DNA repair template and use thereof

Abstract

The present invention relates to the technical field of gene editing, and provides a DNA repair template and a use thereof. On the basis of the exploration of a preference sequence binding mammalian intracellular protein Rad51 to DNA, a specific nucleic acid binding preference sequence is obtained, and the specific nucleic acid binding preference sequence is added to the 5' end of a conventional DNA repair template, so that the efficiency of DNA repair template mediated accurate gene editing is greatly improved. Also provided are a composition comprising a modified DNA repair template and an inhibitor of an NHEJ pathway such as M3814 and a use of the composition. The composition has higher accurate gene editing efficiency.

Description

DNA repair template and its application Technical Field

[0001] The present invention relates to the field of gene editing technology, and in particular to DNA repair templates and applications thereof. Background Art

[0002] With the rapid development of biotechnology, gene editing technology has become a vital research tool in the life sciences. It allows scientists to precisely manipulate the genetic information of organisms at the molecular level, providing powerful support for understanding life mechanisms, treating genetic diseases, and optimizing crop quality.

[0003] The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system is derived from the natural immune mechanism of bacteria and archaea. The system mainly consists of two parts: CRISPR sequence and Cas protein. The CRISPR sequence is composed of a series of repeat sequences and spacer sequences, which can store DNA fragments of viruses or plasmids that have invaded bacteria or archaea during evolution. The Cas protein is a nuclease that can specifically recognize and cut foreign DNA under the guidance of the CRISPR sequence. The working principle of the CRISPR system is that when bacteria or archaea are invaded by foreign DNA (such as viruses or plasmids), they will integrate a small piece of DNA sequence into their own CRISPR sequence. When the same foreign DNA invades again, this DNA segment in the CRISPR sequence will be transcribed and processed to produce crRNA, which can be used as a "guide" to guide the Cas protein to find and cut the foreign DNA, thereby protecting the bacteria or archaea from invasion.

[0004] In the field of gene editing, scientists have transformed the CRISPR system into a powerful tool. By designing specific CRISPR sequences and Cas proteins, scientists can precisely target and efficiently cut target DNA sequences, creating double-strand breaks in the genome. Cells primarily repair double-strand breaks through non-homologous end joining (NHEJ) and homologous recombination (HDR). NHEJ is an imprecise repair method that results in random base deletions and insertions at the double-strand break site, while homologous recombination is a precise repair method that completely replicates the sequence from the repair DNA template. Therefore, when an exogenous DNA repair template is artificially introduced, the repair sequence it carries is perfectly replicated in the genome, enabling precise gene editing. However, due to the low probability of homologous duplication within cells, the low efficiency of homologous recombination has become a bottleneck in the development of precise gene editing technology. Both the construction of cell models with genetic mutations for drug screening and the genetic repair therapy for genetic mutation diseases face significant challenges.

[0005] In recent years, many research efforts have focused on improving the problem of low homologous recombination efficiency. There are two main technical routes: 1. Improving the accessibility of single-stranded DNA repair templates to homologous recombination repair sites; 2. Inhibiting non-homologous end joining, thereby promoting the occurrence of homologous recombination. Strategies for improving the accessibility of single-stranded DNA repair templates usually target the Cas9 nuclease and connect the single-stranded DNA repair template to the Cas9 nuclease through complex chemical modifications. However, these strategies still have many disadvantages: for example, they affect the activity of the Cas9 nuclease, the Cas9 nuclease can only be delivered in the form of protein, and increase the complexity and safety of experimental chemical modifications.

[0006] Summary of the Invention

[0007] One of the purposes of the present invention is to provide a nucleic acid binding preference sequence based on Rad51 protein and its application.

[0008] A second object of the present invention is to provide a method for gene modification, which improves HDR efficiency.

[0009] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are adopted:

[0010] In a first aspect, the present invention provides a nucleic acid binding preference sequence based on Rad51 protein, wherein the nucleic acid binding preference sequence comprises the sequence shown in SEQ ID NO: 1.

[0011] There is no particular limitation on the length of the nucleic acid binding preference sequence, as long as it improves HDR efficiency. In one or more embodiments, the nucleic acid binding preference sequence is 5 bp to 100 bp in length. In certain embodiments, the nucleic acid binding preference sequence is 5 bp to 50 bp in length; and in certain embodiments, the nucleic acid binding preference sequence is 5 bp to 30 bp in length.

[0012] In some embodiments, the nucleic acid binding preference sequence is shown as SEQ ID NO: 2 or SEQ ID NO: 3.

[0013] A second aspect of the present invention provides a DNA repair template, wherein the non-template homologous sequence of the DNA repair template includes the nucleic acid binding preference sequence described in the first aspect of the present invention. The DNA repair template can be used for repair, insertion, deletion, or replacement. For example, the DNA repair template can be used for sequence modification and / or introduction of single point mutations and / or mutant sequences up to 20,000 bp.

[0014] In some embodiments, the DNA repair template is selected from single-stranded DNA, double-stranded DNA, or a combination of single-stranded and double-stranded DNA.

[0015] In some embodiments, the DNA repair template is selected from single-stranded DNA.

[0016] In some embodiments, the DNA repair template includes homology arms and / or an insertion sequence, which can be any target sequence.

[0017] In some embodiments, the DNA repair template comprises, from 5' to 3', a first homology arm comprising a sequence of at least 40 nucleotides located 5' of the gene target sequence; and a second homology arm comprising a sequence of at least 40 nucleotides located 3' of the target sequence.

[0018] In some embodiments, the gene is selected from BFP, EMX1, DNMT1, CXCR4, RUNX1, FANCF, RNF2.

[0019] The third aspect of the present invention provides a composition, comprising the DNA repair template according to the second aspect of the present invention; and

[0020] Optional DNA repair regulators and / or gene editing systems.

[0021] In some embodiments, the composition further comprises a regulator of DNA repair.

[0022] In some embodiments, the regulator of DNA repair is selected from an inhibitor of the NHEJ pathway or an inhibitor of the MMEJ pathway.

[0023] In some embodiments, the regulator of DNA repair is selected from an inhibitor of the NHEJ pathway. In some embodiments, the inhibitor of the NHEJ pathway is selected from a DNA-PK inhibitor. In some embodiments, the DNA-PK inhibitor is selected from M3814, M9831 / VX984, Nu7441, Nu7026, KU0060648, AZD7648, or a combination thereof.

[0024] In a specific embodiment, the DNA-PK inhibitor is M3814.

[0025] In some embodiments, the regulator of DNA repair is selected from an inhibitor of the MMEJ pathway; in some embodiments, the inhibitor of the MMEJ pathway is an inhibitor of POLQ / DNA polymerase θ. In some embodiments, the POLQ inhibitor is PolQ1, PolQ2, PolQ3, PolQ4, PolQ5, PolQ6, PolQ7, or a combination thereof.

[0026] The fourth aspect of the present invention provides a kit, comprising the DNA repair template according to the second aspect of the present invention; and

[0027] Optional DNA repair regulators and / or gene editing systems.

[0028] In some embodiments, the gene editing system is selected from a meganuclease, a TALEN, a ZFN, or a CRISPR system.

[0029] In some embodiments, the gene editing system is a CRISPR system.

[0030] In some embodiments, the CRISPR system comprises a Cas protein or a vector encoding a Cas protein.

[0031] In some embodiments, the CRISPR system further comprises a polynucleotide comprising at least one RNA guide sequence, a Cas binding region, or a combination thereof.

[0032] In some embodiments, the Cas protein is a Cas9 protein or a Cas12 protein.

[0033] In some embodiments, the Cas9 protein comprises Cas9 nickase and Cas9 nuclease; in some embodiments, the Cas9 protein comprises SpyCas9, SauCas9, NmeCas9, StCas9, FnCas9, CjCas9, AnaCas9 or GeoCas9.

[0034] In some embodiments, the Cas12 protein is Cas12a, Cas12b, Cas12f or Cas12i.

[0035] In some embodiments, the Cas12 protein is selected from AsCpf1, FnCpf1, SsCpf1, PcCpf1, BpCpf1, CmtCpf1, LiCpf1, PmCpf1, Pb3310Cpf1, Pb4417Cpf1, BsCpf1, EeCpf1, BhCas12b, AkCas12b, EbCas12b and / or LsCas12b.

[0036] In some embodiments, a polynucleotide comprising at least one guide RNA sequence, a Cas binding region, a DNA repair template sequence, or a combination thereof is encoded on a vector. In some embodiments, the vector is a viral vector.

[0037] In some embodiments, the vector encoding the Cas protein is a viral vector.

[0038] In some embodiments, the Cas protein and the polynucleotide comprising at least one guide RNA sequence, a Cas binding region, a DNA repair template sequence, or a combination thereof are in the form of a ribonucleoprotein (RNP).

[0039] In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0040] The fifth aspect of the present invention provides a method for gene modification of eukaryotic cells, the method comprising: contacting a gene with the DNA repair template described in the second aspect of the present invention.

[0041] In some embodiments, the method further comprises contacting the gene with a gene editing system.

[0042] In some embodiments, the method further comprises adding a regulator of DNA repair.

[0043] In some embodiments, eukaryotic cells are incubated with a gene editing system and a DNA repair template to introduce the gene editing system and the DNA repair template into the eukaryotic cells.

