Pharmaceutical composition for treating cancer comprising polypeptide derived from mycobacterium tuberculosis

Abstract

The present invention relates to a polypeptide derived from Mycobacterium tuberculosis, or a variant thereof, and a pharmaceutical composition for treating cancer, the composition comprising same. The pharmaceutical composition according to the present invention specifically binds to ASC to induce multimerization of the ASC, thereby activating NLRP3 inflammasome, and thus can be applied as an anticancer agent.

Description

Pharmaceutical composition for treating cancer comprising a polypeptide derived from Mycobacterium tuberculosis

[0001] The present invention relates to a polypeptide derived from Mycobacterium tuberculosis that specifically binds to ASC, and a pharmaceutical composition for treating cancer comprising the same.

[0002]

[0003] More than 200 types of cancer are known to have been discovered in humans. Millions of people die from cancer worldwide each year, and the incidence of cancer is increasing due to the aging population. Anticancer drugs have evolved with technological advancements and are commonly categorized as first-generation chemotherapy, second-generation targeted therapy, third-generation immunotherapy, and fourth-generation metabolic therapy. First-generation anticancer drugs work by administering cytotoxic substances or substances that interact with biological signals to kill cancer cells or tissues. These drugs include metabolic inhibitors, alkylating agents, platinum-containing agents, antibiotics, and hormone therapy. However, because these agents can also affect normal tissues, they often cause various side effects. Targeted anticancer drugs were developed to minimize side effects by targeting only cancer cells, but their limited targeting and the development of drug resistance have been problematic. Consequently, immunotherapy, which eliminates cancer cells by enhancing the innate immune system, and metabolic therapy, which eliminates cancer cells by depriving them of nutrients, have been proposed.

[0004] ASC or PYCARD protein has been found in aggregates in human leukemia cells treated with chemotherapy. In many cancer patients, ASC is known to be methylated, inhibiting its role as apoptotic and tumor suppressor. Consequently, ASC has been identified as a key protein in the formation of the NLRP3 inflammasome complex, which mediates the secretion of the inflammatory cytokines IL-1β and IL-18.

[0005] Meanwhile, human NLRP3 inflammasome signaling is controlled by various factors, such as genetic polymorphisms and mutations, which can affect gene expression and ultimately lead to activation. These effects have been found in patients with inflammatory diseases (erma D, Saerndahl E, Andersson H, Eriksson P, Fredrikson M, Joensson JI, et al. The Q705K polymorphism in NLRP3 is a gain-of-function alteration leading to excessive interleukin-1β and L-18 production. LoS ne. 2012) :e34977.; Touitou I, Lesage S, McDermott M, Cuisset L, Hoffman H, Dode C, et al. Infevers: an evolving mutation database for auto-inflammatory syndromes. Hum Mutat. (2004) 24:194-8.; Levy R, Geerard L, Kuemmerle-Deschner J, Lachmann HJ, Konee-Paut I, Cantarini L, et al. Phenotypic and genotypic characteristics of cryopyrin-associated periodic syndrome: a series of 136 patients from the Eurofever Registry. Ann Rheum Dis. (2015) 74:2043-9.; Hoffman HM, Mueller JL, Broide DH, Wanderer AA, Kolodner RD. Mutation of a new gene encoding a putative pyrin-like protein causes familial cold autoinflammatory syndrome and Muckle-Wells syndrome. Nat Genet.(2001) 29:301-5.). Similarly, genetic polymorphisms associated with the NLRP3 inflammasome have also been associated with cancer. For example, the single-nucleotide polymorphism (SNP) Q705K (rs35829419) of the NLRP3 gene was associated with poor survival in patients with invasive colorectal cancer (Ungerbaeck J, Belenki D, Jawad ul-Hassan A, Fredrikson M, Franseen K, Elander N, et al. Genetic variation and alterations of genes involved in NFκB / TNFAIP3- and LRP3-inflammasome ignaling effect usceptibility and utcome for colorectal cancer. Arcinogenesis. 2012) 3:2126-34) and was postulated to be a risk allele for sporadic metastatic melanoma in Swedish men (Verma D, Bivik C, Farahani E, Synnerstad I, Fredrikson M, Enerbaeck C, et al. Inflammasome polymorphisms confer susceptibility to sporadic malignant melanoma. Pigment Cell Melanoma Res. (2012) 25:506-13), and also occurred at a high frequency in patients with pancreatic cancer (Miskiewicz A, Szparecki G, Durlik M, Rydzewska G, Ziobrowski I, Goerska R. The Q705K and F359L single-nucleotide polymorphisms of NOD-like receptor signaling pathway: association with chronic pancreatitis, pancreatic cancer, and periodontitis. Arch Immunol Ther Exp (Warsz). (2015) 63:485-94).Additionally, individuals with NLRP3 polymorphisms (rs10754558 and rs4612666) were found to be more susceptible to gastric cancer when infected with Helicobacter pylori (Castano-Rodrlguez N, Kaakoush NO, Goh KL, Fock KM, Mitchell HM. The NOD-like receptor signaling pathway in Helicobacter pylori infection and related gastric cancer: a case-control study and gene expression analyses. PLoS One. (2014) 9:e98899). Polymorphisms specific to IL-1β and IL-18 have been associated with the clinical and pathophysiological characteristics of AML and chronic myeloid leukemia (CML) in hematological malignancies (Zhang A, Yu J, Yan S, Zhao X, Chen C, Zhou Y, et al. The genetic polymorphism and expression profiles of NLRP3 inflammasome in patients with chronic myeloid leukemia. Hum Immunol. (2018) 79:57-62; Wang H, Hua M, Wang S, Yu J, Chen C, Zhao X, et al. Genetic polymorphisms of IL-18 rs1946518 and IL-1β rs16944 are associated with prognosis and survival of acute myeloid leukemia. Inflamm Res. (2017) 66:249-58). Additionally, studies utilizing gene expression profiling have reported upregulation of the NLRP3 inflammasome in several cancers.For example, NLRP3 is overexpressed in HNSCC, LSCC, and squamous cell carcinoma tissues compared to normal tissues and is often associated with poor prognosis and pathology (Chen L, Huang CF, Li YC, Deng WW, Mao L, Wu L, et al. Blockage of the NLRP3 inflammasome by MCC950 improves anti-tumor immune responses in head and neck squamous cell carcinoma. Cell Mol Life Sci. (2018) 75:2045-58; Xue Y, Du HD, Tang D, Zhang D, Zhou J, Zhai CW, et al. Correlation between the NLRP3 inflammasome and the prognosis of patients with LSCC. Front Oncol. (2019) 9:588; Wu CS, Chang KP, OuYang CN, Kao HK, Hsueh C, Chen LC, et al. ASC contributes to metastasis of oral cavity squamous cell carcinoma. Oncotarget. (2016) 7:50074-85), high expression of NLRP3 inflammasome was also found in bladder cancer, confirming that it could be a potential biomarker for diagnosis (Poli G, Brancorsini S, Cochetti G, Barillaro F, Egidi MG, Mearini E. Expression of inflammasome-related genes in bladder cancer and their association with cytokeratin 20 messenger RNA. Urol Oncol Semin Orig Investig. (2015) 33:505.e1-e7).

[0006]

[0007] The present invention aims to provide a polypeptide capable of treating cancer by activating NLRP3 inflammasome.

[0008]

[0009] The present invention provides a polypeptide comprising a sequence represented by SEQ ID NO: 1 or a variant thereof, which specifically binds to ASC (Apoptosis-associated Speck-like protein containing a CARD). In one embodiment of the present invention, the polypeptide comprises a sequence represented by SEQ ID NO: 1, and in another embodiment of the present invention, the variant may comprise conservative substitutions at positions other than the 2nd, 7th, 10th, and 13th amino acids of SEQ ID NO: 1, and in yet another embodiment of the present invention, the polypeptide comprises a sequence represented by SEQ ID NO: 2, and in yet another embodiment of the present invention, the conservative substitutions are at least one selected from the group consisting of T1S, T3S, G4A, R5K, I8V, G9A, G11A, A12G, and G14A, or at least one selected from the group consisting of T1S, T3S, G4A, R5K, I8L, G9A, G11A, A12G, and G14A.

[0010] The present invention provides an ASC-specific binding molecule comprising the above polypeptide or a variant thereof.

[0011] The present invention provides a pharmaceutical composition for treating cancer, comprising the polypeptide or variant described above. In one embodiment of the present invention, the cancer may be inflammatory colon cancer, colorectal cancer, melanoma, or hepatocellular carcinoma.

[0012] The present invention provides a nucleic acid molecule expressing the above polypeptide or variant.

[0013] The present invention provides a pharmaceutical composition for treating cancer, comprising the nucleic acid molecule described above.

[0014] The present invention provides a recombinant vector comprising the above nucleic acid molecule.

[0015] The present invention provides a host cell comprising the nucleic acid molecule described above.

[0016]

[0017] The polypeptide of the present invention specifically binds to the ASC protein, thereby inducing ASC multimerization and thereby activating the NLRP3 inflammasome. Therefore, the polypeptide of the present invention, or a variant thereof, or a nucleic acid molecule expressing the same, can be used as an anticancer agent.

[0018]

[0019] Figure 1a shows the results confirming that the Rv0747 / PE_PGRS10 protein interacts with ASC, Figure 1b shows the results confirming the interacting domain of the Rv0747 / PE_PGRS10 protein and ASC, Figure 1c shows the results confirming the sequence of the Rv0747 / PE_PGRS10 protein interacting with ASC, and Figure 1d shows the sequence of a peptide composed of 14 amino acids interacting with ASC.

[0020] FIG. 2a shows the results confirming that the binding of NLRP3 and ASC increases by treating with the peptide according to the present invention, FIG. 2b shows the results confirming that the secretion of IL-1β and IL-18 increases by treating with the peptide according to the present invention, FIG. 2c shows the results confirming that the secretion of caspse-1 increases by treating with the peptide according to the present invention, FIG. 2d shows the results confirming that the oligomerization of ASC increases by treating with the peptide according to the present invention, and E shows the results confirming that the ratio of oligomerized ASC in cells increases by treating with the peptide according to the present invention.

[0021] Figure 3 shows the results of confirming amino acids involved in the binding of a peptide and ASC according to one embodiment of the present invention.

