Pichia pastoris engineering bacterium with high homologous recombination efficiency as well as construction method and application of pichia pastoris engineering bacterium

Abstract

The invention discloses pichia pastoris engineering bacteria with high homologous recombination efficiency as well as a construction method and application of the pichia pastoris engineering bacteria. According to the invention, a ku70 gene, a ku80 gene, a Dnl4 gene or a chr3-0308 gene in pichia pastoris are knocked out, and an RAD50 gene, an RAD51 gene, an RAD52 gene, an RAD57 gene, an SAE2 gene and an MRE11 gene are over-expressed, so that the pichia pastoris engineering strain with high homologous integration capability and high growth efficiency is obtained; in addition, it is proved that the homologous recombination activity of pichia pastoris can be improved by overexpressing the homologous recombination related protein and knocking out the non-homologous end connection related protein.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, and in particular to a Pichia pastoris engineered strain with high homologous recombination efficiency, its construction method, and its application. Background Technology

[0002] Pichia pastoris ( P. pastoris Pichia pastoris is a methanol-nutritional yeast that combines the advantages of easy cultivation, rapid reproduction, simple operation, and high-density fermentation with the processing system of eukaryotic products that allows for correct product folding. Furthermore, it can secrete products into the fermentation broth, facilitating subsequent separation and purification. Based on these advantages, Pichia pastoris has become one of the most widely used recombinant protein expression systems, with over 5000 recombinant proteins successfully expressed in it.

[0003] Currently, chromosome integration is the main method for expressing heterologous genes in Pichia pastoris. However, Pichia pastoris is an unconventional yeast with limited screening markers and integration sites. Currently, 15 neutral sites have been identified by analyzing the characteristics of spacer sites using CRISPR-Cpf1 technology. These 15 sites provide sufficient resources for studying metabolic engineering and synthetic biology in Pichia pastoris. The integration efficiency of these sites ranges from 10% to 100%. Although highly efficient integration sites exist, the efficiency of most integration sites remains low. Therefore, there is an urgent need for a method to improve the integration efficiency of these sites, thereby constructing an efficient and stable gene editing platform.

[0004] However, compared with the highly homologous recombination efficiency of Saccharomyces cerevisiae (… Saccharomyces cerevisiae) Unlike traditional yeasts such as Pichia pastoris, which rely on low-efficiency homologous recombination for genome repair, Pichia pastoris primarily uses non-homologous end joining (NHEJ) for repair. Relying solely on Pichia pastoris' own homologous recombination process presents significant challenges in achieving seamless gene knockout and targeted integration of exogenous genes. Similar to CRISPR / Cas9, CRISPR / Cpf1 cuts the target DNA and introduces double-strand breaks, followed by repair via HDR or NHEJ. NHEJ introduces random base insertions, mutations, and deletions, making its repair effectiveness difficult to predict and control. HDR, on the other hand, is a precise repair mechanism. Different donor fragment designs can achieve gene insertion, deletion, and replacement, making it a primary means of integrating exogenous genes into the genome and for targeted genome modification. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings and deficiencies of the prior art and provide a Pichia pastoris engineered strain with high homologous recombination efficiency.

[0006] Another objective of this invention is to provide a method for constructing the above-mentioned Pichia pastoris engineered strain with high homologous recombination efficiency.

[0007] Another object of the present invention is to provide the application of the above-mentioned Pichia pastoris engineered strain with high homologous recombination efficiency.

[0008] The objective of this invention is achieved through the following technical solution: A Pichia pastoris engineered strain with high homologous recombination efficiency is obtained by transferring the Cpf1 gene into Pichia pastoris and then knocking out the chr3-0308 gene; preferably, the MRE11 gene and the RAD57 gene are also overexpressed.

[0009] The Pichia pastoris engineered strain with high homologous recombination efficiency exhibits higher integration efficiency when used as a starting strain to knock out genes or introduce exogenous genes for integration, without affecting growth performance.

