Aptamer targeting CD25, drug conjugate comprising same, and use thereof

Abstract

The present invention relates to an aptamer targeting CD25, a drug conjugate comprising same, and a use thereof.

Description

Aptamers targeting CD25, drug conjugates comprising the same, and uses thereof

[0001] The present invention relates to an aptamer targeting CD25, a drug conjugate comprising the same, and uses thereof.

[0002]

[0003] Cancer immunotherapy is a therapeutic approach that activates immune cells by strengthening the patient's own immunity to kill cancer cells. It can be applied to various types of cancer and has the advantage of showing a sustained anticancer effect because it utilizes the memory and adaptability of the immune system.

[0004] Regulatory T cells (Treg), which infiltrate tumors and are the primary targets of these immunotherapies, significantly contribute to cancer cell immune evasion by limiting the infiltration of effector T cells (Teff) into the tumor. A high Treg / Teff ratio is closely related to cancer prognosis and the limited therapeutic efficacy of immunotherapies (e.g., immune checkpoint inhibitors). Therefore, selectively eliminating intratumoral Tregs in combination with conventional immunotherapies can be expected to result in more effective anticancer effects.

[0005] However, targeting Tregs may affect not only intratumoral Tregs but also systemic Tregs, raising concerns about autoimmune side effects. Therefore, there is a need to develop a technology that minimizes the impact on systemic Tregs and specifically eliminates only Tregs that have infiltrated tumors, thereby increasing the proportion of Teff cells. The cytokine interleukin-2 (IL-2) is essential for the development and function of these Tregs. While Tregs cannot produce IL-2 on their own, they consistently express CD25 (IL-2Rα), the alpha subunit of its receptor, at high levels on their cell surface. In contrast, CD25 is absent or expressed at low levels on the surface of Teff cells. Therefore, CD25 is a potential molecule that can specifically target and deplete Tregs. Furthermore, CD25 is highly expressed in numerous hematological malignancies, including adult T-cell leukemia, acute myeloid leukemia, acute lymphoblastic leukemia, Hodgkin's lymphoma, and non-Hodgkin's lymphoma.

[0006] In this regard, previous studies have demonstrated the potential for selective elimination of Tregs through CD25 targeting in a nonclinical animal model using anti-rodent CD25 antibodies (PC61 clone) (YY Setiadyet al., Eur. J. Immunol., 2010, 40(3): 780-786), and radioimmunotherapy for CD25-positive leukemia was studied in a nonclinical animal model using radionuclide-conjugated anti-human CD25 antibodies (7G7 / B6 clone) (M. Zhang.et al., Cancer Res., 2006, 66(16): 8227 et al.).

[0007] Meanwhile, aptamers are single-stranded nucleic acids (DNA, RNA, or modified nucleic acids) that possess a stable tertiary structure and can bind to target molecules with high affinity and specificity. Since the development of the aptamer discovery technology called SELEX (Systematic Evolution of Ligands by EXponential Enrichment) in 1990, many aptamers capable of binding to various target molecules, including small-molecule organic compounds, peptides, and membrane proteins, have continued to be discovered. Because of their unique ability to bind to target molecules with high affinity (usually pM level) and specificity, aptamers are often compared to single antibodies, and are also called "chemical antibodies," showing great potential as alternative antibodies. In particular, aptamers have a shorter half-life than antibodies, so when targeting Treg, they can minimize the impact on systemic Treg, reducing the risk of autoimmune side effects.

[0008]

[0009] The present inventors have developed a CD25-targeting aptamer and a drug conjugate thereof that enable the treatment of CD25-positive blood cancer-related tumors and / or the treatment of immunotherapy-related cancers by inhibiting the binding of IL-2 to CD25 (IL-2Rα), which corresponds to the alpha subunit of its receptor, thereby inhibiting the activation of CD25-positive T cells and inducing the selective elimination of Tregs that have infiltrated into tumors, thereby completing the present invention.

[0010]

[0011] One object of the present invention is to provide a CD25 aptamer that specifically binds to the CD25 protein.

[0012] Another object of the present invention is to provide a CD25 aptamer-drug conjugate (CD25 ApDC) comprising the CD25 aptamer and one or more drugs bound to the CD25 aptamer.

[0013] Another object of the present invention is to provide a pharmaceutical composition for treating cancer, comprising the CD25 aptamer or CD25 aptamer-drug conjugate as an active ingredient.

[0014] Another object of the present invention is to provide a method for treating cancer, comprising administering the pharmaceutical composition to a subject in need thereof.

[0015]

[0016] The aptamer of the present invention specifically binds to the CD25 protein, inhibiting the binding of IL-2 to the CD25 protein and effectively suppressing the activation of CD25-positive T cells. Furthermore, drug conjugates based on this aptamer have a shorter half-life than antibodies, minimizing side effects and thus can be useful in immunotherapy and / or in the treatment of CD25-positive hematological malignancies, inducing the selective elimination of Tregs that have infiltrated tumors.

[0017]

[0018] Figure 1 shows the results of confirming the binding affinity of the aptamer of the present invention to IL-2 receptor proteins such as rhCD25 (IL-2Rα), rhCD122 (IL-2Rβ), and rhCD132 (IL-2Rγ).

[0019] Figure 2 shows the results of confirming the binding affinity of the aptamer of the present invention to IL-2 receptor proteins such as rhCD25 (IL-2Rα), rhCD122 (IL-2Rβ), and rhCD132 (IL-2Rγ).

[0020] Figure 3 shows the results of confirming the binding affinity of the aptamer of the present invention to IL-2 receptor proteins such as rhCD25 (IL-2Rα), rhCD122 (IL-2Rβ), and rhCD132 (IL-2Rγ).

[0021] Figure 4 shows the results of confirming the binding affinity and internalization of the aptamer of the present invention to CD25 positive cells or CD25 negative cells.

[0022] Figure 5 shows the results of competitive ELISA confirming the binding inhibition ability of the aptamer of the present invention to IL-2 / IL-2Rα.

[0023] Figure 6 shows the results of confirming the pSTAT5 level by IL-2 stimulation in cells treated with the aptamer of the present invention.

[0024] Figure 7 is a diagram showing the secondary structure and tertiary structure of the aptamer of the present invention.

[0025] Figure 8 shows the results of confirming the binding affinity of the aptamer of the present invention to human CD25 protein.

[0026] Figure 9 shows the results of confirming the binding ability of the aptamer of the present invention to CD25 positive cells or CD25 negative cells.

[0027] Figure 10 shows the results confirming the internalization of the aptamer of the present invention into CD25 positive cells or CD25 negative cells.

[0028] Figure 11 shows the results of confirming the internalization rate of the aptamer of the present invention into CD25 positive cells.

[0029] Figure 12 shows the results of competitive ELISA confirming the binding inhibition ability of the aptamer of the present invention to IL-2 / IL-2Rα.

[0030] Figure 13 shows the results of confirming the TGF-β level by IL-2 stimulation in cells treated with the aptamer of the present invention.

[0031] Figure 14 is a diagram showing the secondary structure of the chemically optimized CD25 combi-aptamer of the present invention.

[0032] Figure 15 is a diagram confirming the serum stability of the chemically optimized CD25 combi-aptamer of the present invention.

[0033] Figure 16 shows the results confirming internalization of the aptamer of the present invention through the endosome-lysosome pathway.

[0034] Figure 17 is a diagram showing a method for synthesizing an aptamer drug conjugate (DApR=1) of the present invention.

[0035] Figure 18 is a diagram showing a method for synthesizing an aptamer drug conjugate (DApR=3) of the present invention.

[0036] Figure 19 shows the results confirming the specific apoptosis induction of CD25 positive cells by the aptamer drug conjugate of the present invention.

[0037] Figure 20 shows the results confirming the induction of Treg cell-specific apoptosis by the aptamer drug conjugate of the present invention.

[0038]

[0039] Each description and embodiment disclosed in this invention can also be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this invention fall within the scope of this invention. Furthermore, the scope of this invention is not limited by the specific descriptions described below.

[0040] Furthermore, those skilled in the art will recognize or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific embodiments of the invention described herein. Furthermore, such equivalents are intended to be encompassed by the present invention.

[0041] Additionally, throughout the specification of the present invention, when a part is said to "include" a certain component, this does not mean that other components are excluded, but rather that other components may be further included, unless specifically stated otherwise.

[0042]

[0043] Hereinafter, the present invention will be described in more detail.

[0044]

[0045] A first aspect of the present invention provides a CD25 aptamer that specifically binds to the CD25 protein.

[0046]

[0047] For example, the aptamer may include a base sequence selected from the group consisting of the following general formulae 1 to 3 or a polynucleotide sequence having at least 80% homology or identity therewith:

[0048] [General Formula 1]

[0049] TTCGAGATCAAGTTATAGCGTGTCCCATTCTATCCAAGACACT (SEQ ID NO: 1)

[0050] [General Formula 2]

[0051] GTGTGTGTCACTCTATCGTTACGAGGAATACGGGCAAAGC (SEQ ID NO: 2)

[0052] [General Formula 3]

[0053] CGGTGCAATCGCGTGGTCAACATCCTGTTAACCTCGGAAT (SEQ ID NO: 3).

[0054]

[0055] The term "aptamer" of the present invention, also called "chemical antibody," refers to a short (20 to 120 bases) single-stranded nucleic acid molecule that has the property of binding to a wide variety of target ligands, ranging from specific compounds to proteins, with high specificity and affinity. Aptamers can be developed in vitro through SELEX (Systematic evolution of ligands by exponential enrichment).

[0056] Aptamers are considered oligonucleic acid molecules with properties similar to antibodies, possessing high binding affinity and selectivity for target proteins at the nanomolar (nM) to picomolar (pM) level. Meanwhile, compared to antibodies, aptamers have the following advantages: (1) aptamers manufactured through chemical synthesis are easier to chemically modify and more stable than protein-based materials such as antibodies; (2) selectivity and affinity can be maximized through the SELEX process; (3) purity is high because they can be manufactured through chemical synthesis; and (4) quality control of the final product is easy.