[0022]

[0023] Hereinafter, the present invention will be described in detail with reference to the attached drawings and embodiments thereof. However, the following embodiments are provided as examples of the present invention. If a detailed description of a technology or configuration well known to those skilled in the art is judged to unnecessarily obscure the gist of the present invention, such detailed description may be omitted, and the present invention is not limited thereby. The present invention is capable of various modifications and applications within the scope of the following claims and equivalents interpreted therefrom.

[0024] Additionally, the terminology used in this specification is intended to appropriately express preferred embodiments of the present invention, and may vary depending on the intent of the user or operator, or the customs of the field to which the present invention pertains. Therefore, the definitions of these terms should be determined based on the contents throughout this specification. Throughout this specification, when a part is said to "include" a certain component, unless specifically stated otherwise, this does not mean that other components are excluded, but rather that other components may be included.

[0025] Unless otherwise defined, all technical terms used in this invention have the same meaning as commonly understood by those skilled in the art. While preferred methods and samples are described herein, similar or equivalent methods are also included within the scope of the present invention. The contents of all publications cited herein as references are incorporated herein by reference.

[0026]

[0027] The NLRP3 inflammasome is a multiprotein complex that plays a central role in regulating the innate immune system and inflammatory signaling. Upon activation by pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs), NLRP3 oligomerizes and activates caspase-1, which initiates the processing and release of the proinflammatory cytokines IL-1β and IL-18.

[0028] The NLRP3 inflammasome has anti-tumor activity. It has been reported that the NLRP3 inflammasome is required for dendritic cell-mediated priming of IFN-γ-producing T lymphocytes against tumor cells (Ghiringhelli F, Apetoh L, Tesniere A, Aymeric L, Ma Y, Ortiz C, et al. Activation of the NLRP3 inflammasome in dendritic cells induces IL-1β-dependent adaptive immunity against tumors. Nat Med. (2009) 15:1170-8.). The NLRP3 inflammasome appears to act as a negative regulator of tumorigenesis in colitis-associated cancer (Allen IC, TeKippe EM, Woodford R-MT, Uronis JM, Holl EK, Rogers AB, et al. The NLRP3 inflammasome functions as a negative regulator of tumorigenesis during colitis-associated cancer. J Exp Med. (2010) 207:1045-56.), suggesting an important role for the NLRP3 inflammasome in regulating intestinal homeostasis and consequently in protection against colitis (Zaki MH, Boyd KL, Vogel P, Kastan MB, Lamkanfi M, Kanneganti TD. The NLRP3 inflammasome protects against loss of epithelial integrity and mortality during experimental colitis. Immunity. (2010) 32:379-91). Additionally, deficiency of the NLRP3 inflammasome was shown to increase tumor growth in colorectal cancer.Furthermore, NLRP3 inflammasome-mediated IL-18 production has been reported to suppress colorectal cancer metastatic growth in the liver (Dupaul-Chicoine J, Arabzadeh A, Dagenais M, Douglas T, Champagne C, Morizot A, et al. The Nlrp3 inflammasome suppresses colorectal cancer metastatic growth in the liver by promoting natural killer cell tumoricidal activity. Immunity. (2015) 43:751-63.). NLRP3 / IL-18-mediated downregulation of IL-22BP provides a protective role against intestinal tissue damage during peak inflammation (Huber S, Gagliani N, Zenewicz LA, Huber FJ, Bosurgi L, Hu B, et al. IL-22BP is regulated by the inflammasome and modulates tumorigenesis in the intestine. Nature. (2012) 491:259-63.). In melanoma, NLRP3 in the TME has been shown to attenuate antitumor immune responses to cancer vaccines by supporting the migration of myeloid-derived suppressor cells (MDSCs) and thereby suppressing T cell responses (Van Deventer HW, Burgents JE, Wu QP, Woodford RMT, Brickey WJ, Allen IC, et al. The inflammasome component Nlrp3 impairs antitumor vaccine by enhancing the accumulation of tumor-associated myeloid-derived suppressor cells. Cancer Res. (2010) 70:10161-9.).

[0029] The present invention provides a peptide derived from Mycobacterium tuberculosis that can be used as an anticancer agent by specifically binding to ASC (Apoptosis-associated Speck-like protein containing a CARD) and activating NLRP3 (NOD-, LRR- and pyrin domain-containing protein 3) inflammasome. More specifically, the peptide according to the present invention is derived from Rv0747 / PE_PGRS10 (SEQ ID NO: 2) of Mycobacterium tuberculosis. Wild-type Rv0747 / PE_PGRS10 consists of 801 amino acids. The present invention provides a peptide having a TLTGRPLIGNGANG sequence (SEQ ID NO: 1) consisting of the 401st to 414th amino acids of Rv0747 / PE_PGRS10, which specifically binds to ASC. The DNA sequence encoding the full-length Rv0747 / PE_PGRS10 is represented by SEQ ID NO: 4, and the DNA sequence encoding SEQ ID NO: 2 is represented by SEQ ID NO: 3.

[0030] ASC (NP_037390), also known as PYCARD, consists of an N-terminal PYD (PYRIN-PAAD-DAPIN) domain and a C-terminal CARD (caspase-recruitment domain) domain. The PYD and CARD domains are members of the six-helix bundle death domain fold superfamily, which mediates the assembly of large signaling complexes in inflammatory and apoptotic signaling pathways through caspase activation. In normal cells, this protein is located in the cytoplasm, but in cells undergoing apoptosis, it forms globular aggregates near the nuclear periphery. The ASC protein consists of 195 amino acids.

[0031] When the above peptide according to the present invention binds to ASC, ASC is multimerized or polymerized, which induces activation of NLRP3 inflammasome and specifically increases secretion of IL-1β and / or IL-18 and caspase-1, thereby inducing death of cancer cells.

[0032] In relation to an amino acid sequence (peptide or protein), "fragment" means a part of the amino acid sequence, i.e. a sequence representing an amino acid sequence that is shortened at the N-terminus and / or C-terminus. A fragment shortened at the C-terminus (N-terminal fragment) can be obtained, for example, by translating a truncated open reading frame that lacks the 3'-end of the open reading frame. A fragment shortened at the N-terminus (C-terminal fragment) can be obtained, for example, by translating a truncated open reading frame that lacks the 5'-end of the open reading frame, as long as the truncated open reading frame includes an initiation codon that serves to initiate translation. A fragment of an amino acid sequence comprises, for example, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the amino acid residues from the amino acid sequence. The fragment of the amino acid sequence preferably comprises at least 6, in particular at least 8, at least 12, at least 13, at least 14, at least 15, at least 20, at least 30, at least 50 or at least 100 consecutive amino acids from the amino acid sequence.

[0033] A "variant," "variant," "variant protein," or "variant polypeptide" of a polypeptide or protein refers to any analog, fragment, derivative, or mutant derived from the polypeptide or protein and retaining at least one biological property of the polypeptide or protein. Different variants of the polypeptide or protein may exist in nature. These variants may be allelic mutations characterized by differences in the nucleotide sequence of the structural gene encoding the protein, or may include differential splicing or post-translational modifications. One skilled in the art can generate variants having one or more amino acid substitutions, deletions, additions, or replacements. These variants may include, among others: (a) variants in which one or more amino acid residues are substituted with conservative or non-conservative amino acids, (b) variants in which one or more amino acids are added to the polypeptide or protein, (c) variants in which one or more of the amino acids comprises a substituent, and (d) variants in which the polypeptide or protein is fused to another polypeptide, such as serum albumin.

[0034] Conservative variants also refer to amino acid sequences with sequence changes that do not adversely affect the biological function of the protein. A substitution, insertion, or deletion is described as having an adverse effect on the protein if the altered sequence disrupts or destroys the biological function associated with the protein. For example, the overall charge, structure, or hydrophobic-hydrophilic properties of a protein can be altered without adversely affecting its biological activity. Thus, for example, an amino acid sequence can be altered to render a peptide more hydrophobic or more hydrophilic without adversely affecting the protein's biological activity. Techniques for obtaining such variants, including genetic (suppression, deletion, mutation, etc.), chemical, and enzymatic techniques, are known to those skilled in the art.

[0035] As used herein, "parent polypeptide," "parent protein," "precursor polypeptide," or "precursor protein" refers to an unmodified polypeptide that is later modified to form a variant. The parent polypeptide may be a wild-type polypeptide, or a variant or engineered version of a wild-type polypeptide.

[0036] As used herein, "wild type" or "WT" or "native" refers to an amino acid sequence found in nature, including allelic variants. A wild type protein or polypeptide has an amino acid sequence that has not been intentionally modified.

[0037] For the purposes of this specification, a "variant" of an amino acid sequence (peptide, protein or polypeptide) includes amino acid insertion variants, amino acid addition variants, amino acid deletion variants and / or amino acid substitution variants. The term "variant" includes all splice variants, post-translationally modified variants, conformations, isoforms and species homologs, particularly those naturally expressed by a cell. The term "variant" particularly includes fragments of an amino acid sequence.

[0038] Amino acid insertion variants comprise the insertion of one or more amino acids into a specific amino acid sequence. For amino acid sequence variants with insertions, one or more amino acid residues are inserted at specific sites in the amino acid sequence, although random insertions using appropriate screening of the resulting products are also possible. Amino acid addition variants comprise amino- and / or carboxy-terminal fusions of one or more amino acids, such as 1, 2, 3, 5, 10, 20, 30, 50, or more amino acids. Amino acid deletion variants are characterized by the deletion of one or more amino acids from the sequence, such as the deletion of 1, 2, 3, 5, 10, 20, 30, 50, or more amino acids. The deletions can be at any position in the protein. Amino acid deletion variants containing deletions at the N-terminus and / or C-terminus of a protein are also referred to as N-terminal and / or C-terminal truncation variants. Amino acid substitution variants are characterized by the deletion of one or more residues in the sequence and the insertion of another residue in its place. Preference is given to variants located in amino acid sequences that are not conserved between homologous proteins or peptides and / or to substitution of amino acids with other amino acids having similar properties.

[0039] In particular, the polypeptide according to the present invention may include conservative substitutions at positions other than the 2nd, 7th, 10th, and 13th amino acids of SEQ ID NO: 1. For example, a variant encompassed by the present invention is a protein comprising an amino acid sequence having 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence represented by SEQ ID NO: 1 or 2, which maintains functional identity with a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 or 2.