[0010] The method for constructing the Pichia pastoris engineered strain with high homologous recombination efficiency includes the following steps: (1) After linearizing the plasmid containing the Cpf1 gene, it was transformed into Pichia pastoris and the engineered strain A was obtained after screening; (2) The chr3-0308 gene was knocked out in engineered bacteria A, and engineered bacteria B was obtained after screening; (3) The MRE11 gene was overexpressed in the PNSⅠ-2 site of engineered bacteria B, and engineered bacteria C was obtained after screening; (4) The RAD57 gene was overexpressed in the PNSⅡ-5 site of engineered strain C, and after screening, Pichia pastoris engineered strain with high homologous recombination efficiency was obtained.

[0011] The plasmid containing the Cpf1 gene mentioned in step (1) is pHKA-P GAP -Cpf1-DASTT plasmid.

[0012] The pHKA-P GAP The -Cpf1-DASTT plasmid is a pHKA plasmid carrying the Cpf1 gene expression cassette, in which the Cpf1 gene expression cassette is generated by the promoter P. GAP It consists of the Cpf1 gene and the terminator DASTT.

[0013] The NCBI database accession number for the Cpf1 gene is ASK86102.1.

[0014] The NCBI database accession number for the chr3-0308 gene mentioned in step (2) is XP_002492527.1.

[0015] The knockout described in step (2) is achieved by transferring a donor fragment, including the upstream homologous arm of the chr3-0308 gene, the Cre-loxp expression cassette, and the downstream homologous arm of the chr3-0308 gene, into engineered bacteria and then knocking out the target gene through homologous recombination.

[0016] The NCBI database accession number for the MRE11 gene mentioned in step (3) is XP_002493082.1.

[0017] The overexpression described in step (3) is achieved by transferring a donor fragment, including the upstream homologous arm of the PNSⅠ-2 site, the MRE11 gene expression cassette, and the downstream homologous arm of the PNSⅠ-2 site, together with the Cas9 manipulation vector into engineered bacteria to integrate the gene into the genome.

[0018] The MRE11 gene expression cassette includes the promoter P GAP MRE11 gene, terminator AOXTT.

[0019] The nucleotide sequence of the PNSⅠ-2 site described in step (3) is shown in SEQ ID NO.1.

[0020] The NCBI database accession number for the RAD57 gene mentioned in step (4) is XP_002489361.1.

[0021] The overexpression described in step (4) is achieved by transferring the donor fragment, which includes the upstream homologous arm of the PNSII-5 site, the RAD57 gene expression cassette, and the downstream homologous arm of the PNSII-5 site, into the engineered bacteria along with the Cas9 manipulation vector to integrate the gene into the genome.

[0022] The RAD57 gene expression cassette includes the promoter P GAP RAD57 gene, terminator AOXTT.

[0023] The nucleotide sequence of the PNSⅡ-5 site described in step (4) is shown in SEQ ID NO.2.

[0024] The Cas9 manipulation vector is pENO1-Cas9-sgRNA.

[0025] The promoter P GAP The nucleotide sequence is shown in SEQ ID NO.4.

[0026] The nucleotide sequence of the terminator DASTT is shown in SEQ ID NO.5.

[0027] The nucleotide sequence of the terminator AOXTT is shown in SEQ ID NO.6.

[0028] The above-mentioned Pichia pastoris engineered strain with high homologous recombination efficiency is used in the preparation of engineered strains that can efficiently express exogenous genes.

[0029] The above-mentioned Pichia pastoris engineered strain with high homologous recombination efficiency is used in the preparation of highly efficient endogenous gene knockout engineered strains.

[0030] An engineered bacterium highly expressing the BIR1 gene was constructed through the following steps: Using the above-mentioned Pichia pastoris engineered strain with high homologous recombination efficiency as the starting strain, the donor fragment obtained by sequentially connecting the upstream homologous arm of the P3NS12 site, the BIR1 gene expression cassette, and the downstream homologous arm of the P3NS12 site was transformed together with the Cpf1 manipulation vector, and positive clones were screened to obtain engineered strains that highly express the BIR1 gene.