[0044] In some embodiments, the gene editing system is selected from the gene editing systems described above, including but not limited to meganucleases, TALENs, ZFNs, and CRISPR systems. In some embodiments, the gene editing system is a CRISPR system.

[0045] In some embodiments, the CRISPR system comprises a Cas protein or a vector encoding a Cas protein. In some embodiments, the vector encoding the Cas protein is a viral vector. In some embodiments, the viral vector is a retrovirus, a lentivirus, an adenovirus, or an adeno-associated virus.

[0046] In some embodiments, the CRISPR system further comprises a polynucleotide comprising at least one RNA guide sequence, a Cas binding region, or a combination thereof.

[0047] In some embodiments, the Cas protein is a Cas9 nuclease, a Cas9 nickase, a Cas12a nuclease, or a Cas12f nuclease.

[0048] In some embodiments, a polynucleotide comprising at least one guide RNA sequence, a Cas binding region, a DNA repair template sequence, or a combination thereof is encoded on a vector. In some embodiments, the vector is a viral vector.

[0049] In some embodiments, the Cas protein and the polynucleotide comprising at least one guide RNA sequence, a Cas binding region, a DNA repair template sequence, or a combination thereof are in the form of a ribonucleoprotein (RNP).

[0050] In some embodiments, the gene is selected from BFP, EMX1, DNMT1, CXCR4, RUNX1, RNF2, and FANCF. In some embodiments, the sequences of the RNA guide sequence targeting BFP, EMX1, DNMT1, CXCR4, RUNX1, RNF2, and FANCF are shown in SEQ ID NOs: 4-10, respectively.

[0051] In some embodiments, the DNA repair template and gene editing system are added to eukaryotic cells by microinjection, electroporation, or via lipid nanoparticles, liposomes, exosomes, gold nanoparticles, or DNA nanocoils.

[0052] In some embodiments, the regulator of DNA repair is selected from an inhibitor of the NHEJ pathway or an inhibitor of the MMEJ pathway.

[0053] In some embodiments, the modulator of DNA repair is an inhibitor of the NHEJ pathway. In some embodiments, the NHEJ pathway inhibitor is selected from a DNA-PK inhibitor; in some embodiments, the DNA-PK inhibitor is selected from M3814, M9831 / VX984, Nu7441, Nu7026, KU0060648, AZD7648, or a combination thereof. In a specific embodiment, the DNA-PK inhibitor is M3814.

[0054] In some embodiments, the regulator of DNA repair is selected from an inhibitor of the MMEJ pathway; in some embodiments, the inhibitor of the MMEJ pathway is an inhibitor of POLQ / DNA polymerase θ. In some embodiments, the POLQ inhibitor is PolQ1, PolQ2, PolQ3, PolQ4, PolQ5, PolQ6, PolQ7, or a combination thereof.

[0055] In some embodiments, the eukaryotic cell is in vivo.

[0056] In some embodiments, the eukaryotic cell is in vitro.

[0057] In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the eukaryotic cell is selected from at least one of HEK 293A, HEK 293T, Hela, U2OS, K562, hPB CD34+, NIH3T3, or iBMDM.

[0058] The sixth aspect of the present invention provides a method for genetic modification of eukaryotic cells, the method comprising: contacting a gene with the DNA repair template described in the second aspect of the present invention; the gene comprises a genomically integrated Cas polynucleotide.

[0059] In some embodiments, the method further comprises contacting the gene with a polynucleotide comprising at least one RNA guide sequence, a Cas binding region, or a combination thereof.

[0060] In some embodiments, a DNA repair template sequence, an RNA guide sequence, a Cas binding region, or a combination thereof is encoded on the vector.

[0061] In some embodiments, the gene is selected from BFP, EMX1, DNMT1, CXCR4, RUNX1, RNF2, FANCF.

[0062] In some embodiments, the sequences targeting BFP, EMX1, DNMT1, CXCR4, RUNX1, RNF2, and FANCF in the RNA guide sequence are shown in SEQ ID NOs: 4-10, respectively.

[0063] In some embodiments, the vector is introduced into the eukaryotic cell by transfection.

[0064] In some embodiments, the Cas protein is a Cas9 nuclease, a Cas9 nickase, a Cas12a nuclease, or a Cas12f nuclease.

[0065] In some embodiments, the method further comprises contacting the gene with a regulator of DNA repair.

[0066] In some embodiments, the regulator of DNA repair is selected from an inhibitor of the NHEJ pathway or an inhibitor of the MMEJ pathway.

[0067] In some embodiments, the inhibitor of the NHEJ pathway is selected from DNA-PK inhibitors.

[0068] In some embodiments, the DNA-PK inhibitor is selected from M3814, M9831 / VX984, Nu7441, Nu7026, KU0060648, AZD7648, or a combination thereof.

[0069] In some embodiments, the DNA-PK inhibitor is M3814.

[0070] A seventh aspect of the present invention includes a method for genetic modification of a eukaryotic cell, the method comprising transfecting the eukaryotic cell with a vector comprising a DNA repair template sequence.

[0071] In some embodiments, the method further comprises transfecting the eukaryotic cell with a vector encoding a Cas protein and a vector comprising a polynucleotide comprising an RNA guide sequence, a Cas binding region, or a combination thereof.

[0072] In some embodiments, the gene is selected from BFP, EMX1, DNMT1, CXCR4, RUNX1, RNF2, FANCF.

[0073] In some embodiments, the sequences targeting BFP, EMX1, DNMT1, CXCR4, RUNX1, RNF2, and FANCF in the RNA guide sequence are shown in SEQ ID NOs: 4-10, respectively.

[0074] In some embodiments, the vectors are the same vector or different vectors.

[0075] In some embodiments, the method further comprises adding a regulator of DNA repair.

[0076] In some embodiments, the regulator of DNA repair is selected from an inhibitor of the NHEJ pathway or an inhibitor of the MMEJ pathway.

[0077] In some embodiments, the DNA repair regulator is an inhibitor of the NHEJ pathway. In some embodiments, the NHEJ pathway inhibitor is selected from a DNA-PK inhibitor. In some embodiments, the DNA-PK inhibitor is selected from M3814, M9831 / VX984, Nu7441, Nu7026, KU0060648, AZD7648, or a combination thereof. In a specific embodiment, the DNA-PK inhibitor is M3814.

[0078] The eighth aspect of the present invention provides a method for increasing the efficiency of homology-directed repair in eukaryotic cells, the method comprising adding the DNA repair template described in the second aspect of the present invention or the composition described in the third aspect of the present invention.

[0079] The ninth aspect of the present invention provides the use of the nucleic acid binding preference sequence described in the first aspect of the present invention, the DNA repair template described in the second aspect of the present invention, and the composition described in the third aspect of the present invention in the preparation of drugs for treating gene defect-related diseases.

[0080] The tenth aspect of the present invention provides the use of the nucleic acid binding preference sequence described in the first aspect of the present invention, the DNA repair template described in the second aspect of the present invention, the composition described in the third aspect of the present invention, and the kit described in the fourth aspect of the present invention in gene modification.

[0081] In some embodiments, the genetic modification includes gene editing of exogenous genes and genetic modification of endogenous genes.

[0082] The eleventh aspect of the present invention provides the use of the nucleic acid binding preference sequence of Rad51 protein in gene modification.

[0083] In some embodiments, the genetic modification includes gene editing of exogenous genes and genetic modification of endogenous genes.

[0084] Compared with the prior art, the beneficial effects of the present invention include at least:

[0085] 1) The present invention is based on the exploration of the preferred sequences of the endogenous protein Rad51 in mammalian cells that bind to DNA, and adds them to conventional DNA templates, greatly improving the efficiency of precise gene editing mediated by single-stranded DNA repair templates.

[0086] 2) The gene modification method of the present invention greatly retains the cutting activity of the artificially encodable Cas9 protein, without affecting the efficiency of the first step of gene editing to cause double-strand damage breaks at the target site.

[0087] 3) The present invention is applicable to a variety of application scenarios of gene editing mediated by artificially codable nucleases. After any artificially codable nuclease causes double-strand damage and breaks at a specific site, the strategy of the present invention can be used to complete gene editing.

[0088] 4) The present invention does not impose any limitation on the form of the artificially codable nuclease. The artificially codable nuclease can be delivered into cells in the form of mRNA, DNA plasmid or purified protein.

[0089] 5) The present invention is applicable to gene editing of multiple cell types and multiple gene loci.

[0090] 6) The present invention only adds a DNA sequence to the 5′ end of a conventional single-stranded DNA template without introducing any special chemical modification, and thus will not cause toxicity to cells.