[0040] Preferably, amino acid changes in peptide and protein variants are conservative amino acid changes, i.e., substitutions of similarly charged or uncharged amino acids. A conservative amino acid change involves substitution of one of the families of amino acids with similar side chains. Naturally occurring amino acids are generally divided into four families: acidic (aspartate, glutamate), basic (lysine, arginine, histidine), non-polar amino acids (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), and non-charged polar amino acids (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine). Phenylalanine, tryptophan, and tyrosine are sometimes classified together as aromatic amino acids. In one embodiment, a conservative amino acid substitution includes a substitution within the following groups:

[0041] Glycine, Alanine;

[0042] valine, isoleucine, leucine;

[0043] Aspartate, glutamate;

[0044] Asparagine, glutamine;

[0045] Serine, threonine;

[0046] Lysine, arginine; and

[0047] Phenylalanine, tyrosine.

[0048] In one embodiment of the present invention, a variant is provided that includes conservative substitutions, wherein threonine at position 1 in SEQ ID NO: 1 is replaced with serine (T1S); threonine at position 3 is replaced with serine (T3S); glycine at position 4 is replaced with alanine (G4A); arginine at position 5 is replaced with lysine (R5K); isoleucine at position 8 is replaced with valine (I8V) or leucine (I8L); glycine at position 9 is replaced with alanine (G9A); glycine at position 11 is replaced with alanine (G11A); alanine at position 12 is replaced with glycine (A12G); or glycine at position 14 is replaced with alanine (G14A).

[0049]

[0050] The term “acidic amino acid residue” preferably relates to glutamic acid (glutamate, Glu) or aspartic acid (aspartate, Asp), particularly glutamic acid. The term “basic amino acid residue” relates to lysine (Lys) or arginine (Arg), particularly lysine.

[0051] Preferably, the degree of similarity, preferably identity, between a given amino acid sequence and an amino acid sequence that is a variant of said given amino acid sequence will be at least about 60%, 65%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The degree of similarity or identity is preferably provided for an amino acid region that is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the full length of the reference amino acid sequence. For example, if the reference amino acid sequence consists of 200 amino acids, the degree of similarity or identity is preferably provided for at least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least about 120, at least about 140, at least about 160, at least about 180 or about 200 amino acids, preferably contiguous amino acids. In a preferred embodiment, the degree of similarity or identity is provided for the full length of the reference amino acid sequence. Alignment for determining sequence similarity, preferably sequence identity, can be performed using tools known in the art, preferably using a best sequence alignment, such as Align, under standard settings, preferably EMBOSS::needle, Matrix: Blosum62, Gap Open 10.0, Gap Extend 0.5.

[0052] "Sequence similarity" refers to the percentage of amino acids that are identical or exhibit conservative amino acid substitutions. "Sequence identity" between two amino acid sequences refers to the percentage of amino acids that are identical between the sequences.

[0053] The term "% identity" is intended to refer to the percentage of identical amino acid residues between two sequences being compared, obtained by optimal alignment; this percentage is purely statistical, as the differences between the two sequences are distributed randomly and over their entire length. Sequence comparisons between two amino acid sequences are typically performed by optimally aligning them and then comparing them, with segments or "comparison windows" being used to identify and compare local regions of sequence similarity. Optimal alignment of sequences for comparison can be performed manually or by means of the local homology algorithm of Smith and Waterman, 1981, Ads App. Math. 2, 482, or by means of the local homology algorithm of Neddleman and Wunsch, 1970, J. Mol. Biol. 48, 443, or by means of the local homology algorithm of Pearson and Lipman, 1988, Proc. Natl Acad. Sci. By means of the similarity search methods of USA 85, 2444, or by using computer programs that utilize these algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA of the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.).

[0054] % Identity is calculated by determining the number of identical positions between the two sequences being compared, dividing this number by the number of positions compared, and then multiplying the result by 100.

[0055] Homologous amino acid sequences according to the present disclosure exhibit at least 40%, particularly at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, and preferably at least 95%, at least 98% or at least 99% identity with respect to amino acid residues.

[0056] The amino acid sequence variants described herein can be readily prepared by those skilled in the art, for example, by recombinant DNA manipulation. Manipulation of DNA sequences to produce peptides or proteins with substitutions, additions, insertions, or deletions is described in detail, for example, in Sambrook et al. (1989). Furthermore, the peptides and amino acid variants described herein can be readily prepared using known peptide synthesis techniques, such as solid-phase synthesis and similar methods.

[0057] In one embodiment, the fragment or variant of an amino acid sequence (peptide or protein) is preferably a "functional fragment" or "functional variant." The term "functional fragment" or "functional variant" of an amino acid sequence relates to any fragment or variant that exhibits one or more functional properties identical or similar to the amino acid sequence from which it is derived, i.e., is a functional equivalent.

[0058] The term “functional fragment” or “functional variant,” as used herein, refers to a variant molecule or sequence that comprises an amino acid sequence in which one or more amino acids have been altered, particularly compared to the amino acid sequence of a parent molecule or sequence, and which is still capable of performing one or more functions of the parent molecule or sequence, e.g., binding to a target molecule or contributing to binding to a target molecule. In one embodiment, the alteration in the amino acid sequence of the parent molecule or sequence does not significantly affect or alter the binding characteristics of the molecule or sequence. In other embodiments, the binding of the functional fragment or functional variant may be reduced but still significantly present, e.g., the binding of the functional variant may be at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of that of the parent molecule or sequence. However, in other embodiments, the binding of the functional fragment or functional variant may be increased compared to the parent molecule or sequence.

[0059]

[0060] An amino acid sequence (peptide, protein or polypeptide) "derived from" a designated amino acid sequence (peptide, protein or polypeptide) means the origin of the first amino acid sequence. Preferably, an amino acid sequence derived from a particular amino acid sequence has an amino acid sequence that is identical, essentially identical or homologous to that particular sequence or a fragment thereof. An amino acid sequence derived from a particular amino acid sequence may be a variant of that particular sequence or a fragment thereof. For example, a person skilled in the art will appreciate that Rv0747 / PE_PGRS10 suitable for use herein may be modified in sequence from a naturally occurring or native sequence derived therefrom, but which retains the desired activity of the native sequence.

[0061] "Isolated" means altered or removed from its natural state. For example, a nucleic acid or peptide naturally occurring in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from its natural coexisting materials is "isolated." An isolated nucleic acid or protein may exist in a substantially purified form, or it may exist in a non-natural environment, such as a host cell.

[0062]

[0063] In the context of the present invention, the term "recombinant" means "created through genetic manipulation." Preferably, a "recombinant subject," such as a recombinant cell, in the context of the present invention does not occur naturally.

[0064] As used herein, the term “naturally occurring” means that a subject can be found in nature. For example, a peptide or nucleic acid is naturally occurring if it exists within an organism (including a virus), can be isolated from a source in nature, and has not been intentionally modified by humans in a laboratory.

[0065] The term "genetic modification" encompasses transfecting a cell with a nucleic acid. The term "transfection" relates to the introduction of a nucleic acid, particularly RNA, into a cell. For all purposes of the present invention, the term "transfection" also encompasses the introduction of a nucleic acid into a cell or the uptake of a nucleic acid by such a cell. For some applications of transfection, it is sufficient if the transfected genetic material is only transiently expressed. RNA can be transfected into a cell and cause it to transiently express its encoded protein. Because the nucleic acid introduced during transfection is generally not integrated into the nuclear genome, the foreign nucleic acid will be diluted or degraded through mitosis. Cells capable of episomal amplification of nucleic acid significantly reduce the dilution rate. If the transfected nucleic acid is to persist in the cell and its progenitor cells, stable transfection must occur. Such stable transfection can be achieved using a virus-based or transposon-based transfection system. Typically, cells that are genetically modified to express a receptor polypeptide and / or an antigen receptor are stably transfected with a nucleic acid encoding the receptor polypeptide and / or a nucleic acid encoding the antigen receptor, whereas typically, a nucleic acid encoding a ligand polypeptide and / or a nucleic acid encoding an antigen are transiently transfected into the cell.

[0066] The terms "nucleic acid", "nucleic acid molecule", "oligonucleotide" and "polynucleotide" are used interchangeably and refer to a polymer of the phosphate esters of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecule") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymine or deoxycytidine; "DNA molecule"), either in single-stranded or double-stranded helix form, or any of their phosphate ester analogs such as phosphorothioates and thioesters. Double-stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structures of said molecules and is not limited to any particular tertiary configuration. Accordingly, the term encompasses, among others, linear or circular DNA molecules (e.g., restriction fragments), plasmids, supercoiled DNA, and double-stranded DNA found in chromosomes. When discussing the structure of a particular double-stranded DNA molecule, the sequence may be described herein according to the general convention of presenting the sequence only in the 5' to 3' direction along the non-transcribed DNA strand (i.e., the strand having the sequence matching the mRNA). A "recombinant DNA molecule" is a DNA molecule that has undergone molecular biological manipulation. DNA includes, but is not limited to, cDNA, genomic DNA, plasmid DNA, synthetic DNA, and semi-synthetic DNA.

[0067] The nucleic acid may be contained within a vector. The term “vector,” as used herein, includes any vector known to those skilled in the art, including plasmid vectors, cosmid vectors, phage vectors such as lambda phage, viral vectors such as retrovirus, adenovirus, or baculovirus vectors, or artificial chromosome vectors such as bacterial artificial chromosomes (BAC), yeast artificial chromosomes (YAC), or P1 artificial chromosomes (PAC). Such vectors include expression as well as cloning vectors. Expression vectors include plasmids as well as viral vectors, and generally contain the desired coding sequence and appropriate DNA sequences necessary for the expression of the coding sequence operably linked thereto in a particular host organism (e.g., bacteria, yeast, plants, insects, or mammals) or in vitro expression system. Cloning vectors are generally used to manipulate and amplify a particular desired DNA fragment and may lack functional sequences necessary for the expression of the desired DNA fragment.