[0031] The nucleotide sequence of the P3NS12 site is shown in SEQ ID NO.3.

[0032] The BIR1 gene expression cassette includes the promoter P GAP BIR1 gene, terminator AOXTT.

[0033] The NCBI database accession number for the BIR1 gene is XM_002491621.1.

[0034] The Cpf1 manipulation vector is pPICZ-pSER-CrRNA-SUP4TT.

[0035] The present invention has the following advantages and effects compared with the prior art: This invention involves knocking out the ku70, ku80, Dnl4, or chr3-0308 genes in Pichia pastoris and overexpressing the RAD50, RAD51, RAD52, RAD57, SAE2, and MRE11 genes during the HR process, resulting in engineered Pichia pastoris strains with high homologous integration capacity and efficient growth. Furthermore, it has been demonstrated that overexpression of homologous recombination-related proteins and knockout of non-homologous end-joint-related proteins can improve the homologous recombination activity of Pichia pastoris. Attached Figure Description

[0036] Figure 1 It is pHKA-P in Example 1 GAP Plasmid map of -Cpf1-DASTT plasmid.

[0037] Figure 2 This refers to the colony color change after knocking out the ADE2 gene in Example 6.

[0038] Figure 3This refers to the effect of engineered bacteria after single-factor knockout or overexpression on the knockout efficiency of ADE2 and CFU in Example 6.

[0039] Figure 4 This refers to the effect of engineered bacteria after dual-factor knockout or overexpression in Example 6 on the knockout efficiency of ADE2 and CFU.

[0040] Figure 5 The effect of multi-factor combination knockout or overexpression of engineered bacteria on ADE2 knockout efficiency and CFU in Example 6.

[0041] Figure 6 This describes the integration efficiency of the engineered bacteria after multi-factor combination knockout or overexpression in Example 7, where the BIR1 gene is integrated into the neutral site of Pichia pastoris, and the effect of each combination on CFU. Detailed Implementation

[0042] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0043] Unless otherwise specified in the following implementation plan, the test conditions are generally as per standard test conditions or the test conditions recommended by the reagent company. Unless otherwise specified, all materials and reagents used are commercially available.

[0044] The CRISPR-Cas9 manipulation vector (pENO1-Cas9-sgRNA) used in this invention has been disclosed in the literature “Engineering Pichia pastoris for high-level biosynthesis of squalene [J]. Biochemical Engineering Journal, 2025, 217(109677) doi:https: / / doi.org / 10.1016 / j.bej.2025.109677” and is deposited in the laboratory of the School of Biological Science and Engineering, South China University of Technology.

[0045] The CRISPR-Cpf1 manipulation vector (pPICZ-pSER-CrRNA-SUP4TT) used in this invention has been described in the literature "A Novel and Efficient Genome Editing Tool Assisted by CRISPR-Cas12a / Cpf1 for Pichia pastoris [J]. ACS Synthetic Biology" The results are published in "2021, DOI: 10.1021 / acssynbio.1c00172" and are deposited in the laboratory of the School of Biological Science and Engineering, South China University of Technology.

[0046] The pHKA vector used in this invention was obtained by knocking out the ampicillin resistance gene from the commercial plasmid 9K and is stored in the laboratory of the School of Biological Science and Engineering, South China University of Technology.

[0047] Example 1: Construction of chassis strain PN0 (GS115-HIS4::Cpf1) 3000ng pHKA-P GAP -Cpf1-DASTT plasmid (carrying the Cpf1 gene expression cassette, sequence shown in SEQ ID NO.7, wherein the promoter is P GAP The NCBI database accession number for the Cpf1 gene is ASK86102.1, and the terminator is DASTT. BspEⅠ After single-enzyme digestion and linearization, the gel was purified and then electroporated. Pichia pastoris GS115 competent cells (purchased from Invitrogen, USA) were plated on MD auxotrophic plates and cultured for 3-4 days. Sixteen transformants were selected, yeast was lysed, and positive transformants were picked and confirmed by PCR to be correct, yielding the chassis strain PN0 (GS115-HIS4::Cpf1).

