours of reperfusion), and can be administered either as one or more individual doses or as a continuous infusion beginning within about ten hours of reperfusion. For example, a chimeric polypeptide provided herein or a composition containing a chimeric polypeptide provided herein can be administered about one hour, about two hours, about three hours, about four hours, about five hours, about six hours, about seven hours, about eight hours, about nine hours, or about ten hours after reperfusion. In some embodiments, a chimeric polypeptide provided herein or a composition containing a chimeric polypeptide provided herein can be administered via a first route (e.g., intravenously) for a first period of time, and then can be administered via another route (e.g., topically or subcutaneously) for a second period of time. For example, a chimeric polypeptide provided herein or a composition containing a chimeric polypeptide provided herein can be intravenously administered to a mammal (e.g., a human) at a dose of about 0.1 ng polypeptide / kg / minute to about 300 ng polypeptide / kg / minute (e.g., about 1 ng polypeptide / kg / minute to about 15 ng polypeptide / kg / minute, about 3 ng polypeptide / kg / minute to about 10 ng polypeptide / kg / minute, or about 10 ng polypeptide / kg / minute to about 30 ng polypeptide / kg / minute) for one to seven days (e.g., one, two, three, four, five, six, or seven days), and subsequently can be subcutaneously administered to the mammal at a Attorney Docket No.07039-2196WO1 dose of about 10 ng polypeptide / kg / day to about 100 ng polypeptide / kg / day (e.g., about 10 ng polypeptide / kg / day, about 20 ng polypeptide / kg / day, about 25 ng polypeptide / kg / day, about 30 ng polypeptide / kg / day, about 50 ng polypeptide / kg / day, or about 100 ng polypeptide / kg / day) for five to 30 days (e.g., seven, 10, 14, 18, 21, 24, or 27 days). The methods provided herein can include administering to a mammal an effective amount of a chimeric polypeptide provided herein or a composition containing a chimeric polypeptide provided herein. As used herein, the term “effective amount” is an amount of a molecule or composition that is sufficient to alter one or more (e.g., one, two, three, four, five, six, seven, eight, nine, or ten) parameters indicative of inflammatory disorder or disorder in which oxidative stress is implicated in a mammalian recipient by at least 10% (e.g., 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100%). EXAMPLES Experimental Methods Cell culture experiments HEK293 cells (CLS Cat# 300192) were transfected with GC-A or MasR (cDNA clones from Origene, Rockville, MD) using Lipofectamine. Transfected cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum (FBS), 100 U / mL penicillin, 100 U / mL streptomycin, and 250 g / mLG418 (Geneticin) antibiotic. Human primary cardiomyocytes (HCMs; Catalog No.6200, Lot No. 6288) were obtained from PromoCell. HCMs were maintained andsubcultured according to the manufacturer’s protocols. Cells were cultured inDulbecco’s modified Eagle’s medium (DMEM; Hyclone) supplemented with 10% fetalbovine serum (FBS; Invitrogen), 100 IU / ml penicillin (Hyclone), and 100 g / mlstreptomycin (Hyclone), in an atmosphere of 95% air and 5% CO2. All cell lines have been tested negative for mycoplasma contamination. RNAi transfection siRNA transfections were performed using the Lipofectamine RNAiMAX Transfection Reagent (Invitrogen) according to the manufacturer’s instructions. The siRNAs, siGC-A, siMasR and sip62 were purchased from Invitrogen. Western blotting Attorney Docket No.07039-2196WO1 For immunoblotting, cell lysates were prepared using RIPA buffer (Millipore), supplemented with protease inhibitor cocktail (Roche). Then cell lysates werecentrifuged at 10,000 × g for 10 min at 4 °C to remove cell debris. After total proteinconcentration was assessed BCA Protein Assay Kit (Thermo), 20 g of protein wasdenatured and resolved by SDS / PAGE, then transferred to PVDF membranes (Millipore). The target proteins were immunoblotted with the specific antibodies. Chemiluminescent substrate (Millipore) was used for detecting the signaling