[0068] Viral vectors have been used for a wide range of gene transfer applications in living animals as well as cells. Viral vectors that may be used include, but are not limited to, adenovirus, retrovirus, vaccinia virus, poxvirus, adeno-associated virus, herpes simplex virus, lentivirus, baculovirus, sendai virus, measles virus, simian virus 40, and Epstein-Barr virus vectors. Non-viral vectors include plasmids, lipoplexes (cationic liposome-DNA complexes), polyplexes (cationic polymer-DNA complexes), and protein-DNA complexes. In addition to the nucleic acid, the vector may include one or more regulatory regions and / or selectable markers that are useful for selecting, measuring, and monitoring the outcome of the nucleic acid delivery (e.g., delivery to tissues, persistence of expression, etc.).

[0069] The term "expression vector" refers to a vector, plasmid, or vehicle designed to transform a host cell after expressing an inserted nucleic acid sequence. The cloned gene, i.e., the inserted nucleic acid sequence, is typically placed under the control of regulatory elements such as a promoter, a minimal promoter, an enhancer, and the like. Numerous initiation regulatory regions or promoters useful for directing expression of nucleic acids in a desired host cell are well known to those skilled in the art. Virtually any promoter capable of directing expression of these genes includes, but is not limited to, viral promoters, bacterial promoters, animal promoters, mammalian promoters, synthetic promoters, constitutive promoters, tissue-specific promoters, pathogenesis- or disease-related promoters, developmental-specific promoters, inducible promoters, and lightly regulated promoters;SV40 early (SV40) promoter region, promoter contained in the 3' long terminal repeat (LTR) of Rous sarcoma virus (RSV), E1A or major late promoter (MLP) of adenovirus (Ad), human cytomegalovirus (HCMV) immediate early promoter, herpes simplex virus (HSV) thymidine kinase (TK) promoter, baculovirus IE1 promoter, elongation factor 1 alpha (EF1) promoter, glyceraldehyde-3-phosphate dehydrogenase (GSPDH) promoter, phosphoglycerate kinase (PGK) promoter, ubiquitin C (Ubc) promoter, albumin promoter, mouse metallothionein-L Regulatory sequences of promoters and transcriptional regulatory regions, ubiquitous promoters (HPRT, vimentin, β-actin, tubulin, etc.), intermediate filaments (desmin, neurofilament, keratin, GFAP, etc.), promoters of therapeutic genes (MDR, CFTR, or factor VIII form, etc.), pathogenesis- or disease-related promoters, and promoters that exhibit tissue specificity and have been used in transgenic animals, such as the elastase I gene regulatory region active in pancreatic acinar cells; the insulin gene regulatory region active in pancreatic beta cells, the immunoglobulin gene regulatory region active in lymphoid cells, the mouse mammary carcinoma virus regulatory region active in testicular, breast, lymphoid, and macrophage cells;Including, but not limited to, the albumin gene active in the liver, Apo AI and Apo AII regulatory regions, the alpha-fetoprotein gene regulatory region active in the liver, the alpha1-antitrypsin gene regulatory region active in the liver, the beta-globin gene regulatory region active in bone marrow cells, the myelin basic protein regulatory region active in oligodendrocyte cells in the brain, the myosin light chain-2 gene regulatory region active in skeletal muscle, and the gonadotropic releasing hormone, pyruvate kinase promoter, villin promoter, fatty acid-binding intestinal protein promoter, and smooth muscle cell β-actin promoter active in the hypothalamus;

[0070] Vectors can be transfected by methods known in the art, such as injection, transfection, electroporation, microinjection, transduction, cell fusion, lipofection, calcium phosphate precipitation (Graham, FL et al., Virology, 52:456(1973); and Chen and Okayama, Mol. Cell. Biol. 7:2745-2752(1987)), liposome-mediated transfection (Wong, TK et al., Gene, 10:87(1980); Nicolau and Sene, Biochim. Biophys. Acta, 721:185-190(1982); and Nicolau et al., Methods Enzymol., 149:157-176(1987)), DEAE-dextran treatment (Gopal, Mol. Cell Biol., 5:1188-1190 (1985)), gene bombardment (Yang et al., Proc. Natl. Acad. Sci., 87:9568-9572 (1990)), use of a gene gun, or DNA vector transporters (e.g., Wu et al., J. Biol. Chem. 267:963 (1992); Wu et al., J. Biol. Chem. 263:14621 (1988); and Hartmut et al., Canadian Patent Application No. 2,012,311, see).

[0071] Polynucleotides according to the present invention can be introduced in vivo by lipofection. Over the past several decades, the use of liposomes for in vitro nucleic acid encapsulation and transfection has increased. Synthetic cationic lipids, designed to limit the difficulties and risks encountered with liposome-mediated transfection, can be used to prepare liposomes for in vivo gene transfection (Felgner et al., Proc. Natl. Acad. Sci. USA. 84:7413 (1987); Mackey et al., Proc. Natl. Acad. Sci. USA 85:8027 (1988); and Ulmer et al., Science 259:1745 (1993)). The use of cationic lipids can facilitate the encapsulation of negatively charged nucleic acids and also promote fusion with negatively charged cell membranes (Felgner et al., Science 337:387 (1989)). Particularly useful lipid compounds and compositions for nucleic acid delivery are described in WO95 / 18863, WO96 / 17823, and US 5,459,127. The use of lipofection to introduce exogenous genes into specific tissues in vivo offers several practical advantages. Molecular targeting of liposomes to specific cells offers one area of ​​advantage. Direct transfection into specific cell types would clearly be particularly desirable in tissues with cellular heterogeneity, such as the pancreas, liver, kidney, and brain. Lipids can be chemically linked to other molecules for targeting purposes (Mackey et al. 1988). Targeted peptides, such as hormones or neurotransmitters, and proteins, such as antibodies, or non-peptide molecules can be chemically bound to liposomes.

[0072] Other molecules, such as cationic oligopeptides (e.g., WO95 / 21931), peptides derived from DNA binding proteins (e.g., WO96 / 25508), or cationic polymers (e.g., WO95 / 21931), are also useful for facilitating transfection of nucleic acids in vivo.

[0073] It is also possible to introduce vectors in vivo as naked DNA plasmids (see U.S. Patent Nos. 5,693,622, 5,589,466, and 5,580,859). Receptor-mediated DNA transfer may also be used (Curiel et al., Hum. Gene Ther. 3:147 (1992); and Wu et al., J. Biol. Chem. 262:4429 (1987)).

[0074] The nucleic acids described herein may be recombinant and / or isolated molecules.

[0075] In the context of this specification, the term "transcription" refers to the process by which the genetic code in a DNA sequence is transcribed into RNA. The RNA can then be translated into peptides or proteins.

[0076] “Encoding” refers to the inherent property of a specific sequence of nucleotides in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template for the synthesis of other polymers and macromolecules in biological processes, having a defined sequence of nucleotides (i.e., rRNA, tRNA, and mRNA) or a defined sequence of amino acids and the biological properties derived therefrom. Thus, a gene encodes a protein if the transcription and translation of the mRNA corresponding to that gene produces a protein in a cell or other biological system. Both the coding strand, which is identical to the mRNA sequence and is usually provided as a sequence listing, and the non-coding strand, which serves as a template for transcription of the gene or cDNA, may be said to encode a protein or other product of that gene or cDNA.

[0077] The present invention provides a host cell comprising the vector of the present invention. The host cell includes prokaryotic (e.g., bacterial) and eukaryotic (e.g., fungal, yeast, animal, insect, plant) cells and may be any cell suitable for expressing a polypeptide according to the present invention. Suitable prokaryotic host cells include, but are not limited to, Escherichia coli (e.g., strains DH5, HB101, JM109, or W3110), Bacillus, Streptomyces, Salmonella, Serratia, and Pseudomonas species. Suitable eukaryotic host cells include, but are not limited to, COS, CHO, HepG-2, CV-1, LLCMK2, 3T3, HeLa, RPMI8226, 293, BHK-21, Sf9, Saccharomyces, Pichia, Hansenula, Kluyveromyces, Aspergillus or Trichoderma species.

[0078] As used herein, “endogenous” means any substance derived from or produced within an organism, cell, tissue, or system.

[0079] As used herein, “exogenous” means any substance derived from or produced outside an organism, cell, tissue, or system.

[0080] As used herein, the term “expression” refers to the biological production of a product encoded by a coding sequence, and can be defined as the transcription and / or translation of a specific nucleotide sequence. In most cases, a DNA sequence comprising a coding sequence is transcribed to form messenger RNA (mRNA). This messenger RNA is then translated to form a polypeptide product having the relevant biological activity. The expression process may also include additional processing steps for the RNA transcript product (e.g., splicing to remove introns) and / or post-translational processing of the polypeptide product.

[0081] As used herein, the terms "linked," "fused," or "fusion" are used interchangeably. These terms mean that two or more elements, components, or domains are joined together.

[0082]

[0083] The peptides, proteins, polypeptides, RNAs, RNA particles and additional agents, e.g., immune checkpoint inhibitors, described herein can be administered as pharmaceutical compositions or medicaments for therapeutic or prophylactic treatment, and can be administered in the form of any suitable pharmaceutical composition, which can include a pharmaceutically acceptable carrier and optionally can include one or more adjuvants, stabilizers, etc. In one embodiment, the pharmaceutical composition is for use in therapeutic or prophylactic treatment, e.g., treating or preventing an antigen-associated disease, such as a cancer disease, as described herein.

[0084]

[0085] The term "pharmaceutical composition" relates to a formulation comprising a therapeutically effective substance, preferably together with a pharmaceutically acceptable carrier, diluent, and / or excipient. The pharmaceutical composition is useful for reducing the severity of, preventing, or treating a disease or disorder by administering the pharmaceutical composition to a subject. Pharmaceutical compositions are also known in the art as pharmaceutical dosage forms. In the context of the present invention, a pharmaceutical composition comprises a peptide, protein, polypeptide, RNA, RNA particle, immune effector cell, and / or additional substance as described herein.

[0086]

[0087] The pharmaceutical compositions of the present disclosure may include one or more adjuvants or may be administered together with one or more adjuvants. The term "adjuvant" refers to a compound that prolongs, enhances, or accelerates an immune response. Adjuvants include heterogeneous compounds such as oil emulsions (e.g., Freund's adjuvant), mineral compounds (e.g., alum), bacterial products (e.g., pertussis toxin), or immune-stimulating complexes. Examples of adjuvants include, but are not limited to, LPS, GP96, CpG oligodeoxynucleotides, growth factors, and cytokines such as monokines, lymphokines, interleukins, and chemokines. Cytokines may be IL1, IL2, IL3, IL4, IL5, IL6, IL7, IL8, IL9, IL10, IL12, IFNα, IFNγ, GM-CSF, or LT-a. Additionally known adjuvants include aluminum hydroxide, Freund's adjuvant, or oils such as Montanide®ISA51. Other suitable adjuvants for use herein include lipopeptides such as Pam3Cys.