[0048] Example 2 Construction of the knockout strain PN3 (GS115-Cpf1-ΔDnl4) 2.1 Construction of donor sequence for knocking out Dnl4 gene Using the Pichia pastoris GS115 genome as a template, the upstream homologous arm Dnl4-UP and the downstream homologous arm Dnl4-DOWN of the Dnl4 gene coding sequence were amplified using primer pairs. Using the pPICZA-pGAP-RAD52-Cre-loxp plasmid as a template, the Cre-loxp knockout fragment (including two loxp elements and expression cassettes of the crease and resistance genes, the nucleotide sequence of which is shown in SEQ ID NO.7) was amplified using primer pairs. Subsequently, the three fragments were subjected to overlap PCR to obtain the donor fragment, and Cre-loxp resistance cycling knockout was performed. The fragment construction can be referred to the literature "Recycling of a selectable marker with a self-excisable plasmid in...". Pichia pastoris . Sci Rep 7, 11113 (2017). doi.org / 10.1038 / s41598-017-11494-5.

[0049] 2.2 Knockout of the Dnl4 gene using conventional electroporation methods 3000 ng of donor DNA was co-transformed into the PN0 strain. After recovery, the DNA was plated on YPD plates containing 100 μg / mL Zeocin resistance. After 3–4 days, 16 single colonies were picked for post-zyme PCR verification. Using the lysed yeast genome as a template, sequencing verification was performed. Three positive strains were selected and inoculated into 10 mL of BMMY liquid medium. After induction with 1% methanol for 72 h, the fermentation broth was streaked in YPD solid medium for 3 days. Six single colonies of each positive transformant were selected for post-zyme PCR verification, and the results were obtained as the Dnl4 gene knockout strain PN3 (GS115-Cpf1-ΔDnl4).

[0050] Example 3 Construction of overexpression strain PN6 (GS115-Cpf1-RAD51) 3.1 Construction of donor sequence for overexpression of RAD51 gene Using plasmid pPICZA-PGAP-RAD52-Cre-loxp as a template, the promoter P was amplified using primer pairs. GAP The RAD51 expression cassette was obtained by combining the AOX1TT terminator fragment with the RAD51 gene fragment and performing a three-fragment overlap PCR.

[0051] Using the Pichia pastoris GS115 genome as a template, the RAD51 gene fragment, the upstream homologous arm PNSⅠ-2-UP and the downstream homologous arm PNSⅠ-2-DOWN of the PNSⅠ-2 site were amplified using primer pairs.

[0052] Subsequently, the RAD51 expression cassette was overlapped with three fragments, PNSⅠ-2-UP and PNSⅠ-2-DOWN, to obtain the RAD51-Donor fragment via PCR.

[0053] 3.2 The RAD51 gene was overexpressed using conventional electroporation methods. 3500 ng pENO1-Cas9-PNSⅠ-2-sgRNA and 2500 ng donor DNA were co-transformed into strain PN0. After recovery, the cells were plated on YPD plates containing 100 μg / mL Zeocin resistance. After 3-4 days, 16 single strains were picked for yeast lysis and PCR verification, and strain PN6 (GS115-Cpf1-RAD51) overexpressing the RAD51 gene was obtained.

[0054] Example 4: Construction of the multi-factor modified strain PN26 (GS115-Cpf1-Δchr3-0308-MRE11-RAD57) 4.1 Knockout of the chr3-0308 gene Following the method in Example 2, starting with PN0, the chr3-0308 gene was knocked out to obtain strain GS115-Cpf1-Δchr3-0308.

[0055] 4.2 Overexpression of the MRE11 gene Following the method in Example 3, using GS115-Cpf1-Δchr3-0308 as the starting strain, the MRE11 gene was constructed into the PNSⅠ-2 site to obtain the strain GS115-Cpf1-Δchr3-0308-MRE11.