intensity. For cytoplasm and nuclear protein separation, the Subcellular Protein Fractionation Kit (Thermo) was applied for distinguishing the cytoplasm and nuclear protein. Thecollected proteins were subjected for immunoblotting. The following primaryantibodies were used: anti-GCA (Cat#MAB48601, R&D System), anti-MasR (Cat#55113-1-AP, Proteintech), anti-KEAP1 (Cat#10503-2-AP, Proteintech), anti- NRF2 (Cat#16396-1-AP, Proteintech), anti-NOX2 (Cat#19013-1-AP, Proteintech),anti-G6PD (Cat# 66373-1-Ig, Proteintech), anti-LaminA / C (Cat#10298-1-AP,Proteintech), (anti-SQSTM1 / p62 (Cat#39749, Cell Signaling), anti-Phospho-SQSTM1 / p62 (Ser349) (Cat#16177, Cell Signaling) at 1:1000 dilution.RNA extraction, cDNA synthesis, and real-time quantitative PCR Total RNA was extracted from HCMs using the TRIzol Reagent (Invitrogen) accordingto the manufacturer’s instructions. cDNA was synthesized by using Superscript IIIFirst-Strand Synthesis System (Thermo Fisher Scientific, Waltham, MA, USA) using 1 g mRNA. Real-time reverse transcription PCR assays were conducted in 96-well plates using the LightCycler 480 Instrument (Roche, Wilmington, MA, USA). Levels of mRNA expression were normalized to glyceraldehyde 3-phosphate dehydrogenase(GAPDH). PCR primers used are listed in Table S1 herein.Immunofluorescence microscopy For DHE staining in HCMs, cells were grown on glass coverslips and added 5M dihydroethidium working solution, and then incubated at room temperature for 30minutes. For DHE staining in tissue, section slides were washed in PBS for 30 secondsand immediately placed in 5 M DHE staining solution. The slides were incubated for5-20 min at room temperature and avoided exposure to light. After DHE staining, thecells or the slides were washed twice with PBS and then detected by fluorescencemicroscope. For GFP-NRF2, cells were fixed with 4% paraformaldehyde for 20 min atroom temperature, followed by permeabilization with 0.1% Triton X-100 for 10 min. Attorney Docket No.07039-2196WO1Cells were then blocked with 3% BSA and immune-stained with GFP antibodies.Fluorescence images were acquired using Nikon TE2000-U with Metamorph software (Molecular Devices). GC-A and MasR activation in transfected HEK293 cells or human cardiomyocytes HEK293 cells overexpressing human GC-A were treated with or without NPA7(10 9, 10 8, 10 7 and 10 6 M) for 10 minutes to determine cGMP production (GC-Asecond messenger). HEK293 cells overexpressing human MasR were treated with orwithout NPA7 (10 9, 10 8, 10 7, 10 6, and 10 5 M) for 10 minutes to determine cAMPproduction (MasR second messenger). 70% to 80% confluent cells at passages 2 through 6 were used for experiments. For HCMs, 5 × 105of HCMs / well were grown in 6-well plates until 80 to 90% confluency and were then treated with PBS or NPA7 atdoses of 10 9, 10 8, or 10 6 M for 10 min at 37 °C. Afterward, cells were washed withPBS and lysed, sonicated, centrifuged, and the supernatants were extracted andreconstituted in 300 L 0.1 M HCl for cGMP or cAMP assay. The samples weremeasured using a commercial cGMP or cAMP ELISA kit (Enzo Life Sciences) as instructed by the manufacturer. GSH / GSSG ratio determination reduced and oxidized glutathione (GSH / GSSG) ratio were measured using a GSH-Glo Glutathione Assay kit (Promega), according to the manufacturers’ recommendations. Cell Viability Measurement HCMs were transfected with control siRNA (siNC) or siGC-A and siMasR for 24 hours. Then, HCMs were plated as triplicates in 96-well plates and pre-treated with NPA7 (10 µM) for 6 hours and then stimulated with H2O2 (400 µM ) for 48 hours at 37 °C. At indicated time, 10 µl of 12 mM 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT) were added to each well and incubated for another 4 h. After replacing the culture medium with Stop Solution (40 mM HCL inisopropanol; 100 µl / well), the absorbance were measured at 590 nm on a plate reader.Acute Study Protocol in Wistar Kyoto rats (WKYs) or Spontaneously Hypertensive Rats (SHRs) This study has been approved by the Mayo Clinic Institutional Animal Care and Use Committee (IACUC). The animals were housed in a room with a controlled temperature