[0088]

[0089] Pharmaceutical compositions according to the present specification are generally applied as “pharmaceutically effective amounts” and “pharmaceutically acceptable formulations.”

[0090]

[0091] The term "pharmaceutically acceptable" means the non-toxicity of a substance that does not interact with the action of the active ingredient of the pharmaceutical composition.

[0092]

[0093] The term "pharmaceutically effective amount" or "therapeutically effective amount" means an amount that, alone or in combination with additional administration, achieves the desired response or effect. In the treatment of a specific disease, the desired response preferably means inhibition of the progression of the disease. This includes slowing the progression of the disease, and particularly includes stopping or reversing the progression of the disease. In the treatment of a disease, the desired response may also be delaying the onset or preventing the onset of the disease or condition. The effective amount of the compositions described herein will be determined based on the individual characteristics of the patient, including the condition being treated, the severity of the disease, age, physical condition, height, and weight, the duration of treatment, the type of concomitant therapy (if any), the specific route of administration, and similar factors. Accordingly, the dosage of the compositions described herein can be determined based on these various characteristics. If the patient does not respond sufficiently with the first dose, a higher dose (or a higher dose achieved effectively by another, more localized route of administration) may be used.

[0094]

[0095] The pharmaceutical compositions of the present disclosure may include salts, buffers, preservatives, and optionally other therapeutic agents. In one embodiment, the pharmaceutical compositions of the present disclosure include one or more pharmaceutically acceptable carriers, diluents, and / or excipients.

[0096]

[0097] Preservatives suitable for use in the pharmaceutical compositions of the present disclosure include, but are not limited to, benzalkonium chloride, chlorobutanol, parabens and thimerosal.

[0098]

[0099] As used herein, the term "excipient" refers to a substance that may be present in a pharmaceutical composition of the present disclosure but is not an active ingredient. Examples of excipients include, but are not limited to, carriers, binders, diluents, lubricants, thickeners, surfactants, preservatives, stabilizers, emulsifiers, buffers, flavoring agents, or coloring agents.

[0100]

[0101] The term "diluent" refers to a substance that dilutes and / or thins. Furthermore, the term "diluent" encompasses any one or more of a fluid, liquid, or solid suspension, and / or mixed medium. Examples of suitable diluents include ethanol, glycerol, and water.

[0102]

[0103] The term "carrier" refers to a component which may be natural, synthetic, organic, or inorganic that is combined with an active ingredient to facilitate, enhance, or enable administration of the pharmaceutical composition. As used herein, a carrier may be one or more compatible solid or liquid fillers, diluents, or encapsulating materials suitable for administration to a subject. Suitable carriers include, but are not limited to, sterile water, Ringer's, Ringer's lactate, sterile sodium chloride solution, isotonic saline, polyalkylene glycols, hydrogenated naphthalenes, and, in particular, biocompatible lactide polymers, lactide / glycolide copolymers, or polyoxyethylene / polyoxy-propylene copolymers. In one embodiment, the pharmaceutical compositions herein comprise isotonic saline.

[0104]

[0105] Pharmaceutically acceptable carriers, excipients or diluents for therapeutic use are well known in the art of pharmacy and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R Gennaro edited. 1985).

[0106]

[0107] Pharmaceutical carriers, excipients or diluents may be selected depending on the intended route of administration and standard pharmaceutical practice.

[0108]

[0109] In one embodiment, the pharmaceutical compositions described herein can be administered intravenously, intraarterially, subcutaneously, intradermally, or intramuscularly. In certain embodiments, the pharmaceutical compositions are formulated for topical or systemic administration. Systemic administration can include enteral administration involving absorption through the gastrointestinal tract or parenteral administration. As used herein, "parenteral administration" means administration by any means other than through the gastrointestinal tract, such as intravenous injection. In a preferred embodiment, the pharmaceutical compositions are formulated for systemic administration. In another preferred embodiment, systemic administration is by intravenous administration. In one embodiment of all aspects of the invention, the polypeptides described herein, or variants thereof, or nucleic acid molecules encoding them, are administered systemically.

[0110]

[0111] As used herein, the term "co-administration" refers to the administration of multiple compounds or compositions (e.g., immune effector cells, a polypeptide described herein or a variant thereof or nucleic acid molecule encoding the same, and optionally an RNA encoding a vaccine antigen) to the same patient. The multiple compounds or compositions may be administered simultaneously, essentially simultaneously, or sequentially.

[0112]

[0113] The materials, compositions, and methods described herein can be used to treat individuals with a disease, for example, a disease characterized by the presence of cells expressing the antigen. A particularly preferred disease is cancer. For example, if the antigen is derived from a virus, the materials, compositions, and methods may be useful for treating a viral disease caused by the virus. If the antigen is a tumor antigen, the materials, compositions, and methods may be useful for treating a cancer, wherein cancer cells express the tumor antigen.

[0114]

[0115] The materials, compositions, and methods described herein can be used in the therapeutic or prophylactic treatment of a variety of diseases, wherein support of immune effector cells and / or activation of immune effector cells as described herein is beneficial to patients, such as those with cancer and infectious diseases. In one embodiment, the materials, compositions, and methods described herein are useful for the prophylactic and / or therapeutic treatment of diseases associated with antigens.

[0116]

[0117] The term "disease" refers to an abnormal condition affecting an individual's body. A disease is often interpreted as a medical condition associated with specific symptoms and signs. A disease may be caused by an agent originating from an external source, such as an infectious disease, or by an internal dysfunction, such as an autoimmune disease. In humans, "disease" is used in a broader sense to refer to any condition that, upon contact with the individual, causes pain, dysfunction, distress, social problems, death, or similar problems to the affected individual. In a broader sense, it sometimes includes injuries, disabilities, disorders, syndromes, infections, isolated symptoms, deviant behaviors, and structural and functional atypical alterations, which, in different contexts and for different purposes, can be considered distinct categories. Disease typically affects individuals not only physically but also emotionally, as living with various diseases can alter an individual's outlook on life and personality.

[0118]

[0119] In this context, the term "treatment", "treating" or "therapeutic intervention" means the care and management of a subject for the purpose of combating a condition, such as a disease or disorder. The term is intended to encompass the full range of treatments for a given condition from which a subject is suffering, such as the administration of a therapeutically effective compound to alleviate symptoms or complications, delay the progression of the disease, disorder or condition, relieve or alleviate symptoms and complications, and / or cure or eliminate the disease, disorder or condition, as well as prevent the condition, where prevention will be understood as the care and management of a subject for the purpose of combating the disease, condition or disorder, and includes the administration of an active compound to prevent the onset of symptoms or complications.

[0120]

[0121] The term "therapeutic treatment" means any treatment that improves the health status of a subject and / or prolongs (increases) the lifespan of a subject. Such treatment may result in the elimination of a disease in a subject, the arrest or slowing of the progression of a disease in a subject, the inhibition or slowing of the progression of a disease in a subject, the reduction in the frequency or severity of symptoms in a subject, and / or the reduction in recurrence in a subject currently suffering from or previously suffering from a disease.

[0122]

[0123] The term "prophylactic treatment" or "preventive treatment" refers to any treatment intended to prevent the development of a disease in a subject. The terms "prophylactic treatment" and "preventive treatment" are used interchangeably herein.

[0124]

[0125] The terms "individual" and "subject" are used interchangeably herein. These terms refer to a human or other mammal (e.g., a mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate) that may be susceptible to or may be afflicted with a disease or disorder (e.g., cancer), but may or may not have afflicted with the disease or disorder. In many embodiments, the subject is a human. Unless otherwise specified, the terms "individual" and "subject" do not imply a particular age, and thus encompass adults, elderly people, children, and newborns. In embodiments herein, an "individual" or "individual" is a "patient."

[0126]

[0127] The term "patient" means an individual or entity in need of treatment, specifically an individual or entity suffering from a disease.

[0128]

[0129] In one embodiment of the present disclosure, the goal is to provide an immune response against cells with a disease that expresses an antigen, such as a cancer cell expressing a tumor antigen, and to treat a disease, such as a cancer disease, involving cells expressing an antigen, such as a tumor antigen.

[0130] As used herein, “immune response” refers to a coordinated body response to an antigen or cells expressing an antigen, and refers to a cellular immune response and / or a humoral immune response.

[0131] The terms “cell-mediated immunity”, “cellular immunity”, “cellular immune response”, or similar terms are meant to include cellular responses directed against cells characterized by the expression of antigens, particularly by presentation of antigens with class I or class II MHC molecules. The cellular response involves cells called T cells or T lymphocytes that function either as “helper” or “killer” cells. Helper T cells (also called CD4+ T cells) play a central role by regulating the immune response, while killer cells (cytotoxic T cells, cytolytic T cells, CD8 + T cells (also called CTLs or T cells) kill diseased cells, such as cancer cells, thereby preventing the development of more diseased cells.

[0132] This specification contemplates immune responses that may be protective, prophylactic, prophylactic, and / or therapeutic. As used herein, "inducing [or inducing] an immune response" may mean the absence of an immune response to a particular antigen prior to induction, or it may mean that an immune response to a particular antigen exists at a baseline level prior to induction and is enhanced following induction. Thus, "inducing [or inducing] an immune response" includes "enhancing [or enhancing] an immune response."

[0133] The term "immunotherapy" refers to the treatment of a disease or condition by inducing or enhancing an immune response. The term "immunotherapy" includes antigen immunization or antigen vaccination.

[0134] The term "immunization" or "vaccination" refers to the process of administering an antigen to an individual for the purpose of inducing an immune response, for example, for therapeutic or prophylactic reasons.