[0091] 7) The preparation process of the present invention is simple, the preparation cycle is short, and the cost is low. BRIEF DESCRIPTION OF THE DRAWINGS

[0092] FIG1 is a flowchart of an experiment for exploring the preferred sequence of mammalian cell endogenous protein Rad51 binding to single-stranded DNA according to an embodiment of the present invention;

[0093] FIG2 is a diagram illustrating the preferred sequences of the mammalian cell endogenous protein Rad51 binding to single-stranded DNA according to an embodiment of the present invention; FIGA is a diagram illustrating the sequence of single-stranded DNA that the endogenous protein Rad51 preferentially binds to; FIGB is a diagram illustrating the overall sequence characteristics of the single-stranded DNA sequence that Rad51 preferentially binds to;

[0094] FIG3 is a graph showing the validation results of the binding ability of the mammalian cell endogenous protein Rad51 to its preferred sequence for binding to single-stranded DNA, as provided in an embodiment of the present invention; FIG3 is a graph showing the validation of the binding of single-stranded DNAs with strong and weak binding to Rad51 protein selected from FIG3A; FIG3 is a graph showing the binding of truncated single-stranded DNA No. 9 (SSO9) and single-stranded DNA No. 14 (SSO14) to Rad51 protein;

[0095] Figure 4 is a result diagram of the function of the preferred sequence of the mammalian cell endogenous protein Rad51 binding to single-stranded DNA in the precise gene editing of the exogenous gene BFP mediated by the single-stranded DNA repair template provided by the embodiment of the present invention; Figure A is a diagram showing the efficiency of the precise gene editing of the exogenous gene BFP mediated by the mammalian cell endogenous protein Rad51 in HEK 293T-BFP cells by adding the preferred sequence of the mammalian cell endogenous protein Rad51 binding to single-stranded DNA to the 5' end of the single-stranded DNA repair template; Figure B is a diagram showing the cleavage efficiency of the artificially codable nuclease Cas9 in the experiment of Figure A; Figure C is a diagram showing the efficiency of the precise gene editing of the exogenous gene BFP mediated by the mammalian cell endogenous protein Rad51 binding to single-stranded DNA by adding the preferred sequence of the mammalian cell endogenous protein Rad51 binding to single-stranded DNA to the 5' end of the single-stranded DNA repair template; Figure D is a diagram showing the cleavage efficiency of the artificially codable nuclease Cas9 in the experiment of Figure C;

[0096] FIG5 is a graph showing the function of the preferred sequence of the mammalian cell endogenous protein Rad51 binding to single-stranded DNA in the precise gene editing of endogenous genes in HEK 293T cells mediated by a single-stranded DNA repair template, as provided in an embodiment of the present invention; FIG5 is a graph showing the efficiency of the precise gene editing of endogenous genes mediated by the addition of the preferred sequence of the mammalian cell endogenous protein Rad51 binding to single-stranded DNA to the 5′ end of the single-stranded DNA repair template in HEK 293T cells; FIG5 is a graph showing the relative efficiency of the modified single-stranded DNA repair template compared to the conventional single-stranded DNA repair template; and FIG5 is a graph showing the cleavage efficiency of the artificially codable nuclease Cas9 in the experiment in FIG5;

[0097] FIG6 is a graph showing the function of the preferred sequence of the mammalian cell endogenous protein Rad51 binding to single-stranded DNA in the precise gene editing of HeLa cell endogenous genes mediated by a single-stranded DNA repair template, as provided in an embodiment of the present invention; FIG6 is a graph showing the efficiency of the precise gene editing of endogenous genes mediated by the addition of the preferred sequence of the mammalian cell endogenous protein Rad51 binding to single-stranded DNA to the 5′ end of the single-stranded DNA repair template in HeLa cells, and the relative efficiency compared to conventional single-stranded DNA repair templates; FIG6 is a graph showing the cleavage efficiency of the artificially codable nuclease Cas9 in the experiment in FIG6;

[0098] FIG7 is a graph showing the function of the preferred sequence of the mammalian cell endogenous protein Rad51 binding to single-stranded DNA in the precise gene editing of endogenous genes in U2OS cells mediated by a single-stranded DNA repair template, as provided in an embodiment of the present invention; FIG7 is a graph showing the efficiency of the precise gene editing of endogenous genes mediated by the addition of the preferred sequence of the mammalian cell endogenous protein Rad51 binding to single-stranded DNA to the 5′ end of the single-stranded DNA repair template in U2OS cells, and the relative efficiency compared to conventional single-stranded DNA repair templates; FIG7 is a graph showing the cleavage efficiency of the artificially codable nuclease Cas9 in the experiment in FIG7;

[0099] FIG8 is a graph showing the function of the preferred sequence of the mammalian cell endogenous protein Rad51 binding to single-stranded DNA in the precise gene editing of endogenous genes in K562 cells mediated by a single-stranded DNA repair template, as provided in an embodiment of the present invention; FIG8 is a graph showing the efficiency of the precise gene editing of endogenous genes mediated by the addition of the preferred sequence of the mammalian cell endogenous protein Rad51 binding to single-stranded DNA to the 5′ end of the single-stranded DNA repair template in K562 cells, and the relative efficiency compared to conventional single-stranded DNA repair templates; FIG8 is a graph showing the cleavage efficiency of the artificially codable nuclease Cas9 in the experiment in FIG8;

[0100] FIG9 is a graph showing the function of the preferred sequence of the mammalian cell endogenous protein Rad51 binding to single-stranded DNA in the precise gene editing of endogenous genes in human peripheral blood CD34 cells mediated by a single-stranded DNA repair template, as provided in an embodiment of the present invention; FIG9 is a graph showing the efficiency of the precise gene editing of endogenous genes mediated by the addition of the preferred sequence of the mammalian cell endogenous protein Rad51 binding to single-stranded DNA to the 5′ end of the single-stranded DNA repair template in human peripheral blood CD34 cells, and the relative efficiency compared to conventional single-stranded DNA repair templates; FIG9 is a graph showing the cleavage efficiency of the artificially codable nuclease Cas9 in the experiment in FIG9;

[0101] Figure 10 is a result diagram of the function of the preferred sequence of the mammalian cell endogenous protein Rad51 binding to single-stranded DNA in the precise gene editing of the exogenous gene BFP mediated by paired nCas9 (Cas9 nickase) provided in an embodiment of the present invention; Figures A and B are respectively a schematic diagram and a result diagram of verifying the efficiency of the precise gene editing of the exogenous gene BFP mediated by paired nCas9 in HEK 293T-BFP cells by adding the preferred sequence of the mammalian cell endogenous protein Rad51 binding to single-stranded DNA to the 5′ end of the single-stranded DNA repair template;

[0102] FIG11 is a flow chart of a gene editing operation using a single-stranded DNA repair template containing a RAD51 high-affinity nucleic acid sequence and an M3814 small molecule inhibitor in combination with an embodiment of the present invention;

[0103] Figure 12 is a graph showing the functional validation results of the experimental example of the present invention using a single-stranded DNA repair template containing a high-affinity RAD51 nucleic acid sequence and the M3814 small molecule inhibitor in precise gene editing of the BFP gene locus in HEK 293T-BFP cells; Mock is a blank control; RNP is an RNP complex; Donor is a single-stranded DNA repair template without modified RAD51 high-affinity nucleic acid sequence, and sso14-Donor is a single-stranded DNA repair template with modified RAD51 high-affinity nucleic acid sequence, wherein "-" indicates no addition of the M3814 small molecule inhibitor, "M3814" indicates addition of the M3814 small molecule inhibitor, and HDRobust is a single-stranded DNA repair method described in prior art literature;

[0104] Figure 13 is a graph showing the functional validation results of the experimental example of the present invention using a single-stranded DNA repair template containing a high-affinity RAD51 nucleic acid sequence and the M3814 small molecule inhibitor in precise gene editing of endogenous gene sites in HEK 293T cells; Donor is a single-stranded DNA repair template without modified RAD51 high-affinity nucleic acid sequence, sso14-Donor is a single-stranded DNA repair template modified with a high-affinity RAD51 nucleic acid sequence, wherein "M3814" refers to the addition of the M3814 small molecule inhibitor, and HDRobust is a single-stranded DNA repair method mentioned in prior art literature;

[0105] Figure 14 is a graph showing the functional verification results of the experimental example of the present invention using a single-stranded DNA repair template containing a high-affinity RAD51 nucleic acid sequence and the M3814 small molecule inhibitor in precise gene editing of endogenous gene sites in K562 cells; Mock: no M3814 small molecule inhibitor was added, and only the DNA repair template was used for gene editing; wherein, Donor is a single-stranded DNA repair template into which an unmodified high-affinity RAD51 nucleic acid sequence was transferred, and sso14-Donor is a single-stranded DNA repair template into which a modified high-affinity RAD51 nucleic acid sequence was transferred; M3814: the M3814 small molecule inhibitor was added, and gene editing was performed using a DNA repair template; wherein, Donor is a single-stranded DNA repair template into which an unmodified high-affinity RAD51 nucleic acid sequence was transferred, and M3814, and sso14-Donor is a single-stranded DNA repair template into which a modified high-affinity RAD51 nucleic acid sequence was transferred, and M3814;

[0106] The legends involved in Figures 12 and 13 above are: HDR: precise gene editing mediated by a single-stranded DNA repair template; IMPERFECT HDR: repair not completely following the single-stranded DNA repair template; NHEJ: repair not dependent on a DNA template, usually causing gene damage; UNMODIFIED: unedited genome. DETAILED DESCRIPTION

[0107] The following detailed description is illustrative and is not intended to limit the invention or its application. Throughout the specification, illustrations of specific terms should be considered as non-limiting examples. The singular forms "a", "an" or "the" include plural objects unless the context clearly indicates otherwise. Approximate language used throughout this specification and claims can be used to modify any quantitative representation that can be allowed to vary without resulting in a change in the basic function to which it is related. Unless otherwise indicated, all similar terms used in this specification and claims are

[0108] Numbers expressing amounts of ingredients, properties such as molecular weight, reaction conditions, and the like should be understood as being modified in all instances by the term "about." Therefore, unless indicated to the contrary, the numerical parameters set forth in the following specification and claims are approximate and may vary depending upon the desired properties sought to be obtained by the present invention. Where necessary, ranges have been provided, and such ranges include all subranges therebetween.