[0057] In the present invention, the term "SELEX (Systematic evolution of ligands by exponential enrichment)" refers to a method for selecting aptamers that bind to a target substance. In the case of a generally known method, a target protein is reacted with an oligonucleotide library (DNA or RNA) having a random base sequence at a certain temperature, then the DNA / RNA library that does not bind to the target is removed, the nucleotides that bind to the target are separated, and the sequence is amplified using a gene amplification method. This process is repeated several times to select aptamers that have high binding affinity to the target. The aptamer of the present invention can be manufactured using the above-described general SELEX method, but is not limited thereto.

[0058] Specifically, the aptamer screening process typically involves 10 14 10 inland 15A process is needed to secure a pool of single-stranded nucleic acids from a library containing a variety of sequences, or diversity. Various methods are employed for this purpose, but the most common are asymmetric PCR, which amplifies only one strand, and streptavidin-coated beads, which bind biotin to the end of one strand of double-stranded nucleic acids and then selectively isolate only that strand.

[0059] Afterwards, a selection process is performed to select aptamers with high binding affinity by binding the acquired library to the target molecule. If the target molecule is a protein, the biotin-labeled protein is typically pulled down using streptavidin beads. After inducing binding of the target protein to the modified nucleic acid library, the library is washed with a buffer to remove any modified nucleic acid library that does not bind to the target protein.

[0060] Similarly, in the case of plates, after inducing binding of the nucleic acid library to the target protein, the nucleic acids are washed with a buffer to remove nucleic acids that do not bind to the target protein. Using these methods, aptamers with affinity for the ligand can be obtained. Typically, 5 to 15 rounds of selection-amplification are required to obtain aptamers with high affinity. After the selection process is complete, the amplified nucleic acids are cloned, and the sequences of individual clones are confirmed through sequence analysis. Aptamers are then synthesized and their affinity and binding affinity with the target molecule are measured.

[0061] The above "target molecule" may refer to a substance that can be specifically detected using a selected aptamer. Specifically, the target molecule may be one or more selected from the group consisting of proteins, peptides, carbohydrates, polysaccharides, glycoproteins, hormones, receptors, antigens, antibodies, viruses, cofactors, drugs, dyes, growth factors, and controlled substances that can be bound to the capture aptamer, and that exist in the separated sample. For the purposes of the present invention, the target molecule may be the CD25 protein.

[0062]

[0063] The aptamer of the present invention may additionally include 1 to 30 nucleotides at at least one selected from the 5' end and the 3' end.

[0064] For example, the aptamer of the present invention may comprise a polynucleotide of any one of the general formulae 1 to 3 described above and the additional nucleotides described above at the 5' end, the 3' end, or both ends thereof, so that the aptamer of the present invention may comprise 41 to 103 nucleotides.

[0065]

[0066] The aptamer of the present invention may include at least one polynucleotide sequence selected from the group consisting of the polynucleotide sequences of general formula 1 (SEQ ID NO: 1), general formula 2 (SEQ ID NO: 2), and general formula 3 (SEQ ID NO: 3), or a polynucleotide sequence having 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity thereto. In addition, it is obvious that a polynucleotide consisting of a base sequence in which some of the sequences are deleted, modified, substituted, or added is also included within the scope of the aptamer of the present application, as long as it is a base sequence having such homology or identity and exhibiting an efficacy corresponding to the aptamer.

[0067]

[0068] As used herein, the terms "homology" or "identity" refer to the degree of resemblance between two given base sequences, which may be expressed as a percentage. The terms "homology" and "identity" are often used interchangeably.

[0069] Conserved polynucleotide sequence homology or identity is determined by standard alignment algorithms, and may be combined with default gap penalties established by the program being used. In practice, homologous or identical sequences are generally capable of hybridizing under moderate or high stringency conditions, typically along at least about 50%, 60%, 70%, 80%, or 90% of the entire sequence or its full length. Hybridization is also contemplated for polynucleotides that contain degenerate codons in place of codons in the polynucleotide.

[0070] Whether any two polynucleotide sequences are homologous, similar or identical can be determined using a well-known computer algorithm such as the "FASTA" program using default parameters, for example, as in the paper by Pearson et al. (PNAS, 1988, 85(8): 2444-2448). Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, J. Mol. Biol., 1970, 48: 443-453) as performed in the EMBOSS package (EMBOSS: The European MolecuLar Biology Open Software Suite, Rice et al., Trends Genet., 2000, 16: 276-277) (version 5.0.0 or later) can be determined using the GCG program package (Devereux et al., Nucleic Acids Research, 1984, 12: 387-395), BLASTP, BLASTN, FASTA (Atschulet al., J. Mol. Biol., 1990, 215(3): 403-410; Guide to Huge Computers, Martin J. Bishop, Academic Press, San Diego, 1994 and Carillo et al., SIAM J. Appl. Math., 1988, 48(5): 1073-1082). For example, BLAST or ClustalW from the National Center for Biotechnology Information database can be used to determine homology, similarity, or identity.

[0071] Polynucleotide homology, similarity, or identity can be determined by comparing sequence information, for example, using the GAP computer program of Needleman et al. (J Mol Biol. 1970, 48(3): 443-453), as described, for example, in the paper by Smith and Waterman (Adv. Appl. Math., 1981, 2(4): 482-489). In short, the GAP program defines the total number of symbols in the shorter of the two sequences as the number of similarly arranged symbols (i.e., nucleotides). Default parameters for the GAP program may include (1) a binary comparison matrix (containing values ​​1 for identity and 0 for non-identity) and a weighted comparison matrix (or EDNAFULL (the EMBOSS version of NCBI NUC4.4) substitution matrix) of Gribskov et al. (Nucl. Acids Res., 1986, 14(16): 6745-6763) as described by Schwartz and Dayhoff, Atlas Of Protein Sequence And Structure (National Biomedical Research Foundation, 1979, pp. 353-358); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.

[0072] Additionally, whether any two polynucleotide sequences have homology, similarity or identity can be determined by comparing the sequences by Southern hybridization experiments under defined stringent conditions, and the appropriate hybridization conditions defined are within the scope of the art and can be determined by methods well known to those skilled in the art (e.g., J. Sambrook et al., MolecuLar Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F. M. Ausubel et al., Current Protocols in MolecuLar Biology, John Wiley & Sons, Inc., New York).

[0073]

[0074] In addition, the aptamer of the present invention may include one or more modifications selected from the following in one or more nucleotides constituting its polynucleotide sequence:

[0075] i) The 5th carbon of one or more T bases in the nucleotide is substituted with one or more selected from the group consisting of a benzyl group, a naphthyl group, a 2-naphthyl group, a pyrrolebenzyl group, and a tryptophan;

[0076] ii) replacement of the -OH group at the 2nd carbon position in one or more nucleotides with one or more selected from the group consisting of deoxy, methoxy, amino and fluoro (F); and

[0077] iii) One or more T bases in the nucleotides are replaced by U Me Replace with .

[0078]

[0079] For example, the substitution of a benzyl group at the 5th carbon of the T base may be a substitution with Bn-dU (5'-(N-benzylcarboxyamide)-2'-deoxyuridine), but is not limited thereto.

[0080] As another example, the substitution of a naphthyl group at the 5th carbon of the T base is not limited to NapdU (5-(N-1-naphthylmethylcarboxyamide)-2'-deoxyuridine).

[0081] As another example, the substitution of a 2-naphthyl group at the 5th carbon of the T base may be, but is not limited to, a substitution with 2NapdU (5-(N-(2-naphthylmethyl)carboxyamide)-2'-deoxyuridine).

[0082] The above NapdU may be a substituent represented by the following chemical formula 1:

[0083] [Chemical Formula 1]

[0084] .

[0085]

[0086] In one embodiment, the aptamer of the present invention comprises a base sequence of formula 1, and the aptamer including the above-described modification may be one in which at least one nucleotide selected from the group consisting of nucleotides corresponding to positions 8, 13, 14, 16, 21, 23, 28, 29, 31, 33, and 43 in the base sequence of formula 1 is modified. For example, the nucleotides corresponding to any one, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, or 11 selected from the above-described positions may be modified. Specifically, the aptamer of the present invention may comprise at least one polynucleotide sequence selected from the group comprising the polynucleotide sequences of SEQ ID NOs: 6, 18, and 19.

[0087] In another embodiment, the aptamer of the present invention comprises a base sequence of formula 2, and the aptamer comprising the above-described modification may be one in which at least one nucleotide selected from the group consisting of nucleotides corresponding to the 2nd, 4th, 6th, 8th, 12th, 14th, 16th, 19th, 20th and 29th positions in the base sequence of formula 2 is modified. For example, the nucleotides corresponding to any one, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more or 10 selected from the above-described positions may be modified. Specifically, the aptamer of the present invention may comprise a polynucleotide sequence of SEQ ID NO: 4.

[0088] In another embodiment, the aptamer of the present invention comprises a base sequence of general formula 3, and the aptamer comprising the above-described modification may be one in which at least one nucleotide selected from the group consisting of nucleotides corresponding to positions 4, 9, 14, 17, 23, 26, 28, 29, 34, and 40 in the base sequence of general formula 3 is modified. For example, any one, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, or 10 nucleotides selected from the above-described positions may be modified. Specifically, the aptamer of the present invention may comprise a polynucleotide sequence of SEQ ID NO: 5.

[0089]

[0090] As used herein, the term "corresponding position" refers to a base (nucleotide) at a position listed in a base sequence or polynucleotide, or a base similar to, identical to, or homologous to a base listed in the base sequence or polynucleotide. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related polynucleotide or a reference polynucleotide.

[0091] In the present application, specific numbering may be used for base positions within the base sequence or polynucleotide used in the present application. For example, by aligning the base sequence of the present application with the target base sequence to be compared, it is possible to renumber positions corresponding to the base positions of the polynucleotide of the present application.