[0135] The term "macrophage" refers to a subset of phagocytes produced by the differentiation of monocytes. Activated by inflammation, immune cytokines, or microbial products, macrophages nonspecifically engulf and degrade exogenous pathogens within the macrophage by hydrolytic and oxidative attack. Peptides derived from the degraded proteins are presented on the cell surface of the macrophage, where they can be recognized by T cells and interact directly with antibodies on the surface of B cells, activating T and B cells and further stimulating the immune response. Macrophages belong to the class of antigen-presenting cells. In one embodiment, the macrophages are splenic macrophages.

[0136] The term "dendritic cell" (DC) refers to a subtype of phagocyte belonging to the antigen-presenting cell class. In one embodiment, dendritic cells are derived from hematopoietic bone marrow progenitor cells. These progenitor cells first transform into immature dendritic cells. These immature cells are characterized by high phagocytic activity and low T-cell activation potential. Immature dendritic cells continuously sample their surroundings for pathogens such as viruses and bacteria. Once they encounter a presentable antigen, they are activated into mature dendritic cells and begin migrating to the spleen or lymph nodes. Immature dendritic cells phagocytose pathogens, degrade their proteins into small fragments, and upon maturation, present these fragments on their surface using MHC molecules. Simultaneously, these cells upregulate cell-surface receptors, such as CD80, CD86, and CD40, which act as co-receptors in T-cell activation, significantly enhancing their T-cell activation capacity. They also upregulate CCR7, a chemotactic receptor that induces dendritic cells to migrate to the spleen via the bloodstream or to lymph nodes via the lymphatic system. Here, they act as antigen-presenting cells, activating B cells by antigen presentation, as well as helper T cells and killer T cells, in conjunction with non-antigen-specific co-stimulatory signals. Thus, dendritic cells can actively induce T- or B-cell-mediated immune responses. In one embodiment, the dendritic cells are splenic dendritic cells.

[0137] The term "antigen-presenting cell" (APC) refers to a variety of cells capable of displaying, acquiring, and / or presenting at least one antigen or antigen fragment on (or at) their surface. Antigen-presenting cells can be divided into professional antigen-presenting cells and non-professional antigen-presenting cells.

[0138] The term "professional antigen-presenting cell" refers to an antigen-presenting cell that constitutively expresses major histocompatibility complex class II (MHC class II) molecules required for interaction with naive T cells. When a T cell interacts with the MHC class II molecule complex on the antigen-presenting cell's membrane, the antigen-presenting cell produces co-stimulatory molecules that induce T cell activation. Professional antigen-presenting cells include dendritic cells and macrophages.

[0139] The term "non-professional antigen-presenting cell" refers to an antigen-presenting cell that does not constitutively express MHC class II molecules upon stimulation by specific cytokines, such as interferon-gamma. Examples of non-professional antigen-presenting cells include fibroblasts, thymic epithelial cells, thyroid epithelial cells, glial cells, pancreatic beta cells, or vascular endothelial cells.

[0140] "Antigen processing" means breaking down an antigen into processing products, which are fragments of said antigen (e.g., breaking down a protein into peptides) and combinations of one or more of these fragments with an MHC molecule (e.g., through binding) for presentation by a cell, such as an antigen presenting cell, to a specific T cell.

[0141] The term "disease involving an antigen" refers to any disease associated with an antigen, such as a disease characterized by the presence of an antigen. The disease involving an antigen may be an infectious disease, a cancerous disease, or a simple cancer. As described above, the antigen may be a disease-associated antigen, such as a tumor-associated antigen, a viral antigen, or a bacterial antigen. In one embodiment, the disease involving an antigen is a disease involving cells that express the antigen, preferably on the surface of the cells.

[0142] The term "infectious disease" refers to any disease that can be transmitted from one individual to another or from organism to organism and is caused by a microbial agent (e.g., a cold). Infectious diseases are well known in the art and include, for example, viral, bacterial, or parasitic diseases caused by viruses, bacteria, and parasites, respectively. In this regard, infectious diseases can be, for example, hepatitis, sexually transmitted diseases (e.g., chlamydia or gonorrhea), tuberculosis, HIV / acquired immunodeficiency syndrome (AIDS), diphtheria, hepatitis B, hepatitis C, cholera, severe acute respiratory syndrome (SARS), avian influenza, and influenza.

[0143] The term "cancer disease" or "cancer" refers to or means a pathological condition in an organism that is typically characterized by uncontrolled cell proliferation. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More specifically, examples of such cancers include bone cancer, blood cancer, lung cancer, liver cancer, pancreatic cancer, skin cancer, head and neck cancer, cutaneous or intraocular melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal area, stomach cancer, colon cancer, breast cancer, prostate cancer, uterine cancer, carcinoma of the sexual and reproductive organs, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, bladder cancer, kidney cancer, renal cell carcinoma, renal pelvic carcinoma, neoplasms of the central nervous system (CNS), neuroectodermal cancer, spinal tumors, gliomas, meningiomas, and pituitary adenomas. As used herein, the term “cancer” also includes cancer metastasis.

[0144] In cancer treatment, combination strategies may be suitable due to the synergistic effects achieved, which may be considered superior to the efficacy of monotherapy. In one embodiment, the pharmaceutical composition is administered in combination with an immunotherapeutic agent. As used herein, "immunotherapeutic agent" refers to any substance capable of activating a specific immune response and / or immune effector function(s). The present disclosure contemplates the use of antibodies as immunotherapeutic agents. While not wishing to be bound by theory, antibodies may achieve therapeutic effects against cancer cells through various mechanisms, including inducing apoptosis, blocking components of signal transduction pathways, or inhibiting the proliferation of tumor cells. In certain embodiments, the antibody is a monoclonal antibody. Monoclonal antibodies can induce cell death through antibody-dependent cell-mediated cytotoxicity (ADCC) or can bind to complement proteins to induce direct cytotoxicity, known as complement-dependent cytotoxicity (CDC). Non-limiting examples of anti-cancer antibodies and potential antibody targets (in parentheses) that can be used in combination with the present invention include Abagovomab (CA-125), Abciximab (CD41), Adecatumumab (atumumab) (EpCAM), Afutuzumab (CD20), Alacizumab pegol (VEGFR2), Altumomab pentetate (CEA), Amatuximab (MORAb-009), Anatumomab mafenatox (TAG-72), Apolizumab (HLA-DR), Arcitumomab (CEA), Atezolizumab (Atezolizumab) (PD-L1), Bavituximab (phosphatidylserine), Bectumomab (CD22),Belimumab (BAFF), Bevacizumab (VEGF-A), Bivatuzumab mertansine (CD44 v6), Blinatumomab (CD19), Brentuximab vedotin (CD30 TNFRSF8), Cantuzumab mertansine (mucin CanAg), Cantuzumab ravtansine (MUC1), Capromab pendetide (prostate carcinoma cells), Carlumab (CNT0888), Catumaxomab (EpCAM, CD3), Cetuximab (EGFR), Citatumazumab Citatuzumab bogatox (EpCAM), Cixutumumab (IGF-1 receptor), Claudiximab (Claudin), Clivatuzumab tetraxetan (MUC1), Conatumumab (TRAIL-R2), Dacetuzumab (CD40), Dalotuzumab (insulin-like growth factor I receptor), Denosumab (RANKL), Detumomab (B-lymphoma cells), Drozitumab (DR5), Ecromeximab (GD3 ganglioside), Edrecolomab (EpCAM), Elotuzumab (Elotuzumab) (SLAMF7), Enavatuzumab (PDL192), Ensituximab (NPC-1C), Epratuzumab (CD22), Ertumaxomab (HER2 / neu, CD3), Etaracizumab (integrin αγβ3),Farletuzumab (folate receptor 1), FBTA05 (CD20), Ficlatuzumab (SCH 900105), Figitumumab (IGF-1 receptor), Flavoutumab (glycoprotein 75), Fresolimumab (TGF-β), Galiximab (CD80), Ganitumab (IGF-I), Gemtuzumab ozogamicin (CD33), Gevokizumab (IL1β), Girentuximab (carbonic anhydrase 9 (CA-IX)), Glembatumumab vedotin (GPNMB), Ibritumomab tiuxetan (CD20), Icrucumab (VEGFR-1), Igovoma (CA-125), Indatuximab ravtansine (SDC1), Intetumumab (CD51), Inotuzumab ozogamicin (CD22), Ipilimumab (CD 152), Iratumumab (CD30), Labetuzumab (CEA), Lexatumumab (TRAIL-R2), Libivirumab (hepatitis B surface antigen), Lintuzumab (CD33), Lorvotuzumab mertansine (CD56), Lucatumumab (CD40), Lumiliximab (CD23), Mapatumumab (TRAIL-R1), Matuzumab (EGFR), Mepolizumab (IL5), Milatuzumab (CD74),Mitumomab (GD3 ganglioside), Mogamulizumab (CCR4), Moxetumomab pasudotox (CD22), Nacolomab tafenatox (C242 antigen), Naptumomab estafenatox (5T4), Namatumab (RON), Necitumumab (EGFR), Nimotuzumab (EGFR), Nivolumab (IgG4), Ofatumumab (CD20), Olaratumab (PDGF-R a), Onartuzumab (human scatter factor receptor kinase (human scatter factor receptor kinase), Oportuzumab monatox (EpCAM), Oregovomab (CA-125), Oxelumab (OX-40), Panitumumab (EGFR), Patritumab (HER3), Pemtumoma (MUC1), Pertuzuma (HER2 / neu), Pintumomab (adenocarcinoma antigen), Pritumumab (vimentin), Racotumomab (N-glycolylneuraminic acid), Radretumab (fibronectin extradomain-B), Rafivirumab (rabies virus glycoprotein), Ramucirumab (Ramucirumab) (VEGFR2), Rilotumumab (HGF), Rituximab (CD20), Robatumumab (IGF-1 receptor), Salmalizumab (CD200), Sibrotuzumab (FAP),Siltuximab (IL6), Tabalumab (BAFF), Tacatuzumab tetraxetan (α-fetoprotein), Taplitumomab paptox (CD 19), Tenatumomab (Tenacin C), Teprotumumab (CD221), Ticilimumab (CTLA-4), Tigatuzumab (TRAIL-R2), TNX-650 (IL13), Tositumomab (CD20), Trastuzumab (HER2 / neu), TRBS07 (GD2), Tremelimumab (CTLA-4), Tucotuzumab celmoleukin (Tucotuzumab celmoleukin) (EpCAM), Ublituximab (MS4A1), Urelumab (4-1 BB), Volociximab (integrin α5β1), Votumumab (tumor antigen CTAA 16.88), Zalutumumab (EGFR) and Zanolimumab (CD4).