[0056] 4.3 Overexpression of the RAD57 gene Referring to the method in Example 3, using GS115-Cpf1-Δchr3-0308-MRE11 as the starting strain, the RAD57 gene was constructed into the PNSⅡ-5 site to obtain the multifactorial modified strain PN26 (GS115-Cpf1-Δchr3-0308-MRE11-RAD57).

[0057] Table 1 shows the integration sites of exogenous genes in the examples.

[0058] Table 2. Integration site homologous arm amplification primers involved in the examples.

[0059] Example 5 Construction of other strains Following the methods described in Examples 1-4, thirty strains of bacteria, PN0 to PN29, were constructed. The specific knocked-out or overexpressed genes can be found in the genotypes listed in Table 3. Specifically, the NCBI gene IDs for the ku70 gene are XP_002492546.1, ku80 gene, Dnl4 gene, and chr3-0308 gene are XP_002492527.1. The NCBI gene IDs for the RAD50 gene are XP_002490645.1, RAD51 gene is XP_002493142.1, RAD52 gene is XP_002491040.1, RAD57 gene is XP_002489361.1, SAE2 gene is AOA68218.1, and MRE11 gene is XP_002493082.1.

[0060]

[0061] Example 6: Verification of ADE2 gene knockout efficiency 6.1 Experimental Methods To evaluate the homologous recombination efficiency of Pichia pastoris strains after single-factor, two-factor, and multi-factor modifications, the ADE2 gene encoding phosphoribosylaminoimidazolium carboxylase was selected as the target gene. Deletion of the ADE2 gene resulted in the formation of pink transformants (…). Figure 2 The efficiency of CRISPR-Cpf1-based genome editing can be evaluated by the color change of transformants. Using PN0 strain as a negative control and the engineered strain as a positive control, gRNA of the targeted Pichia pastoris endogenous gene ADE2 (NCBI database accession number XM_002492251.1) and the donor fragment were transformed into each strain. pPICZ-pSER-ΔADE2-CrRNA1-SUP4TT was the gRNA plasmid targeting the ADE2 gene (sgRNA: ACCTGCTAAGCACATTAATGCTG). Using the Pichia pastoris GS115 genome as a template, the upstream homologous arm ADE2-UP and the downstream homologous arm ADE2-DOWN of the ADE2 gene coding sequence were amplified using primer pairs ADE2-UP-S / ADE2-DA and ADE2-DS / ADE2-DA, respectively. The donor fragment was obtained by overlapping PCR of these two fragments. The amount of plasmid and donor fragment added was 5000 ng and 2000 ng, respectively.

[0062] 6.2 Experimental Results 6.2.1 Single-factor knockout or overexpression like Figure 3 As shown, except for strains PN5 and PN9, the transformation efficiency of other modified strains was improved to some extent; and except for strains PN1, PN2, and PN9, the number of transformants (CFU) of other modified strains was also improved to some extent. In particular, strains PN3, PN4, PN8, and PN10 showed homologous recombination efficiency increases of more than twofold, and the number of CFUs increases of more than sixfold. Among them, strain PN4 had the highest homologous recombination efficiency at 42.23%. This indicates that these single knockout or single overexpression strains have high homologous recombination efficiency and can be used for the construction of efficient gene editing chassis strains.

[0063] 6.2.2 Two-factor knockout or overexpression like Figure 4As shown, except for strains PN14 and PN15, the homologous recombination efficiency of other modified strains was improved to some extent; the number of transformants (CFU) of all modified strains was also improved to some extent. In particular, the homologous recombination efficiency of strains PN11, PN19, and PN22 could reach more than two times, with the highest CFU increase reaching 10 times. Among them, strain P11 had the highest homologous recombination efficiency at 21.875%, while strain PN22 had a CFU as high as 1100. This indicates that these modified strains have high homologous recombination efficiency and can promote strain growth, and can be used for the construction of high-efficiency gene editing chassis strains.

