Barrier membrane for bone regeneration to maintain microorganism-cell symbiosis and method for producing same

Abstract

The objective of the present invention is to provide: a barrier membrane for bone regeneration, which can create a microorganism-cell symbiotic environment in guided bone regeneration and maintain structural stability in the mouth regardless of surrounding enzymes; and a method for producing same. The barrier membrane for bone regeneration, of the present invention, can reduce the proportion of inflammation-related pathogens in oral microorganisms and improve microbiota stability. In addition, the barrier membrane for bone regeneration can be introduced into a bone defect site to promote bone formation and tissue regeneration.

Description

A barrier membrane for bone regeneration and a method for manufacturing the same to maintain microbial-cell symbiosis

[0001] The present invention relates to a novel barrier membrane that helps maintain symbiosis between microorganisms and cells during a bone regeneration procedure, and a method for manufacturing the same.

[0002] Inflammatory periodontal disease (ID) is a common condition that causes over $15 billion in annual economic losses worldwide. Guided bone regeneration, a treatment method that effectively regenerates damaged gums, is being used. Guided bone regeneration is a treatment method that involves placing a barrier membrane in the edentulous area, independent of periodontal tissue, to induce the influx of osteoblasts into the bone defect, thereby promoting bone tissue regeneration.

[0003] In guided bone regeneration (GBR), the barrier membrane plays a crucial role in ensuring effective bone tissue regeneration. The barrier membrane physically blocks soft tissue from infiltrating the bone defect, thereby facilitating bone tissue regeneration. In guided bone regeneration, the bone defect, located in a cell-rich hard tissue area and covered by the barrier membrane, undergoes closed healing, while the soft tissue area outside the membrane is exposed to microorganisms and undergoes open healing.

[0004] Considering this complex regenerative process, the performance of a barrier membrane can be evaluated based on the following three criteria. First, the barrier membrane must be biocompatible, not detrimental to surrounding tissue. Second, the barrier membrane must prevent connective tissue from infiltrating into adjacent bone tissue, and when exposed to the oral cavity, it must be resistant to bacterial invasion while still allowing the passage of nutrients and gases. Third, the barrier membrane must be able to withstand without collapsing and provide adequate space for bone tissue regeneration (structural stability).

[0005] Barrier membranes developed to date have had distinct limitations due to their non-absorbability and resorbability. First, non-absorbable barrier membranes, such as polytetrafluoroethylene membranes and titanium meshes, have low biological permeability, induce inflammatory responses in the body, and can only be surgically removed after treatment. Absorbable barrier membranes, such as collagen membranes, integrate with host tissues and eliminate the need for surgical removal. However, they lack sufficient structural stability, and their premature loss and resorption can cause periodontitis in bone defect areas.

[0006] In addition, since most of them were developed considering only the competitive inhibition between fibroblasts and osteoblasts without considering the oral environment where a healthy symbiosis is formed between microorganisms and cells, the barrier membrane during the GBR process affects the oral microbial environment, causing secondary inflammatory diseases as side effects. Therefore, there is a need to develop a barrier membrane that can maintain the symbiotic relationship between microorganisms and cells in the difficult oral environment and promote the regeneration of soft and hard tissues to induce an ideal prognosis for guided bone regeneration treatment.

[0007] Patent Document 1. Republic of Korea Patent Publication No. 10-2006-0041091

[0008] The purpose of the present invention is to provide a bone regeneration barrier membrane and a method for manufacturing the same, which can create a symbiotic environment between microorganisms and cells in bone-guided regeneration and maintain structural stability domestically regardless of surrounding enzymes.

[0009] In order to achieve the above object, the present invention provides a barrier membrane for bone regeneration, characterized by comprising: a collagen support impregnated with a solution containing a monomer having a sulfobetaine group; the monomer being polymerized into a zwitterionic polymer through photopolymerization to form an integral part with the support; and a closed layer composed of hydroxyapatite in the form of flakes deposited on the support.

[0010] The above solution may further comprise a first photoinitiator or gelling agent.

[0011] The above gelling agent may include alginic acid or sodium alginate.

[0012] The first photoinitiator is selected from the group consisting of 2-hydroxy-4'-(2-hydroxyethoxy)-2-methylpropiophenone, 2-hydroxy-2-methylpropiophenone, benzoin ethyl ether, benzoin isobutyl ether, benzoin methyl ether, dibenzosuberenone, 2,2-dimethoxy-2-phenylacetophenone, 3,4-dimethylbenzophenone, and 3'-hydroxyacetophenone. There may be more than one selected.

[0013] The above biocompatible polymer may be at least one selected from the group consisting of collagen, chitosan, and gelatin.

[0014] The monomer having the above sulfobetaine group may be 2-[(methacryloyloxy)ethyl]dimethyl-(3-sulfopropyl)ammonium hydroxide or 2-methacryloyloxyethyl phosphorylcholine.

[0015] The above-mentioned bone regeneration barrier membrane may have a pore volume of 0.01 to 1 ㎛ of 1 to 10 cc / g.

[0016] The above bone regeneration barrier membrane has a Raman spectrum analysis of 950 to 960 cm -1 It may represent the maximum peak intensity.

[0017] The above bone regeneration barrier film may not contain a lamellar structure as a result of small-angle X-ray scattering.

[0018] In order to solve the above-described problem, the present invention provides a method for manufacturing a barrier membrane for aggregate, comprising the following steps.

[0019] S1) A step of preparing a precursor solution comprising a monomer containing a sulfobetaine group, a first photoinitiator, and a solvent;

[0020] S2) A step of impregnating a collagen scaffold with the precursor solution and polymerizing a zwitterionic polymer within the collagen scaffold through ultraviolet irradiation to produce a zwitterionic membrane;

[0021] S3) A step of immersing the amphoteric membrane manufactured through the above S2 step in a solution containing calcium ions to manufacture a membrane to which calcium ions are bound; and

[0022] S4) A step of immersing the membrane to which the calcium ions are bound in a solution containing phosphate ions.

[0023] In the above step S1), the precursor solution may include 20 to 30 wt% of a monomer containing a sulfobetaine group; 0.5 to 5 wt% of a first photoinitiator and the remainder of a solvent.

[0024] The above collagen support may further comprise a second photoinitiator.

[0025] In the above step S1), the precursor solution may further include a gelling agent.

[0026] The precursor solution may comprise 20 to 30 wt% of a monomer containing a sulfobetaine group; 0.5 to 5 wt% of a first photoinitiator; 1 to 5 wt% of a gelling agent and the remainder of a solvent.

[0027] Between the above steps S2) and S3), the method may further include an ionic cross-linking step S-1) of immersing the zwitterionic membrane manufactured through the above step S2 in a solution containing divalent cations.

[0028] The monomer containing the above sulfobetaine group may be 2-[(methacryloyloxy)ethyl]dimethyl-(3-sulfopropyl)ammonium hydroxide or 2-methacryloyloxyethyl phosphorylcholine.

[0029] The above steps S3) and S4) may be performed as a unit process, and the above unit process may be repeated 5 or more times.

[0030] The solution containing the above calcium ions may contain 0.1 to 1.0 M of calcium ions.

[0031] The above solution containing phosphate ions may contain 0.1 to 0.5 M of phosphate ions.

[0032] The bone regeneration barrier membrane of the present invention can reduce the proportion of inflammation-related pathogens among oral microorganisms and improve the stability of microbial communities.

[0033] The above bone regeneration barrier membrane can be introduced into a bone defect area to promote bone formation and tissue regeneration.

[0034] In addition, the above bone regeneration barrier membrane can maintain its shape even when subjected to the action of enzymes in the oral cavity, so it has excellent structural stability and durability and is highly convenient to use.

[0035] Figures 1a and b illustrate the manufacturing process of a barrier membrane for bone regeneration.

[0036] Figure 1c shows a bone regeneration barrier membrane (SIOM) (1×1 cm) manufactured from Example 1. 2) as an example of a practical application, showing SIOMs of various sizes (left) and one application to dental surgery (GBR) (right).

[0037] Figures 2a and 2b show XPS analysis results for the zwitterionic membrane (ZM) and collagen polymer membrane (CM) in Example 1. Figure 2c shows the upper surface image and sulfur (S) ion mapping results (n=5) of the zwitterionic membrane (ZM) in Example 1.

[0038] Figure 2d shows the results of TOF-SIMS analysis of the sulfur signal (-S-) in the zwitterionic membrane (ZM) and collagen polymer membrane (CM) in Example 1.

[0039] Figure 3 shows the results of calcium and phosphorus ion mapping of the bone regeneration barrier membrane (SIOM) of Example 1 using an energy-dispersive spectrometer (Scale bar = 2 μm).

[0040] Figure 4a shows the photopolymerization reaction time fixed at 180 minutes, and the biomineralization process (PO4 3- and Ca 2+ This is the Raman spectrum result for each bone regeneration barrier membrane (SIOM) (#=0 (CM), #=5 (ACP), #=10 (SIOM)) manufactured by varying the number of times (#) of immersion in an aqueous solution to 0, 5, and 10 times.

[0041] Figure 4b shows the results of analyzing the degree of zwitteration in each zwitterionic membrane (ZM) manufactured by varying the photopolymerization reaction time to 60 minutes, 180 minutes, and 360 minutes.

[0042] Figure 4c shows the photopolymerization reaction time (reaction time) of 60 minutes, 180 minutes, and 360 minutes, and the biomineralization process (PO4 3- and Ca 2+The Raman analysis results for each bone regeneration barrier membrane (SIOM) manufactured by varying the number of times (#) of immersion in the aqueous solution (5 and 10 times) are shown.

[0043] Figure 4d shows the photopolymerization reaction time (reaction time) of 60 minutes, 180 minutes, and 360 minutes, and the biomineralization process (PO4 3- and Ca 2+ This is a graph comparing the degree of both ionization and biomineralization for each bone regeneration barrier membrane (SIOM) manufactured by varying the number of times (#) of immersion in the aqueous solution (5 and 10 times).

[0044] Figure 5 shows the results of XRD diffraction pattern analysis for a collagen polymer membrane (CM), a zwitterionic membrane (ZM), and a bone regeneration barrier membrane (SIOM) of Example 1.

[0045] Figure 6a shows one-dimensional and two-dimensional SAXS patterns for a collagen polymer membrane (CM) and a bone regeneration barrier membrane (SIOM) of Example 1. Here, q is a scattering vector, where q = (4π / λ)sin(θ / 2), and θ and λ represent the scattering angle and wavelength of the incident X-ray beam, respectively.

[0046] Figure 6b shows one-dimensional and two-dimensional WAXS patterns for the bone regeneration barrier membrane (SIOM) of Example 1, with X-rays in the normal direction (ND; z-axis) and the cross-sectional direction of the SIOM (xy-axis).

[0047] Figure 6c shows the results of the storage elastic modulus (Pa) versus the loss elastic modulus (tanδ) of the bone regeneration barrier membrane (SIOM) of Example 1.

[0048] Figure 7 shows the results of measuring the pore size distribution of a collagen polymer membrane (CM) (a) and a bone regeneration barrier membrane (SIOM) (b) of Example 1.

[0049] Figure 8a schematically illustrates the structure of a collagen polymer membrane (CM), a cathodic barrier membrane (NM) of Comparative Example 1, an anodic barrier membrane (PM) of Comparative Example 2, a bone regeneration barrier membrane (SIOM) of Example 1, and a bone regeneration barrier membrane (SIOM-2) of Example 2.

[0050] Figure 8b is a SEM (b Scanning electron microscope) image of the cathode barrier film (NM) of Comparative Example 1, the anode barrier film (PM) of Comparative Example 2, the bone regeneration barrier film (SIOM) of Example 1, and the bone regeneration barrier film (SIOM-2) of Example 2 (scale bar=1㎛) (n=5). Figure 8c is a diagram illustrating the penetration process of collagenase according to the structure of the bone regeneration barrier film.

[0051] Figure 8d shows the appearance of a collagen polymer membrane (CM), a cathodic barrier membrane (NM) of Comparative Example 1, anodic barrier membrane (PM) of Comparative Example 2, a bone regeneration barrier membrane (SIOM) of Example 1, and a bone regeneration barrier membrane (SIOM-2) of Example 2 after treatment with collagenase (0.2 IU / mL).

[0052] Figure 8e shows the results of analyzing the degradation rates of a collagen polymer membrane (CM), a cathodic barrier membrane (NM) of Comparative Example 1, anodic barrier membrane (PM) of Comparative Example 2, a bone regeneration barrier membrane (SIOM) of Example 1, and a bone regeneration barrier membrane (SIOM-2) of Example 2.

[0053] Figure 8f shows the results of analyzing the rheological response of a collagen polymer membrane (CM) (left) and a bone regeneration barrier membrane (SIOM) of Example 1 (right) when treated with collagenase (0.2 IU / mL) for 0 to 10 hours. The image interpolated in Figure 8f is an ion mapping image of the bone regeneration barrier membrane (SIOM) of Example 1 after exposure to collagenase (scale bar = 2 μm).