[0092]

[0093] The aptamer comprising the above-described modification in the present invention may comprise, for example, one or more polynucleotide sequences selected from the group comprising the polynucleotide sequences of SEQ ID NOs: 4, 5, 6, 18, 19, and 27, or a polynucleotide sequence having at least 90% homology thereto, but is not limited thereto.

[0094] In one embodiment, in the present invention, the CD25 protein-specific aptamer comprising the base sequence of general formula 1 may comprise at least one polynucleotide sequence selected from the group comprising the polynucleotide sequences of SEQ ID NOs: 6, 18, 19, and 27.

[0095] In another embodiment, in the present invention, the CD25 protein-specific aptamer comprising the base sequence of general formula 2 may comprise at least one polynucleotide sequence selected from the group comprising the polynucleotide sequence of SEQ ID NO: 4.

[0096] In another embodiment, in the present invention, the CD25 protein-specific aptamer comprising the base sequence of general formula 3 may comprise at least one polynucleotide sequence selected from the group comprising the polynucleotide sequence of SEQ ID NO: 5.

[0097]

[0098] For example, the substitution of the -OH group at the 2nd carbon position in the nucleotide may be, but is not limited to, a substitution with methoxy. The substitution may be uracil (U) substituted with methoxy at one or both ends of a given aptamer sequence. Me ), guanine (G Me ) or both, but is not limited thereto. For example, substitution of an -OH group at the 2nd carbon position in the nucleotide can overcome the shortcoming of the aptamer that makes it difficult to develop as a therapeutic agent due to its short half-life in plasma. In a specific embodiment of the present invention, uracil (U) substituted with methoxy is added to each of the two terminals of the CD25 aptamer of the present invention. Me ) and guanine (G Me ) was introduced to prepare a chemically optimized combi-aptamer, and it was confirmed that the aptamer had a half-life that was increased from 2.8 to 8.8 times compared to the aptamer before optimization, confirming that significantly improved plasma stability could be achieved through the substitution.

[0099] As described above, substitution of the -OH group at the 2nd carbon position in the nucleotide can provide an aptamer with improved functions such as improved plasma stability by introducing a substitution with methoxy, and such an aptamer can be named a "chemically optimized aptamer", a "CD25 combi aptamer", etc.

[0100]

[0101] The aptamer of the present invention is characterized by specifically binding to the CD25 protein. Specifically, the aptamer of the present invention can bind to the CD25 protein and act as an IL-2 antagonist. More specifically, the aptamer of the present invention can exert effects such as inhibiting the binding between CD25 and IL-2, inhibiting signal transduction induced by the binding between CD25 and IL-2, reducing the level of STAT5 phosphorylation induced by the binding between CD25 and IL-2, or reducing the level of TGF-β induced by the binding between CD25 and IL-2. Furthermore, the aptamer of the present invention can inhibit the activation of CD25-positive T cells.

[0102] In the present invention, the term "CD25" refers to a receptor subunit of the cytokine interleukin-2 (IL-2). The IL-2 receptor subunit is composed of an alpha subunit (IL-2Rα), a beta subunit (IL-2Rβ), and a gamma subunit (IL-2Rγ), and CD25 corresponds to the double alpha subunit, IL-2Rα. The CD25 may be used interchangeably with CD25 protein or IL-2Rα.

[0103] Regulatory T cells (Treg) that infiltrate tumors, a key target of immunotherapy, limit the infiltration of effector T cells (Teff) into the tumor and significantly contribute to cancer cell immune evasion. A high Treg / Teff ratio is closely related to cancer prognosis and the limited therapeutic efficacy of immunotherapy (e.g., immune checkpoint inhibitors). Therefore, selectively eliminating intratumoral Tregs in combination with conventional immunotherapy regimens can be expected to result in more effective anticancer effects.

[0104] However, targeting Tregs may affect not only intratumoral Tregs but also systemic Tregs, raising concerns about autoimmune side effects. Therefore, there is a need to develop a technology that minimizes the impact on systemic Tregs and specifically eliminates only Tregs that have infiltrated tumors, thereby increasing the proportion of Teffs. IL-2 is essential for the development and function of Tregs. Although Tregs cannot produce IL-2 on their own, they constantly express CD25 (IL-2Rα), the alpha subunit of its receptor, at high levels on their cell surface. In contrast, CD25 is absent or expressed at low levels on the surface of Teff cells. Therefore, it is one of the potential molecules that can specifically target Tregs. Furthermore, CD25 is highly expressed in many hematological malignancies, including adult T-cell leukemia, acute myeloid leukemia, acute lymphoblastic leukemia, Hodgkin's lymphoma, and non-Hodgkin's lymphoma.

[0105] In this regard, previous studies have demonstrated the potential for selective elimination of Tregs through CD25 targeting in a nonclinical animal model using anti-rodent CD25 antibodies (PC61 clone) (Setiady et al., Eur. J. Immunol., 2010, 40(3): 780-786), and radioimmunotherapy for CD25-positive leukemia was studied in a nonclinical animal model using radionuclide-conjugated anti-human CD25 antibodies (7G7 / B6 clone) (Zhang et al., Cancer Res., 2006, 66(16): 8227-8232).

[0106] Therefore, the CD25 aptamer of the present invention can specifically bind to CD25 and inhibit the binding of CD25 (IL-2Rα), which corresponds to the alpha subunit of IL-2 and its receptor, thereby inhibiting the activation of CD25-positive T cells and inducing selective elimination of Tregs that have infiltrated into tumors, thereby enabling the treatment of immunotherapy and / or tumors related to CD25-positive blood cancer.

[0107]

[0108] A second aspect of the present invention provides a CD25 aptamer-drug conjugate (CD25 ApDC) comprising the CD25 aptamer of the first aspect and one or more drugs bound to the CD25 aptamer.

[0109] The term "CD25 aptamer of the first embodiment" of the present invention is as described above.

[0110]

[0111] For example, in a CD25 aptamer-drug conjugate, the aptamer may further include at least one selected from the group consisting of PEG (polyethylene glycol), HEG (hexaethylene glycol), idT (inverted deoxythymidin), DBCO linker, azide linker, aldehyde linker, NHS linker, maleimide linker, COOH linker, biotin, a fluorescent substance, an amine linker, a thiol linker, cholesterol, and a fatty acid at either one end thereof or at any position in the polynucleotide sequence thereof for binding to the drug.

[0112]

[0113] For example, the drug may be an anti-tumor agent. Specifically, the drug may be, but is not limited to, monomethyl auristatin E (MMAE), monomethyl auristatin F (MMAF), cytarabine, gemcitabine, carboplatin, cisplatin, crizotinib, cyclophosphamide, docetaxel, doxorubicin, erlotinib, etoposide, fluorouracil, imatinib mesylate, irinotecan, methotrexate, paclitaxel, sorafinib, sunitinib, topotecan, trabectidine, vincristine, vinblastine, maytansine, DM1, DM4, calicheamicin and derivatives thereof, doxorubicin, duocarmycin and derivatives thereof, pyrrolobenzodiazepine (PBD), SN-38, α-amantine, or a tubulosin analog.

[0114]

[0115] For example, the drug may be linked to one end of the CD25 aptamer via a chemical linker, linked to the aptamer by interaction between the CD25 aptamer and the drug, or substituted on a nucleotide constituting the CD25 aptamer.

[0116] For example, the drug may be bound to either of the two terminals of the CD25 aptamer, to a nucleotide constituting the aptamer, or may be chemically bonded to at least one of a covalent bond, an ionic bond, a metal bond, a van der Waals bond, and a hydrogen bond, or may be inserted between two or more nucleotides constituting the aptamer, but is not limited thereto.

[0117] At this time, the aptamer and the drug may be combined one by one in a 1:1 ratio, or multiple drug molecules may be combined with one aptamer molecule. The number of drug molecules that can be combined with one aptamer molecule may be 1 to 3, but is not limited thereto, and may vary depending on the method of binding the drug to the aptamer. For example, when binding to one terminal of a CD25 aptamer through a chemical linker, the number of drugs that can be combined may vary depending on the type of linker, and for example, 1 to 3 drug molecules may be combined, but is not limited thereto.

[0118]

[0119] For example, the chemical linker is selected from the group consisting of 5'-thiol-modifier C6, thiol-modifier C6 SS, dithiol serinol, PC amino-modifier, 5'-amino-modifier C3, 5'-amino-modifier C6, 5'-amino-modifier C12, 5'-amino-modifier TEG, amino-modifier TEG, amino-modifier C2 dT, amino-modifier C6 dT, S-Bz-thiol-modifier C6-dT, a phosphodiester bond and a nucleotide, and a first linker, and maleimidocaproyl-valine-citrulline-p-aminobenzoyloxycarbonyl (MC-Val-Cit-PAB), a hydrazone, a peptide, a disulfide, a thioether, valine-citrulline, It may include a combination of a second linker selected from the group consisting of N-maleimidomethylcyclohexane-1-carboxylate (MCC), maleimidocaproyl, mercaptoacetamidocaproyl, N-succinimidyl 4-(2-pyridylthio) pentanoate (SPP), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), N-succinimidyl 4-(2-pyridylthio) pentanoate (SPDB), a phosphodiester bond, and a nucleotide.

[0120]

[0121] The CD25 aptamer-drug conjugate of the present invention can be manufactured by a method known in the art, for example, a general oligonucleotide synthesis method, a method of reacting a nucleic acid aptamer with a drug, etc., but is not limited thereto.

[0122] The above oligonucleotide synthesis method may specifically be a method of manufacturing an aptamer including a modified nucleic acid in the aptamer sequence by adding a modified nucleic acid instead of a base during nucleic acid aptamer synthesis, but is not limited thereto.

[0123] The method for reacting the nucleic acid aptamer with a drug may specifically include an aptamer preparation step of preparing a nucleic acid aptamer having an aptamer base sequence that specifically binds to CD25; and a drug conjugate formation step of reacting the nucleic acid aptamer with a drug to form a drug conjugate. The drug conjugate formation step may be, for example, a step of adding a drug and an activator dissolved in dimethyl sulfoxide (DMSO) to the nucleic acid aptamer and reacting the drug for several minutes, but is not limited thereto.