[0064] 6.2.3 Verification of the efficiency of multi-factor combination like Figure 5 As shown, except for strains PN27 and PN29, the transformation efficiency of other modified strains was improved to some extent; only the number of transformants (CFU) of modified strain PN26 was improved to some extent. Figure 6 Among them, the modified strain PN26 showed a significant advantage over the control strain PN0 in both homologous recombination efficiency and CFU. Therefore, strains that overexpress HR-related genes or knock out NHEJ-related genes in Pichia pastoris have broader application prospects in further metabolic engineering and can become key strains for subsequent research.

[0065] Example 7: BIR1 gene integration efficiency verification experiment 7.1 Experimental Methods To further investigate the transformation efficiency of the modified strains, the neutral site P3NS12 was selected for overexpression of the endogenous gene BIR1 in Pichia pastoris. This site is a CRISPR / Cpf1-based integration site with high integration efficiency. The BIR1 gene is the riboflavin synthesis gene in Pichia pastoris; overexpression causes transformants to turn yellow, facilitating subsequent gene editing efficiency statistics. PN0 from Example 1 was used as a negative control, while the modified engineered strains PN4, PN10, PN22, and PN26 were used as positive controls.

[0066] Using the Pichia pastoris GS115 genome as a template, the BIR1 gene fragment, the upstream homologous arm P3NS12-UP and the downstream homologous arm P3NS12-DOWN of the P3NS12 site were amplified using primer pairs.

[0067] Using plasmid pPICZA-PGAP-RAD52-Cre-loxp as a template, the promoter P was amplified using primer pairs. GAPThe AOXTT terminator fragment and the above two fragments were combined with the BIR1 gene fragment by three-fragment overlap PCR to obtain the BIR1 expression cassette. Subsequently, the expression cassette was combined with the P3NS12-UP and P3NS12-DOWN fragments by overlap PCR to obtain the BIR1-Donor fragment.

[0068] The gRNA plasmid targeting the P3NS12 site and the BIR1 donor fragment were transformed into the above five modified strains. The amount of gRNA plasmid and donor fragment added was 5000 ng and 2000 ng, respectively. pPICZ-pSER-P3NS12-CrRNA1-SUP4TT is a gRNA plasmid targeting the P3NS12 site.

[0069] 7.2 Experimental Results like Figure 5 As shown, all combinations significantly improved the integration efficiency of the BIR1 gene into the P3NS12 site, i.e., homologous recombination efficiency; among them, strains PN4 and PN26 also showed a certain degree of increase in CFU count compared to the control. Strain PN26 had the highest homologous recombination efficiency, reaching 86.45%, with a transformant CFU count of 413. This indicates that knocking out the chr3-0308 gene, overexpressing the MRE11 gene, and the RAD57 gene have a significant promoting effect on improving the homologous recombination efficiency of Pichia pastoris. Therefore, this strain with high homologous recombination capacity can provide a more convenient Pichia pastoris chassis cell for subsequent research.

[0070] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A high homologous recombination efficiency Pichia pastoris engineering bacteria, characterized in that: is the Cpf1 gene into Pichia pastoris, then knock out chr3-0308 gene, and then overexpress MRE11 gene and RAD57 gene.

2. The high homologous recombination efficiency Pichia pastoris engineering bacteria according to claim 1, characterized in that: The high homologous recombination efficiency Pichia pastoris engineering bacteria has higher integration efficiency when knocking out genes or introducing exogenous gene integration as a starting strain, and does not affect the growth effect.

3. A method for constructing a high homologous recombination efficiency Pichia pastoris engineering strain, characterized in that Comprise the following steps: (1) linearize the plasmid containing Cpf1 gene and transfer it into Pichia pastoris, and obtain engineering bacteria A after screening; (2) knock out the chr3-0308 gene in engineering bacteria A, and obtain engineering bacteria B after screening; (3) transfer MRE11 gene into engineering bacteria B PNSⅠ-2 site for overexpression, and obtain engineering bacteria C after screening; (4) transfer RAD57 gene into engineering bacteria C PNSⅡ-5 site for overexpression, and obtain high homologous recombination efficiency Pichia pastoris engineering bacteria after screening.