[0054] Figure 8g shows the results measured after treating a collagen polymer membrane (CM) and a bone regeneration barrier membrane (SIOM) of Example 1 with amylase and culturing them for 0 to 48 hours.

[0055] Figure 9a shows the results of qRT-PCR analysis of cytokine expression (OPN) after culturing BMSC cells on collagen polymer membrane (CM) and bone regeneration barrier membrane (SIOM) of Example 1 for 2 weeks under growth medium conditions (mean ± standard deviation, n = 3, two-tailed t-tests, p = 0.0317).

[0056] Figure 9b shows the results of qRT-PCR analysis of cytokine expression (RUNX2, OCN, OPN, BMP2) after culturing BMSC cells on collagen polymer membrane (CM) and bone regeneration barrier membrane (SIOM) of Example 1 for 2 weeks under osteogenic differentiation medium conditions (mean ± standard deviation, n = 3, two-tailed t-tests, p = 0.000012 for OPN, p = 0.000249 for BMP2) (p < 0.05, p < 0.01, p < 0.001.******).

[0057] Figure 10a schematically illustrates the experimental process for in vitro microbiological assays.

[0058] Figure 10b shows the phylum-level classification of microbial groups identified from saliva cultures treated with collagen polymer membranes (CM), zwitterionic membranes (ZM), or bone regeneration barrier membranes (SIOM) of Example 1. PC is a positive control (PC) saliva culture without a barrier membrane.

[0059] Figure 10c shows the rarefaction curves for saliva cultures treated with a collagen polymer membrane (CM), a zwitterionic membrane (ZM), or the bone regeneration barrier membrane (SIOM) of Example 1. This is a function graph for the number of given samples and species. PC is the positive control (PC), which is a saliva culture without a barrier membrane.

[0060] Figure 10d shows the specific abundance ratio in saliva cultures treated with collagen polymer membranes (CM), zwitterionic membranes (ZM), or bone regeneration barrier membranes (SIOM) of Example 1. PC is a positive control (PC) saliva culture without a barrier membrane.

[0061] Figure 10e shows the results of a comparative analysis of microorganisms at the genus level for saliva cultures treated with a positive control (PC), collagen polymer membrane (CM), zwitterionic membrane (ZM), or bone regeneration barrier membrane (SIOM) of Example 1.

[0062] Figure 10f shows the results showing the relative abundance of the most predominant microbial species among the microbial groups identified from the saliva cultures treated with the positive control (PC), collagen polymer membrane (CM), zwitterionic membrane (ZM), or bone regeneration barrier membrane (SIOM) of Example 1.

[0063] Figure 10g shows the results comparing the species levels in saliva cultures treated with a positive control (PC), collagen polymer membrane (CM), or bone regeneration barrier membrane (SIOM) of Example 1.

[0064] Figure 10h is a Venn plot of the core microbial groups present in saliva cultures treated with a positive control (PC), collagen polymer membrane (CM), zwitterionic membrane (ZM), or bone regeneration barrier membrane (SIOM) of Example 1.

[0065] Figure 10i shows the results of SIMPER analysis showing the dissimilarity between the saliva culture groups treated with the positive control (PC), collagen polymer membrane (CM), zwitterionic membrane (ZM), or bone regeneration barrier membrane (SIOM) of Example 1.

[0066] Figure 10j shows the results for the portion where the dissimilarity between the microorganisms in the saliva culture solution treated with the collagen polymer membrane (CM), the bone regeneration barrier membrane (SIOM) of Example 1, and the microorganisms in the positive control group (PC) exceeds 1%.

[0067] Figure 11 shows the results of confirming colony forming units after co-culturing Porphyromonas gingivalis (a) and Staphylococcus aureus (b) with a collagen polymer membrane (CM) or a bone regeneration barrier membrane (SIOM) of Example 1, respectively.

[0068] Figures 12a and b illustrate the manufacturing process of a bone-induced regeneration experimental animal model.

[0069] Figure 12c is a rarefaction curve for the species richness of the collagen polymer membrane (CM) (comparative group) or the bone regeneration barrier membrane (SIOM) of Example 1 (experimental group) according to the treatment period.

[0070] Figure 12d shows the results of analyzing alpha diversity in the sequences of amplicons obtained from GCF, collagen polymer membrane (CM) (control group), or bone regeneration barrier membrane (SIOM) of Example 1 (experimental group). GCF is gingival crevicular fluid collected from a healthy subject 24 hours prior to GBR surgery.

[0071] Figure 12e shows the relative abundance confirmed in the bone regeneration barrier membrane (SIOM) (experimental group) of Example 1 compared to the collagen polymer membrane (CM) (comparative group).

[0072] Figure 12f shows the results showing the relative abundance of microorganisms at the phylum level in samples of collagen polymer membrane (CM) (comparative group) or bone regeneration barrier membrane (SIOM) of Example 1 (experimental group) according to the treatment period.

[0073] Figure 12g shows the distribution of core microbial groups between GCF, collagen polymer membrane (CM) (comparative group) or bone regeneration barrier membrane (SIOM) of Example 1 (experimental group).

[0074] Figure 12i shows the results of the out-of-bag (OOB) probability score and the dysbiosis score obtained from the median community level variations (CLV) for the collagen polymer membrane (CM) (comparative group) or the bone regeneration barrier membrane (SIOM) of Example 1 (experimental group).

[0075] Figure 12j shows the results of analyzing the postoperative wound healing rate for collagen polymer membrane (CM) (comparative group) or bone regeneration barrier membrane (SIOM) of Example 1 (experimental group) (n=7, RM ANOVA, p=0.002)(*p<0.05, **p<0.01, ***p<0.001).

[0076] Figure 13a shows an experimental schedule for an inflammatory animal model.

[0077] Figure 13b schematically illustrates the treatment of a bone substitute and a complete occlusive membrane (CM or SIOM) in an inflammatory animal model, followed by complete suturing.

[0078] Figures 13c-e show the results of immunohistochemical staining analysis of tissues recovered from Blank, Control Group-2 (CM), and Experimental Group-2 (SIOM). Figure 13c shows neutrophils (myeloperoxidase; MPO, mean ± SD, n = 6, ANOVA, p = 0.048), Figure 13d shows M1 macrophages (CD86, mean ± SD, n = 6, ANOVA, p = 0.001), and Figure 13e shows mature B cells (CD20, mean ± SD, n = 6).

[0079] Figure 13f is a micro-CT image of tissues recovered from Blank, Comparative Group-2 (CM), and Experimental Group-2 (SIOM) 4 weeks after treatment.

[0080] Figure 13g is a tissue immunochemical staining image of tissues recovered from Blank, Comparative Group-2 (CM), and Experimental Group-2 (SIOM) 4 weeks after treatment.

[0081] Figure 13h shows the new bone volume (NBV, mean±SD, n=6, Kruskal, p=0.004) and new bone area (NBA, mean±SD, n=6, ANOVA, p=0.012 for blank vs. SIOM, p=0.024 for CM vs. SIOM) measured by micro-CT and histochemical staining of tissues recovered from Blank, Comparative Group-2 (CM), and Experimental Group-2 (SIOM) 4 weeks after treatment (*p<0.05, **p<0.01, ***p<0.001).

[0082] The present invention will be described in detail below. Terms used herein, unless specifically defined, should be interpreted as generally understood by those skilled in the art. The drawings and examples in this specification are intended to facilitate the understanding and practice of the present invention by those skilled in the art. Content that may obscure the gist of the invention may be omitted from the drawings and examples, and the present invention is not limited to the drawings and examples.

[0083] The singular forms used in this specification are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0084] Additionally, the numerical range used in the present invention includes lower and upper limits and all values ​​within that range, increments logically derived from the shape and width of the defined range, all doubly defined values, and all possible combinations of upper and lower limits of numerical ranges defined in different shapes. Unless otherwise specifically defined in the specification of the present invention, values ​​outside the numerical range that may arise due to experimental error or rounding of values ​​are also included in the defined numerical range.

[0085] In this specification, terms such as include, have, and have mean that a feature or component described in the specification exists, and unless specifically limited, do not preclude the possibility that one or more other features or components may be added.

[0086] Guided bone regeneration (GBR) is a procedure where periodontal disease prevents implant placement due to insufficient gum bone. This involves placing a barrier membrane beneath the gums to the bone defect, preventing the formation of other tissues and encouraging the formation of only gum bone. The barrier membrane plays a crucial role in preventing the entry of connective tissue and epithelial cells other than osteocytes into the bone defect, thereby facilitating the stable proliferation of osteocytes.

[0087] Conventionally, barrier membranes used in guided bone regeneration are divided into absorbable and non-absorbable membranes. Absorbable membranes offer the advantage of eliminating the need for surgical removal. However, their inherent rigidity and premature absorption often hinder maximizing bone tissue regeneration. Conversely, non-absorbable membranes offer structural rigidity, but their low biocompatibility increases the risk of infection and bone loss. Furthermore, they require surgical removal, adding to the inconvenience.

[0088] Accordingly, the present disclosure provides a bone regeneration barrier membrane and a method for manufacturing the same, which overcomes the shortcomings that occur depending on the type of barrier membrane, has a strength that allows sufficient proliferation of bone cells, and can continuously induce bone formation without surgical removal.

[0089] A barrier membrane for bone regeneration according to the present invention is characterized by having a collagen support impregnated with a solution containing a monomer having a sulfobetaine group; the monomer is polymerized into a zwitterionic polymer through photopolymerization to form an integral part with the support; and has a closed layer composed of flake-shaped hydroxyapatite deposited on the support.

[0090] The bone regeneration barrier membrane according to the present invention comprises a collagen support impregnated with a solution containing a monomer having a sulfobetaine group, by photopolymerizing the support, thereby including both a zwitterionic polymer and a collagen polymer, and depositing hydroxyapatite in a more dense flake form on the surface and the entire interior of the support to obtain a closed (i.e., completely coated) layer, thereby providing a bone regeneration barrier membrane having excellent structural stability and durability.

[0091] More specifically, the above-mentioned bone regeneration barrier membrane is formed by impregnating a support skeleton composed of collagen with a solution containing a monomer having a sulfobetaine group and polymerizing the zwitterionic polymer by photopolymerization, thereby integrally forming the collagen support and the zwitterionic polymer, and thereby the monomer containing a sulfobetaine group is introduced into the collagen support skeleton and polymerized into the zwitterionic polymer by light irradiation, thereby forming collagen fibers covered with the zwitterionic polymer.

[0092] That is, the bone regeneration barrier membrane according to the present invention is formed on the surface by the ammonium (-NR2) ion-active polymer of the support. + -)(R is an alkyl group having 1 to 5 carbon atoms) and sulfuric acid (-SO3 -) is characterized by the nucleation and crystal growth of hydroxyapatite being promoted and deposited. In general, cumbersome processes were required, such as immersing biodegradable polymers in a strong alkaline solution to change the surface for the deposition of hydroxyapatite and washing them several times to remove the remaining base. In this process, there was a problem that the biodegradable polymer was decomposed or its properties changed, and there was a problem that the surface of the biodegradable polymer was exposed because the content of hydroxyapatite deposited was very small. Because of this structure, it had a negative impact on the microbial environment existing in the oral cavity and acted as a cause of inflammation, which prolonged the treatment period or required reoperation.

[0093] However, in the present invention, hydroxyapatite (HAp) deposited on a biodegradable polymer is deposited or biomineralized as a single closed layer, so that the zwitterionic polymer and the collagen support become one unit, and hydroxyapatite is deposited on the support in the form of flakes to form a closed layer.

[0094] The cationic functional group of the above zwitterionic polymer may adsorb phosphate ions, and the anionic functional group of the above zwitterionic polymer membrane may adsorb calcium ions, thereby causing hydroxyapatite to be deposited or biomineralized.

[0095] The monomer having the above sulfobetaine group may be 2-[(methacryloyloxy)ethyl]dimethyl-(3-sulfopropyl)ammonium hydroxide.

[0096] The above hydroxyapatite, also called hydroxyapatite, is a major component of the inorganic matrix of enamel that forms the dental hard tissue. It has osteoconductive properties that attract bone cells at an early stage, and is therefore effective in promoting the regeneration of dental hard tissue and stimulating cell differentiation in various cell lineages.

[0097] In addition, the bone regeneration barrier according to the present disclosure can prevent the movement of cells and microorganisms between the soft tissue forming the gum area and the hard tissue of the teeth, thereby increasing the initial normal bacterial species for the microbial community in an inflammatory environment and maintaining symbiosis between microorganisms and cells in the oral cavity, thereby being effective in maintaining oral health.

[0098] Specifically, during the process of guided bone regeneration, the symbiosis between microbiota and cells may be broken in the process of competition between fibroblasts for soft tissue recovery and osteocytes for hard tissue recovery for microbial resources. The bone regeneration barrier is located at the boundary between these two to maintain a stable symbiotic relationship between microbiota and cells.