[0124] Specific reactions for synthesizing the above CD25 aptamer-drug conjugate can be exemplified as follows.

[0125]

[0126] Another specific reaction for synthesizing the above drug conjugate can be exemplified as follows.

[0127]

[0128]

[0129] For example, the CD25 aptamer-drug conjugate of the present invention can selectively eliminate Tregs.

[0130] In a specific embodiment of the present invention, it was confirmed that the CD25 aptamer-drug conjugates of the present invention, CD25-MMAE(1)(DAqR=1) and CD25-MMAE(3)(DAqR=3), did not cause toxicity in CD25-negative cell lines, but selectively showed toxicity in CD25-positive Treg-like cell lines (Fig. 19). Furthermore, it was confirmed that in a co-culture state of a CD25-positive Treg-like cell line and a CD25-negative cell line, a selective killing effect was exerted only on the CD25-positive Treg-like cell line (Fig. 20).

[0131]

[0132] The third aspect of the present invention provides a pharmaceutical composition for treating cancer, comprising the CD25 aptamer of the first aspect or the CD25 aptamer-drug conjugate of the second aspect as an active ingredient.

[0133] The terms of the present invention, “CD25 aptamer of the first aspect” and “CD25 aptamer-drug conjugate of the second aspect” are as described above.

[0134]

[0135] The term "treatment" in the present invention means any action by which the symptoms of a cancer disease are improved or beneficially changed by administration of the composition of the present invention.

[0136] As described above, the CD25 aptamer of the present invention can act as an IL-2 antagonist by binding to the CD25 protein, and specifically, exhibits effects such as inhibiting the binding between CD25 and IL-2, inhibiting signal transduction by the binding between CD25 and IL-2, reducing the level of STAT5 phosphorylation by the binding between CD25 and IL-2, or reducing the level of TGF-β by the binding between CD25 and IL-2, and can suppress the activation of CD25-positive T cells. The CD25 aptamer-drug conjugate can selectively remove Tregs and exhibit a selective killing effect only on CD25-positive Treg-like cell lines, and therefore, a pharmaceutical composition containing the same as an active ingredient can be useful for the treatment of cancer diseases related thereto. For example, the pharmaceutical composition of the present invention can be used for the treatment of lung cancer such as non-small cell lung cancer, small cell lung cancer, and malignant mesothelioma; mesothelioma; pancreatic cancer such as pancreatic ductal cancer and pancreatic endocrine tumor; pharyngeal cancer; laryngeal cancer; esophageal cancer; Gastric cancers such as papillary adenocarcinoma, mucinous adenocarcinoma, and adenosquamous carcinoma; duodenal cancer; small intestine cancer; colorectal cancers such as colon cancer, rectal cancer, anal cancer, familial colorectal cancer, hereditary nonpolyposis colorectal cancer, and gastrointestinal stromal tumor; breast cancers such as invasive ductal carcinoma, noninvasive ductal carcinoma, and inflammatory breast cancer; ovarian cancers such as epithelial ovarian carcinoma, extratesticular germ cell tumor, ovarian germ cell tumor, and ovarian low-grade tumor; testicular tumors; prostate cancers such as hormone-dependent prostate cancer and hormone-independent prostate cancer; liver cancers such as hepatocellular carcinoma, primary liver cancer, and extrahepatic cholangiocarcinoma; thyroid cancers such as medullary thyroid carcinoma; kidney cancers such as renal cell carcinoma and transitional carcinoma of the renal pelvis and ureter; uterine cancers such as cervical cancer, endometrial cancer, and uterine sarcoma; Brain tumors such as medulloblastoma, glioma, pineal astrocytoma, pilocytic astrocytoma, diffuse astrocytoma, anaplastic astrocytoma, and pituitary adenoma; retinoblastoma; skin cancers such as basal cell carcinoma and malignant melanoma; sarcomas such as rhabdomyosarcoma, leiomyosarcoma, and soft tissue sarcoma; malignant bone tumors; and bladder cancer, but are not limited thereto.Furthermore, CD25 expression has been reported for several B- and T-cell-derived subtypes of non-Hodgkin's lymphoma, namely B-cell chronic lymphocytic leukemia, hairy cell leukemia, small cell lymphocytic lymphoma / chronic lymphocytic leukemia, as well as adult T-cell leukemia / lymphoma and anaplastic large cell lymphoma, and thus may also be useful in the treatment of these diseases.

[0137]

[0138] Preferably, the pharmaceutical composition according to the present invention may contain CD25 aptamer or CD25 aptamer-drug conjugate as an active ingredient in an amount of 0.0001 to 75 wt%, for example, 0.001 to 50 wt%, 0.0001 to 10 wt%, 0.001 to 10 wt%, or 0.001 to 1 wt%, based on the total weight of the composition.

[0139] The composition of the present invention may additionally contain a pharmaceutically acceptable carrier, diluent or excipient, and may be formulated and used in various forms, such as oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups and aerosols, and injections of sterile injection solutions, according to conventional methods according to each intended use, and may be administered orally or through various routes, including intravenous, intraperitoneal, subcutaneous, rectal and topical administration. Examples of suitable carriers, excipients or diluents that may be included in such compositions include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In addition, the compositions of the present invention may further include fillers, anticoagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives and the like.

[0140] Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations are formulated by mixing at least one excipient, such as starch, calcium carbonate, sucrose, lactose, gelatin, etc., with the above composition. In addition to simple excipients, lubricants such as magnesium stearate and talc may be used.

[0141] Oral liquid preparations include suspensions, solutions, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, flavoring agents, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin.

[0142] Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solutions and suspensions can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases include withepsol, macrogol, Tween 61, cacao butter, laurin, and glycerogelatin. Injections can also include conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifiers, stabilizers, and preservatives.

[0143]

[0144] At this time, the composition of the present invention is administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount" as used herein means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment and not causing side effects. The effective dosage level may be determined based on factors including the patient's health condition, the type and severity of the disease, the activity and sensitivity of the drug, the method of administration, the time of administration, the route and excretion rate, the duration of treatment, drugs used in combination or simultaneously, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or in multiple doses. It is important to administer an amount that can achieve the maximum effect with the minimum amount without side effects by taking all of the above factors into consideration, and this can be easily determined by those skilled in the art.

[0145] For example, the dosage may increase or decrease depending on the route of administration, severity of disease, gender, weight, age, etc., and thus the dosage does not limit the scope of the present invention in any way.

[0146] Specifically, the effective amount of the compound in the composition of the present invention may vary depending on the patient's age, sex, and weight, and is generally 0.001 to 1000 mg per kg of body weight, specifically 0.05 to 2000 mg, and more specifically 0.1 to 100 mg per kg of body weight, administered daily or every other day, or administered once or several times a day in divided doses. However, the dosage may increase or decrease depending on the route of administration, severity of the disease, sex, body weight, age, etc., and thus the above dosage does not limit the scope of the present invention in any way.

[0147]

[0148] The fourth aspect of the present invention provides a method for treating cancer, comprising administering the pharmaceutical composition of the third aspect to a subject in need thereof.

[0149] The terms of the present invention, “pharmaceutical composition of the third aspect”, “cancer disease” and “treatment” are as described above.

[0150]

[0151] The term "subject" of the present invention refers to any animal, including humans, monkeys, cows, horses, sheep, pigs, chickens, turkeys, quails, cats, dogs, mice, rats, rabbits, or guinea pigs, that has developed or can develop the cancer disease, and the disease can be effectively treated by administering the pharmaceutical composition of the present invention to the subject. The pharmaceutical composition of the present invention can be administered in combination with existing therapeutic agents.

[0152] The term "administration" in the present invention means providing a predetermined substance to a patient by any suitable method, and the route of administration of the composition of the present invention may be administered through any common route as long as it can reach the target tissue. It may be intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, intranasal administration, intrapulmonary administration, or rectal administration, but is not limited thereto. In addition, the pharmaceutical composition of the present invention may be administered by any device that allows the active substance to travel to the target cell. Preferred administration methods and formulations include intravenous injection, subcutaneous injection, intradermal injection, intramuscular injection, and drip injection. Injectables can be manufactured using aqueous solvents such as saline solution and Ringer's solution, non-aqueous solvents such as vegetable oils, higher fatty acid esters (e.g., ethyl oleate, etc.), alcohols (e.g., ethanol, benzyl alcohol, propylene glycol, glycerin, etc.), and pharmaceutical carriers such as stabilizers to prevent deterioration (e.g., ascorbic acid, sodium bisulfite, sodium pyrosulfite, BHA, tocopherol, EDTA, etc.), emulsifiers, buffers to adjust pH, and preservatives to inhibit microbial growth (e.g., phenylmercuric nitrate, thimerosal, benzalkonium chloride, phenol, cresol, benzyl alcohol, etc.).

[0153] The term “therapeutically effective amount” used in combination with an active ingredient in the present invention means an amount of a CD25 aptamer or CD25 aptamer-drug conjugate that is effective in treating a target disease.

[0154] Depending on the type of disease to be prevented or treated, the pharmaceutical composition of the present invention may additionally contain, as an active ingredient, a known drug used for the prevention or treatment of each disease other than the CD25 aptamer or the CD25 aptamer-drug conjugate. For example, when used for the prevention or treatment of cancer, the pharmaceutical composition of the present invention may additionally contain, as an active ingredient, a known drug other than the CD25 aptamer or the CD25 aptamer-drug conjugate, and may be used in combination with other known treatments for the treatment of these diseases.

[0155]

[0156] Hereinafter, the present invention will be described in more detail through examples. However, these examples are intended to illustrate the present invention and the scope of the present invention is not limited to these examples.

[0157]

[0158] Example 1: Production of CD25 protein-specific aptamer

[0159]

[0160] As a CD25 protein-specific aptamer, a total of three aptamers that bind to the CD25 (IL-2Rα) protein corresponding to the alpha subunit of the interleukin-2 (IL-2) receptor were discovered through SELEX (Systematic evolution of ligands by exponential enrichment), a general process for discovering aptamers, and the selected sequences were chemically synthesized to produce them as shown in Table 1 below.