4. The construction method of high homologous recombination efficiency Pichia pastoris engineering bacteria according to claim 3, characterized in that: The plasmid containing Cpf1 gene in step (1) is pHKA-P GAP -Cpf1-DASTT plasmid; The pHKA-P GAP The Cpf1-DASTT plasmid is a pHKA plasmid carrying a Cpf1 gene expression cassette, wherein the Cpf1 gene expression cassette is composed of a promoter P GAP , a Cpf1 gene, and a terminator DASTT.

5. The construction method of high homologous recombination efficiency Pichia pastoris engineering bacteria according to claim 3, characterized in that: The NCBI database accession number of the chr3-0308 gene in step (2) is XP_002492527.1; The knock-out in step (2) is to transfer the donor fragment including the upstream homologous arm of chr3-0308 gene, Cre-loxp expression cassette and the downstream homologous arm of chr3-0308 gene into engineering bacteria to knock out the target gene through homologous recombination.

6. The construction method of high homologous recombination efficiency Pichia pastoris engineering bacteria according to claim 3, characterized in that: The NCBI database accession number of the MRE11 gene in step (3) is XP_002493082.1; The overexpression in step (3) is to transfer the donor fragment including the upstream homologous arm of PNSⅠ-2 site, MRE11 gene expression cassette and the downstream homologous arm of PNSⅠ-2 site into engineering bacteria together with Cas9 operation vector to integrate the gene into genome; The MRE11 gene expression cassette includes the promoter P GAP MRE11 gene, terminator AOXTT; The nucleotide sequence of PNSⅠ-2 site in step (3) is shown in SEQ ID NO.

1.

7. The construction method of high homologous recombination efficiency Pichia pastoris engineering bacteria according to claim 3, characterized in that: The NCBI database accession number of the RAD57 gene in step (4) is XP_002489361.1; The overexpression in step (4) is to transfer the donor fragment including the upstream homologous arm of PNSⅡ-5 site, RAD57 gene expression cassette and the downstream homologous arm of PNSⅡ-5 site into engineering bacteria together with Cas9 operation vector to integrate the gene into genome; The RAD57 gene expression cassette includes a promoter P GAP , a RAD57 gene, a terminator AOXTT The nucleotide sequence of PNSⅡ-5 site in step (4) is shown in SEQ ID NO.

2.

8. The use of high homologous recombination efficiency Pichia pastoris engineering bacteria according to any one of claims 1-2 in preparing high-efficiency exogenous gene expression engineering bacteria.

9. Use of the Pichia pastoris engineering bacteria with high homologous recombination efficiency according to any one of claims 1-2 in the preparation of engineering bacteria with high efficiency of knocking out endogenous genes.

10. An engineered bacterium with high expression of BIR1 gene, characterized in that The Pichia pastoris engineering bacteria with high homologous recombination efficiency is constructed by the following steps: After the donor fragment obtained by sequentially connecting the upstream homologous arm of the P3NS12 site, the BIR1 gene expression cassette, and the downstream homologous arm of the P3NS12 site is transformed into the Pichia pastoris engineering bacteria with high homologous recombination efficiency according to any one of claims 1-2 together with the Cpf1 operation vector, and positive clones are screened, the engineering bacteria with high expression of the BIR1 gene are obtained; The nucleotide sequence of the P3NS12 site is shown as SEQ ID NO.

3. The BIR1 gene expression cassette includes a promoter P GAP , a BIR1 gene, a terminator AOXTT. The NCBI database accession number of the BIR1 gene is XM_002491621.

1. The Cpf1 operation vector is pPICZ-P3NS12-pSER-CrRNA1-SUP4TT.

Images