and a 12-h light-dark cycle and provided with food and water ad libitum. Attorney Docket No.07039-2196WO1 All rats were delivered by a commercial breeder (Charles River, USA). Wistar Kyoto rats (WKYs) or Spontaneously Hypertensive Rats (SHRs) (male, 14 weeks old, n=4 in each group) were anesthetized and maintained with 2% isoflurane. Rats were kept on heating pad at 37 °C for the entire experiment to maintain their body temperature. Polyethylene tubes (PE-50) were placed into a jugular vein for saline and peptides infusion and into a carotid artery for blood sampling. After the surgical setup, an initial infusion of 0.9% saline started at a fixed rate based on rat weight and allow to equilibrate for 45 min. After the 45 min equilibrium and another 5 min of recovery, infusion of saline control or peptide (NPA7) was initiated. Based on our preliminarytesting, NPA7 at 600 pmol / kg / min were chosen for the current protocol. The NPA7group of animals received combination of a single IV bolus of NPA7 and continuous NPA7 infusion for 60 minutes (Fig. 45). The control group of animals received combination of a single IV bolus of 0.9% normal saline and continuous saline infusion. The rats were euthanized by exsanguination. Left ventricle, liver and lung were collected, frozen and sectioned for ROS level assessment with DHE staining. Western blotting and qRT-PCR were performed on the collected tissues. Statistical analysisAll in vitro and in vivo data were presented as mean ± SEM. Statistical significance wasdetermined by unpaired Student’s t test, one-way, or two-way ANOVA, accordingly.Data analysis and visualization were conducted in GraphPad Prism 9 (GraphPadSoftware, La Jolla, CA). The statistical significance is indicated as **P < 0.05, and***P < 0.001.Table S1. Specific primer pairs used in this study. Attorney Docket No.07039-2196WO1 GSS _F GGGAGCCTCTTGCAGGATAAAGSS R GAATGGGGCATAGCTCACCAC Example 1 Results (Fig. 33A) showed that H2O2increased DHE staining intensity, which represents elevated intracellular ROS levels. However, treatment with NPA7 attenuated H2O2 induced ROS level upregulation. Notably, the effect of NPA7 is superior to BNP or Ang 1-7 alone. Moreover, NPA7 significantly rescued the H2O2 induced GSH / GSSG ratio reduction (Fig. 33B), better than BNP or Ang 1-7. Furthermore, H2O2leads to ahigh level of NOX2, however, NPA7 inhibited the mRNA levels of NOX2. NADPHand GSH are essential for oxidative stress defense. G6PD is the limiting enzyme of the PPP pathway, which is the main source of NADPH production. GCLC, GCLM and GSS are the key enzymes of GSH biosynthesis. A significant increase in the mRNA level of G6PD, GCLC, GCLM and GSS was observed when NPA7 was pretreated before H2O2(Fig.34A). As shown in Fig.34B, western blot indicated that the protein level of G6PD Attorney Docket No.07039-2196WO1 also increased with NPA7 treatment. The protein level of NRF2, which is the major antioxidant transcript factor, was elevated in the NPA7 treated cells. Preliminary data revealed that NPA7 attenuated H2O2 induced oxidative stress and GC-A or MasR enhanced the antioxidant capacity and activated Nrf2 in HCM cells. The transcription factor, NFE2- related factor 2 (Nrf2), is a master regulator of the expression levels of various antioxidant enzymes, including G6PD, GSS, GCLM. They are responsible for glutathione (GSH) and NADPH biosynthesis, which are essential antioxidant molecules in redox regulation. Example 2 GC-A or MasR enhances the antioxidant capacity and activates Nrf2 inHCMs. We used siGC-A or siMas1 to reduce GC-A or MasR expression in HCMs(Fig.35A and 35B). We examined the gene expression levels of antioxidant proteins, such as glucose-6-phosphate dehydrogenase (G6PD), glutathione synthetase (GSS) andglutamate-cysteine ligase modifier subunit (GCLM). We found that GC-A or MasRknockdown decreased the mRNA levels of these genes in HCMs (Fig.35C and 35D). Nuclear factor erythroid 2-related factor 2 (Nrf2) is a well-characterized cellular defense molecule against oxidative stress. G6PD, GSS and GCLM are the downstream targets of Nrf2. We further found that the protein levels of Nrf2 and its target