[0099] The above biomineralization process is inspired by the biomineralization method of tooth enamel, specifically, osteopontin (OPN) of tooth enamel is PO4 3- Selectively captures ions, and dentin matrix acid phosphoprotein 1 (DMP1) is a Ca 2+ It is conceived from selectively capturing and forming enamel. Accordingly, the barrier membrane for bone regeneration with laminated hydroxyapatite has superior structural stability than conventional barrier membranes, and is effective in promoting bone cell proliferation by preventing cells other than osteocytes and inflammatory microorganisms from moving into the bone defect area.

[0100] Specifically, the above-mentioned bone regeneration barrier membrane can increase the number of Firmicutes and Fusobacteria, which are microorganisms that have a positive effect on osteocyte proliferation in bone defect areas, and reduce the number of Bacteroidetes, Bacteroidetes, Actinobacteria, Proteobacteria, and Prevotella, Allopreveotella, and Actinomyces, which are pathogens related to periodontitis, which have a negative effect, thereby maintaining a stable symbiotic relationship between osteocytes and beneficial microorganisms.

[0101] The solution impregnated into the support may further include a first photoinitiator or gelling agent. Specifically, the gelling agent may be alginic acid or sodium alginate, and more specifically, alginic acid.

[0102] The first photoinitiator is selected from the group consisting of 2-hydroxy-4'-(2-hydroxyethoxy)-2-methylpropiophenone, 2-hydroxy-2-methylpropiophenone, benzoin ethyl ether, benzoin isobutyl ether, benzoin methyl ether, dibenzosuberenone, 2,2-dimethoxy-2-phenylacetophenone, 3,4-dimethylbenzophenone, and 3'-hydroxyacetophenone. Any one or more may be selected, and preferably 2-hydroxy-4'-(2-hydroxyethoxy)-2-methylpropiophenone or 2-hydroxy-2-methylpropiophenone may be used.

[0103] When the above solution further comprises only the first photoinitiator, it may be 20 to 30 wt% of a monomer containing a sulfobetaine group; 0.5 to 5 wt% of the first photoinitiator and the remainder of a solvent; and when it comprises both the first photoinitiator and the gelling agent, it may be 20 to 30 wt% of a monomer containing a sulfobetaine group; 0.5 to 5 wt% of the first photoinitiator; 1 to 5 wt% of the gelling agent and the remainder of a solvent. The gelling agent is intended to strengthen the meshwork structure of the gel of the bone regeneration barrier membrane, and specifically, when it exceeds 5 wt%, a problem may arise in that it may be used for a period shorter than its original lifespan.

[0104] The collagen support may further comprise a second photoinitiator. The second photoinitiator may be at least one selected from the group consisting of benzophenone, 4,4'-dimethylbenzophenone, and 4-methacryloxybenzophenone.

[0105] The above-mentioned bone regeneration barrier membrane may have a pore volume of 0.01 to 1 ㎛ and a pore size of 1 to 10 cc / g.

[0106] The ion mapping analysis results of the above-mentioned bone regeneration barrier membrane confirmed that the Ca / P ratio was 1 to 2, and preferably 1.67. The above-mentioned range means that hydroxyapatite is densely deposited on the entire surface and interior of the support, forming a closed layer.

[0107] The above bone regeneration barrier film has a 1-dimensional and 2-dimensional pattern measured by wide-angle X-ray diffraction scattering (WAXS), regardless of the angle of incidence (specifically, about 10 to 50°, preferably 17 to 35°), and has a thickness of 18.3 nm. -1 It is characterized by the confirmation of hydroxyapatite (HAP) peaks. That is, it can be seen that the surface and the entire interior of the collagen membrane support are deposited with hydroxyapatite to form a closed layer.

[0108] The above bone regeneration barrier membrane has a Raman spectrum analysis of 950 to 960 cm -1 It may exhibit maximum peak intensity at, specifically, 955 to 958 cm -1 It can be. The above-described range is the range of peaks that can be detected due to the stacking of hydroxyapatite, and when the maximum peak intensity is shown in the above range, it can be seen that hydroxyapatite is densely stacked on the surface and the entire interior of the protein-based support.

[0109] The above-mentioned bone regeneration barrier membrane may not contain a lamellar structure as a result of small-angle X-ray scattering. This may be because the protein forming the support forms a lamellar structure, and hydroxyapatite is densely laminated on the surface and the entire interior of the support, so the lamellar structure is not detected.

[0110] The above hydroxyapatite may be laminated in the form of flakes. Specifically, the above hydroxyapatite may form primary particles of several hundred nanometers in size, including multiple nanoflakes, and these primary particles may aggregate to form secondary particles of several μm in size. Since the above flake structure forms secondary particles of several micrometers in size by laminating multiple primary flakes, spherical agglomerations do not occur, and a uniform and dense structure can be formed for each layer.

[0111] As described above, the bone regeneration barrier membrane of the present disclosure comprises densely layered hydroxyapatite on the surface and interior of the support, forming a structure similar to tooth enamel. Accordingly, it is structurally stable, resistant to degradation by oral enzymes, and, due to its biocompatibility, does not require removal, thereby contributing to bone regeneration formation regardless of duration.

[0112] Another aspect of the present invention relates to a method for manufacturing a barrier membrane for bone regeneration, comprising the following steps.

[0113] S1) A step of preparing a precursor solution comprising a monomer containing a sulfobetaine group, a first photoinitiator, and a solvent;

[0114] S2) A step of impregnating a collagen scaffold with the precursor solution and polymerizing a zwitterionic polymer within the collagen scaffold through ultraviolet irradiation to produce a zwitterionic membrane;

[0115] S3) A step of immersing the amphoteric membrane manufactured through the above S2 step in a solution containing calcium ions to manufacture a membrane to which calcium ions are bound; and

[0116] S4) It may be characterized by including a step of immersing the membrane to which the calcium ions are bound in a solution containing phosphate ions.

[0117] In the step S1), the precursor solution may include 20 to 30 wt% of a monomer containing a sulfobetaine group; 0.5 to 5 wt% of a first photoinitiator and the remainder of a solvent; and preferably, it may include 20 to 30 wt% of a monomer containing a sulfobetaine group; 0.5 to 5 wt% of a first photoinitiator and 65-75 wt% of a solvent.

[0118] The monomer containing the above sulfobetaine group may be 2-[(methacryloyloxy)ethyl]dimethyl-(3-sulfopropyl)ammonium hydroxide or 2-methacryloyloxyethyl phosphorylcholine.

[0119] In the above step S1), the precursor solution may further include a gelling agent, and the gelling agent may be alginic acid or sodium alginate. Since the polysaccharide of alginic acid, a natural polymer, has a negative charge, it can form a hydrogel by combining with divalent cations to form an egg-box structure, and the divalent cations are Ca 2+ , Sr 2+ or Ba 2+ It can be, specifically Ca 2+ It may include, but is not limited to.

[0120] When the precursor solution further comprises a gelling agent, the precursor solution may comprise 20 to 30 wt% of a monomer containing a sulfobetaine group; 0.5 to 5 wt% of a first photoinitiator; 1 to 5 wt% of a gelling agent and the remainder of a solvent, and preferably 20 to 30 wt% of a monomer containing a sulfobetaine group; 0.5 to 5 wt% of a first photoinitiator; 1 to 5 wt% of a gelling agent and 65-75 wt% of a solvent.

[0121] The first photoinitiator is selected from the group consisting of 2-hydroxy-4'-(2-hydroxyethoxy)-2-methylpropiophenone, 2-hydroxy-2-methylpropiophenone, benzoin ethyl ether, benzoin isobutyl ether, benzoin methyl ether, dibenzosuberenone, 2,2-dimethoxy-2-phenylacetophenone, 3,4-dimethylbenzophenone, and 3'-hydroxyacetophenone. Any one or more may be selected, and preferably 2-hydroxy-4'-(2-hydroxyethoxy)-2-methylpropiophenone or 2-hydroxy-2-methylpropiophenone may be used.

[0122] The collagen scaffold may further comprise a second photoinitiator. The second photoinitiator may be at least one selected from the group consisting of benzophenone, 4,4'-dimethylbenzophenone, and 4-methacryloxybenzophenone.

[0123] Between the steps S2) and S3), the method may further include an ionic cross-linking step S-1) of immersing the zwitterionic membrane manufactured through the step S2 in a solution containing a divalent cation. The divalent cation may be calcium chloride (CaCl2) of 0.05 to 0.5 M.

[0124] The above S3) and S4) steps may be performed as a unit process, and the unit process may be repeated 5 or more times, and preferably 10 or more times.

[0125] By repeating steps S3) and S4) in the above method for manufacturing a barrier membrane for bone regeneration, the calcium ions and phosphate ions are combined by electrostatic attraction to form hydroxyapatite (Ca) having two unit structures of Ca5(PO4)3 on the support. 10 (PO4)6(OH)2) can be formed.

[0126] The solution containing the calcium ions may contain 0.1 to 1.0 M of calcium ions, and specifically, 0.3 to 0.8 M of calcium ions. In addition, the solution containing the phosphate ions may contain 0.1 to 0.5 M of phosphate ions, and specifically, 0.2 to 0.4 M of phosphate ions. When the method for manufacturing the barrier membrane for bone regeneration is performed according to the concentration range described above, hydroxyapatite can be formed by being densely laminated on the support.

[0127]

[0128] Hereinafter, the bone regeneration barrier membrane and its manufacturing method according to the present invention will be described in more detail through specific examples. However, the following examples are merely references for further explanation of the present invention and are not intended to limit the present invention to these examples, which may be implemented in various forms. Furthermore, the terminology used in the description of the present invention is intended solely to effectively describe specific embodiments and is not intended to limit the present invention.

[0129]

[0130] Example 1. Preparation of a bone regeneration barrier membrane (SIOM)

[0131] The ZM precursor solution was prepared by mixing 22.5 wt% 2-[(methacryloyloxy)ethyl]dimethyl-(3-sulfopropyl)ammonium hydroxide, 1.5 wt% alginic acid, 0.75 wt% 2-hydroxy-4′-(2-hydroxyethoxy)-2-methylpropiophenone, and the remainder deionized water.

[0132] Clinical grade type I collagen polymer membrane (CM: dry thickness 300 ㎛) was purchased from the manufacturer GENOSS (Korea), and all sides of the collagen polymer scaffold were treated with O2 plasma for 2 minutes each, then soaked in 10% (w / w) benzophenone (solvent: ethanol) for 3 minutes, and washed with deionized water. Then, the washed collagen polymer membrane was immersed in a ZM precursor solution and UV photopolymerized for 3 hours. After photopolymerization, the collagen polymer membrane was transferred to a 0.1 M CaCl2 solution and alginate cross-linking was performed for 2 hours, and the completed sample was washed several times with deionized water to prepare a zwitterionic membrane (ZM).

[0133] The washed zwitterionic membrane (ZM) was stabilized by storing in deionized water for 24 hours and transferred to 40 mM Tris buffer (pH 8.5). Next, it was soaked in a 0.3 M K2HPO4 solution for 60 seconds, washed by soaking in deionized water for 10 seconds, and soaked in a 0.5 M CaCl2 solution for 60 seconds, and washed by soaking in deionized water for 10 seconds. The soaking process for the two solutions above was repeated 10 times. The membrane, whose biomineralization was completed through the above process, was stored in 0.5 M CaCl2 at 37°C for 24 hours and then stabilized by storing in deionized water to produce the final barrier membrane for bone regeneration (SIOM).

[0134] The overall manufacturing process of the embodiment is shown in Fig. 1b. In summary, the bone regeneration barrier membrane (SIOM) according to the present invention is completed by manufacturing a double radical-based ZM from a collagen polymer membrane (CM) and then through biomineralization. Two photoinitiators (PI) and a sulfobetaine zwitterionic monomer are used. The primary photoinitiator is benzophenone (BP) used in the CM, and the secondary photoinitiator is 2-hydroxy-4'-(2-hydroxyethoxy)-2-methylpropiophenone (I2959) used in the ZM precursor. As the above sulfobetaine zwitterionic monomer, 2-[(methacryloyloxy)ethyl]dimethyl-(3-sulfopropyl)ammonium hydroxide (SBMA) is used.

[0135]

[0136] Example 2. Bone regeneration barrier membrane (SIOM-2)

[0137] A zwitterionic membrane (ZM-2) was manufactured in the same manner as in Example 1, except that 2-methacryloyloxyethyl phosphorylcholine was used instead of 22.5 wt% of 2-[(methacryloyloxy)ethyl]dimethyl-(3-sulfopropyl)ammonium hydroxide in the ZM precursor solution. Then, biomineralization was performed in the same manner as in Example 1 to manufacture a bone regeneration barrier membrane (SIOM-2).

[0138]

[0139] Comparative Example 1. Cathode barrier membrane (NM, Normal Membrane)

[0140] A cathode membrane was manufactured in the same manner as in Example 1, except that 22.5 wt% of sodium 4-vinylbenzenesulfonate, a cationic polymer, was used instead of 22.5 wt% of 2-[(methacryloyloxy)ethyl]dimethyl-(3-sulfopropyl)ammonium hydroxide in the ZM precursor solution, and then biomineralization was performed in the same manner as in Example 1 to manufacture a cathode barrier membrane (NM).