[0161] Sequence Number Name Sequence (5'→3') Length 4CD25-2218-11-02AGTTCGTGTGTGTCACTCTATCGTTACGAGGAATACGGGCAAAGCGACCA50mer5CD25-2235-15-02AGTTCCGGTGC AATCCGTGGTCAACATCCTGTTAACCTCGGAATGACCA50mer6CD25-2264-10-02AGTTCGAGATCAAGTTATAGCGTGTCCCATTCTATCCAAGACACTGACCA50mer

[0162] The bolded bases above represent thymine or uracil bases substituted with NapdU (5-naphthylmethylaminocarbonyl-dU).

[0163]

[0164] Example 2: Confirmation of binding affinity, cell binding, and internalization of CD25 aptamer to CD25 protein.

[0165]

[0166] 2-1. Binding affinity of CD25 aptamer to IL-2 receptor protein

[0167] To confirm the binding affinity of the three aptamers obtained from Example 1 to the CD25 protein, the three aptamers were mixed with 1× SB18 T0.05 A 1 nM aptamer solution of 100 μL was prepared by diluting in buffer (200 mM HEPES (hydroxyethyl piperazine ethane sulfonic acid), 510 mM NaCl, 25 mM MgCl2, 25 mM KCl, 0.05% [v / v] tween-20), and heated at 95°C, 70°C, 48°C, and 37°C for 5 minutes each, and then cooled to room temperature (RT) for 15 minutes to perform heating and cooling of the aptamer. 100 nM of rhCD25 (IL-2Rα), rhCD122 (IL-2Rβ), and rhCD132 (IL-2Rγ) proteins as recombinant human IL-2 receptor proteins were added to 1× SB18T0.05 After serially diluting 4.64 times to 7 points using buffer, 30 μL was dispensed into a 96-well plate. 1× SB18 was added to the heated and cooled aptamer. T0.05 After adding 200 μL of buffer and mixing, 30 μL was added to each well of a 96-well plate and the aptamer and protein binding reaction was performed at 37°C for 30 minutes. 5.5 μL of 400 mg / mL zorbax beads were added to each well and the reaction was performed in a thermomixer at 1400 rpm for 5 minutes. The completed reaction product was pre-mixed with 1× SB18 T0.05 Place on a Durapore filter plate (hydrophilic low protein binding Durapore 0.45 μm filter plate) moistened with 30 μL of buffer, vacuum to remove the buffer, and then add 1× SB18 T0.05 Washed three times with 200 uL of buffer.

[0168] 20 μL of 8 mM HCl was added to a 1 mL deep-well plate, a filter plate was placed on top, and 80 μL of 2 mM NaCl was added to the well where the aptamer and protein binding reaction was performed. The mixture was reacted in a thermomixer at 1000 rpm for 5 minutes to elute the protein-bound aptamer. The eluted aptamer solution was centrifuged at 1000 rpm for 1 minute, and the HCl solution in the deep-well plate was mixed to neutralize. 0.04 μL each of the 100 μM forward primer and reverse primer, AccuPower ®10 μL of 2X GreenStar™ qPCR MasterMix (-ROX Dye, Bioneer), 0.1 μL of 1 M MgCl2, and 9.82 μL of the eluted aptamer solution were mixed to make a total of 20 μL, and then amplified by qPCR. The forward and reverse primer sequences used are shown in Table 2. The PCR conditions were 96°C for 15 s, 55°C for 10 s, and 68°C for 30 min once, and then 40 cycles of 96°C for 15 s and 72°C for 1 min. The Ct values ​​were normalized to the standard, and Kd was calculated using SigmaPlot.

[0169] Sequence number name sequence (5'→3')72218-11-02-ForGGA GTT CGT GTG TGT CAC TCT ATC GTT82218-11-02-RevGTC GCT TTG CCC GTA TTC CTC G92235-15-02-ForGTT CCG GTG CAA TCG CGT G102235-15-02-RevGGA GGT CAT TCC GAG GTT AAC AGG A112264-10-02-ForGGA GTT CGA GAT CAA GTT ATA GCG TGT CC122264-10-02-RevGGA GGT CAG TGT CTT GGA TAG AAT GGG

[0170] As a result, as shown in Figures 1 to 3, all three aptamers exhibited high binding affinity of less than nM to the human CD25 (IL-2Rα) protein corresponding to the alpha subunit of the human IL-2 receptor, and 2264-10-02 (SEQ ID NO: 6) had the best CD25 protein binding affinity.

[0171] In addition, all three aptamers did not show binding affinity to human CD122 (IL-2Rβ) and CD132 (IL-2Rγ), which correspond to the beta subunit and gamma subunit of the human IL-2 receptor, respectively, and thus were confirmed to specifically bind to CD25 (IL-2Rα).

[0172]

[0173] 2-2. Cell binding affinity of CD25 aptamer

[0174] To confirm the cell binding ability of the three aptamers of Example 1 above, 1×10 Karpas299 cells, which are CD25 positive cells, or Daudi cells, which are CD25 negative cells 6 After counting cells / samples and collecting them in FACS (Fluorescence-activated cell sorting) tubes, centrifugation was performed at 1000 rpm for 3 minutes at 4°C and washing once with 1× PBS (Phosphate-buffered saline) buffer. After heating at 95°C for 5 minutes and cooling at room temperature for 15 minutes, the three types of heated and cooled aptamers were diluted to a final concentration of 100 nM using ice-cold FACS buffer (1× PBS buffer containing 5 mM MgCl2) and treated to the cells, and incubated for 30 minutes at 4°C in the dark. Centrifugation was performed at 1000 rpm for 3 minutes at 4°C, the supernatant was discarded, and 2 mL of 1× PBS buffer was added, mixed slowly, and washing was repeated three times. Centrifuge again at 1000 rpm for 3 minutes at 4°C, discard the supernatant, add 1 mL of FACS buffer, transfer to a new strainer cap FACS tube, and measure using flow cytometry equipment (BD FACS Calibur).

[0175] As a result, as shown in Fig. 4, it was confirmed that all three aptamers specifically bound to the CD25-positive cell line Karaps299. In addition, the fluorescence intensity was highest in the order of 2218-11-02, 2235-15-02, and 2264-10-02, confirming that the 2264-10-02 aptamer had the best cell binding ability.

[0176]

[0177] 2-3. Internalization of CD25 aptamer

[0178] To confirm the internalization of the three aptamers of Example 1, cover glasses were sterilized by fire and prepared on a 6-well plate. Poly-L-lysine (PLL) solution was treated on the cover glasses at room temperature for 15 minutes, and then washed three times with sterilized distilled water filtered to 0.45 μm. The cover glasses were dried overnight using a UV lamp on a clean bench to remove moisture, and a 6-well plate equipped with a PLL-coated cover glass was manufactured. Karpas299 cells were seeded at 1 × 10 on the 6-well plate equipped with the PLL-coated cover glass. 6 After seeding with cells / samples, the cells were cultured at room temperature for 10 minutes. After heating at 95℃ for 5 minutes and cooling at room temperature for 15 minutes, the three heated and cooled aptamers were diluted to a final concentration of 50 nM using FACS buffer and treated to the cells, and cultured in the dark at 4℃ for 1 hour. After 4 hours, 1× PBS buffer was added, and after 5 minutes at room temperature, the 1× PBS buffer was removed, which was repeated three times. The residual solution was removed by suction and washed using 1× PBS buffer. Complete medium (RPMI1640 medium containing 10% FBS (Fetal bovine serum) and 1% penicillin / streptomycin) was added, and the cells were cultured for 4 hours in a CO2 incubator, and washed three times using 1× PBS buffer. Each well was filled with PBS buffer containing 4% PFA (paraformaldehyde), and the cells were fixed for 15 minutes at 4°C in the dark. Then, they were washed three times with 1× PBS buffer. A mounting solution containing DAPI (4',6'-diamidino-2-phenylindole) was dropped onto a slide glass, covered with a cover glass, and staining and mounting were performed. These were stored in a light-shielding box and refrigerated, and measurements were taken the following day using a confocal device (LSM800).

[0179] As a result, as shown in Fig. 4, all three aptamers were observed to bind to the cell surface at 0 hr and were confirmed to be internalized into the cytoplasm at 4 hr. From the above results, it can be seen that the three aptamers can bind to the CD25 protein on the cell surface and then enter CD25-positive cells through the receptor-mediated endocytosis (RME) mechanism.

[0180]

[0181] Example 3: Confirmation of binding of IL-2 / IL-2Rα by CD25 aptamer and subsequent inhibition of cell signaling

[0182]

[0183] 3-1. Inhibition of IL-2 / IL-2Rα binding by CD25 aptamer

[0184] To confirm whether the three aptamers of Example 1 inhibit the binding of IL-2 / IL-2Rα, 100 μL of 100 ng / mL rhCD25 protein was added to a 96-well ELISA (enzyme-linked immunosorbent assay) plate and incubated overnight on a shaker to coat the inside of the wells with rhCD25 protein. After removing the residual solution from the wells, they were washed three times using 200 μL of 1× PBST buffer (PBS buffer containing 0.1% Tween 20). 50 μL of each of the three aptamers, diluted in FACS buffer to a final concentration of 100 nM, 50 nM, and 10 nM, were added to each well coated with CD25 protein and reacted at 400 rpm for 30 minutes at room temperature using a Thermomixer. After removing the residual solution, 50 μL of 50 ng / mL biotin-conjugated IL-2 protein was added to each well and reacted at 400 rpm for 1 hour and 30 minutes at room temperature. After removing the residual solution, the wells were washed three times with 200 μL of 1× PBST buffer. 100 μL of HRP (horseradish peroxidase)-streptavidin solution was added to each well and reacted at 400 rpm for 30 minutes at room temperature. After removing the residual solution, the wells were washed three times with 200 μL of 1× PBST buffer. 50 μL of TMB (3,3',5,5'-tetramethylbenzidine) substrate solution was added to each well and reacted at 400 rpm for 1 hour and 30 minutes at room temperature. 50 μL of the stop solution was added to each well, and the OD value was measured at 450 nm using a plate reader. The percentage for the control group was calculated from the measured value, and the results are shown in Figure 5.