geneG6PD were lower in GC-A or MasR-knockdown cells compared to control cells (Fig.35E and 35F), suggesting that GC-A or MasR regulates Nrf2 expression in HCMs. Our designer peptide NPA7 generates the second messengers cGMP andcAMP in vitro. We previously engineered NPA7 that simultaneously co-activates theprotective GC-A / cGMP and MasR / cAMP pathways. We tested the levels of the second messengers cGMP and cAMP in 293 overexpressed GC-A or MasR cells. Compared to no treatment, NPA7 significantly increasing concentrations of cGMP and cAMP production (Fig.36), supporting the ability of NPA7 to co-activate GC-A and MasR. NPA7 ameliorates H2O2-induced oxidative stress in HCMs. Based on theantioxidant capacity of GC-A or MasR, we therefore determined whether our designer peptide NPA7 has antioxidant function. Our results (Fig. 37) reports that H2O2increased DHE staining intensity, which represents elevated intracellular ROS levels. However, treatment with NPA7 attenuated H2O2induced ROS level upregulation, suggesting that NPA7 exerts antioxidant function in HCMs. Attorney Docket No.07039-2196WO1 Example 3. NPA7 regulates oxidative stress by targeting GC-A and MasR To investigate whether NPA7 rescued oxidative stress through GC-A and MasRreceptor, the siRNA transfection was successfully applied to knock down GC-A andMasR expression. As shown in Fig. 38A and 38B, the effect of NPA7 inhibition ofROS accumulation induced by H2O2 was obviously attenuated in loss of GC-A andMasR expression. Supporting this data, the elevation of cell viability by NPA7 in H2O2 treatment was not observed in GC-A and MasR knockdown cells (Fig. 38C).Furthermore, NPA7 lost the capacity to reverse H2O2-induced NOX2 upregulation inresponse to GC-A and MasR knockdown (Fig.38D). Taken together, NPA7 regulates cellular redox balance in cardiomyocytes under oxidative stress is GC-A and MasR- dependent. Example 4. NPA7 activates KEAP1-NRF2 pathway. NRF2 is known to function as an important transcription factor that translocates to the nucleus and induces the transcription of genes for antioxidant or detoxification proteins. To verify nuclear translocation of NRF2, HEK293 cells were transfected with GFP-tagged NRF2 (GFP-NRF2) with concomitant treatment of NPA7 for 24 h. Immunofluorescence analysis revealed that NPA7 increased the amount of NRF2 in the nucleus (Fig. 40A). To further examine whether NPA7 mediated the accumulation ofnuclear NRF2, HCMs were treated with 10 M NPA7 for 20 h and the nuclear fractionswere isolated. Immunoblot analysis showed that the nuclear amounts of NRF2 were increased (Fig.40B). This NPA7-induced translocation of NRF2 was accompanied byan upregulation of NRF2 target genes including G6PD, SOD2, GPX1, GSS, GCLM andGCLC in HCMs. (Fig. 40C). Previous research suggested that KEAP1 degradationrepresent a possible mechanism of NRF2 activation, we speculated that the effects of NPA7 on influencing NRF2 function might through KEAP1. HCMs were treated withNPA7 (10 M) for 20 hours. Western blotting results showed that KEAP1 protein levelsdecreased whereas NRF2 protein levels increased (Fig. 39A). We performed timecourse experiments in HCMs treated with NPA7 (10 M). KEAP1 protein and mRNAlevels were determined by western blotting and quantitative qRT-PCR assays, respectively. NPA7 reduced the abundance of KEAP1 protein in a time-dependent manner, whereas the amount of KEAP1 mRNA remained unaffected (Fig. 40D-F). Attorney Docket No.07039-2196WO1 Furthermore, NPA7 enhanced the NRF2 protein expression level and KEAP1degradation after H2O2 exposure (Fig. 39B). These results demonstrate that NPA7activates KEAP1-NRF2 pathway. Example 5. p62 is required for NPA7-induced KEAP1 degradation and NRF2 activation. The autophagy adaptor protein, p62, has recently been identified as being essential for NRF2 activation. It is reported that p62 phosphorylation (p-S349) activates the NRF2 pathway. GC-A or MasR knockdown upregulated KEAP1 protein level, while decreased p62 phosphorylation and NRF2 level (Fig. 41A and 41B). We also found that phosphorylation of p62 at Ser349 is significantly induced by NPA7 undernormal condition (Fig. 41C) or