[0141]

[0142] Comparative Example 2. Positively charged membrane (PM)

[0143] A cationic polymer, diallydimethylammonium chloride, was used at 22.5 wt% instead of 22.5 wt% of 2-[(methacryloyloxy)ethyl]dimethyl-(3-sulfopropyl)ammonium hydroxide in the ZM precursor solution, and a cationic membrane was manufactured in the same manner as in Example 1. Then, biomineralization was performed in the same manner as in Example 1 to manufacture a cationic barrier membrane (PM).

[0144]

[0145] Experimental Method 1. Statistical Analysis

[0146] Statistical analysis in the present invention was performed as follows. A two-tailed Student's t-test was used for two-group comparisons. For multiple-group comparisons, a one-time ANOVA was used, and a RM ANOVA was used for analysis between groups at each time point. Statistical significance was set at 5%. Software (SPSS version 23; IBM, Armonk, NY, USA) was used for statistical analysis.

[0147]

[0148] Experimental Example 1. Characteristics of a Zwitterionic Membrane (ZM)

[0149] 1-1. Surface structure and composition evaluation

[0150] In Example 1, the characteristics of a zwitterionic membrane (ZM) prior to a bone regeneration barrier membrane (SIOM) were analyzed. A collagen polymer membrane (CM) was used as a comparison group. Analysis was performed using X-ray photoelectron spectroscopy (XPS) (K-ALPHA, Thermo Fisher Scientific, USA) and time of flight secondary ion mass spectrometry (TOF-SIMS) (TOF SIMS 5, IONTOF, Germany).

[0151] 1-2. Analysis Results

[0152] Figures 2a and 2b show the XPS analysis results for the zwitterionic membrane (ZM) and collagen polymer membrane (CM) in Example 1. According to these results, a distinct peak was identified specifically at 168.6 eV, which is the -SO of SBMA. 3 - indicates. A weak and broad peak is observed at 167 eV, which is attributed to the cysteine ​​of the collagen polymer membrane (CM). In other words, it can be confirmed that the zwitterionic polymer is successfully polymerized within the collagen polymer membrane (CM), and a zwitterionic membrane (ZM) is produced.

[0153] Figure 2c shows the upper surface image and sulfur (S) ion mapping results (n=5) of the zwitterionic membrane (ZM) in Example 1, according to which it can be seen that a large number of sulfur ions exist in the zwitterionic membrane (ZM) in Example 1.

[0154] Figure 2d shows the sulfur signal (-S-) in the zwitterionic membrane (ZM) and collagen polymer membrane (CM) in Example 1 analyzed by TOF-SIMS. According to this, it can be confirmed that the signal intensity of the zwitterionic membrane (ZM) increased 3.86 times compared to the collagen polymer membrane (CM). In other words, it was confirmed that a zwitterionic layer was successfully formed on the collagen polymer membrane (CM) and the zwitterionic membrane (ZM) was manufactured. Specifically, it was confirmed that the zwitterionic functional group of the zwitterionic membrane (ZM) functions as a nucleation site similar to DPN and DMPI. That is, the cationic portion (-NR) of the zwitterionic membrane (ZM) +4 -) is PO4 3- and forms an interaction with the anionic moiety (-SO3 - -) is Ca 2+Interactions were formed. This selective ion adsorption determines the role of biomineralization. It can be seen that the zwitterionic membrane (ZM) manufactured according to the present invention enables multi-nucleation biomineralization and overall formation of HAP within the SIOM manufactured later due to its structural specificity.

[0155]

[0156] Experimental Example 2. Ion Mapping Analysis of a Bone Regeneration Barrier Membrane (SIOM) (Example 1)

[0157] The bone regeneration barrier membrane (SIOM) according to the present invention is intended to provide a high-density biomaterial composed entirely of HAP using a biomineralization strategy. First, the elemental composition of the bone regeneration barrier membrane (SIOM) manufactured from Example 1 was analyzed.

[0158] The top image and Ca and P ion mapping of the bone regeneration barrier membrane (SIOM) manufactured according to Example 1 were analyzed. These were measured using an energy-dispersive spectrometer and an emission scanning electron microscope (JSM-IT-500HR, JEOL, Japan).

[0159] Figure 3 shows the results of calcium and phosphorus ion mapping of the bone regeneration barrier membrane (SIOM) of Example 1 using an energy-dispersive spectrometer (Scale bar = 2 μm). The results of Figure 3 were quantified and shown in Table 1.

[0160] CaPAtom%13.578.13

[0161] As shown in Fig. 3 and Table 1, the ion mapping results confirmed that the bone regeneration barrier membrane (SIOM) of Example 1 had a Ca / P ratio of 1.67. That is, it was confirmed that the bone regeneration barrier membrane (SIOM) of Example 1 had a densely formed HAP coating layer on the entire surface. The HAP coating layer is composed of thermodynamically stable hydroxyapatite Ca. 10 It was confirmed that (PO4)6(OH)2 was formed by precipitation in the form of flakes.

[0162]

[0163] Experimental Example 3. Dynamics of Natural Multiple Nucleation Biomineralization of a Structural Insulator for Bone Regeneration (SIOM) (Example 1)

[0164] In manufacturing a bone regeneration barrier membrane (SIOM) according to the present invention, the biomineralization dynamics as a function of zwitteration was investigated.

[0165] For this purpose, the photopolymerization reaction time is changed to 60 minutes, 180 minutes, and 360 minutes, or the biomineralization process (PO4 3- and Ca 2+ Each bone regeneration barrier membrane (SIOM) was manufactured in the same manner as in Example 1, except that the number of times (#) of immersion in the aqueous solution was changed to 0, 5, and 10 times.

[0166] Among these, the bone regeneration barrier membrane (SIOM) of Example 1 was manufactured by performing the photopolymerization reaction time of 180 minutes and the biomineralization process (#) 10 times. However, in order to provide convenience in notation, the bone regeneration barrier membrane (SIOM) was expressed in terms of the photopolymerization reaction time and the biomineralization process (#) in this experimental example.

[0167] For example, '#=0, 60 min' means a bone regeneration barrier membrane (SIOM) manufactured according to Example 1, except that the photopolymerization reaction time was 60 minutes and the number of biomineralization processes (number of times, #) was 0. The bone regeneration barrier membrane (SIOM) manufactured under each condition was subjected to Raman analysis as follows.

[0168] X-ray photoelectron spectroscopy (XPS) (K-ALPHA, Thermo Fisher Scientific, USA) and Raman analysis were used, and the Raman signal was analyzed using a Raman spectrometer (XploRA PLUS, HORIBA, France) with a 10x magnification microscope lens and a 532 nm laser. The laser intensity was approximately 75 mW, and the 520 nm -1 The crystalline silicon peak in was used as a calibration reference. The laser was exposed for 30 seconds for each measurement, and this was repeated five times.

[0169] Figure 4a shows the photopolymerization reaction time fixed at 180 minutes, and the biomineralization process (PO4 3- and Ca 2+ These are the Raman spectra results for each bone regeneration barrier membrane (SIOM) (#=0 (CM), #=5 (ACP), #=10 (SIOM)) manufactured by varying the number of times (#) of immersion in aqueous solution: 0, 5, and 10 times. The light gray line is the depth profile measured up to 400 μm per 10 μm, and the thick black and orange lines are the results for the upper surface.

[0170] As shown in Fig. 4a, #=0(CM) where the immersion process was repeated 0 times is 920 cm -1 and 935 cm -1 Proline and glycine signals contained in collagen were detected, and #=5(ACP), which repeated the immersion process five times, was detected at 955 cm -1In addition, the hydroxyapatite signal was detected more strongly in #=10 (SIOM, Example 1), where the immersion process was repeated 10 times.

[0171] In order to determine the relationship between the zwitterionic functional group and the degree of biomineralization in the bone regeneration barrier membrane (SIOM) according to the present invention, the degree of zwitterionic functional group generation was confirmed according to the photopolymerization time before manufacturing the barrier membrane. To this end, zwitterionic membranes (ZM) were manufactured by varying the photopolymerization reaction time to 60 minutes, 180 minutes, and 360 minutes, and the degree of zwitterion in each zwitterionic membrane (ZM) was analyzed and shown in Fig. 4b. According to this, it was confirmed that the degree of zwitterion rapidly increased as the reaction time increased. The degree of zwitterion was 168.6 eV (-SO) in the XPS graph. 3 -) You can check it through signal strength.

[0172] Figure 4c shows the photopolymerization reaction time (reaction time) of 60 minutes, 180 minutes, and 360 minutes, and the biomineralization process (PO4 3- and Ca 2+ The Raman analysis results for each bone regeneration barrier membrane (SIOM) manufactured by varying the number of times (#) of immersion in the aqueous solution (5 and 10 times) are shown. The colored line is the result for the surface of the membrane, and the light gray line represents the depth profile up to 400 μm per 10 μm. HAP stands for hydroxyapatite. As shown in Fig. 4c, it was confirmed that selective ion adsorption determines the rate of biomineralization. Therefore, in order to manufacture a bone regeneration barrier membrane (SIOM) with a dense HAP layer, the photopolymerization reaction time should be 180 minutes or more, and the biomineralization process (PO4 3- and Ca 2+It can be seen that it is desirable to perform the number of times (#) of immersion in the aqueous solution 10 times.

[0173] Figure 4d shows the photopolymerization reaction time (reaction time) of 60 minutes, 180 minutes, and 360 minutes, and the biomineralization process (PO4 3- and Ca 2+ This is a graph comparing the degree of both ionization and biomineralization for each bone regeneration barrier membrane (SIOM) manufactured by varying the number of times (#) of immersion in the aqueous solution to 5 and 10 times. The degree of biomineralization is at each depth point. The value of ν1(HAP) / [ν(Pro)+ν(Gly)+ν1(HAP)] was calculated. According to this, the biomineralization process (PO4 3- and Ca 2+ When the number of times of immersion in the aqueous solution (#) is 5, it was confirmed that the increase in the degree of biomineralization was minimal even though the degree of both ionization increased.

[0174] In contrast, the biomineralization process (PO4 3- and Ca 2+ When the number of times (#) of immersion in the aqueous solution is 10, it was confirmed that the degree of biomineralization also increases rapidly as the degree of both ionization increases.

[0175] That is, since the zwitterionic membrane (ZM) in Example 1 enables multi-nucleation biomineralization, the surface and the entire interior of the finally manufactured bone regeneration barrier membrane (SIOM) are formed to be surrounded by HAP, and in this process, it is preferable that the number of immersions (#) exceeds 5, and most preferably 10.

[0176]

[0177] Experimental Example 4. XRD diffraction pattern analysis of collagen polymer membrane (CM), zwitterionic membrane (ZM), and bone regeneration barrier membrane (SIOM) of Example 1

[0178] Figure 5 shows the results of XRD diffraction pattern analysis for a collagen polymer membrane (CM), a zwitterionic membrane (ZM), and a barrier membrane for bone regeneration (SIOM) of Example 1, which were analyzed using a high-resolution X-ray diffractometer (SmartLab, Japan) equipped with a 9 kW X-ray source. According to the results, in the barrier membrane for bone regeneration (SIOM) of Example 1, the signals related to HAP, namely the (002) peak at 26.2°, the (211) peak at 31.8°, and the (300) peak at 32.5°, were confirmed. On the other hand, the above peaks were not observed in the collagen polymer membrane (CM) and the zwitterionic membrane (ZM).

[0179] That is, it can be seen that the bone regeneration barrier membrane (SIOM) of Example 1 successfully formed HAP through biomineralization on the zwitterionic membrane (ZM).

[0180]

[0181] Experimental Example 5. Structural Analysis of the Bone Regeneration Barrier Membrane (SIOM) of Example 1

[0182] SAXS and WAXS experiments were performed at the Pohang Accelerator Laboratory (PLS, Korea) using the 9 AX-ray beamline. For WAXS measurements, the distance between the sample and the detector was 0.2 m, and the exposure time was 5–10 s. For SAXS measurements, the distance between the sample and the detector was 2.5 m, and the exposure time was 10–30 s. The rheological response was analyzed under frequency sweep conditions (amplitude 1%, angular frequency 5 rad s). -1 ) was monitored using a rheometer (MCR 302, Anton Paar, Austria).

[0183] Figure 6a shows one-dimensional and two-dimensional SAXS patterns for a collagen polymer membrane (CM) and a bone regeneration barrier membrane (SIOM) of Example 1. Here, q is a scattering vector, where q = (4π / λ)sin(θ / 2), and θ and λ represent the scattering angle and wavelength of the incident X-ray beam, respectively.

[0184] Figure 6b shows one-dimensional and two-dimensional WAXS patterns for the bone regeneration barrier membrane (SIOM) of Example 1, in which the X-rays are in the normal direction (ND; z-axis) and the cross-sectional direction (xy-axis) of the SIOM. Specifically, the cross-sectional WAXS signal was measured by rotating the X-rays 30° in the xy-plane of the bone regeneration barrier membrane (SIOM) of Example 1.

[0185] Figure 6c shows the results of the storage elastic modulus (Pa) versus the loss elastic modulus (tanδ) of the bone regeneration barrier membrane (SIOM) of Example 1.