[0109] The inventors of the present invention have found through a large number of experimental screening and verification that DNA sequences containing the TCCCC sequence bind more efficiently to the endogenous protein Rad51 in mammalian cells. Further research has also found that adding this preferred sequence to conventional DNA templates can greatly improve the efficiency of precise gene editing mediated by DNA repair templates.

[0110] Methods for modifying genes

[0111] The present disclosure provides methods for gene modification of eukaryotic cells, in some embodiments, by using a DNA repair template and a gene editing system to modify the eukaryotic genome. The disclosed gene editing system can effectively and efficiently modify the eukaryotic genome by inserting a donor DNA with a desired level of specificity in vitro or in vivo. The disclosed method for modifying genes uses a DNA repair template that contains a nucleic acid binding preference sequence of the Rad51 protein. In some embodiments, the nucleic acid binding preference sequence of the Rad51 protein contains the nucleotide sequence shown in SEQ ID NO: 1.

[0112] The genetic modification of eukaryotic cells can include modifying at least one target sequence of eukaryotic cells. In some embodiments, genetic modification includes editing multiple genes of eukaryotic cells. In some embodiments, genetic modification includes replacing or inserting at least one nucleotide at a specific DNA locus in the genome of eukaryotic cells. Such site-specific genome modification can be used for gene silencing, gene activation or target visualization. In some embodiments, genetic modification is a single nucleotide polymorphism (SNP) with a desired efficiency. Gene editing using SNP can help develop new disease models for various diseases such as cancer, cardiovascular disease and diabetes.

[0113] In some embodiments, genes in eukaryotic cells are contacted with gene editing systems and DNA repair templates to promote genetic modification in eukaryotic cells. In such embodiments, gene editing systems and DNA repair templates are introduced into eukaryotic cells from the outside (e.g., by transfection, transduction, or microinjection) so that gene editing systems, DNA repair templates, and genes are co-located in cells. In some embodiments, at least one component of DNA repair template and gene editing system can be introduced into eukaryotic cells, which contain the remaining components of the gene editing system as part of the eukaryotic cell genome. In certain other embodiments, all components of the gene editing system and DNA repair template are introduced into eukaryotic cells from the outside so that genes are contacted with gene editing systems and DNA repair templates to facilitate genetic modification of eukaryotic cells.

[0114] The gene editing system and the DNA repair template can be introduced into eukaryotic cells simultaneously or sequentially. In some embodiments, the gene editing system or one or more components of the gene editing system and the donor repair template are introduced into eukaryotic cells simultaneously. In certain embodiments, one or more components of the gene editing system and the DNA repair template are introduced into eukaryotic cells simultaneously, wherein the remaining components of the same gene editing system are already present in the eukaryotic cells (for example, genes encoding protein components of the gene editing system can be pre-existing or pre-integrated in the eukaryotic genome). When one or more components are introduced, a fully functional gene editing system is formed in the eukaryotic cell to introduce DSB at or near a predetermined modification site. For example, in the CRISPR-Cas system, crRNA and tracrRNA can be introduced into eukaryotic cells together with the repair template, wherein the Cas 9 gene has been integrated into the eukaryotic genome. In alternative aspects, a single guide RNA (sgRNA) can be introduced into eukaryotic cells integrated with the DNA repair template to promote genetic modification of eukaryotic cells.

[0115] In certain other embodiments, the complete gene editing system or one or more components of the gene editing system and the DNA repair template are introduced into the eukaryotic cell sequentially. In some such embodiments, the gene editing system can be introduced before the DNA repair template is introduced into the eukaryotic cell. In some such embodiments, the gene editing system can be introduced into the eukaryotic cell after the DNA repair template is introduced.

[0116] In some embodiments, the gene editing system and DNA repair template are introduced into eukaryotic cells by incubating the eukaryotic cells with the gene editing system and the DNA repair template. The DNA repair template and the gene editing system can be introduced into eukaryotic cells by any technique for introducing external molecules into eukaryotic cells, including but not limited to transfection and transduction. In some embodiments, the DNA repair template is introduced by transfection. For example, a plasmid encoding Cas9 and sgRNA can be used and transfected into eukaryotic cells together with the DNA repair template to promote site-specific modification of endogenous target DNA. In certain other embodiments, the DNA repair template and / or sgRNA are introduced into cells by transduction mediated by a viral construct. For example, delivering CRISPR / Cas9 components to many human cell types that are difficult to transfect can be achieved by viral transduction. An example of viral transduction is transduction mediated by adeno-associated virus (AAV). In certain other embodiments, lentiviral delivery can be used to introduce DNA repair templates for gene editing. For example, lentiviral DNA constructs can be used as carriers of zinc finger nuclease (ZFN) proteins to provide effective targeted gene breaks in cell lines and primary cells. ZFN proteins and DNA are co-packaged in lentiviral particles, and ZFN proteins and DNA repair templates can be co-delivered for homology-directed repair, resulting in targeted DNA repair template insertion and gene modification.

[0117] DNA repair template

[0118] The DNA repair template can transfer the genetic information encoded in the donor DNA to the endogenous target DNA sequence of the eukaryotic genome through homologous recombination. The DNA repair template disclosed herein comprises a nucleic acid binding preference sequence of the Rad51 protein. In some embodiments, the nucleic acid binding preference sequence of the Rad51 protein comprises the nucleotide sequence shown in SEQ ID NO: 1. In some embodiments, the nucleic acid binding preference sequence of the Rad51 protein is located at the 5′ end of the DNA template.

[0119] In some cases, the sequence of the DNA repair template can be substantially identical to the portion of the endogenous target DNA sequence to be replaced, except for one nucleotide, which is different and results in the introduction of a point mutation during homologous recombination. In some aspects, the sequence of the DNA repair template can be substantially identical to the portion of the endogenous target DNA sequence to be replaced, except that it can be composed of additional sequences or genes that were not previously present in the endogenous target DNA sequence. The length, base composition, and similarity of the DNA repair template to the endogenous target DNA sequence depend on how the endogenous target DNA sequence needs to be modified.

[0120] The total length of the DNA repair template includes the length of the donor 5' flanking sequence and the donor 3' flanking sequence (homologous arms) and the length of the exogenous donor DNA sequence. In one or more embodiments, the size of the exogenous donor DNA sequence is in the range of from about 10 base pairs to about 10 kb. In some embodiments, the size of the DNA repair template is in the range of from about 100 bp to about 200 bp.

[0121] CRISPR system

[0122] In some embodiments, the CRISPR system comprises a naturally occurring Cas protein or a non-naturally occurring Cas protein, and a polynucleotide encoding a target sequence. In some embodiments, the CRISPR system comprises a naturally occurring Cas protein or a non-naturally occurring Cas protein, a polynucleotide encoding a target sequence, and a polynucleotide capable of forming a complex with the Cas protein. In some embodiments, the polynucleotide capable of forming a complex with the Cas protein comprises a guide sequence (guide RNA), a Cas binding region, and a DNA repair template.

[0123] In some embodiments, the guide sequence is about 10 to about 40 nucleotides in length. In some embodiments, the guide sequence is about 12 to about 30 nucleotides in length. In some embodiments, the guide sequence is about 15 to about 20 nucleotides in length. In some embodiments, the guide sequence is about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, or about 40 nucleotides in length. In some embodiments, the guide sequence is long enough to hybridize to the target polynucleotide.

[0124] In some embodiments, the Cas binding region is capable of binding to a Cas effector protein (e.g., a Cas nuclease or a Cas nickase), thereby forming a complex with the Cas protein. In some embodiments, the Cas binding region comprises RNA. In some embodiments, the Cas binding region comprises a combination of RNA and DNA.

[0125] In some embodiments, multiple guide RNAs described in the aforementioned methods, kits, and compositions can be used in the same method, kit, or composition. For example, in some embodiments, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more different guide RNAs can be used at the same time.

[0126] In some embodiments, the Cas binding region includes a tracrRNA that binds to and activates the Cas protein. In some embodiments, the Cas binding region can hybridize with tracrRNA, and the composition further includes tracrRNA. In some embodiments, the tracrRNA can bind to the Cas nuclease or Cas nickase. In some embodiments, the tracrRNA can activate the Cas nuclease or Cas nickase. In some embodiments, activation includes initiating or increasing the cleavage activity of the Cas nuclease or Cas nickase. In some embodiments, activation includes promoting the binding of the Cas nuclease or Cas nickase to the target polynucleotide (for example, as under the guidance of the guide sequence). In some embodiments, activation includes the following combination: promoting the binding of the Cas nuclease or Cas nickase to the target polynucleotide; and initiating or increasing the cleavage activity of the Cas nuclease or Cas nickase.