H2O2 incubation (Fig. 41D). To examine whetherNPA7-induced NRF2 activation is dependent on p62, HCMs were pretreated with small interfering RNA (siRNA) targeting p62 and then incubated with NPA7 (Fig. 41E). Western blot analysis indicated that NPA7-induced KEAP1 degradation was markedlyblocked in p62 knockdown HCMs compared to control cells (Fig. 41E and 41F).However, the levels of KEAP1 mRNAs were not changed in p62 knockdown HCM (Fig.41G). Correspondingly, we showed that a p62-deficiency downregulated NPA7-mediated induction of NRF2 target genes including G6PD, SOD2, GPX1, GSS andGCLC (Fig. 41H). Together, our observations suggest that NPA7 induced NRF2 activation is mediated by a p62-dependent pathway. Example 6. NPA7 inhibits oxidative stress in left ventricle of spontaneously hypertensive rat (SHR). Spontaneously hypertensive rats (SHR) are a well-established genetic animal model of cardiovascular diseases, which exhibit similar properties to human hypertension. It has been reported that the production of superoxide anions in aortic vessels is increased in spontaneously hypertensive rats (SHR). Notably, NRF2 has been reported as an important transcription factor for protecting cells from oxidative stress in SHR. To explore the antioxidant function of NPA7 as a potent NRF2 activator in the pathological setting, we examined the cardioprotection effects against oxidative stressof NPA7 in the heart of SHR model. Firstly, myocardial ROS production was assessed Attorney Docket No.07039-2196WO1by DHE staining of the left-ventricular sections. As shown in Fig. 42A and 42B, therewas an increase in ROS production in the LV of saline treated SHR compared with the WKY control group. Acute infusion treatment with NPA7 at doses of 600 pmol significantly reduced ROS production in SHR. To determine whether the antioxidant role of NPA7 is due to KEAP1 degradation induced NRF2 activation in the LV of SHR, we examined the expression levels of KEAP1 protein and NRF2 target genes. NPA7 caused the degradation of KEAP1 (Fig.42C). However, the NRF2 target genes didn’t increase significantly (data not shown). This might be due to the time of NPA7 infusion is too short that NRF2 hasn’t upregulate yet. However, the mRNA level of Nox2 and p67, which is critical regulators for ROS production, were suppressed by NPA7 (Fig.42D). These results indicated that although short time bolus of NPA7 didn’t increase NRF2’s target genes, but NPA7 can inhibit the oxidative stress by targeting Nox2 and p67. Example 7. NPA7 suppress oxidative stress in liver and lung of SHR To explore the antioxidant function of NPA7 in other organs, ROS productionwas assessed by DHE staining in the liver and lung sections. There was an increase inROS production in liver (Fig. 43A and 43B) or lung (Fig. 43C and 43D) of salinetreated SHR compared with the WKY control group. Acute infusion treatment withNPA7 at doses of 600 pmol significantly reduced ROS production in SHR. Fig. 44shows the percentage (%) decrease of DHE fluorescence caused by NPA7 in left ventricle, liver and lung of SHR. OTHER EMBODIMENTS It is to be understood that while the present application has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the present application, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

Attorney Docket No.07039-2196WO1 WHAT IS CLAIMED IS:

1. A method of treating a disease, disorder, or condition responsive to reduction ofoxidative stress in an organ or tissue affected by pathology of the disease, disorder, or condition, the method comprising: (i) identifying a subject diagnosed with the disease, disorder, or conditionresponsive to reduction of oxidative stress in the organ or tissue affected by pathology of the disease, disorder, or condition, wherein the organ or tissue affected by the oxidative stress is selected from lung, stomach, intestines, liver, bladder, gallbladder, eye, skin, gland brain, colon, lymph node, spleen, muscle, and bone; (ii) after (i), administering to the subject a therapeutically effectiveamount of a polypeptide NPA7 with no more than two additions, subtractions, or substitutions, or a pharmaceutically acceptable salt thereof.