[0186] As shown in Fig. 6a, the collagen polymer membrane (CM) was confirmed to be composed of a lamellar structure with a d-spacing of 63 nm through SAXS results. The bone regeneration barrier membrane (SIOM) of Example 1 did not exhibit a distinct scattering peak, thus confirming that the lamellar structure, which is a unique characteristic of the collagen polymer membrane (CM), disappeared after biomineralization.

[0187] In addition, as shown in Fig. 6b, the bone regeneration barrier membrane (SIOM) of Example 1 has a thickness of 18.3 nm regardless of the X-ray incident angle. -1 A distinct hydroxyapatite (HAP) peak was observed. Accordingly, it can be seen that the entire surface and interior of the collagen membrane scaffold were biomineralized with hydroxyapatite.

[0188] As shown in Fig. 6c, the bone regeneration barrier membrane (SIOM) of Example 1 has a tanδ (loss modulus / storage modulus) of 0.1 to 0.3 Pa, which indicates that the bone regeneration barrier membrane (SIOM) of Example 1 has a viscoelasticity that is intermediate between the soft and hard tissues of the gums. Through these results, it was confirmed that the bone regeneration barrier membrane (SIOM) of Example 1 is physically preferable to be placed at the interface between the gums and the alveolar bone defect as a barrier membrane.

[0189]

[0190] Experimental Example 6. Pore Structure Analysis of the Bone Regeneration Barrier Membrane (SIOM) of Example 1

[0191] Figure 7 shows the results of measuring the pore size distribution of a collagen polymer membrane (CM) (a) and a bone regeneration barrier membrane (SIOM) (b) of Example 1. The pore size was analyzed using a mercury intrusion porosimeter (PM33GT, Quantachrome).

[0192] As shown in Fig. 7, the collagen polymer membrane (CM) had almost no pores formed, but the bone regeneration barrier membrane (SIOM) of Example 1 had pores formed more densely with sizes ranging from 100 nm to 1 μm than the CM.

[0193]

[0194] Experimental Example 7. Structural Safety Evaluation under Enzyme Decomposition Conditions

[0195] GBR requires a treatment period of several months. Therefore, the bone regeneration barrier membrane must maintain its structure to provide sufficient time and space for alveolar bone regeneration. In the early stages of alveolar bone regeneration, degradative enzymes and inflammatory cytokines are produced, which affect the stability of the membrane. Collagenase I, a bone-forming enzyme, is an essential enzyme involved in regeneration, but it rapidly degrades the collagen polymer membrane (CM), causing the problem of destroying the healing zone. Therefore, the bone regeneration barrier membrane (SIOM) of Example 1 must have structural stability under enzymatic degradation conditions. In this study, we aimed to evaluate the importance of osteo-mimetic multiple nucleation biomineralization by introducing various functional groups (R) into the collagen polymer membrane (CM).

[0196] The bone regeneration barrier membrane (SIOM) of Example 1 is a sulfobetaine zwitterionic polymer, and the bone regeneration barrier membrane (SIOM-2) of Example 2 is a phosphorylcholine zwitterionic polymer. In addition, the cathode barrier membrane (NM) of Comparative Example 1 and the anode barrier membrane (PM) of Comparative Example 2 were manufactured from polystyrene sulfonate and poly(diallydimethylammonium chloride), and their chemical structures are shown in Fig. 8a.

[0197] In order to evaluate the enzyme stability of the barrier membrane formed by HAP through biomineralization, 0.2 IU / ml collagenase I was mixed with 1× Hank's balanced salt solution containing 10 mM CaCl2 to prepare an enzyme solution, and 1 ml was dispensed into each of 24 wells. The cathodic barrier membrane (NM) of Comparative Example 1, the anodic barrier membrane (PM) of Comparative Example 2, the bone regeneration barrier membrane (SIOM) of Example 1, and the bone regeneration barrier membrane (SIOM-2) of Example 2 were each 1×1 cm 2 After preparing the specimens to be the size of , they were each immersed in 24 wells containing the enzyme solution and incubated at 37°C for 12 hours to induce enzyme degradation. The thickness of the remaining membrane was measured according to the incubation time. The shear modulus was measured during biodegradation, and the frequency sweep mode was performed according to the protocol.

[0198] Figure 8b is a SEM (b Scanning electron microscope) image of the cathode barrier film (NM) of Comparative Example 1, the anode barrier film (PM) of Comparative Example 2, the bone regeneration barrier film (SIOM) of Example 1, and the bone regeneration barrier film (SIOM-2) of Example 2 (scale bar=1㎛) (n=5). Figure 8c is a diagram illustrating the penetration process of collagenase according to the structure of the bone regeneration barrier film.

[0199] As shown in Fig. 8b, in the cathode barrier film (NM) of Comparative Example 1 and the anode barrier film (PM) of Comparative Example 2, hydroxyapatite (HAP) was deposited in a spherical aggregated shape by being bound only to a portion of the surface of the membrane through single nucleation biomineralization. Therefore, it can be confirmed that the surface of the cathode barrier film (NM) of Comparative Example 1 and the anode barrier film (PM) of Comparative Example 2 is exposed.

[0200] On the other hand, it was confirmed that the bone regeneration barrier membrane of Example 1 (SIOM) and the bone regeneration barrier membrane of Example 2 (SIOM-2) were deposited with hydroxyapatite (HAP) in the form of wrinkled flakes so as to completely cover the entire membrane. It can be confirmed that the bone regeneration barrier membrane of Example 1 (SIOM) and the bone regeneration barrier membrane of Example 2 (SIOM-2) are more densely laminated with hydroxyapatite due to the multiple nucleation method, and the surface of the membrane is not exposed to the outside at all. In other words, it can be seen that the bone regeneration barrier membrane of Example 1 (SIOM) and the bone regeneration barrier membrane of Example 2 (SIOM-2) have excellent enzymatic stability because the penetration of collagenase is physically and electrostatically blocked due to the densely grown HAP.

[0201] Figure 8d shows the appearance of a collagen polymer membrane (CM), a cathodic barrier membrane (NM) of Comparative Example 1, anodic barrier membrane (PM) of Comparative Example 2, a bone regeneration barrier membrane (SIOM) of Example 1, and a bone regeneration barrier membrane (SIOM-2) of Example 2 after treatment with collagenase (0.2 IU / mL). The residual membrane is indicated by an orange arrow.

[0202] Figure 8e shows the results of analyzing the degradation rates of a collagen polymer membrane (CM), a cathodic barrier membrane (NM) of Comparative Example 1, anodic barrier membrane (PM) of Comparative Example 2, a bone regeneration barrier membrane (SIOM) of Example 1, and a bone regeneration barrier membrane (SIOM-2) of Example 2. The specific values ​​are summarized and shown in Table 2.

[0203] CMNMPMSIOM-2SIOM decomposition rate (10 -2 ×h -1 )3.532.143.00.200

[0204] As shown in Fig. 8d, the collagen polymer membrane (CM) showed excellent stability against hydrolytic enzymes for 48 hours, but was rapidly degraded within 12 hours in collagenase, resulting in a rapid deterioration in performance. The cathodic barrier membrane (NM) of Comparative Example 1 and the anodic barrier membrane (PM) of Comparative Example 2 had relatively lower degradation rates than the collagen polymer membrane (CM), but it was confirmed that the degradation rates increased as much as the collagen polymer membrane (CM) after 48 hours. In contrast, the bone regeneration barrier membrane (SIOM) of Example 1 did not degrade for the longest time, maintaining its shape almost perfectly even after 48 hours. It was confirmed that the bone regeneration barrier membrane (SIOM) of Example 1 has remarkable technical features such as excellent enzyme stability and long-lasting structural stability because the wrinkled flake-shaped HAP completely covers the surface, blocking the penetration of collagenase. The bone regeneration barrier membrane (ZM-2) of Example 2 was also confirmed to have a very low degradation rate by HAP.

[0205] The rheological response was analyzed using a rheometer. Frequency sweep conditions (amplitude 1%, angular frequency 5 rad s) -1 ) was monitored using a rheometer (MCR 302, Anton Paar, Austria).

[0206] Figure 8f shows the results of analyzing the rheological response of a collagen polymer membrane (CM) (left) and a bone regeneration barrier membrane (SIOM) of Example 1 (right) when treated with collagenase (0.2 IU / mL) for 0 to 10 hours. The image interpolated in Figure 8f is an ion mapping image of the bone regeneration barrier membrane (SIOM) of Example 1 after exposure to collagenase (scale bar = 2 μm).

[0207] As shown in Fig. 8f, the storage elastic modulus and loss elastic modulus of the collagen polymer membrane (CM) and the bone regeneration barrier membrane (SIOM) of Example 1 were measured, and as a result, it was confirmed that the collagen polymer membrane (CM) lost about 90% of the storage elastic modulus after 4 hours of exposure, whereas the bone regeneration barrier membrane (SIOM) of Example 1 maintained viscoelasticity and the Ca / P element ratio of hydroxyapatite even after 10 hours of exposure to collagenase. In other words, it can be seen that the bone regeneration barrier membrane (SIOM) of Example 1 can stably maintain its original chemical and structural properties in vivo for a long period of time due to excellent enzyme stability.

[0208] In order to confirm whether it is stable against enzymes present in the oral cavity other than collagen-decomposing enzymes, a collagen polymer membrane (CM) and a bone regeneration barrier membrane (SIOM) of Example 1 were cultured in a 1,000 U / mL α-amylase solution at 37°C for 48 hours, and the residual membrane thickness was measured, which was expressed as a percentage of the initial membrane thickness.

[0209] Figure 8g shows the results of measurements taken after treating a collagen polymer membrane (CM) and a bone regeneration barrier membrane (SIOM) of Example 1 with amylase and culturing them for 0 to 48 hours. According to the results, the collagen polymer membrane (CM) began to decompose from 24 hours and was completely removed at 48 hours, whereas the bone regeneration barrier membrane (SIOM) of Example 1 was confirmed not to decompose even after 48 hours. Therefore, it can be seen that the bone regeneration barrier membrane (SIOM) of Example 1 has excellent structural stability even in the oral environment.

[0210]

[0211] Experimental Example 8. Toxicity Analysis of the Bone Regeneration Barrier Membrane (SIOM) of Example 1

[0212] The bone regeneration barrier membrane (SIOM) of Example 1 was subjected to a cytotoxicity test [related standard: ISO 10993-5] guaranteed by GLP (Good Laboratory Practice, non-clinical trial management standard), and the reaction distance from the sample was analyzed and shown in Table 3 (scale: cm), and the reaction grade in the biocompatibility analysis is shown in Table 4. In Tables 3 and 4 a HDPE is a high-density polyethylene film and was used as a negative control (NC). b ZDEC was used as a positive control (PC) with 0.1% ZDEC polyurethane film.

[0213] Distinction SIOM (Example 1) a HDPE(NC) b ZDEC(PC)1000.512000.53000.52mean ± SD0.00 ± 0.000.00 ± 0.000.51 ± 0.01

[0214] Distinction SIOM (Example 1) a HDPE(NC) bZDEC(PC)11 (Slight)0 (None)3 (Moderate)21 (Slight)0 (None)3 (Moderate)31 (Slight)0 (None)3 (Moderate)Average1 (Slight)0 (None)3 (Moderate)

[0215] As shown in Tables 3 and 4, the bone regeneration barrier membrane (SIOM) of Example 1 was confirmed to have high biocompatibility, as only a slight Grade 1 reaction was observed in an indistinguishable area.

[0216]

[0217] Experimental Example 9. Symbiotic Induction Effect of the Bone Regeneration Barrier Membrane (SIOM) of Example 1-1

[0218] 9-1. In vitro cell experiments

[0219] BMSCs (American Type Culture Collection (ATCC), PCS-500-012) were cultured in Minimum Essential Medium (MEM), Alpha Modification (Alpha MEM, WELGENE, LM 008-01) containing 10% fetal bovine serum (FBS) (WELGENE, S001-07) and 1% penicillin-streptomycin (Gibco, 15140122). BMSCs were used at passages #5-8. BMSCs were cultured for 2 weeks in growth medium and osteogenic differentiation medium, and during this period, they were cultured with collagen polymer membrane (CM) or the bone regeneration barrier membrane (SIOM) of Example 1, respectively. Osteogenic differentiation medium was Alpha MEM medium containing 10% (v / v) FBS, supplemented with 10 mM β-glycerophosphate (Sigma-Aldrich, G5422-25G) and 50 μg / mL ascorbic acid (Sigma-Aldrich, A5960-25G). BMSCs were cultured in a CO2 incubator (Thermo Fisher Scientific, BB 150) at 37°C and 5% CO2.