[0127] In some embodiments, the CRISPR system comprises a regulatory element operably linked to a polynucleotide sequence encoding a recombinant Cas protein, and a polynucleotide that forms a complex with the recombinant Cas protein and comprises a guide sequence. In some embodiments, the regulatory element connected to the polynucleotide sequence encoding the recombinant Cas protein is a promoter. In some embodiments, the regulatory element is a eukaryotic promoter. In some embodiments, the regulatory element is a viral promoter. In some embodiments, the regulatory element is a eukaryotic regulatory element, i.e., a eukaryotic promoter. In some embodiments, the eukaryotic regulatory element is a mammalian promoter.

[0128] In some embodiments, the polynucleotides encoding the recombinant Cas protein and the guide polynucleotides are on a single vector. In some embodiments, the polynucleotides encoding the recombinant Cas protein, the guide polynucleotides (or nucleotides that can be transcribed into guide polynucleotides) and tracrRNA are on a single vector. In some embodiments, the polynucleotides encoding the recombinant Cas protein, the guide polynucleotides (or nucleotides that can be transcribed into guide polynucleotides), tracrRNA and the same direction repeat sequence are on a single vector. In some embodiments, the vector is an expression vector. In some embodiments, the vector is a mammalian expression vector. In some embodiments, the vector is a human expression vector. In some embodiments, the vector is a plant expression vector.

[0129] In some embodiments, the polynucleotide encoding the recombinant Cas protein and the guide polynucleotide (comprising a Cas binding region (which binds to and / or activates the Cas protein) and a guide sequence (which hybridizes to a target sequence)) are a single nucleic acid molecule. In some embodiments, the polynucleotide encoding the recombinant Cas protein, the guide polynucleotide, and the tracrRNA are a single nucleic acid molecule. In some embodiments, the polynucleotide encoding the recombinant Cas protein, the guide polynucleotide, the tracrRNA, and the direct repeat sequence are a single nucleic acid molecule. In some embodiments, the single nucleic acid molecule is an expression vector. In some embodiments, the single nucleic acid molecule is a mammalian expression vector. In some embodiments, the single nucleic acid molecule is a human expression vector. In some embodiments, the single nucleic acid molecule is a plant expression vector.

[0130] In some embodiments, the recombinant Cas protein and the guide polynucleotide are capable of forming a complex. In some embodiments, the complex of the recombinant Cas protein and the guide polynucleotide does not exist in nature.

[0131] eukaryotic cells

[0132] In certain embodiments, the eukaryotic cell is an animal cell or a human cell. In certain embodiments, the eukaryotic cell is a human or rodent or bovine cell line or cell strain. Examples of such cells, cell lines or cell strains include but are not limited to mouse myeloma (NSO) cell lines, Chinese hamster ovary (CHO) cell lines, HT1080, H9, HepG2, MCF7, MDBKJurkat, NIH3T3, PC12, BHK (baby hamster kidney cells), VERO, SP2 / 0, YB2 / 0, Y0, C127, L cells, COS (such as COS1 and COS7), QC1-3, HEK-293 and its derivative cell lines, VERO, PER.C6, HeLa, EB1, EB2, EB3, K562, U2OS, oncolytic or hybridoma cell lines. In certain embodiments, the eukaryotic cell is a CHO cell line. In certain embodiments, the eukaryotic cell is a CHO cell. In some embodiments, the cell is a CHO-K1 cell, a CHO-K1 SV cell, a DG44 CHO cell, a DUXB11 CHO cell, a CHOS cell, a CHO GS knockout cell, a CHO FUT8 GS knockout cell, a CHOZN cell, or a CHO-derived cell. The CHO GS knockout cell (e.g., a GSKO cell) is, for example, a CHO-K1 SV GS knockout cell. The CHO FUT8 knockout cell is, for example, the potentiating CHOK1 SV. The eukaryotic cell can also be an avian cell, cell line, or cell strain, such as an EBX cell, EB14, EB24, EB26, EB66, or EBv13.

[0133] In certain embodiments, the eukaryotic cell is a human cell. In certain embodiments, the human cell is a stem cell. The stem cell can be, for example, a pluripotent stem cell, including embryonic stem cells (ESC), adult stem cells, induced pluripotent stem cells (iPSC), tissue-specific stem cells (e.g., hematopoietic stem cells) and mesenchymal stem cells (MSC). In certain embodiments, human cells are differentiated forms of any cell described herein. In certain embodiments, the eukaryotic cell is a cell derived from any primary cell in culture.

[0134] In certain embodiments, the eukaryotic cell is a hepatocyte, such as a human hepatocyte, an animal hepatocyte or a non-parenchymal cell. For example, the eukaryotic cell can be a metabolically qualified human hepatocyte that can be inoculated, a qualified human hepatocyte that can be induced to be inoculated, a human hepatocyte that can be inoculated, a suspension qualified human hepatocyte (including the hepatocytes merged by 10-donors and 20-donors), human liver Kupffer cells, human hepatic stellate cells, dog hepatocytes (including single and merged beagle hepatocytes), mouse hepatocytes (including CD-1 and C57BI / 6 hepatocytes), rat hepatocytes (including Sprague-Dawley, WistarHan and Wistar hepatocytes), monkey hepatocytes (including cynomolgus (Cynomolgus) or rhesus monkey (Rhesus) hepatocytes), cat hepatocytes (including domestic shorthair cat hepatocytes) and rabbit hepatocytes (including New Zealand white rabbit hepatocytes).

[0135] In some embodiments, the eukaryotic cell is a hematopoietic cell. In some embodiments, the hematopoietic cell is a bone marrow progenitor cell. In some embodiments, the hematopoietic cell is a lymphoid progenitor cell. In some embodiments, the hematopoietic cell is a mast cell, a megakaryocyte, a platelet, a basophil, a neutrophil, an eosinophil, a dendritic cell, a monocyte or a macrophage. In some embodiments, the hematopoietic cell is a natural killer cell (NK cell), a T lymphocyte or a B lymphocyte. In some embodiments, the T lymphocyte or the B lymphocyte comprises a chimeric antigen receptor (CAR).

[0136] In some embodiments, the eukaryotic cell comprises a genomically integrated Cas polynucleotide. In some embodiments, the eukaryotic cell comprises an inducible genomically integrated Cas polynucleotide.

[0137] Inhibitors of the microhomologous end joining (MMEJ) pathway

[0138] An inhibitor of the MMEJ pathway is any compound, molecule, or entity that inhibits, antagonizes, blocks, or reduces the activity and / or level of any component of the MMEJ pathway. The MMEJ inhibitor can be an antibody or antigen-binding fragment thereof, peptide, soluble protein, siRNA, antisense oligonucleotide, aptamer, or small molecule compound that inhibits, antagonizes, blocks, or reduces the activity and / or level of any component of the MMEJ pathway. In some embodiments, the MMEJ inhibitor inhibits, antagonizes, blocks, or reduces the activity and / or level of FEN1 (Flap endonuclease 1), DNA ligase III, MREII, NBS1 (Nibrin, NBN), XRCC1 (X-ray repair cross-complementing protein 1), PARP1 (poly [ADP-ribose] polymerase 1), or PolQ (DNA polymerase theta). In some embodiments, the inhibitor of the MMEJ pathway is novobiocin. In some embodiments, the inhibitor of the MMEJ pathway is a PolQ inhibitor. In some embodiments, the PolQ inhibitor is ART558. In some embodiments, the PolQ inhibitor is selected from PolQ1, PolQ2, PolQ3, PolQ4, PolQ5, PolQ6, PolQ7, or a combination thereof.

[0139] Inhibitors of the non-homologous end joining (NHEJ) pathway

[0140] The inhibitor of NHEJ pathway is any compound, molecule or entity that inhibits, antagonizes, blocks or reduces the activity and / or level of any component of NHEJ pathway. The NHEJ inhibitor can be an antibody or its antigen-binding fragment, peptide, soluble protein, siRNA, antisense oligonucleotide, aptamer or small molecule compound that inhibits, antagonizes, blocks or reduces the activity and / or level of any component of NHEJ pathway. In some embodiments, the NHEJ inhibitor inhibits, antagonizes, blocks or reduces the activity and / or level of Ku70, Ku80, DNA ligase IV, XLF (non-homologous end joining factor 1; XRCC4-like factor) or DNA dependent protein kinase (DNA-PK). In some embodiments, the inhibitor of DNA-PK is M3814, M9831 / VX984, Nu7441, KU0060648, AZD7648, Nu5455, vanillin, wortmannin or a combination thereof. In some embodiments, the inhibitor of DNA-PK is M3814.

[0141] In some embodiments, an inhibitor of the MMEJ pathway or an inhibitor of the NHEJ pathway is added before the Cas protein is added. In some embodiments, an inhibitor of the MMEJ pathway or an inhibitor of the NHEJ pathway is added after the Cas protein is added. In some embodiments, an inhibitor of the MMEJ pathway or an inhibitor of the NHEJ pathway is added at the same time as the Cas protein is added.

[0142] The present invention will be further described below in conjunction with specific examples. The specific examples are only used to explain the present invention and are not to be construed as limiting the present invention. Those skilled in the art will appreciate that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and purpose of the present invention, and that the scope of the present invention is defined by the claims and their equivalents. The experimental methods in the following examples where specific conditions are not specified are generally tested under conventional conditions or according to the conditions recommended by the manufacturer.