[0185] As a result, as shown in Fig. 5, it was confirmed that all three types of aptamers bind to the CD25 protein in the competitive ELISA, and that the IL-2 protein and the aptamer act as the same binding site.

[0186]

[0187] 3-2. Inhibition of IL-2 / IL-2Rα cell signaling by CD25 aptamer

[0188] To confirm the change in the level of STAT5 phosphorylation (pSTAT5) in the IL-2 / IL-2Rα cell signaling pathway by treatment with 2264-10-02 in Example 1 above, Karpas299 cells were seeded in 6-well plates at a density of 1×10 6 Cells / samples were seeded and cultured overnight to induce serum starvation. Aptamer 2264-10-02 was diluted in FACS buffer to final concentrations of 100 nM, 50 nM, and 10 nM, and cells were treated. After 30 min, IL-2 protein was treated to a final concentration of 10 U / mL, and Western blot was performed 15 min later.

[0189] To perform Western blot, cells treated as above were homogenized by mixing with 1× RIPA buffer (50 mmol / L Tris, pH 8.0, containing 1% NP-40, 0.5% sodium deoxycholate (DOC), 0.1% SDS, and 150 mmol / L NaCl; Sigma-Aldrich) and 1× protease inhibitor. Next, the sample was mixed with 5× loading buffer and boiled at 100°C for 10 min. Ten μg of extracted protein was separated by SDS-PAGE on a 12% polyacrylamide gel and transferred to a nitrocellulose membrane (10600001, GE Healthcare). Protein concentration was quantified using the Quick Start Bradford protein assay (Bio-Rad). The membrane was blocked with 5% bovine serum albumin (BSA) and incubated with primary antibodies overnight at 4°C. The membrane was washed three times with Tris-buffered saline (TBS) containing 0.1% Triton X-100 and then incubated with secondary antibodies for 2 h at room temperature. Each protein band was visualized using an ECL kit (DG-WF200; Dogen) and quantified using ImageJ (NIH) software, and the results are shown in Figure 6. The antibodies used were anti-pSTAT5 and anti-β-actin, and β-actin was used as a loading control.

[0190] As a result, as shown in Fig. 6, it was confirmed that the pSTAT5 level induced by IL-2 stimulation decreased when 2264-10-02 was treated. As the concentration of the treated aptamer increased to 25, 50, and 100 nM, the pSTAT5 expression level induced by IL-2 stimulation decreased to 85, 65, and 42%, respectively, and the approximate IC50 value was confirmed to be 73.96 nM.

[0191] As confirmed above, the aptamer of the present invention effectively inhibits signal transduction by inhibiting the binding between CD25 and IL-2, thereby reducing the level of pSTAT5, and thus has the effect of inhibiting the activity of CD25-positive cells.

[0192]

[0193] Example 4: Optimization of CD25 Aptamer Length

[0194]

[0195] In order to optimize the length of aptamer 2264-10-02, which was confirmed to have the best cell binding ability to CD25 positive cells in Example 2-2 above, a total of 7 aptamers having the minimum length (46, 43, 40, 39, 33, 30, 27mer) that maintains the stem and loop regions were additionally produced as shown in Table 2 below by simulating the secondary structure through RNAstructure and the tertiary structure through RNAComposer (Fig. 7).

[0196] Sequence Number Name Sequence (5'→3') Length6CD25-2264-10-02AGTTCGAGATCAAGTTATAGCGTGTCCCATTCTATCCAAGACACTGACCA50mer13CD25-2264-10-05GCGTGTCCCATTCTATCCA AGACACTG27mer14CD25-2264-10-06GAGATCAAGTTATAGCGTGTCCCATTCTATCCAAGACACT40mer15CD25-2264-10-07ATCAAGTTATAGCGTGTCCCATTCTATCCAAGA CACTG38mer16CD25-2264-10-08GTTATAGCGTGTCCCATTCTATCCAAGACACTG33mer17CD25-2264-10-09ATAGCGTGTCCCATTCTATCCAAGACACTG30mer18CD25-2 264-10-10TTCGAGATCAAGTTATAGCGTGTCCCATTCTATCCAAGACACTGAC46mer19CD25-2264-10-11TTCGAGATCAAGTTATAGCGTGTCCCATTCTATCCAAGACACT43mer

[0197] The bolded bases above represent thymine or uracil bases substituted with NapdU (5-naphthylmethylaminocarbonyl-dU).

[0198]

[0199] Example 5: Confirmation of binding affinity, cell binding, and internalization of length-optimized CD25 aptamers to CD25 protein.

[0200]

[0201] 5-1. Binding affinity of length-optimized CD25 aptamer to CD25 protein

[0202] In order to confirm the binding affinity of the seven aptamers of Example 4 to the CD25 protein, a binding reaction with rhCD25 (IL-2Rα) protein was performed using the method of Example 2-1, and the Ct value was normalized to the standard, and then Kd was calculated using SigmaPlot, and the results are shown in Figure 8. The forward and reverse primer sequences used are as follows (Table 4).

[0203] Sequence number name sequence (5'→3') 202264-10, 27~38mer ForGGA CGA GCA GCG TGT CCC ATT C212264-10, 27~38mer RevGGA CGA GCA AGT GTC TTG GAT AG222264-10, 40~46mer ForGGA CGA GCA GAG ATC AAG TTA TAG CG232264-10, 40~46mer RevGGA CGA GCA AGT GTC TTG GAT AGA ATG

[0204] As a result, as shown in Fig. 8, among the seven aptamers, it was confirmed that CD25-2264-10-10 (SEQ ID NO: 18) and CD25-2264-10-11 (SEQ ID NO: 19), which have a length of 46mer and 43mer, respectively, have binding affinity to human CD25 protein.

[0205] Accordingly, it can be seen that the 5'-terminal helical structure of the aptamer's tertiary structure is important for binding to the CD25 protein.

[0206]

[0207] 5-2. Cell binding affinity of length-optimized CD25 aptamers

[0208] In order to confirm the cell binding ability of 2264-10-02 of the above Example 1 and CD25-2264-10-10 and CD25-2264-10-11 having optimized lengths of 46mer and 43mer of the above Example 4, a binding reaction was performed on Karpas299 cells or Daudi cells using the method of the above Example 2-2, and measured using a flow cytometry equipment (Beckman CytoFlex), and the results are shown in Fig. 9.

[0209] As a result, as shown in Fig. 9, it was confirmed that both aptamer 2264-10-02 and its length-optimized CD25-2264-10-10 and CD25-2264-10-11 exhibited binding affinity to CD25-positive cells compared to the negative control aptamer (NC aptamer) and CD25-negative cells.

[0210]

[0211] 5-3. Internalization of length-optimized CD25 aptamers

[0212] To confirm the internalization of CD25-2264-10-11 having a length of 43mer, which was confirmed to have excellent cell binding ability according to the above Example 5-2, an internalization reaction was performed on Karpas299 cells or Daudi cells using the method of the above Example 2-3, and measured using a confocal device (LSM800). The negative control aptamer (NC aptamer) used was an NC aptamer having the same sequence as the 2264-10-11 aptamer, but in which the thymine base was not substituted with NapdU (Table 5).

[0213] Sequence number name sequence (5'→3') 24NC aptamer TTCGAGATCAAGTTATAGCGTGTCCCATTCTATCCAAGACACT

[0214] As a result, as shown in Fig. 10, it was confirmed that the length-optimized CD25-2264-10-11 exhibited selective internalization for CD25 positive cells.

[0215]

[0216] 5-4. Internalization rate of length-optimized CD25 aptamers

[0217] To confirm the internalization rate of CD25-2264-10-11 of Example 4 above, Karpas299 cells were cultured at 1×10 6 After counting cells / samples and collecting them in FACS tubes, centrifugation was performed at 1000 rpm for 3 minutes at 4°C and washing once with 1× PBS buffer. After resuspending the cells in ice-cold 1× PBS buffer, pre-chilling was performed at 4°C for 30 minutes, centrifugation was performed at 1000 rpm for 3 minutes at 4°C and the supernatant was removed. After heating at 95°C for 5 minutes and cooling at room temperature for 15 minutes, the heated and cooled aptamer was diluted to a final concentration of 100 nM using ice-cold FACS buffer and treated to the cells. The cells were then incubated in the dark at 4°C for 30 minutes. Centrifugation was performed at 1000 rpm for 3 minutes at 4°C, the supernatant was discarded, and 2 mL of 1× PBS buffer was added and mixed slowly for washing. Complete medium was added and incubated in a CO2 incubator at 37℃ for 15, 30, 60, 120, 240, and 300 minutes. Centrifugation was performed at 1000 rpm for 3 minutes at 4℃, the supernatant was discarded, and 2 mL of 1× PBS buffer was added and mixed gently to wash. The FACS tube was divided into two, one tube containing PBS buffer for cell binding conditions, and the other tube containing buffer containing 0.1 M glycine at pH 10.0 and 4 g / L NaCl for internalization conditions. After incubation at 37℃ for 15 minutes, the internalization rate at each time was calculated using the following equation through the MFI (Median fluorescence intensity) value measured using a flow cytometry equipment (Beckman CytoFlex).

[0218]

[0219] As a result, as shown in Figure 11, the internalization rate of aptamer CD25-2264-10-11 was 92% at 30 minutes of incubation, confirming that the internalization speed was fast (Half-time: 9.9 min (95% CI - 8.2~12.6 min)).

[0220]

[0221] Example 6: Confirmation of IL-2 / IL-2Rα binding and subsequent inhibition of cell signaling by length-optimized CD25 aptamer.