[0220] 9-2. qRT-PCR(Quantitative real-time polymerase chain reaction)

[0221] Total RNA was extracted using the RNeasy Mini Kit (Qiagen, 74140). cDNA was synthesized using SuperScript III First-Strand and oligo-dT primer (Invitrogen, 18080-051) according to the manufacturer's instructions. SYBR Green PCR master mix (Applied Biosystems, Foster City, 4309155) and QuantStudio 3 Real-time PCR (Life Technologies, A28131) were used for qPCR experiments. PCR experiments were performed at 95°C for 15 min, followed by 40 cycles of 95°C for 10 s, 60°C for 15 s, and 72°C for 30 s, and then a final extension at 72°C for 10 min and 95°C for 10 s. Relative gene expression levels were quantified using the delta Ct method. The primers used in the present invention are listed in Table 5, and the full names of the biomarkers used in this experimental example are as follows: RUNX2: runt-related transcription factor 2; OCN osteocalcin, OPN osteopontin, BMP2 bone morphogenic protein-2.

[0222] Target gene primer sequence (5'-3') BMP2 forward sequence 1 AGCGAGTTCGAGTTGCGGCTreverse sequence 2 AGCTGCGCACAGTGTTGGCTOCN forward sequence 3 CCCAGGCGCTACCTGTATCAAreverse sequence 4 GGTCAGCCAACTCGTCACAGTCOPN forward sequence 5 ACACATATGATGGCCGAGGTGAreverse sequence 6 TGTGAGGTGATGTCCTCGTCTGTAGRUNX2 forward sequence 7 AACCCTTAATTTGCACTGGGTCAreverse sequence 8 CAAATTCCAGCAATGTTTGTGCTAC

[0223] 9-3. Analysis Results

[0224] Figure 9a shows the results of qRT-PCR analysis of cytokine expression (OPN) after culturing BMSC cells on collagen polymer membrane (CM) and bone regeneration barrier membrane (SIOM) of Example 1 for 2 weeks under growth medium conditions (mean ± standard deviation, n = 3, two-tailed t-tests, p = 0.0317). Figure 9b shows the results of qRT-PCR analysis of cytokine expression (RUNX2, OCN, OPN, BMP2) after culturing BMSC cells on collagen polymer membrane (CM) and bone regeneration barrier membrane (SIOM) of Example 1 for 2 weeks under osteogenic differentiation medium conditions (mean ± standard deviation, n = 3, two-tailed t-tests, p = 0.000012 for OPN, p = 0.000249 for BMP2) (p < 0.05, p < 0.01, p < 0.001.******)

[0225] As shown in Fig. 9, RUNX2, OCN, OPN, and BMP2 are important biomarkers related to osteogenesis. In the growth medium, OPN expression was confirmed to be 2.67 times higher in the bone regeneration barrier membrane (SIOM) of Example 1 than in the collagen polymer membrane (CM). In other words, it can be seen that the bone regeneration barrier membrane (SIOM) of Example 1 increases the density of osteogenic differentiation.

[0226] In addition, according to the BMSC test performed under osteogenic differentiation medium conditions, the bone regeneration barrier membrane (SIOM) of Example 1 showed a 127% increase in RUNX2, a 118% increase in OCN, a 1065% increase in OPN, and a 2884% increase in BMP2 compared to the collagen polymer membrane (CM). In other words, it can be seen that the bone regeneration barrier membrane (SIOM) of Example 1 significantly improves bone formation and differentiation compared to the collagen polymer membrane (CM).

[0227] The results described above demonstrate that the bone regeneration barrier membrane (SIOM) of Example 1 induces excellent stimulation for bone differentiation. In addition, the significantly enhanced expression of OPN and BMP2 in Fig. 9b indicates that the bone regeneration barrier membrane (SIOM) of Example 1 promotes bone healing up to the bone tissue formation stage for two weeks. Therefore, the bone regeneration barrier membrane (SIOM) of Example 1 is very useful for guided bone regeneration (GBR) treatment requiring alveolar bone regeneration and expansion.

[0228]

[0229] Experimental Example 10. In vitro microbiological assays

[0230] 10-1. Sample preparation

[0231] To evaluate the microbial ecosystem symbiosis of the barrier membrane, a biofilm analysis experiment using saliva was conducted. Saliva collection adhered to the ethical principles of the 64th World Medical Association Declaration of Helsinki and was conducted under procedures approved by the Institutional Review Board of Yonsei University Dental Hospital (2-2019-0049). Saliva was collected from three healthy women and three healthy men aged 20-30 years. Equal amounts of saliva from six healthy donors were mixed and used, and individual data were not collected. Informed consent was obtained from all participants prior to saliva donation. The saliva mixture was diluted 30% in sterile glycerol and stored at -80°C. McBaine's medium was used for the biofilm model. The saliva mixture was cultured in McBain's medium for 24 hours to obtain a culture medium. 1.5 ml of the culture medium was added to the samples and incubated at 37°C for 48 hours. At this time, collagen polymer membrane (CM), zwitterionic membrane (ZM), or bone regeneration barrier membrane (SIOM) of Example 1 were used as samples. Medium without barrier membrane was used as a positive control (PC). During the above culture period, the medium was replaced with fresh medium every 8, 16, and 24 hours, and after 48 hours, the culture medium was recovered and used as a sample (sequentially classified into CM, ZM, SIOM, and PC).

[0232] 10-2. 16S rRNA sequencing analysis

[0233] DNA sequencing was performed using the DNeasy PowerSoil Kit. Bacterial DNA was extracted from the CM, ZM, SIOM, and PC samples, respectively, and prepared according to the Illumina 16S Metagenomic Sequencing Library protocol. DNA quality and quantity were assessed using PicoGreen and VICTOR Nivo. The 16S rRNA gene was amplified using the 16S V3-V4 primers, and a limited cycle amplification step was performed to increase the multiplexing index and add Illumina sequencing adapters. The final products were normalized and pooled for size confirmation before sequencing on the MiSeq platform.

[0234] Amplicon sequencing was performed using the Illumina Miseq Sequencing System from Illumina, USA. Low-quality reads with values ​​less than 25 were removed to maintain data integrity. Divisive Amplicon Denoising Algorithm 2 (DADA2 version 1.26) was applied in R Studio (R version 4.2) to assemble paired-end reads and provide read alignment for amplicon sequence variations. 16S rRNA reads were separated at a similarity threshold of 97% and classified based on the EzBioCloud 16S rRNA database. The sequencing data generated in this experiment were registered in the NCBI BioProject database with the accession number: PRJNA981675.

[0235] 10-3. Analysis Results

[0236] Figure 10a schematically illustrates the experimental process for in vitro microbiological assays. Figure 10b shows the phylum-level classification of microbial groups identified from saliva cultures treated with collagen polymer membranes (CM), zwitterionic membranes (ZM), or the bone regeneration barrier membrane (SIOM) of Example 1. Figure 10c shows rarefaction curves for saliva cultures treated with collagen polymer membranes (CM), zwitterionic membranes (ZM), or the bone regeneration barrier membrane (SIOM) of Example 1. This is a function graph for the given sample and the number of species. Figure 10d shows the specific abundance ratio in saliva cultures treated with collagen polymer membranes (CM), zwitterionic membranes (ZM), or the bone regeneration barrier membrane (SIOM) of Example 1. In Figure 10, saliva cultures without a barrier membrane were used as a positive control (PC).

[0237] As shown in Fig. 10c, b, SIOM can be seen to have a significantly lower species abundance compared to PC and CM. It was also confirmed that the Firmicutes-to-Bacteroidetes (F / B) ratio was significantly increased compared to PC and CM (49.0 times). The F / B ratio is related to the metabolic fermentation pathway, and a lower F / B ratio is closely related to an increase in the expression of proinflammatory cytokines, and the expression of proinflammatory cytokines interferes with normal healing. That is, it can be seen that the bone regeneration barrier according to the present invention significantly inhibits the growth of Gram-negative bacteria of Bacteroidetes in the oral environment and induces the growth of beneficial bacteria of Firmicutes, thereby increasing the F / B ratio and suppressing the expression of proinflammatory cytokines.

[0238] Figure 10e shows the results of a comparative analysis of microorganisms at the genus level for saliva cultures treated with a positive control (PC), collagen polymer membrane (CM), zwitterionic membrane (ZM), or bone regeneration barrier membrane (SIOM) of Example 1. According to this, SIOM showed a lower relative abundance of three periodontal pathogens (Prevotella, Allopreveotella, and Actinomyces) related to periodontal disease compared to PC, CM, and ZM.

[0239] Figure 10f shows the relative abundance of the most prevalent microbial species among the microbial groups identified from saliva cultures treated with a positive control (PC), collagen polymer membrane (CM), zwitterionic membrane (ZM), or bone regeneration barrier membrane (SIOM) of Example 1. Taxa accounting for less than 1% of the total base sequences were classified as other groups.

[0240] Figure 10g shows the results comparing the species levels in saliva cultures treated with a positive control (PC), collagen polymer membrane (CM), or bone regeneration barrier membrane (SIOM) of Example 1. A log abundance distribution pattern was observed in the genera Fusobacterium, Prevotella, Streptococcus, and Veillonella.

[0241] According to Figures 10f and g, pathogenic microorganisms such as Fusobacterim periodonticum, Gemella haemolysans, Haemophilus parainfluenzae, Porphyromonas pasteri, and Veillonella sps were not observed in SIOM. Furthermore, SIOM was found to have a lower abundance of Veillonella, which causes microbial imbalance. Veillonella parvula, Veillonella dispar, and Veillonella rogosae were found to be present at twice the abundance in CM compared to SIOM.

[0242] Thus, it can be seen that SIOM significantly inhibits the proliferation of pathogens in the oral microbial environment and provides a useful environment for commensal microorganisms, thereby improving the therapeutic effect.

[0243] In contrast, ZM was found to shape the distribution of microbial groups such as Bacteroides vulgatus, Enterococcus faecium, and Romboutsia timonensis. Furthermore, the zwitterionic functional group of ZM was found to non-specifically inhibit the growth of microbial groups by up to 50% compared to CM. In other words, non-biomineralized ZM has a very high possibility of rapidly altering the microbial environment in the oral cavity, thereby inducing a transition to a disease state.

[0244] Figure 10h is a Venn plot of the core microbial groups present in saliva cultures treated with a positive control (PC), a collagen polymer membrane (CM), a zwitterionic membrane (ZM), or the bone regeneration barrier membrane (SIOM) of Example 1. The overlapping areas in the Venn plots indicate shared species-level and unique taxa. Figure 10i is the result of SIMPER analysis showing the dissimilarity between saliva culture groups treated with a positive control (PC), a collagen polymer membrane (CM), a zwitterionic membrane (ZM), or the bone regeneration barrier membrane (SIOM) of Example 1. Figure 10j is the result of showing the difference in taxonomic microbial abundance in saliva cultures treated with a collagen polymer membrane (CM), a bone regeneration barrier membrane (SIOM) of Example 1 and the positive control (PC) for which the dissimilarity exceeds 1%. Negative values ​​on the x-axis indicate lower abundance in PC compared to CM / SIOM.

[0245] As shown in Figures 10h-j, SIOM was found to significantly influence the overall diversity similarity index. ZM and SIOM were found to have very high dissimilarity (>79%) with respect to PC abundance (reference). This difference was found to be largely due to differences in the core microbial community (>70% prevalence).

[0246] As shown in Fig. 10j, CM and SIOM were observed to show the highest dissimilarity in Enterobacteriaceae and Bacillus cereus. V. dispar, P. melaninogenica, and F. periodonticum were found to have higher abundances at the CM interface. These differences contributed to the -3% dissimilarity. In addition, Porphyromonas and Fusobacterium, which are periodontitis-causing bacteria, were observed only in the PC and CM groups.

[0247]

[0248] Experimental Example 11. In vitro microbiological assays

[0249] Porphyromonas gingivalis and Staphylococcus aureus, which are closely related to periodontitis and dental caries, were treated with a collagen polymer membrane (CM) or a bone regeneration barrier membrane (SIOM) of Example 1, and then cultured at 37°C for 48 hours, and then colony-forming units (CFUs) were analyzed.

[0250] Figure 11 shows the results of confirming colony forming units after co-culturing Porphyromonas gingivalis (a) and Staphylococcus aureus (b) with a collagen polymer membrane (CM) or a bone regeneration barrier membrane (SIOM) of Example 1.

[0251] As shown in Fig. 11, the bone regeneration barrier membrane (SIOM) of Example 1 was confirmed to have a 68% decrease in Porphyromonas gingivalis colonies and a 54% decrease in Staphylococcus aureus colonies compared to CM. Staphylococcus aureus is well known as Staphylococcus aureus and is a gram-positive coccus that generally causes bacteremia or food poisoning due to surgery or infection. Staphylococcus aureus can be easily found anywhere, and is generally harmless when present on the skin, but can cause diseases if it enters the body through an incision or injection during implant surgery. Staphylococcus aureus easily adheres to metal (especially titanium) and causes problems such as peri-implantitis, inducing an inflammatory response in bone grafting, or forming a biofilm that makes treatment difficult.

[0252] The bone regeneration barrier membrane (SIOM) according to the present invention has a remarkably excellent proliferation inhibitory effect on Porphyromonas gingivalis and Staphylococcus aureus, and thus can prevent infection as a graft material for implants or bone regeneration, thereby having an excellent effect of increasing the success rate of bone regeneration treatment and reducing the infection rate.