[0143] Example 1 Screening of Rad51-based Nucleic Acid Binding Preferred Sequences

[0144] 1. A method for improving precise gene editing based on the preferred nucleic acid binding sequence of Rad51. The nucleic acid sequence exploration method includes the following steps:

[0145] First, 200 24nt DNA sequences were randomly extracted from the ClinVar database and synthesized, named SSO1 to SSO200 (single-stranded oligodeoxynucleotide, SSO). To avoid interference from ODN concentration in the experiment, these 200 ODNs were diluted to the same concentration and mixed in equal volumes to serve as the ODN library in the subsequent ODIP-Seq experiment. This ODN library was incubated with cell lysate for 12 hours, and then the protein-ODN complex was immunoprecipitated using the primary antibody corresponding to the target protein. Next, the ODN was recovered from the magnetic beads using phenol-chloroform extraction, and a second-generation sequencing library was constructed. The library was then tested and analyzed to obtain specific sequence information.

[0146] The experimental flow diagram is shown in Figure 1. The nucleic acid sequences that bind to Rad51 are shown in Figure 2, A. The results show that Rad51 has significant differences in its ability to bind to single-stranded DNA of different sequences, indicating that Rad51 has sequence preference for binding to single-stranded DNA.

[0147] 2. Specific sequence information analysis of Rad51's nucleic acid binding preference sequence:

[0148] Select the top DNA sequences that bind to Rad51 in Figure 2A. The sequence numbers and sequence information are listed in Figure 2A. Open the WebLogo 3 website, enter the selected DNA sequences, and upload them to obtain the overall sequence characteristics of these top-ranked DNA sequences.

[0149] The DNA sequence information binding to Rad51 protein is shown in Figure 2B. The results show that the preferred nucleic acid binding sequence of Rad51 begins with 5′TCCCC.

[0150] Example 2 Verification of the binding ability of Rad51 to its preferred sequence for binding to single-stranded DNA

[0151] Verification of the binding ability of the mammalian cell endogenous protein Rad51 discovered in Example 1 of the present invention to its preferred sequence for binding to single-stranded DNA, wherein the verification of the binding between the single-stranded DNA and the Rad51 protein comprises the following steps:

[0152] 5′-biotin-labeled single-stranded DNA (selected from Figure 2, A) was incubated with cell lysate for 12 hours. The single-stranded DNA-protein complex was pulled down using streptavidin magnetic beads, and 2× SDS loading buffer was added, followed by boiling in a water bath for 10 minutes to elute the bead-bound single-stranded DNA. Western blotting was used to examine the binding of the single-stranded DNA to Rad51. Figures 3, A and 3, B show the binding of single-stranded DNAs with strong and weak binding to Rad51, respectively, selected from Figure 2, A. The results show that single-stranded DNA 9 (SSO9, GTTCCCCGGAAATCACAGTCACAG, SEQ ID NO: 2) and single-stranded DNA 14 (SSO14, AACTCCCCCTCCATCATTCACTGT, SEQ ID NO: 3) showed the strongest binding to Rad51. Figure 3C and Figure 3D show the experiments of truncated single-stranded DNA No. 9 (SSO9) and single-stranded DNA No. 14 (SSO14) binding to Rad51 protein, which further verified that Rad51 protein has sequence preference for binding to single-stranded DNA, mainly related to the TCCCC (SEQ ID NO: 1) sequence.

[0153] Example 3 Functional evaluation of the preferred sequence of endogenous protein Rad51 binding to single-stranded DNA in precise gene editing of exogenous genes mediated by single-stranded DNA repair templates

[0154] Functional evaluation of the preferred sequence of the mammalian cell endogenous protein Rad51 binding to single-stranded DNA discovered in Example 1 of the present invention in the precise gene editing of the exogenous gene BFP mediated by the single-stranded DNA repair template:

[0155] 1. ssDNA donor-mediated cell genome editing (electroporation)

[0156] (a) Preparation of target cells

[0157] Use cells that are in good condition and have been passaged for a short time. Change the cell culture medium the day before electroporation.

[0158] (b) Preparation of guide RNA

[0159] 1) Design of guide RNA

[0160] The guide RNAs used in this example were all designed using the Zhang Feng laboratory website (https: / / zlab.bio / guide-design-resources).

[0161] First, search and download the sequence of the target gene on the NCBI website. Open the Zhang Feng laboratory website, find and click CRISPOR in the TOOLS FOR GUIDE DESIGN item. On the gRNA design page that jumps to the page, follow the prompts to design. Based on the different gRNAs designed on the website, select the appropriate and highest-scoring one for subsequent experiments. The seed sequences of the sgRNAs targeting the genes BFP, EMX1, DNMT1, CXCR4, RUNX1, RNF2, and FANCF are shown in SEQ ID NOs: 4-10, respectively.

[0162] 2) Synthesis and dissolution of guide RNA

[0163] Guide RNA was ordered from Nanjing GenScript Biotechnology Co., Ltd. Upon receipt of the powdered guide RNA, it was centrifuged at 4000 rpm for 1 minute. The tube cap was opened in a laminar flow hood and RNase-free water was added.

[0164] 3) Formation of RNP complex

[0165] First dilute the Cas9 protein (Cas9 nuclease purchased from IDT) in a clean EP tube, then add the guide RNA, and then gently mix with a pipette.

[0166] Incubate at room temperature for 10-20 minutes to allow Cas9 protein and gRNA to fully combine.

[0167] 4) Preparation of Neon Electroporation Equipment

[0168] Turn on the Neon electroporator. Enter the electroporation parameters. In this example, the following parameters were used: Note: For electroporation parameters of other cells, please refer to the cell database on the Thermo Fisher Scientific official website: https: / / www.thermofisher.cn / cn / zh / home / life-science / cell-culture / transfection / transfection---select ion-misc / neon-transfection-system / neon-protocols-cell-line-data.html.

[0169] 5) Electroporation of cells

[0170] Digest the cells, resuspend them in 1 mL of PBS, and count the cells using a cell counter or counting plate. 2 × 10 5 Take the appropriate amount of cells. Add the appropriate Cas9 RNP and single-stranded DNA repair template to each cell sample. After all groups have been electroporated, mix the cells using the figure-of-eight technique and place the culture dish in a 37°C incubator. Detect the gene editing results after 72 hours.

[0171] 2. Flow cytometric analysis of gene editing results

[0172] 1) Preparation of single-cell suspension

[0173] The cultured cells were digested with trypsin, centrifuged and resuspended in DPBS. Centrifuged again at 500g for 5 minutes at room temperature and the culture medium was washed off. The cells were resuspended in DPBS to control the cell concentration to less than 1×10 7 / ml, filtered through a 40 μm filter to remove cell clumps.

[0174] Note: In this application, cells detected and sorted are autofluorescent cells, so fluorescent labeling is not required.

[0175] 2) On-machine testing

[0176] For detailed steps, refer to the user manual of the flow cytometer.

[0177] First, load the negative control sample onto the machine, circle the gate, and mark the positive signal area. Then, load the experimental sample onto the machine and circle the negative and positive cell populations.

[0178] 3) Result analysis

[0179] FlowJo analysis software was used to calculate the percentage of negative and positive cell populations, and the proportion of repair results generated by each DSB repair pathway was calculated. GraphPad Prism software was used to analyze statistical significance of independent repeated experiments.

[0180] The results in Figure 4A demonstrate that the addition of a Rad51-preferred sequence for single-stranded DNA binding to the 5′ end of the single-stranded DNA repair template significantly improves the efficiency of precise gene editing mediated by the single-stranded DNA repair template in HEK293T-BFP cells. The results in Figure 4B demonstrate that the addition of a Rad51-preferred sequence for single-stranded DNA binding to the 5′ end of the single-stranded DNA repair template does not affect the efficiency of the Cas9 nuclease. The results in Figure 4C demonstrate that the addition of a Rad51-preferred sequence for single-stranded DNA binding to the 5′ end of the single-stranded DNA repair template increases the efficiency of precise gene editing mediated by the single-stranded DNA repair template by 2.5-fold in K562-BFP cells. The results in Figure 4D demonstrate that the addition of a Rad51-preferred sequence for single-stranded DNA binding to the 5′ end of the single-stranded DNA repair template does not affect the efficiency of the Cas9 nuclease.

[0181] Example 4 Functional evaluation of the preferred sequence of endogenous protein Rad51 binding to single-stranded DNA in precise gene editing of endogenous genes in different cells mediated by single-stranded DNA repair templates

[0182] Functional evaluation of the preferred sequence of the mammalian cell endogenous protein Rad51 binding to single-stranded DNA discovered in Example 1 of the present invention in the precise gene editing of endogenous genes in HEK293T cells, HeLa cells, U2OS cells, K562 cells, and human peripheral blood CD34 cells mediated by single-stranded DNA repair templates:

[0183] Using electroporation, the CRISPR gene editing tool and a single-stranded DNA repair template were introduced into HEK293T cells, HeLa cells, U2OS cells, K562 cells, and human peripheral blood CD34 cells to mediate precise editing of the endogenous genome. After gene editing, the cells were harvested and their genomes extracted. Next-generation sequencing was used to obtain the edited gene sequence. Sequencing reads that achieved precise editing were extracted and their proportion was calculated to determine the efficiency of precise gene editing.