[0145]

[0146] References to the literature and research cited herein are not intended to be an admission that any of the aforementioned content is related to the prior art. All references to the contents of these documents are based on information available to the applicant and do not constitute any admission as to the accuracy of the contents of these documents.

[0147]

[0148] The following description is provided to enable those skilled in the art to create and utilize various embodiments. Descriptions of specific devices, techniques, and applications are provided solely as examples. Various modifications to the embodiments described herein will readily become apparent to those skilled in the art, and the general principles defined herein may be applied to other embodiments and applications without departing from the spirit and scope of the various embodiments. Therefore, the various embodiments are not intended to be limited to the embodiments described and illustrated herein, but are intended to be consistent with the scope of the claims.

[0149]

[0150] Example

[0151] 1. Materials and Methods

[0152] 1.1 Mice and Tissue Culture

[0153] Wild-type C57BL / 6 mice were supplied by Samtako Bio Korea (Osan, Korea). Primary bone marrow-derived macrophages (BMDMs) were collected from the mice and cultured in DMEM with M-CSF (R&D Systems, 416-ML) for 3–5 days. HEK293T cells (ATCC-11268; American Type Culture Collection) were cultured in DMEM (Gibco) containing 10% fetal bovine serum (FBS) (Gibco), nonessential amino acids, sodium pyruvate, streptomycin (100 μg / mL), and penicillin (100 IU / mL).

[0154]

[0155] 1.2 Reagents and Antibodies

[0156] Lipopolysaccharide (LPS) (Escherichia coli O111:B4, tlrl-eblps), adenosine 5'-triphosphate (ATP, tlrl-atpl), nigericin, and dextran sulfate sodium (DSS) were purchased from Invivogen. Actin (I-19), ASC (N-15-R), IL-18 (H-173-Y), caspase-1 p10 (M-20), HA (12CA5), Flag (D-8), GST (B-14), His (H-3), and V5 (C-9) were purchased from Santa Cruz Biotechnology. IL-1β and NLRP3 (AG-20B-0014) were from R&D system and Adipogen, respectively.

[0157]

[0158] 1.3 Plasmid construction

[0159] GST-Rv0747, Flag-NLRP3, V5-ASC, and HA-Ub plasmids were purchased from Addgene. Wild-type NLRP3 (Int. J. Mol. Sci. 2020, 21, 8437) is 1036 amino acids long, and ΔPYD, ΔNACHT, 1-219 and 537-1036 in wtNLRP3, and ΔLRR, 1-741 in wtNLRP3 were used. Plasmids for expressing full-length (FL) NLRP3 and mutants (ΔPYD, ΔNACHT, and ΔLRR) were inserted into the pcDNA3 vector. Plasmids encoding different regions of Rv0747 (1-801, 1-93, 94-200, 201-300, 301-400, 401-500, 501-600, 601-700, 701-800) were amplified by PCR from FL Rv0747 cDNA and subcloned into pEBG derivatives encoding N-terminal GST epitope tags flanked by BamHI and NotI sites. Plasmids encoding different regions of ASC (1-195, 1-91, 107-195) were generated by PCR amplification from FL ASC cDNA and subcloned into pEF derivatives encoding C-terminal Flag tags between BamHI and NotI sites. All transient proteins encoded in the plasmids were produced in mammalian cells using the pEBG-GST mammalian fusion vector and the pEF-IRES-Puro expression vector. All constructs were sequenced using an ABI PRISM 377 automated DNA sequencer to ensure 100% identity with the original sequence.

[0160]

[0161] 1.4 Peptides

[0162] NLRP3 or ASC peptides conjugated with 9R were provided by Peptron (Daejeon, South Korea), manufactured and purified in acetate form to avoid undesirable intracellular reactions. Endotoxin levels were measured using the Limulus amebocyte lysate test (Charles River Endosafe ®Endochrome-K™USA), and the peptide concentrations used in the experiments were less than 3–5 pg / mL.

[0163]

[0164] 1.5 GST pulldown, immunoblot, and immunoprecipitation assays

[0165] GST pulldown, Western blot, and co-immunoprecipitation assays were performed with 293T and BMDM cells. For GST pulldown, 293T cells were harvested and lysed in NP40 buffer supplemented with a protease inhibitor cocktail (Roche, Basal, CH). After centrifugation, the supernatant was pretreated with protein A / G beads for 2 h at 4°C. The pretreated lysate was combined with a 50% slurry of glutathione-conjugated Sepharose beads (Amersham Biosciences, Amersham, UK) and incubated for 4 h at 4°C. The precipitate was thoroughly rinsed with lysis buffer. Proteins bound to the glutathione beads were eluted by boiling in sodium dodecyl sulfate (SDS) loading buffer for 5 min. For immunoprecipitation analysis, cells were harvested and lysed in NP40 buffer supplemented with a protease inhibitor cocktail (Roche, Basal, CH). Whole-cell lysates were pretreated with protein A / G agarose beads for 1 h at 4°C and then immunoprecipitated with the treated antibodies. Typically, 1 mL of cell lysate was treated with 1–4 μg of antibody for 8–12 h at 4°C. After 6 h of incubation with protein A / G agarose beads, immunoprecipitates were washed thoroughly with lysis buffer and eluted by boiling in SDS loading buffer for 5 min. Polypeptides were separated by SDS-polyacrylamide gel electrophoresis and transferred to PVDF membranes for immunoblotting (IB) (Bio-Rad, Hercules, CA, USA). Specific antibodies were required for immunodetection, and chemiluminescence (ECL; Millipore, MA, USA) was used to visualize target-bound antibodies.And to detect this, a Vilber chemiluminescence analyzer (Fusion SL3; Vilber Lourmat, Coleegien, France) was used.

[0166]

[0167] 1.6 Enzyme-linked immunosorbent assay

[0168] TNF-α, IL-6, IL-1β, and IL-18 levels were measured in cell culture supernatants and mouse serum using the BD OptEIA ELISA system (BD Pharmingen). All assays were performed according to the manufacturer's instructions.

[0169]

[0170] 1.7 Kinetic analysis of NLRP3 interaction with ASC binding partners

[0171] The NLRP3-ASC interaction was monitored using a Fluormax-4 spectrofluorometer (HORIBA Scientific) as described previously. NLRP3 was labeled with BODIPY FL Iodoacetamide (ThermoFisher Scientific) according to the manufacturer's instructions. The NLRP3 label was excited at 350 nm and detected through a cutoff filter at 512 nm. For kinetic analysis, NLRP3 was designated as unlabeled NLRP3 or ASC. The excitation and emission wavelengths used were 498 nm and 518 nm, respectively. The acquired data were viewed using the Grafit program, and all fluorescence measurements were performed at 25°C in 30 mM Tris, pH 7.4, 150 mM NaCl, and 1 mM dithiothryitol.

[0172]

[0173] 2. Results

[0174] 2.1 PYD domain of ASC and Rv0747 401 TLTGRPLIGNGANG 414interact with each other.

[0175] To identify the M. tuberculosis antigenic protein that interacts with ASC, an adaptor protein required for NLRP3 inflammasome complex formation, recombinant ASC (rASC-His) was co-immunoprecipitated with M. tuberculosis H37Rv lysate and purified using His-agarose beads. The purified rASC-His complex was identified by silver staining and liquid chromatography-mass spectrometry. Interestingly, the M. tuberculosis Rv0747 / PE_PGRS10 protein bound to ASC (Fig. 1a). ASC consists of a PYD domain that binds NLRP3 and a CARD domain that binds the effector protein caspase-1. To identify the domains through which ASC and Rv0747 interact, GST-tagged Rv0747 (GST-Rv0747) and V5-tagged ASC WT, the PYD domain of ASC, and the CARD domain of ASC were transfected into 293T cells, and a GST pull-down assay was performed. When immunodetected with a V5 antibody, the PYD domain of V5-ASC WT was detected, but the CARD domain was not (Fig. 1b). In addition, the entire domain (1-801), the PE domain (1-93), and domains divided into approximately 100 amino acids each of GST-Rv0747 and V5-ASC were used, and it was confirmed that the entire domain of Rv0747 and the peptide 401-500 interacted with the ASC protein (Fig. 1c). Using the PredictProtein tool, we identified that the 14 amino acid sequences from positions 401 to 414 of the peptide positions 401-500 of Rv0747 are likely to be important in the interaction with the ASC protein (Fig. 1d).

[0176]

[0177] 2.2 Rv0747 401 TLTGRPLIGNGANG 414 increases NLRP3 inflammasome activation.

[0178] To confirm the role of the interaction between ASC and Rv0747, an Rv0747-derived peptide (Rv0747) that interacts with ASC was combined with the cell-penetrating peptide R9 (RRRRRRRRR). 401 TLTGRPLIGNGANG 414 ) was produced. 293T cells were transfected with Flag-NLRP3 and V5-ASC, and the binding between NLRP3 and ASC was observed after treatment with the peptide in a concentration-dependent manner. As a result, Rv0747 401 TLTGRPLIGNGANG 414 The binding between NLRP3 and ASC was increased in proportion to the concentration of Rv0747. In addition, NLRP3 inflammasome was activated by stimulating bone marrow-derived macrophages (BMDMs) with LPS and ATP, and Rv0747 401 TLTGRPLIGNGANG 414 When treated with , the binding of NLRP3 and ASC was confirmed to increase (Fig. 2a). Next, several inflammasome activators and Rv0747 were added to LPS-stimulated BMDMs. 401 TLTGRPLIGNGANG 414 After treatment, IL-1β / 18 was confirmed through enzyme-linked immunosorbent assay and immunoblotting. Rv0747 401 TLTGRPLIGNGANG 414 Specifically, Rv0747 increased only IL-1β / 18 secretion by NLRP3 inflammasome activation, and immunoblot results showed that only NLRP3 inflammasome activation increased the secretion of IL-1β / 18 and caspase-1, an effector protein of the inflammasome (Fig. 2b and 2c). When NLRP3 inflammasome is activated, ASC monomers oligomerize into multiple units, forming micrometer-sized perinuclear structures called ASC specks. In LPS-stimulated BMDMs, Rv0747 401 TLTGRPLIGNGANG 414 When treated in a concentration-dependent manner, the oligomerization of ASC increased in proportion to the concentration, and also Rv0747401 TLTGRPLIGNGANG 414 As the concentration of Rv0747 increased, the proportion of ASC multimers inside the cells also increased (Fig. 2d). In summary, these results suggest that ASC and Rv0747 401 TLTGRPLIGNGANG 414 This indicates that the interaction of NLRP3 and ASC specifically activates the NLRP3 inflammasome by increasing the binding of NLRP3 to ASC.