[0253]

[0254] Experimental Example 12. Therapeutic Efficacy Using an In Vivo Animal Model

[0255] 12-1. Laboratory animals

[0256] Six male mixed-breed dogs, 10-14 months old and weighing 25-30 kg, were used in this experiment (CRONEX, Suwon, Korea). The animals were housed in separate cages under standard laboratory conditions and provided with sufficient food and water. The experiment was performed on the maxillary fourth premolars. General anesthesia was administered intravenously with sodium pentobarbital (Tokyo Chemical Co., Japan) one week before surgery. The maxillary fourth premolars were extracted on both sides, and a collagen polymer membrane (CM) or the bone regeneration barrier membrane (SIOM) of Example 1 was introduced into the surgical site. The particulate bone graft (Osteon III; Genoss, Korea) (0.5 cc) consisted of 60% porous HAP and 40% tricalcium phosphate, with particle sizes ranging from 0.5 to 1.0 mm. The groups were randomly assigned. The animals were euthanized after a 4-week healing period.

[0257] 12-2. GBR treatment procedure

[0258] All surgical procedures used medetomidine (0.75 mg / kg, im; Tomidin, Provet Veterinary Products, Istanbul, Turkey) and alfaxalone (2 mg / kg, i.v.; Jurox, Rutherford, NSW, Australia), and was maintained by inhalation of isoflurane (Forane, Choongwae Pharmaceutical, Seoul, South Korea). The alveolar mucosa at the surgical site was infiltrated with 2% lidocaine containing epinephrine 1:100,000 (Kwang Myung Pharm, Seoul, Korea) to control bleeding and ensure deep anesthesia. Supragingival scaling was performed on all teeth using an ultrasonic scaler and curette.

[0259] For the extraction socket model, a gingival incision was made along the left and right maxillary fourth premolars (P4), and then a hemi-incision was performed to extract the distal root canal. The pulp tissue of the remaining mesial canal was removed and sealed with calcium hydroxy paste (Dycal, Dentsply Caulk, Milford, Delaware). The extraction socket was filled with particulate bone graft (Osteon III; Genoss, Suwon, Korea), and a collagen polymer membrane (CM) (control group) or the bone regeneration barrier membrane (SIOM) of Example 1 (experimental group) was carefully applied over the extraction socket entrance. The membrane was secured with absorbable sutures (4-0 glyconate monofilament, Monosyn, B Braun, Tuttlingen, Germany). Primary sutures for open wound healing were not performed.

[0260] 12-3. Microbiome Sequencing Analysis Following GBR Treatment in Vivo

[0261] Gingival crevicular fluid (GCF) samples were collected from the P4 surface of the control group (CM) and the experimental group (SIOM). GCF was collected from healthy subjects 24 hours prior to GBR surgery (Sx-24). For consistency, sterile paper of the same size was used for collection, and each paper was allowed to absorb exudate for up to half its length for a maximum of 30 seconds. Samples were collected 24 hours prior to tooth extraction and immediately after membrane insertion, with additional samples collected at 24-hour intervals for 2 days during the healing period. Bilateral samples collected before membrane insertion were combined to minimize baseline variation. Water and food were provided regularly after surgery, and samples were collected at least 12 hours after the last intake. No additional oral prophylaxis was administered during the evaluation period. This procedure is illustrated in Figures 12a and b.

[0262] The collected samples were filtered to remove bacteria and analyzed according to 10-2. 16S rRNA sequencing analysis in Experimental Example 10. However, the base sequence analysis of the 16S rRNA amplicons of V3-V4 was analyzed using the Bakt 341F-805R target region. The most appropriate BLAST hit was selected as a reference for each representative sequence from NCBI_16S_20211127 (BLAST). The raw base sequence analysis data generated in this experiment were registered in the NCBI BioProject database with the accession number .

[0263] 12-4. Gingival soft tissue analysis

[0264] The surgical site of each experimental animal group was measured using an intraoral scanner (Medit i500) for two weeks after surgery. The intraoral scanner can rapidly acquire three-dimensional images of the oral tissues of the experimental animals. The scanned images were analyzed using a digital imaging software program (SMOP; Swissmeda, Switzerland) to determine the area change of the exposed surgical wound (gingival tissue) as a region of interest (ROI).

[0265] 12-5. Analysis Results

[0266] Figures 12a and b are experimental animal models. During the post-surgical healing period, the collagen polymer membrane and the bone regeneration barrier membrane (SIOM) of Example 1 are exposed in the oral cavity, which causes changes in the oral environment by coming into contact with saliva and GCF. Therefore, we aimed to determine the microbiome information on the surface of the membrane within 48 hours after GBR surgery to determine the impact on the oral environment. Referring to Figure 12b, the sample collection schedule was planned based on the GBR surgical site (Sx). GCF was collected in a healthy state 24 hours before GBR surgery, and free gingival tissue (gingiva) and subapically inflamed granular tissue (inflamed; pathogenic reference) were obtained at the Sx site. The GCF, gingiva, and inflammation samples recovered in this manner were further subjected to microbiome analysis.

[0267] Figure 12c is a rarefaction curve for the species richness of the collagen polymer membrane (CM) (comparative group) or the bone regeneration barrier membrane (SIOM) of Example 1 (experimental group) according to the treatment period.

[0268] As shown in Figure 12c, at the beginning of treatment (24 hours), GCF exhibited a grouping pattern of species richness relative to the base sequence sample size. In contrast, the bone regeneration barrier membrane (SIOM) of Example 1 showed changes in species richness, which became more pronounced after 48 hours of treatment.

[0269] Figure 12d shows the results of analyzing alpha diversity in amplicon sequences obtained from GCF, collagen polymer membrane (CM) (control group), or bone regeneration barrier membrane (SIOM) of Example 1 (experimental group). Chao1 and ACE indices can estimate total species richness by considering both observed and unobserved species.

[0270] As shown in Fig. 12d, it can be seen that the microbial species or mutations are significantly lower in the bone regeneration barrier membrane (SIOM) of Example 1 (experimental group) than in the collagen polymer membrane (CM) (control group). This means that the bone regeneration barrier membrane (SIOM) of Example 1 (experimental group) has fewer unique operational taxonomic units (OTUs).

[0271] Figure 12e shows the relative abundance confirmed in the bone regeneration barrier membrane (SIOM) (experimental group) of Example 1 compared to the collagen polymer membrane (CM) (control group). Figure 12e shows the relative abundance confirmed at the phylum level compared to GCF for both CM and SIOM through ANCOM-BC analysis.

[0272] Figure 12f shows the results showing the relative abundance of microorganisms at the phylum level in samples of collagen polymer membrane (CM) (comparative group) or bone regeneration barrier membrane (SIOM) of Example 1 (experimental group) according to the treatment period.

[0273] As shown in Fig. 12f, the relative abundance of Fusobacteria increased in both the collagen polymer membrane (CM) (comparative group) and the bone regeneration barrier membrane (SIOM) of Example 1 (experimental group), but the relative abundance of Proteobacteria was confirmed to be significantly reduced in the bone regeneration barrier membrane (SIOM) of Example 1 (experimental group) unlike the collagen polymer membrane (CM) (comparative group). In other words, it can be seen that the bone regeneration barrier membrane (SIOM) of Example 1 (experimental group) has growth inhibition activity and resistance against Proteobacteria involved in the progression of periodontitis.

[0274] Figure 12g shows the distribution of core microbiota among GCF, collagen polymer membrane (CM) (control group), or the intraosseous microbial barrier membrane (SIOM) of Example 1 (experimental group). GCF is gingival crevicular fluid collected in a healthy state 24 hours before GBR surgery. As shown in Figure 12g, the intraosseous microbial barrier membrane (SIOM) of Example 1 (experimental group) was confirmed to have an overall 8.3% overlap in core microbiota distribution with the GCF. In contrast, the intraosseous microbial barrier membrane (CM) of Example 1 (control group) was confirmed to have an overall 3.6% overlap in core microbiota distribution with the GCF. Therefore, it can be seen that the intraosseous microbial barrier membrane (SIOM) of Example 1 (experimental group) maintains an environment most similar to the microbial environment of a healthy state during GBR treatment.

[0275] Figure 12i shows the results of the out-of-bag (OOB) probability score and dysbiosis score obtained from median community level variations (CLV) for the collagen polymer membrane (CM) (control group) or the bone regeneration barrier membrane (SIOM) of Example 1 (experimental group). The dysbiosis threshold is set on a scale from 0 to 1 based on the preoperative GCF sample, where 1 represents the maximum dysbiosis score.

[0276] As shown in Figure 12i, OOB (Out-of-Bag) and CLV (Neighborhood Classification Method by Community) are indices of dysbiosis, a state in which the balance of a normal ecosystem or microbial community is disrupted and altered. The bone regeneration barrier membrane (SIOM) of Example 1 (experimental group) was found to have a low to moderate OOB score, whereas the collagen polymer membrane (CM) (control group) was found to have a high microbial imbalance score (>0.6).

[0277] The bone regeneration barrier membrane (SIOM) of Example 1 (experimental group) was confirmed to be more effective in resisting dysbiosis induction than the collagen polymer membrane (CM) (comparative group). In other words, it can be seen that the bone regeneration barrier membrane (SIOM) of Example 1 (experimental group) promotes the microbial community in a desirable and positive direction in bone regeneration.

[0278] Figure 12j shows the results of analyzing the postoperative wound healing rate for collagen polymer membrane (CM) (comparative group) or bone regeneration barrier membrane (SIOM) of Example 1 (experimental group) (n=7, RM ANOVA, p=0.002). *p<0.05, **p<0.01, ***p<0.001.

[0279] As shown in Fig. 12j, the experimental group to which the bone regeneration barrier membrane (SIOM) of Example 1 was applied maintained the composition of the oral microbial environment and suppressed the proliferation of harmful bacteria, thereby confirming that the gingival tissue was regenerated 2 to 3 times faster than the control group.

[0280] In particular, the experimental group to which the bone regeneration barrier membrane (SIOM) of Example 1 was applied showed a significant reduction in the initial surgical wound size within 72 hours of treatment, and complete healing was achieved within 168 hours (1 week). On the other hand, the comparative group to which a collagen polymer membrane (CM) was applied showed that it took twice as long (336 hours: 14 days) to complete healing compared to the experimental group.

[0281] Not only CM, but most bone regeneration barriers require a very long period of time for GBR treatment like the control group and do not take into consideration the oral microbial environment, resulting in a very high infection rate during treatment. On the other hand, the barrier according to the present invention has a significantly superior treatment efficacy and side effect reduction efficacy in that it not only shortens the treatment period rapidly compared to conventional barriers, but also induces inhibition of harmful bacteria without causing changes in the oral microbial environment.

[0282]

[0283] Experimental Example 13. Therapeutic Efficacy in an Animal Model of Inflammation

[0284] 13-1. Laboratory animals

[0285] Six male mixed-breed dogs, 10-14 months old and weighing 25-30 kg, were used in this experiment (CRONEX, Suwon, Korea). The animals were housed in separate cages under standard laboratory conditions and provided with sufficient food and water. The experiment was performed on the second and third premolars of the maxillary teeth. General anesthesia was administered intravenously with sodium pentobarbital (Tokyo Chemical Co., Japan) one week prior to surgery. Inflammation was induced. Tooth extraction was performed according to the experimental schedule. A collagen polymer membrane (CM) or the bone regeneration barrier membrane (SIOM) of Example 1 was then introduced into the surgical site. The particulate bone graft (Osteon III; Genoss, Korea) (0.5 cc) consisted of 60% porous HAP and 40% tricalcium phosphate, with particle sizes ranging from 0.5 to 1.0 mm. The groups were randomly assigned. The animals were euthanized 13 weeks after the start of the experiment.

[0286] 13-2. GBR treatment procedure

[0287] All surgical procedures used medetomidine (0.75 mg / kg, im; Tomidin, Provet Veterinary Products, Istanbul, Turkey) and alfaxalone (2 mg / kg, i.v.; Jurox, Rutherford, NSW, Australia), and was maintained by inhalation of isoflurane (Forane, Choongwae Pharmaceutical, Seoul, South Korea). The alveolar mucosa at the surgical site was infiltrated with 2% lidocaine containing epinephrine 1:100,000 (Kwang Myung Pharm, Seoul, Korea) to control bleeding and ensure deep anesthesia. Supragingival scaling was performed on all teeth using an ultrasonic scaler and curette.

[0288] To model infected alveolar bone augmentation, root canal and periodontal lesions were induced in the maxillary premolar area. To achieve this, the flap was elevated, and the distal root canals of the second and third premolars were carefully removed through a hemi-incision. The buccal bone was removed to create a narrow alveolar ridge. The remaining mesial root canals were filled with a plaque suspension and a temporary restorative material without root canal treatment. Silk ligature was applied to the root-cervical junction to induce periodontal lesions. Nine weeks after discontinuation of oral hygiene, alveolar bone loss due to root canal and periodontal lesions was assessed with periapical radiographs. The infected root canal was extracted, the inflamed soft tissue was removed, and GBR (guided bone regeneration) was performed using a collagen polymer membrane (CM) on the right P2 and the bone regeneration barrier membrane (SIOM) of Example 1 on the right P3. The inflamed soft tissue was sutured to create control group 2 and experimental group 2. The buccal flap was advanced toward the crown and first sutured with an absorbable suture (4-0 glyconate monofilament, Monosyn®, B. Braun, Tuttlingen, Germany). Blanks without a barrier membrane were used on the left P2 and P3.