[0184] The results in Figures 5A and 5B demonstrate that the addition of a Rad51-preferred sequence at the 5′ end of the single-stranded DNA repair template significantly improved the efficiency of precise gene editing mediated by the single-stranded DNA repair template in HEK293T cells, from 4.1-10.5% to 9.4-29.7%, a 1.7-4.8-fold increase. The results in Figure 5C demonstrate that the addition of a Rad51-preferred sequence at the 5′ end of the single-stranded DNA repair template did not affect the efficiency of the Cas9 nuclease.

[0185] The results in Figures 6A and 6B demonstrate that the addition of a Rad51-preferred sequence at the 5′ end of the single-stranded DNA repair template significantly improved the efficiency of precise gene editing mediated by the single-stranded DNA repair template in HeLa cells, ranging from 0.9 to 9.8%. The effect was strongest at the FANCF site, with a maximum increase of approximately 15-fold. The results in Figure 6C demonstrate that the addition of a Rad51-preferred sequence at the 5′ end of the single-stranded DNA repair template did not affect the efficiency of the Cas9 nuclease.

[0186] Figures 7A and 7B show that the addition of a Rad51-preferred sequence at the 5′ end of the single-stranded DNA repair template significantly improved the efficiency of precise gene editing mediated by the single-stranded DNA repair template in U2OS cells, ranging from 8.2% to 23.8%. The effect was strongest at the FANCF site, with a maximum increase of approximately 8-fold. Figure 7C shows that the addition of a Rad51-preferred sequence at the 5′ end of the single-stranded DNA repair template did not affect the efficiency of the Cas9 nuclease.

[0187] The results in Figures 8A and 8B demonstrate that the addition of a Rad51-preferred sequence at the 5′ end of the single-stranded DNA repair template significantly improved the efficiency of precise gene editing mediated by the single-stranded DNA repair template in K562 cells, from 4.4-14.5% to 17.9-32.6%. The strongest effect was observed at the CXCR4 and FANCF loci, with increases of up to approximately 5-fold. The results in Figure 8C demonstrate that the addition of a Rad51-preferred sequence at the 5′ end of the single-stranded DNA repair template did not affect the efficiency of the Cas9 nuclease.

[0188] The results in Figures 9A and 9B demonstrate that the addition of a Rad51-preferred sequence at the 5′ end of the single-stranded DNA repair template significantly improved the efficiency of precise gene editing mediated by the single-stranded DNA repair template in human peripheral blood CD34 cells, with the maximum increase being approximately 2.5-fold, achieving a precise editing efficiency of 5%. The results in Figure 9C demonstrate that the addition of a Rad51-preferred sequence at the 5′ end of the single-stranded DNA repair template did not affect the efficiency of the Cas9 nuclease.

[0189] Example 5 Functional evaluation of the preferred sequence of endogenous protein Rad51 binding to single-stranded DNA in paired nCas9-mediated precise gene editing of exogenous genes

[0190] Functional evaluation of the preferred sequence of the mammalian cell endogenous protein Rad51 binding to single-stranded DNA discovered in Example 1 of the present invention in the precise gene editing of the exogenous gene BFP mediated by paired nCas9 (Cas9 nickase):

[0191] HEK293T-BFP cells were electroporated with the CRISPR gene-editing tool (nCas9) and a single-stranded DNA repair template to precisely edit the BFP gene. After gene editing, the cells were harvested and analyzed by flow cytometry for the number of cells with different fluorescent signals. The percentage of cells with precisely edited genes was calculated and recorded as the efficiency of precise gene editing.

[0192] The results in Figure 10 show that when a Rad51-binding sequence with a preference for single-stranded DNA is added to the 5′ end of the single-stranded DNA repair template, the efficiency of precise gene editing mediated by the single-stranded DNA repair template is improved, up to about 2 times.

[0193] Example 6 Functional evaluation of single-stranded DNA repair templates of RAD51 high-affinity nucleic acid sequences and the M3814 small molecule inhibitor in precise gene editing

[0194] Precise gene editing is tested using a single-stranded DNA repair template containing a high-affinity RAD51 nucleic acid sequence and the M3814 small molecule inhibitor, as shown in the flowchart of FIG11 , which specifically includes the following steps:

[0195] (a) Designing a suitable single-stranded DNA repair template for the targeted gene locus, including homology arm sequences at both ends and the sequence to be modified (or inserted) in the middle;

[0196] (b) Add the RAD51 high-affinity nucleic acid sequence sso14 to the 5′ end of the designed single-stranded DNA repair template, and then send the complete sequence to a biotechnology company for chemical synthesis.

[0197] (c) introducing the CRISPR editing system and the single-stranded DNA repair template into cells for gene editing by electroporation, using the same method as in Example 3;

[0198] (d) After electroporation, the cells were cultured in a medium containing 2 μM M3814 for 48 h, and the medium was replaced with fresh medium after 48 h.

[0199] (e) Five days after electroporation, the efficiency of precise gene editing was detected by flow cytometry or next-generation sequencing.

[0200] Comparative Example 1

[0201] The difference from Example 1 is that the single-stranded DNA repair template does not have a RAD51 high-affinity nucleic acid sequence added to the 5' end. The other steps are the same.

[0202] Comparative Example 2

[0203] The difference from Example 1 is that M3814 is not used after the electroporation is completed. The other steps are the same.

[0204] Comparative Example 3

[0205] The difference from Example 1 is that the single-stranded DNA repair template does not have a RAD51 high-affinity nucleic acid sequence added to the 5' end; and after electroporation, M3814 is not used. Other steps are the same.

[0206] The functions of single-stranded DNA repair (HDRobust) involved in the above Example 1 and Comparative Examples 1-3 and the literature "Efficient high-precision homology-directed repair-dependent genome editing by HDRobust (PMID: 37474806)" in the precise gene editing of exogenous genes and endogenous genes were evaluated.

[0207] The efficiency results of precise gene editing at the BFP gene locus in HEK293T-BFP cells using a single-stranded DNA repair template containing a high-affinity nucleic acid sequence for RAD51 and a small molecule inhibitor of M3814 are shown in Figure 12. The results show that the single-stranded DNA repair template containing a high-affinity nucleic acid sequence for RAD51 is more efficient than the conventional single-stranded DNA repair template (see bar 6 vs bar 3 in Figure 12). The use of the small molecule inhibitor of M3814 can also improve the efficiency of gene editing mediated by the single-stranded DNA repair template (see bar 4 vs bar 3 in Figure 12). This indicates that the combined use of a single-stranded DNA repair template containing a high-affinity nucleic acid sequence for RAD51 and a small molecule inhibitor of M3814 can achieve efficient and precise gene editing, with an efficiency of up to 55.8% (see bar 7 in Figure 12).

[0208] The results of the efficiency of precise gene editing of the endogenous gene sites EMX1, CXCR4, RUNX1 and FANCF in HEK293T cells by combining a single-stranded DNA repair template containing a high-affinity nucleic acid sequence of RAD51 and a small molecule inhibitor of M3814 are shown in Figure 13. The results show that the single-stranded DNA repair template containing a high-affinity nucleic acid sequence of RAD51 is more efficient than the conventional single-stranded DNA repair template (see bar 13 VS bar 1 in Figure 13). The combined use of a single-stranded DNA repair template containing a high-affinity nucleic acid sequence of RAD51 and a small molecule inhibitor of M3814 can achieve efficient and precise gene editing with an efficiency range of 66.6-84.8% (see bar 3 in Figure 13). Moreover, this phenomenon is universal across gene sites.

[0209] The results of the efficiency of precise gene editing at the endogenous gene loci EMX1, DNMT1, CXCR4, RUNX1, and RNF2 in K562 cells using a single-stranded DNA repair template containing a high-affinity nucleic acid sequence and the M3814 small molecule inhibitor are shown in Figure 14. The results show that the single-stranded DNA repair template containing a high-affinity nucleic acid sequence is more efficient than the conventional single-stranded DNA repair template (see bar 2 vs. bar 1 in Figure 14). The use of the M3814 small molecule inhibitor can also improve the efficiency of gene editing mediated by the single-stranded DNA repair template (see bar 3 vs. bar 1 in Figure 14). The combined use of a single-stranded DNA repair template containing a high-affinity nucleic acid sequence and the M3814 small molecule inhibitor can achieve efficient and precise gene editing, with an efficiency range of 69.7-87.3% (see bar 4 in Figure 14).

[0210] Based on the above experimental results, it can be seen that the method provided by the present invention is universal in achieving efficient and precise gene editing effects across gene sites and cell lines.

Claims

1. A nucleic acid binding preference sequence based on Rad51 protein, characterized in that: The nucleic acid binding preference sequence comprises the sequence shown in SEQ ID NO: 1; Preferably, the nucleic acid binding preference sequence length is 5 bp-100 bp; Preferably, the nucleic acid binding preference sequence is 5 bp-50 bp in length; Preferably, the nucleic acid binding preference sequence is 5 bp to 30 bp in length; Optionally, the nucleic acid binding preference sequence is shown as SEQ ID NO: 2 or SEQ ID NO:

3.