2. The method of claim 1, wherein the polypeptide NPA7 has a sequence asdepicted in Figure 21B.

3. The method of claim 1, wherein the disease, disorder, or condition is responsiveto reduction of oxidative stress in the organ or tissue by activation of Nrf2 pathway in the organ or tissue.

4. The method of claim 1, wherein the organ or tissue is brain.

5. The method of claim 5, wherein the disease or disorder is a neurodegenerativedisorder selected from Alzheimer’s disease, Parkinson’s disease, Motor neuron disease, dementia, dementia associated with Alzheimer’s disease, dementia with Lewy bodies, mild cognitive impairment (MCI), a memory impairment, amyotrophic lateral sclerosis, multiple sclerosis, multiple system atrophy epilepsy, Bell’s palsy, and cerebral palsy.

6. The method of claim 1, wherein the disease or disorder is an inflammatorydisease selected from the group diabetes (e.g., diabetes mellitus, type 2diabetes), cancer, rheumatoid arthritis, colitis, ulcerative colitis, asthma, allergic asthma, fatty liver disease, obesity, insulin resistance, inflammatory diseases of the liver and gut, steatohepatitis, liver inflammation, autoimmune diseases,Attorney Docket No.07039-2196WO1 atherosclerosis, hyperlipidemia, dyslipidemia, rhinitis, conjunctivitis, oral inflammation, thyroid disease, lung disease, inflammatory bowel disease (IBD), Crohn’s disease, ankylosing spondylitis, psoriasis, and chronic obstructive airways disease.

7. The method of claim 6, wherein the cancer is selected from bladder cancer, braincancer, breast cancer, colorectal cancer, cervical cancer, gastrointestinal cancer, genitourinary cancer, head and neck cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cancer, skin cancer, and testicular cancer.

8. The method of claim 1, the disorder is a disorder associated with aging selectedfrom age-related anxiety, anemia, arteriosclerosis, balance disorder, bone marrow failure, breathlessness, cachexia, chronic infection, cirrhosis, deafness, emphysema, failure to thrive, frailty, gastrointestinal ulcer, generalized anxiety disorder, gout, hair loss, hearing loss, hepatic insufficiency, high fat, hypercholesterolemia, hyperglycemia, hyperhomocysteinemia, hyperlipidemia, immunosenescence, impaired mobility, loss of appetite, loss of bone density, loss of sense of taste, metabolic syndrome, muscle loss, muscle wasting, muscular dystrophy, organ dysfunction, osteoporosis, peripheral artery disease, peripheral vascular disease, pneumonia secondary to impaired immune function, pulmonary disease, pulmonary emphysema, pulmonary fibrosis, reduced fitness, scoliosis, spinal stenosis, syndrome X, tinnitus, urinary incontinence, vertebral fracture, weight loss, osteoarthritis, rheumatoid arthritis, sarcopenia, hypertension, atherosclerosis, interstitial lung disease, age-related decline in cognitive function, age-related decline in cardiopulmonary function, age-related decline in muscle strength, age-related decline in vision, and age- related decline in hearing.