[0222]

[0223] 6-1. Inhibition of IL-2 / IL-2Rα binding by length-optimized CD25 aptamers

[0224] To confirm whether CD25-2264-10-11 of Example 4 inhibits the binding of IL-2 / IL-2Rα, a 96-well ELISA plate was coated with 200 ng / mL rhCD25 protein using the method of Example 3-1. 50 μL of aptamer, serially diluted 4.64-fold from 1 nM to 100 nM, was added to each well coated with CD25 protein and reacted at 400 rpm for 30 minutes at room temperature using a thermomixer. After removing the residual solution, 50 μL of 400 ng / mL biotin-conjugated IL-2 protein was added to each well and reacted at 400 rpm for 1 hour and 30 minutes at room temperature using a thermomixer. The subsequent process was performed in the same manner as in Example 3-1, and the OD value was measured at 450 nm using a plate reader. The percentage for the control group was calculated from the above measurement values, and the results are shown in Figure 12.

[0225] As a result, as shown in Fig. 12, it was confirmed that the aptamer CD25-2264-10-11 acted as an antagonist in the competitive ELISA.

[0226]

[0227] 6-2. Inhibition of IL-2 / IL-2Rα Cell Signaling by Length-Optimized CD25 Aptamer

[0228] To confirm the change in the mRNA level of TGF-β (Transforming Growth Factor-β) in the IL-2 / IL-2Rα cell signaling pathway by CD25-2264-10-11 treatment in Example 4 above, Karpas299 cells were seeded in a 6-well plate at a density of 1×10 6 Cells / samples were seeded and cultured overnight to induce serum starvation. CD25-2264-10-11 aptamer diluted in FACS buffer to final concentrations of 200 nM, 100 nM, and 50 nM was treated to the cells. After 30 min, IL-2 protein was treated to the cells at a final concentration of 10 U / mL. After 24 h, tRNA was recovered from each sample using an RNA extraction kit (Qiagen). cDNA was synthesized from 1 μg tRNA using a cDNA synthesis kit (Takara), and qPCR was performed using this as a template. For this, 0.4 μL of 10 μM forward primer and reverse primer, AccuPower ® 2× GreenStar™ qPCR MasterMix (-ROX Dye, Bioneer) 10 μL, cDNA template 2 μL, and dw 7.2 μL were mixed to make a total volume of 20 μL, and then amplified by qPCR. The PCR conditions were 95°C for 2 minutes, 40 cycles of 95°C for 15 seconds, 65°C for 30 seconds, and 72°C for 30 seconds. The primer sequences used are shown in Table 6 below. Furthermore, the normalized TGF-β mRNA expression level was calculated and shown in Figure 13.

[0229] Sequence number name sequence (5'→3') 25TGF-β-ForGGC CAG ATC CTG TCC AAG C26TGF-β-RevGTG GGT TTC CAC CAT TAG CAC

[0230] As a result, as shown in Fig. 13, it was confirmed that when the CD25-2264-10-11 aptamer was treated, the increase in TGF-β mRNA expression induced by IL-2 stimulation was significantly reduced. Specifically, as the concentration of the aptamer increased to 50 nM, 100 nM, and 200 nM, the level of TGF-β mRNA expression induced by IL-2 stimulation decreased to 23%, 5%, and 4%, respectively, and the approximate IC50 value was confirmed to be 29.07 nM.

[0231] As confirmed above, this indicates that the aptamer of the present invention can exert an effect of suppressing the activity of CD25 positive regulatory Tregs by effectively inhibiting the signal transduction resulting from the inhibition of binding between CD25 and IL-2, thereby reducing the level of TGF-β.

[0232]

[0233] Example 7: Chemical Optimization of Length-Optimized CD25 Aptamers

[0234]

[0235] In order to chemically optimize the aptamer CD25-2264-10-11 produced in Example 4, a uracil (U) base (U) with the -OH group substituted with methoxy at the 2nd carbon position in the nucleotide at the 5' end of the aptamer sequence was added as shown in Table 3 below. Me ) was additionally introduced, and a guanine (G) base (G) substituted with methoxy was added to the 3' end of the aptamer sequence. Me ) was introduced and modified (Fig. 14). The chemically optimized CD 25 aptamer sequence as described above is shown in Table 7 below along with the basic sequence.

[0236] Sequence number name sequence (5'→3') 19CD25-2264-10-11TTCGAGATCAAGTTATAGCGTGTCCCATTCTATCCAAGACACT27CD25-combiU MeTCGAGATCAAGTTATAGCGTGTCCCATTCTATCCAAGACACTG Me

[0237] The bolded bases above represent thymine or uracil bases substituted with NapdU (5-naphthylmethylaminocarbonyl-dU).

[0238]

[0239] Example 8: Confirmation of Plasma Stability of Chemically Optimized CD25 Aptamer

[0240]

[0241] The plasma stability of the chemically optimized CD25 combi-aptamer produced in Example 7 above was confirmed.

[0242] Specifically, 10 μL of 10 μM CD25-2264-10-11 (SEQ ID NO: 19) and CD25_combi aptamers (SEQ ID NO: 27) were treated to 45 μL of 100% mouse plasma and incubated at 37°C for 0, 4, 24, 48, and 72 hours. After the incubation, 5 μL of 10 μM control aptamer (random sequence with a length of 74mer) was treated and then diluted with 165 μL of distilled water. An equal volume of phenol: chloroform: isoamyl alcohol = 25:24:1 [v / v] mixed solvent was added to the sample and mixed using a vortex mixer for 20 seconds. The mixture was centrifuged at 16,000 × g for 10 min at room temperature, and the supernatant was transferred to a new tube. Five sample buffers were added to the supernatant and heated at 95°C for 5 min. The samples were added to Urea PAGE and electrophoresed at 220 V for 25 min. The gel was stained with SYBR Gold and the gel images were analyzed using a Gel Doc™ EZ System infrared imaging system. The band intensities of the control aptamer and the CD25-2264-10-11 and CD25_combi aptamers were quantified using Image J, and the half-lives were calculated using GraphPad Prism software and are shown in Figure 15.

[0243] As a result, as shown in Fig. 15, the half-life of the chemically optimized CD25_combi aptamer was significantly increased from 20-fold to 8.8-fold compared to 7.8 hours for the control aptamer, with a half-life of 21.49 hours in mouse plasma, 32.48 hours in rat plasma, and 68.27 hours in human plasma, confirming that the chemical optimization significantly improved plasma stability.

[0244]

[0245] Example 9: Confirmation of cellular internalization of chemically optimized CD25 aptamers through the endosome-lysosomal pathway.

[0246]

[0247] To confirm the internalization of the chemically optimized CD25 combi-aptamer produced in Example 7 above, Karpas299 cells were cultured at 1×10 6 Cells / samples were counted on poly-L-lysine-coated coverslips. 100 nM of the chemically optimized CD25 combi-aptamer labeled with the pH-dependent reagent pHrodo RED (Invitrogen) was added to the cells and incubated at 4°C for 30 min in the dark, followed by additional incubation at 37°C for 30, 180, and 300 min. After washing three times with 1× PBS buffer and mixing gently, the cells were fixed with 4% PFA / PBS for 15 min. After washing three times with 1× PBS buffer and mixing gently, the cells were observed under a fluorescence microscope, and the results are shown in Fig. 16.

[0248] As a result, as shown in Fig. 16, it was confirmed that the chemically optimized CD25 combi-aptamer was internalized via the endosome-lysosome pathway.

[0249]

[0250] Example 10: Confirmation of target-specific cell death by chemically optimized CD25 combi aptamer drug conjugate (CD25 combi Aptamer drug conjugate, CD25 combi ApDC)

[0251]

[0252] 10-1. Production of CD25 Combination ApDC (Drug-to-Aptamer Binding Ratio = 1, DApR = 1)

[0253] The CD25 combi-aptamer of Example 7 was synthesized by synthesizing a CD25 aptamer having a disulfide bond for conjugation reaction with the maleimide of MMAE (microtubule inhibitor) - valine-citrulline linker (VC), and obtaining SH-CD25 aptamer through reduction reaction using DTT. The SH-CD25 aptamer was recovered with a recovery rate of at least 80% through UV quantification, and conjugation was performed under pH 7.4 buffer conditions by adding an excess amount of VcMMAE corresponding to 20 equivalents. In order to confirm the synthesis of the CD25 combi-aptamer conjugate, after purification by HPLC, an electrophoresis experiment was performed using urea gel, and the final conjugate material was confirmed by comparing the expected molecular weight with the measured molecular weight result through ESI-MS measurement. The synthetic method and the structure of the final synthesized conjugate material are schematically shown in Fig. 17.

[0254]

[0255] 10-2. Production of CD25 Combination ApDC (Drug-to-Aptamer Binding Ratio = 3, DApR = 3)

[0256] The CD25 combi-aptamer of Example 7 was synthesized by synthesizing a branched disulfide CD25 aptamer to conjugate MMAE (microtubule inhibitor) - VC (valine-citrulline linker) three molecules, and then obtaining a branched SH-CD25 aptamer through a DTT reduction reaction. At least 80% of the branched aptamer was recovered through UV quantification, and the recovered aptamer was conjugated under pH 7.4 buffer conditions by adding an excess amount of VcMMAE corresponding to 25 equivalents. To confirm the synthesis of the branched CD25 combi-aptamer conjugate, purification was performed by HPLC, an electrophoresis experiment was performed on a urea gel, and the final conjugate material was confirmed by comparing the expected molecular weight with the measured molecular weight result through ESI-MS measurement. The synthetic method and the structure of the final synthesized conjugate material are schematically shown in FIG. 18. The above reaction was confirmed by HPLC while changing the ratio of drug to SH-CD25 aptamer, and the reaction was completed at 25 equivalents, which is the minimum equivalent number at which the peak of reduced SH-CD25 disappears. The reaction was carried out at that ratio.

[0257]

[0258] 10-3. Confirmation of specific apoptosis of CD25-expressing cells by CD25 combinatorial ApDCs.