2. A DNA repair template, characterized in that The DNA repair template non-template homologous sequence includes the nucleic acid binding preference sequence of claim 1; Preferably, the DNA repair template is selected from single-stranded DNA, double-stranded DNA, or a combination of single-stranded and double-stranded DNA; Preferably, the DNA repair template is selected from single-stranded DNA; Preferably, the DNA repair template includes homology arms and / or insertion sequences at both ends; Preferably, the DNA repair template comprises, from 5' to 3': a first homology arm, the first homology arm comprising a sequence of at least 40 nucleotides located 5' of the gene target sequence; and a second homology arm, the second homology arm comprising a sequence of at least 40 nucleotides located 3' of the target sequence; Preferably, the gene is selected from BFP, EMX1, DNMT1, CXCR4, RUNX1, FANCF, RNF2.

3. A composition, characterized in that The composition comprises the DNA repair template of claim 2; Preferably, the composition further comprises a regulator of DNA repair; Preferably, the regulator of DNA repair is selected from an inhibitor of the NHEJ pathway or an inhibitor of the MMEJ pathway; Preferably, the regulator of DNA repair is selected from DNA-PK inhibitors; Preferably, the DNA-PK inhibitor is selected from M3814, M9831 / VX984, Nu7441, Nu7026, KU0060648, AZD7648 or a combination thereof.

4. The composition according to claim 3, characterized in that The composition also includes a gene editing system; Preferably, the gene editing system is selected from meganuclease, TALEN, ZFN, CRISPR system; Preferably, the gene editing system is a CRISPR system; Preferably, the CRISPR system comprises a Cas protein or a vector encoding a Cas protein; Preferably, the CRISPR system further comprises a polynucleotide comprising at least one RNA guide sequence, a Cas binding region, or a combination thereof; Preferably, the Cas protein is a Cas9 protein or a Cas12 protein; Preferably, the Cas9 protein comprises SpyCas9, SauCas9, NmeCas9, StCas9, FnCas9, CjCas9, AnaCas9 or GeoCas9; Preferably, the Cas12 protein is Cas12a, Cas12b, Cas12f or Cas12i; Preferably, the Cas12 protein is selected from AsCpf1, FnCpf1, SsCpf1, PcCpf1, BpCpf1, CmtCpf1, LiCpf1, PmCpf1, Pb3310Cpf1, Pb4417Cpf1, BsCpf1, EeCpf1, BhCas12b, AkCas12b, EbCas12b and / or LsCas12b; Preferably, a polynucleotide comprising at least one guide RNA sequence, a Cas binding region, a DNA repair template sequence, or a combination thereof is encoded on the vector; Preferably, the vector encoding the Cas protein is a viral vector; Preferably, the Cas protein and the polynucleotide comprising at least one guide RNA sequence, a Cas binding region, a DNA repair template sequence, or a combination thereof are in the form of a ribonucleoprotein (RNP); Preferably, the composition further comprises a pharmaceutically acceptable carrier.

5. A kit, characterized in that: The kit comprises the DNA repair template according to claim 2; and Optional regulators of DNA repair and / or gene editing systems; Preferably, the regulator of DNA repair is selected from an inhibitor of the NHEJ pathway or an inhibitor of the MMEJ pathway; Preferably, the inhibitor of the NHEJ pathway is selected from DNA-PK inhibitors; Preferably, the gene editing system is a CRISPR system; Preferably, the CRISPR system comprises a Cas protein or a vector encoding a Cas protein; Preferably, the CRISPR system further comprises a polynucleotide comprising at least one RNA guide sequence, a Cas binding region, or a combination thereof; Preferably, the vector encoding the Cas protein is a viral vector; Preferably, a polynucleotide comprising at least one guide RNA sequence, a Cas binding region, a DNA repair template sequence, or a combination thereof is encoded on the vector; Preferably, the vector encoding the Cas protein is a viral vector; Preferably, the Cas protein and the polynucleotide comprising at least one guide RNA sequence, a Cas binding region, a DNA repair template sequence or a combination thereof are in the form of a ribonucleoprotein (RNP).

6. A method for genetic modification of eukaryotic cells, characterized in that: The method comprises: contacting the gene with the DNA repair template of claim 2: Preferably, the method further comprises contacting the gene with a gene editing system; Preferably, the method further comprises adding a regulator of DNA repair; Preferably, the eukaryotic cells are incubated with the gene editing system and the DNA repair template to introduce the gene editing system and the DNA repair template into the eukaryotic cells; Preferably, the gene editing system is selected from the gene editing system described in claim 4; Preferably, the gene editing system is a CRISPR system; Preferably, the CRISPR system comprises a Cas protein or a vector encoding a Cas protein; Preferably, the CRISPR system further comprises a polynucleotide comprising at least one RNA guide sequence, a Cas binding region, or a combination thereof; Preferably, the Cas protein is a Cas9 nuclease, a Cas9 nickase, a Cas12a nuclease or a Cas12f nuclease; Preferably, a polynucleotide comprising at least one guide RNA sequence, a Cas binding region, a DNA repair template sequence, or a combination thereof is encoded on the vector; Preferably, the vector encoding the Cas protein is a viral vector; Preferably, the viral vector is a retrovirus, a lentivirus, an adenovirus or an adeno-associated virus; Preferably, the Cas protein and the polynucleotide comprising at least one guide RNA sequence, a Cas binding region, a DNA repair template sequence, or a combination thereof are in the form of a ribonucleoprotein (RNP); Preferably, the DNA repair template and gene editing system are added to the eukaryotic cells by microinjection, electroporation, or via lipid nanoparticles, liposomes, exosomes, gold nanoparticles, or DNA nanowires; Preferably, the regulator of DNA repair is selected from an inhibitor of the NHEJ pathway or an inhibitor of the MMEJ pathway; Preferably, the inhibitor of the NHEJ pathway is selected from DNA-PK inhibitors; Preferably, the DNA-PK inhibitor is selected from M3814, M9831 / VX984, Nu7441, Nu7026, KU0060648, AZD7648 or a combination thereof; Preferably, the DNA-PK inhibitor is M3814; Preferably, the eukaryotic cell is a mammalian cell; Preferably, the eukaryotic cells are selected from at least one of HEK293A, HEK 293T, Hela, U2OS, K562, hPB CD34+, NIH3T3 or iBMDM.

7. A method for genetic modification of eukaryotic cells, characterized in that: The method comprises: contacting a gene with the DNA repair template of claim 2; the gene comprises a genomically integrated Cas polynucleotide; Preferably, the method further comprises contacting the gene with a polynucleotide comprising at least one RNA guide sequence, a Cas binding region, or a combination thereof; Preferably, a DNA repair template sequence, an RNA guide sequence, a Cas binding region, or a combination thereof is encoded on the vector; Preferably, the vector is introduced into the eukaryotic cell by transfection; Preferably, the Cas protein is a Cas9 nuclease, a Cas9 nickase, a Cas12a nuclease or a Cas12f nuclease; Preferably, the method further comprises contacting the gene with a regulator of DNA repair; Preferably, the regulator of DNA repair is selected from an inhibitor of the NHEJ pathway or an inhibitor of the MMEJ pathway; Preferably, the inhibitor of the NHEJ pathway is selected from DNA-PK inhibitors; Preferably, the DNA-PK inhibitor is selected from M3814, M9831 / VX984, Nu7441, Nu7026, KU0060648, AZD7648 or a combination thereof; Preferably, the DNA-PK inhibitor is M3814.

8. A method for genetic modification of eukaryotic cells, characterized in that: The method comprises transfecting a eukaryotic cell with a vector comprising a DNA repair template sequence; Preferably, the method further comprises transfecting a eukaryotic cell with a vector encoding a Cas protein and a vector comprising a polynucleotide comprising an RNA guide sequence, a Cas binding region, or a combination thereof; Preferably, the carriers are the same carrier or different carriers; Preferably, the method further comprises adding a regulator of DNA repair; Preferably, the regulator of DNA repair is selected from an inhibitor of the NHEJ pathway or an inhibitor of the MMEJ pathway; Preferably, the inhibitor of the NHEJ pathway is selected from DNA-PK inhibitors; Preferably, the DNA-PK inhibitor is selected from M3814, M9831 / VX984, Nu7441, Nu7026, KU0060648, AZD7648 or a combination thereof; Preferably, the DNA-PK inhibitor is M3814.

9. A method for increasing the efficiency of homology-directed repair in eukaryotic cells, the method comprising adding the DNA repair template of claim 2 or the composition of claim 3 or 4.

10. Use of the nucleic acid binding preference sequence according to claim 1, the DNA repair template according to claim 2, and the composition according to claim 3 or 4 in the preparation of drugs for treating diseases related to gene defects.

11. Use of the nucleic acid binding preference sequence according to claim 1, the DNA repair template according to claim 2, the composition according to claim 3 or 4, and the kit according to claim 5 in gene modification; Preferably, the genetic modification includes gene editing of exogenous genes and genetic modification of endogenous genes.

12. Application of the nucleic acid binding preference sequence of Rad51 protein in gene modification; Preferably, the genetic modification includes gene editing of exogenous genes and genetic modification of endogenous genes.

Images