[0289] 13-3. Radiation Analysis

[0290] Radiographic analysis was performed using a micro-CT system at a resolution of μM (using kV and μA), acquired as a DICOM (Digital Imaging and Communications in Medicine) file, and confirmed using computer software (OnDemand3D; Cybermed, Korea). The ROI was set within the extraction socket and analyzed. The same threshold was applied to the ROI. Specifically, the threshold for residual bone graft material was between 140 and 255, and the threshold for new bone was between 83 and 139.

[0291] 13-4. Organizational Preparation and Analysis

[0292] Four weeks after regenerative surgery, experimental animals were sacrificed by intravenous overdose of anesthetic and perfused with 2.5% glutaraldehyde in 0.1 M phosphate buffer via the carotid artery. The resected tissues were further fixed in the same fixative for 1 week, sectioned mesially at 2 mm thickness, and decalcified with Rapid-Decal (Calci-Clear RapidTM, National Diagnostics, Georgia, USA).

[0293] Tissue samples recovered from each of the above groups were cut in half centered on the defect area, one half was subjected to histological analysis, and the other half was subjected to immunohistochemical staining.

[0294] The tissue specimens were dehydrated and embedded in paraffin according to the conventional method. After staining with Masson's trichrome, they were digitally scanned at ×200 magnification using software (Panoramic 250 Flash III; 3DHISTECH, Hungary) and viewed using Case Viewer (3DHISTECH, Hungary). Histomorphometric analysis of the images was performed using Photoshop software (Adobe, USA).

[0295] Tissues for immunohistochemistry were calcified with EDTA (12.5%, pH = 7) for 4 months, and after complete decalcification, they were embedded in paraffin and sectioned to prepare 7 μm-thick sections. Staining was performed using the Master Polymer Plus Detection System kit with secondary antibodies. It was performed with a micropolymer base containing rabbit and mouse monoclonal and polyclonal primary antibodies. The visualization solution used was 3,3'-diaminobenzidine (DAB). All acquired images were standardized for brightness, contrast, and color tone using Adobe Photoshop software (Adobe Inc., San Jose), and the staining intensities (%) of MPO, CD86, and CD20 were quantitatively measured using IHC Profiler and Image J (NIH, Bethesda). The antibodies used in the present invention are as follows: MPO was purchased from Antibodies (Catalog number: ABIN5013150; Clone name: 1F10; Applicable: IHC; Dilution: 1:200). CD86 was purchased from Antibodies (Catalog number: ABIN736701; Clone name: BU63; Applicable: IHC; Dilution: 1:200). CD20 was purchased from Novus Biologicals (Catalog number: NBP2-70362H; Clone name: OTI4B3; Applicable: IHC; Dilution: 1:200).

[0296] 13-5. Analysis Results

[0297] Figure 13a shows the experimental schedule for an inflammatory animal model. As a result of inducing periodontitis for 9 weeks, apical granulomatous lesions were confirmed near the roots of the maxillary second and third premolars. These lesions were removed and fixed with a collagen polymer membrane (CM) and the bone regeneration barrier membrane (SIOM) of Example 1 to prepare Comparative Group 2 and Experimental Group 2. Figure 13b schematically illustrates the inflammatory animal model after treatment with a bone substitute and a complete occlusive membrane (CM or SIOM) and complete suturing.

[0298] Bone immunology studies how bone surrounding teeth heals and how the immune system influences this process, providing crucial information for healing areas damaged by complex periodontal disease (gum disease). Guided bone regeneration (GBR) is a treatment method that creates and maintains a specific space to prevent the ingress of other tissues. This space is maintained by a special membrane called a barrier. However, prolonged inflammation during healing can cause problems. This inflammation can lead to excessive connective tissue proliferation, altering the barrier and compromising the space where bone should grow. This inflammation is primarily caused by bacterial metabolites such as lipopolysaccharide (LPS), which trigger the production of signaling proteins called cytokines by immune cells (neutrophils, macrophages, and B cells). Therefore, if inflammation persists due to changes in the microbial environment or bacterial infection, the space for bone growth is reduced, ultimately limiting bone formation.

[0299] In this invention, we aimed to analyze the effect of SIOM on the healing process of GBR in an inflamed condition. To this end, we designed an inflammatory animal model that induced severe inflammation in the gums and bone for nine weeks. Infected teeth were extracted, the defect was filled with bone substitute material, and then covered with SIOM or CM, followed by covering the area with inflamed gum tissue. For comparison, the opposite side was left untreated and allowed to heal naturally. This area was referred to as the "blank" area.

[0300] Figures 13c-e show the results of immunohistochemical staining analysis of tissues recovered from Blank, Comparative Group-2 (CM), and Experimental Group-2 (SIOM). Figure 13c shows neutrophils (myeloperoxidase; MPO, mean ± SD, n = 6, ANOVA, p = 0.048), Figure 13d shows M1 macrophages (CD86, mean ± SD, n = 6, ANOVA, p = 0.001), and Figure 13e shows mature B cells (CD20, mean ± SD, n = 6).

[0301] As shown in Figures 13c-e, experimental group-2 (SIOM) showed a more than two-fold decrease in MPO and CD86 compared to control group-2 (CM). + Expression decreased by 3.3 times, and CD20 expression decreased by more than 2 times. That is, it can be seen that the bone regeneration barrier membrane (SIOM) of Example 1 according to the present invention promotes early macrophage polarization in the tissue healing process, reduces inflammation, and minimizes tissue damage. In conclusion, it can be seen that the bone regeneration barrier membrane (SIOM) of Example 1 reduces the inflammatory expression of M1 macrophages in tissues even in an inflammatory environment, improves foreign body response by reducing the number of B cells, rapidly alleviates the early inflammatory response, promotes tissue healing, and prevents the inflammatory response from worsening even in an environment prone to inflammation.

[0302] Figure 13f shows micro-CT images of tissues recovered from Blank, Comparative Group-2 (CM), and Experimental Group-2 (SIOM) 4 weeks after treatment. Figure 13g shows histochemical staining images of tissues recovered from Blank, Comparative Group-2 (CM), and Experimental Group-2 (SIOM) 4 weeks after treatment.

[0303] Figure 13h shows the new bone volume (NBV, mean ± SD, n=6, Kruskal, p=0.004) and new bone area (NBA, mean ± SD, n=6, ANOVA, p=0.012 for blank vs. SIOM, p=0.024 for CM vs. SIOM) measured from micro-CT and histochemical staining of tissues recovered from Blank, Comparative Group-2 (CM), and Experimental Group-2 (SIOM) 4 weeks after treatment (*p < 0.05, **p < 0.01, ***p < 0.001).

[0304] Previous experiments have shown that the initial inflammatory response is important for the healing process, but can be problematic if excessive. Figures 13f-h show the effect on bone regeneration. The new bone volume (NBV) of experimental group 2 (SIOM) was significantly increased compared to the comparative group 2 (CM), and the tissue cross-sections show that the new bone area (NBA) of experimental group 2 (SIOM) was also significantly increased compared to the comparative group 2 (CM) (specifically, the experimental group 2 (SIOM) increased by approximately 67% compared to the comparative group 2 (CM), and by approximately 64% compared to balnk).

[0305] The above results demonstrate that Experimental Group 2 (SIOM) effectively integrates with tissues, effectively promoting bone formation and providing the structural support necessary for healing. Evaluation of inflammatory markers such as MPO, CD86, and CD20 also clearly demonstrates that Experimental Group 2 (SIOM) suppresses the inflammatory response and facilitates the smooth progression of the healing process.

[0306] Therefore, it can be seen that GBR treatment using the bone regeneration barrier membrane (SIOM) of Example 1 brings about effective treatment results by working in harmony with the body to reduce inflammation and promote bone formation.

[0307]

[0308] As described above, the present invention has been described with specific details and limited examples and comparative examples, but these are provided only to help a more general understanding of the present invention, and the present invention is not limited to the above examples, and those skilled in the art to which the present invention pertains can make various modifications and variations from this description.

[0309] Therefore, the idea of ​​the present invention should not be limited to the described embodiments, and all things that are equivalent or equivalent to the following claims as well as the claims are considered to fall within the scope of the idea of ​​the present invention.

Claims

1. A collagen scaffold impregnated with a solution containing a monomer having a sulfobetaine group; The above monomer is polymerized into a zwitterionic polymer through photopolymerization and formed into an integral part with the support, A bone regeneration barrier membrane characterized by having a closed layer composed of hydroxyapatite in the form of flakes deposited on the outer surface of the support.

2. In paragraph 1, A barrier membrane for bone regeneration, characterized in that the solution further comprises a first photoinitiator or gelling agent.

3. In paragraph 2, A barrier membrane for bone regeneration, characterized in that the gelling agent comprises alginic acid or sodium alginate.

4. In paragraph 2, The first photoinitiator is selected from the group consisting of 2-hydroxy-4'-(2-hydroxyethoxy)-2-methylpropiophenone, 2-hydroxy-2-methylpropiophenone, benzoin ethyl ether, benzoin isobutyl ether, benzoin methyl ether, dibenzosuberenone, 2,2-dimethoxy-2-phenylacetophenone, 3,4-dimethylbenzophenone, and 3'-hydroxyacetophenone. A bone regeneration barrier membrane characterized by one or more of the following:

5. In paragraph 1, A bone regeneration barrier membrane characterized in that the monomer having the above sulfobetaine group is 2-[(methacryloyloxy)ethyl]dimethyl-(3-sulfopropyl)ammonium hydroxide or 2-methacryloyloxyethyl phosphorylcholine.

6. In paragraph 1, The above bone regeneration barrier membrane is characterized in that the volume of pores of 0.01 to 1 ㎛ is 1 to 10 cc / g.

7. In paragraph 1, The above bone regeneration barrier membrane has a Raman spectrum analysis of 950 to 960 cm -1 A barrier membrane for bone regeneration characterized by exhibiting maximum peak strength at .

8. In paragraph 1, The above bone regeneration barrier membrane is characterized in that it does not contain a lamellar structure as a result of small-angle X-ray scattering. 9.S1) A step of preparing a precursor solution comprising a monomer containing a sulfobetaine group, a first photoinitiator, and a solvent; S2) A step of impregnating a collagen scaffold with the precursor solution and polymerizing a zwitterionic polymer within the collagen scaffold through ultraviolet irradiation to produce a zwitterionic membrane; S3) A step of immersing the amphoteric membrane manufactured through the above S2 step in a solution containing calcium ions to manufacture a membrane to which calcium ions are bound; and S4) A method for manufacturing a barrier membrane for bone regeneration, comprising the step of immersing the membrane to which the calcium ions are bound in a solution containing phosphate ions.

10. In paragraph 9, A method for producing a barrier membrane for bone regeneration, characterized in that, in the step S1), the precursor solution comprises 20 to 30 wt% of a monomer containing a sulfobetaine group; 0.5 to 5 wt% of a first photoinitiator; and the remainder of a solvent.

11. In paragraph 9, A method for manufacturing a barrier membrane for bone regeneration, characterized in that the collagen support further comprises a second photoinitiator.

12. In paragraph 9, A method for manufacturing a barrier membrane for bone regeneration, characterized in that in the above step S1), the precursor solution further contains a gelling agent.

13. In paragraph 12, A method for producing a barrier membrane for bone regeneration, characterized in that the precursor solution comprises 20 to 30 wt% of a monomer containing a sulfobetaine group; 0.5 to 5 wt% of a first photoinitiator; 1 to 5 wt% of a gelling agent and the remainder of a solvent.

14. In paragraph 9, Between the above steps S2) and S3), S-1) A method for manufacturing a barrier membrane for bone regeneration, characterized in that it further includes an ionic cross-linking step of immersing the bivalent ionic membrane manufactured through the above S2 step in a solution containing divalent cations.

15. In paragraph 9, A method for manufacturing a barrier membrane for bone regeneration, characterized in that the monomer containing the above sulfobetaine group is 2-[(methacryloyloxy)ethyl]dimethyl-(3-sulfopropyl)ammonium hydroxide or 2-methacryloyloxyethyl phosphorylcholine.

16. In paragraph 9, A method for manufacturing a barrier membrane for bone regeneration, characterized in that the above steps S3) and S4) are performed as a unit process, and the above unit process is repeated 5 or more times.

17. In paragraph 9, A method for manufacturing a barrier membrane for bone regeneration, characterized in that the solution containing the calcium ions contains 0.1 to 1.0 M of calcium ions.

18. In paragraph 9, A method for manufacturing a barrier membrane for bone regeneration, characterized in that the solution containing the above phosphate ions contains 0.1 to 0.5 M of phosphate ions.

Images