[0179]

[0180] 2.3 Rv0747 401 TLTGRPLIGNGANG 414 In the sequence, the T and N amino acids affect binding to ASC.

[0181] Rv0747 401 TLTGRPLIGNGANG 414 We aimed to determine which amino acid point mutations in Rv0747 could affect the interaction with ASC. 401 TLTGRPLIGNGANG 414 In the amino acid sequence of , two amino acids that exist symmetrically at regular intervals were point-mutated: L at position 402 to F, L at position 407 to F, N at position 410 to T, and N at position 413 to T. As a result, it was observed that V5-ASC and point-mutated GST-Rv0747 did not bind to each other (Fig. 3), indicating that each amino acid may play an important role in binding to ASC.

[0182]

[0183] For example, for purposes of claim construction, the claims set forth below should not be construed narrowly beyond their literal language, and thus, exemplary embodiments from the specification should not be construed as claims. Therefore, it should be understood that the present invention has been described by way of example only, and not as a limitation on the scope of the claims. Accordingly, the present invention is limited only by the claims below. All publications, issued patents, patent applications, books, and journal articles cited in this application are hereby incorporated by reference in their entirety.

[0184]

[0185] SEQ ID NO: 1

[0186] TLTGRPLIGN GANG

[0187]

[0188] SEQ ID NO: 2

[0189] MSWVMVSPEL VVAAAADLAG IGSAISSANA AAAVNTTGLL TAGADEVSTA IAALFGAQGQ APPLICATION AFYAQFVQAL SAGGGAYAAA EAAAVSPLLA PINAQFVAAT GRPLIGNGAN GAPGTGANGG PGGWLIGNGG AGGSGAPGAG AGGNGGAGGL FGSGGAGGAS TDVAGGAGGA GGAGGNAGML FGAAGVGGVG GFSNGGATGG AGGAGGAGGL FGAGRERGSG GSGNLTGGAG GAGGNAGTLA TGDGGAGGTG GASRSGGFGG AGGAGGDAGM FFGSGGSGGA GGISKSVGDS AAGGAGGAPG LIGNGGNGGN GGASTGGGDG GPGGAGGTGV LIGNGGNGGS GGTGATLGKA GIGGTGGVLL GLDGFTAPAS TSPLHTLQQD VINMVNDPFQ TLTGRPLIGN GANGTPGTGA DGGAGGWLFG NGGNGGQGTI GGVNGGAGGA GGAGGILFGT GGTGGSGGPG ATGLGGIGGA GGAALLFGSG GAGGSGGAGA VGGNGGAGGN AGALLGAAGA GGAGGAGAVG GNGGAGGNGG LFANGGAGGP GGFGSPAGAG GIGGAGGNGG LFGAGGTGGA GGGSTLAGGA GGAGGNGGLF GAGGTGGAGS HSTAAGVSGG AGGAGGDAGL LSLGASGGAG GSGGSSLTAA GVVGGIGGAG GLLFGSGGAG GSGGFSNSGN GGAGGAGGDA GLLVGSGGAG GAGASATGAA TGGDGGAGGK SGAFGLGGDG GAGGATGLSG AFHIGGKGGV GGSAVLIGNG GNGGNGGNSG NAGKSGGAPG PSGAGGAGGL LLGENGLNGL M

[0190]

[0191] SEQ ID NO: 3

[0192] acgctcaccg ggcgtccgct gatcggcaac ggcgccaacg gc

[0193]

[0194] SEQ ID NO: 4

[0195] atgtcatggg tgatggtttc gccggagctg gtggtggcgg cggcagcgga tttggcgggg atcgggtcgg cgattagctc ggctaatgcg gcggcggccg tcaacacgac gggattgttg accgcgggtg ccgatgaggt gtcgacagcg attgcggcgt tgttcggtgc ccaaggccag gcctaccagg cggcgagcgc acaggcggcg gcgttttacg cccagttcgt gcaggccctg agcgccggcg gaggcgcgta tgcggccgcc gaggccgccg ccgtgtcgcc gctgctggcc ccgatcaacg cgcaattcgt ggcggccacc gggcgcccgc tgatcggcaa cggcgccaac ggcgcccccg ggaccggagc caacggcggg cccggcgggt ggttgatcgg caacggcggc gccggcgggt ctggcgcccc cggcgctggg gccggcggta acggcggggc cggcgggctg ttcggcagcg gcggggccgg cggggcctcc accgacgtcg ccggcggggc cggtggggcc ggcggggccg gcggaaacgc cggcatgctg ttcggcgccg ccggggtcgg cggcgtcggc ggattctcga acggcggtgc caccggcggg gcaggcgggg ccggcggggc gggcgggctg tttggcgccg gaagggaacg cggcagcggc gggtcgggca acctcactgg cggggccggc ggggccggcg gcaacgccgg gacactcgcc actggtgatg gcggggccgg cgggaccggc ggcgctagtc gcagcggcgg attcggcggg gccggcggag ccggcggcga cgccggcatg ttcttcggct ccggcggctc cggcggcgcc ggcggcatta gtaaaagcgt cggggacagc gccgccggcggggccggcgg ggcccccggg ctgatcggca acggcggcaa cggcggcaac ggcggcgcga gcaccggcgg cggggacggt gggcccggcg gggccggcgg caccggcgtg ttgatcggca acggcggcaa cggcggcagc ggcgggaccg gcgcgaccct gggcaaggcc ggcatcggcg gtaccggggg ggtgctgttg ggcctggacg gctttacggc ccccgccagc acctcgcccc tgcacaccct gcagcaggac gtgatcaata tggtgaacga ccccttccag acgctcaccg ggcgtccgct gatcggcaac ggcgccaacg gcactccggg gaccggggct gacggcggag ccggcggctg gttgttcggc aacggcggaa acggcgggca gggaacgatc ggcggcgtca acggcggggc cggcggggcc ggcggggccg gcgggatctt gttcggcacc ggcggcaccg ggggcagcgg cgggcccggc gccaccggcc tcggcgggat tggcggggcc ggcggagccg ccttgctctt cggctccggc ggggccggcg gaagcggtgg tgccggcgcg gtcggtggca atggcggggc cggcggcaac gccggtgcgc tcttgggcgc cgccggggcc ggcggggccg gtggtgccgg cgcggtcggt ggcaatggcg gggccggcgg taacggcggg ctgttcgcca acgggggagc cggcgggccc ggtgggtttg gcagccccgc tggggctggc gggatcggcg gggcaggtgg gaacggcggg ctgttcggcg ccggcgggac cggcggggcc ggcgggggaa gcaccctcgc cggcggcgcc ggcggggcgg gcggcaacgg cgggctgttc ggcgccggcg gcaccggcggcgccggcagc catagcaccg ccgccggagt ttccggaggg gccggcgggg ccggcggcga cgccggcttg ctctccctcg gcgcctccgg cggggccggc ggcagcggcg gttccagcct gaccgccgcc ggcgtggtcg gcggcatcgg cggcgccgga ggcttgctct tcggctccgg cggcgccggc gggagcggcg ggttcagcaa ctctggcaac ggcggcgccg gcggggccgg cggcgacgcg ggtttgctcg tcggctccgg cggggccggc ggggccggcg cctccgccac cggcgccgcc accggcgggg acggcggggc cggcggcaag tccggagcgt tcggtctcgg aggtgacggc ggcgccggcg gcgccaccgg tttgtccggt gctttccaca tcggcggcaa gggcggcgtc ggcggcagcg ccgtgctgat cggcaacggc ggcaacggcg gcaacggcgg taacagcggt aacgccggga aatccggggg tgcacccggc cccagcggcg ccggcggcgc cggcgggctg ctgctcggtg agaacgggct gaacggcttg atgtag

Claims

1. A polypeptide comprising a sequence represented by SEQ ID NO: 1 or a variant thereof, which specifically binds to ASC (Apoptosis-associated Speck-like protein containing a CARD).

2. In the first paragraph, the polypeptide or a variant thereof is composed of a sequence represented by SEQ ID NO:

1.

3. In the first paragraph, the polypeptide or a variant thereof comprises a sequence represented by SEQ ID NO:

2.

4. A polypeptide or a variant thereof, in the first paragraph, wherein the variant comprises a conservative substitution at positions other than the 2nd, 7th, 10th, and 13th amino acids of SEQ ID NO:

1.

5. A polypeptide or variant thereof, in claim 4, wherein the conservative substitution is at least one selected from the group consisting of T1S, T3S, G4A, R5K, I8V, G9A, G11A, A12G, and G14A, or at least one selected from the group consisting of T1S, T3S, G4A, R5K, I8L, G9A, G11A, A12G, and G14A.

6. An ASC-specific binding molecule comprising a polypeptide of any one of claims 1 to 5 or a variant thereof.

7. A pharmaceutical composition for treating cancer, comprising a polypeptide or variant of any one of claims 1 to 5.

8. A pharmaceutical composition for treating cancer, wherein the cancer in paragraph 7 is inflammatory colon cancer, colorectal cancer, melanoma, or hepatocellular carcinoma.

9. A nucleic acid molecule expressing a polypeptide or variant of any one of claims 1 to 5.

10. A pharmaceutical composition for treating cancer, comprising the nucleic acid molecule of claim 9.

11. A pharmaceutical composition for treating cancer, wherein the cancer is inflammatory colon cancer, colorectal cancer, melanoma, or hepatocellular carcinoma, in the 10th paragraph.

12. A recombinant vector comprising the nucleic acid molecule of paragraph 9.

13. A host cell comprising the nucleic acid molecule of claim 9.

14. A method for treating cancer, comprising administering to a patient in need of treatment a polypeptide or variant of any one of claims 1 to 5.

15. A method for treating cancer, comprising administering the nucleic acid molecule of claim 9 to a patient in need of treatment.

Images