[0259] To confirm whether the two CD25 combi-aptamer conjugates produced in Examples 10-1 and 10-2 induce cell-specific apoptosis that expresses CD25, Karpas299 cells, which are CD25-positive cells, and Daudi cells, which are CD25-negative cells, were seeded in 96-well plates at a density of 10,000 cells / well and 20,000 cells / well, respectively. Each of the two CD25 combi-aptamer conjugates produced in Examples 10-1 and 10-2 and free MMAE were serially diluted 3.16-fold 11 times, starting at 1 μM, and treated to each well. After culturing the treated cells for 72 hours, the absorbance at 450 nm was measured 2 hours after treatment with the CCK-8 (Dojindo) reagent, and the cell viability was calculated therefrom, which is shown in Fig. 19.

[0260] As a result, as shown in Fig. 19, it was confirmed that both types of CD25 combi-aptamer conjugates induced cell death specifically for CD25.

[0261]

[0262] 10-4. Confirmation of specific killing of Treg-like cells by CD25 combi ApDC under tumor-like co-culture conditions.

[0263] To confirm whether the two CD25 combi-aptamer conjugates produced in Examples 10-1 and 10-2 above induce Treg cell-specific apoptosis, 10 Karpas299 cells, which are Treg-like cells, or HuT78 cells, which are Teff-like cells, were cultured in a concentration of 10 6Each cell line was seeded on a plate. Two CD25 combi-aptamer conjugates, CD25-MMAE (1) and CD25-MMAE (3), were diluted to a final concentration of 40 nM and 10 nM, respectively, and treated with the cell lines, and then cultured for 24, 48, and 72 hours. The treated cell lines were centrifuged at 1000 rpm for 3 minutes at 4°C, washed with 1× PBS, and placed in a 3% BSA / PBS solution. Each cell line was treated with 0.5 μg of FITC-CD25 (Invitrogen) and 2 μg of AF647-CD4 (R&D systems), and left for 1 hour at 4°C. Each cell line was centrifuged at 1000 rpm for 3 minutes at 4°C, washed with 1× PBS, and transferred to a strainer cap tube with 3% BSA / PBS PI solution. Among PI negative (living cells), Karpas299 (CD25 high CD4 high ), HuT78(CD25 low CD4 low ) was confirmed.

[0264] As a result, as shown in Figure 20, it was confirmed that apoptosis was induced at a higher rate in Karpas299, which has high CD25 expression, compared to the HuT78 cell line, which has low CD25 expression. Furthermore, it was confirmed that the higher the ratio of drug bound to the aptamer, the faster and higher the rate of cell death induced.

[0265] As confirmed above, it was confirmed that the CD25 aptamer drug conjugate of the present invention selectively induces the death of cells with a high CD25 expression ratio.

[0266]

[0267] From the results of the above examples, the CD25 aptamer of the present invention inhibits the activation of CD25 positive T cells by specifically binding to the CD25 protein and thereby binding IL-2 to the CD25 protein, and its drug conjugate has a shorter half-life than an antibody and thus does not exhibit side effects, and thus can be applied to the treatment of cancer as an immunotherapy agent.

[0268]

[0269] From the above description, those skilled in the art will understand that the present invention can be implemented in other specific forms without altering its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as encompassing all changes or modifications derived from the meaning and scope of the following claims and their equivalent concepts, rather than the detailed description above.

Claims

1. CD25 aptamer that specifically binds to the CD25 protein.

2. In the first paragraph, the aptamer comprises a base sequence selected from the group consisting of the following general formulas 1 to 3 or a polynucleotide sequence having 80% or more homology or identity therewith, a CD25 aptamer: [General Formula 1] TTCGAGATCAAGTTATAGCGTGTCCCATTCTATCCAAGACACT (SEQ ID NO: 1) [General Formula 2] GTGTGTGTCACTCTATCGTTACGAGGAATACGGGCAAAGC (SEQ ID NO: 2) [General Formula 3] CGGTGCAATCGCGTGGTCAACATCCTGTTAACCTCGGAAT (SEQ ID NO: 3).

3. A CD25 aptamer according to claim 1, wherein the aptamer additionally comprises 1 to 30 nucleotides at at least one selected from the 5' end and the 3' end.

4. A CD25 aptamer according to claim 3, wherein the aptamer comprises 41 to 103 nucleotides.

5. In the first paragraph, the aptamer comprises at least one modification selected from the following in at least one nucleotide constituting its polynucleotide sequence: i) The 5th carbon of one or more T bases in the nucleotide is substituted with one or more selected from the group consisting of a benzyl group, a naphthyl group, a 2-naphthyl group, a pyrrolebenzyl group, and a tryptophan; ii) replacement of the -OH group at the 2nd carbon position in one or more nucleotides with one or more selected from the group consisting of deoxy, methoxy, amino and fluoro (F); and iii) One or more T bases in the nucleotides are replaced by U Me Replace with .

6. In the fifth paragraph, the aptamer is a CD25 aptamer in which at least one nucleotide selected from the group consisting of nucleotides corresponding to the 8th, 13th, 14th, 16th, 21st, 23rd, 28th, 29th, 31st, 33rd, and 43rd positions in the base sequence of general formula 1 is modified.

7. A CD25 aptamer according to claim 6, wherein the aptamer comprises at least one polynucleotide sequence selected from the group comprising the polynucleotide sequences of SEQ ID NOs: 6, 18, 19, and 27.

8. In the fifth paragraph, the aptamer is a CD25 aptamer in which at least one nucleotide selected from the group consisting of nucleotides corresponding to the 2nd, 4th, 6th, 8th, 12th, 14th, 16th, 19th, 20th, and 29th positions in the base sequence of general formula 2 is modified.

9. In the 8th paragraph, the aptamer comprises a polynucleotide sequence of sequence number 4, a CD25 aptamer.

10. In the fifth paragraph, the aptamer is a CD25 aptamer in which at least one nucleotide selected from the group consisting of nucleotides corresponding to the 4th, 9th, 14th, 17th, 23rd, 26th, 28th, 29th, 34th, and 40th positions in the base sequence of general formula 3 is modified.

11. A CD25 aptamer according to claim 10, wherein the aptamer comprises a polynucleotide sequence of sequence number 5.

12. A CD25 aptamer according to claim 1, which binds to the CD25 protein and acts as an IL-2 antagonist.

13. A CD25 aptamer that inhibits the activation of CD25 positive T cells in the first paragraph.

14. A CD25 aptamer-drug conjugate (CD25 ApDC) comprising the CD25 aptamer of claim 1 and one or more drugs bound to the CD25 aptamer.

15. A CD25 aptamer-drug conjugate according to claim 14, wherein the drug is an antitumor substance.

16. In claim 14, the drug is selected from the group consisting of monomethyl auristatin E (MMAE), monomethyl auristatin F (MMAF), cytarabine, gemcitabine, carboplatin, cisplatin, crizotinib, cyclophosphamide, docetaxel, doxorubicin, erlotinib, etoposide, fluorouracil, imatinib mesylate, irinotecan, methotrexate, paclitaxel, sorafinib, sunitinib, topotecan, trabectidine, vincristine, vinblastine, maytansine, DM1, DM4, calicheamicin and derivatives thereof, doxorubicin, duocarmycin and derivatives thereof, pyrrolobenzodiazepine (PBD), SN-38, α-amantine, and a tubulosin analog. Aptamer-drug conjugate.

17. A CD25 aptamer-drug conjugate in claim 14, wherein the drug is bound to one terminal of the CD25 aptamer through a chemical linker, bound to the aptamer through interaction between the CD25 aptamer and the drug, or substituted on a nucleotide constituting the CD25 aptamer.

18. A CD25 aptamer-drug conjugate according to claim 14, wherein the drug is bound to either of the two terminals of the CD25 aptamer, to a nucleotide constituting the aptamer, or to at least one chemical bond among a covalent bond, an ionic bond, a metal bond, a van der Waals bond, and a hydrogen bond, or is inserted between two or more nucleotides constituting the aptamer.

19. In the 17th paragraph, the chemical linker is a first linker selected from the group consisting of 5'-thiol-modifier C6, thiol-modifier C6 SS, dithiol serinol, PC amino-modifier, 5'-amino-modifier C3, 5'-amino-modifier C6, 5'-amino-modifier C12, 5'-amino-modifier TEG, amino-modifier TEG, amino-modifier C2 dT, amino-modifier C6 dT, S-Bz-thiol-modifier C6-dT, phosphodiester bond and nucleotide, and maleimidocaproyl-valine-citrulline-p-aminobenzoyloxycarbonyl (MC-Val-Cit-PAB), hydrazone, peptide, disulfide, thioether, valine-citrulline, A CD25 aptamer-drug conjugate, wherein the combination is a second linker selected from the group consisting of N-maleimidomethylcyclohexane-1-carboxylate (MCC), maleimidocaproyl, mercaptoacetamidocaproyl, N-succinimidyl 4-(2-pyridylthio) pentanoate (SPP), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), N-succinimidyl 4-(2-pyridylthio) pentanoate (SPDB), a phosphodiester bond, and a nucleotide.

20. A pharmaceutical composition for treating cancer, comprising as an active ingredient a CD25 aptamer of any one of claims 1 to 13, or a CD25 aptamer-drug conjugate of any one of claims 13 to 18.

21. A pharmaceutical composition according to claim 20, wherein the cancer disease is a disease selected from the group consisting of lung cancer, mesothelioma, pancreatic cancer, pharyngeal cancer, laryngeal cancer, esophageal cancer, stomach cancer, duodenal cancer, small intestine cancer, colon cancer, breast cancer, ovarian cancer, testicular tumor, prostate cancer, liver cancer, thyroid cancer, kidney cancer, uterine cancer, brain tumor, retinoblastoma, skin cancer, sarcoma, malignant bone tumor, bladder cancer, B-cell chronic lymphocytic leukemia, hairy cell leukemia, small cell lymphocytic lymphoma / chronic lymphocytic leukemia, adult T-cell leukemia / lymphoma, and anaplastic large cell lymphoma.

Images