Anti-her2 nanobody, and preparation method therefor and use thereof

Abstract

Provided are an anti-HER2 nanobody, and a preparation method therefor and a use thereof. Also provided are a corresponding anti-HER2 antibody, chimeric antigen receptor, fusion protein, and recombinant protein, an encoding nucleic acid therefor, an expression vector, and a host cell. The anti-HER2 nanobody has high affinity and a simple structure, is easy to prepare, binds to trastuzumab and pertuzumab at different epitopes, and has a wide prospect for application in the fields of tumor treatment, immunodetection and the like.

Description

An anti-HER2 nanoantibody and its preparation method and application Technical Field

[0001] The present invention relates to the field of biomedicine or biopharmaceutical technology, and more specifically to an anti-HER2 nanoantibody and a preparation method and application thereof. Background Art

[0002] Human epidermal growth factor receptor 2 (HER2, ERBB2) is a tyrosine kinase receptor membrane glycoprotein encoded by the ErbB gene and a member of the epidermal growth factor receptor family. Abnormal HER2 expression can predispose normal cells and tissues to cancerous transformation, leading to tumor formation. HER2 oncogene amplification or protein overexpression has been found in a variety of human tumors, including breast, gastric, colon, ovarian, lung, and prostate cancers.

[0003] HER2 consists of three domains: an extracellular ligand-binding domain (ECD), a short transmembrane region, and an intracellular tyrosine kinase domain. Its ECD consists of 630 amino acids and comprises four domains (Domains I–IV). When antibodies bind to different HER2 domains, their mechanisms of action and biological functions vary, offering new avenues for developing HER2 targets. For example, the classic HER2 targets, trastuzumab and pertuzumab, bind to different domains. Trastuzumab binds to the extracellular, proximal membrane ECD4 of HER2, inhibiting HER2 signaling. Pertuzumab binds to HER2 ECD2, preventing homo- and heterodimerization with HER2 and HER3. This has become a successful treatment for tumors, significantly improving patient survival rates and durations. However, antibody therapy still faces limitations in its use and toxic side effects, and HER2 remains a very important target for tumor therapy.

[0004] Compared to traditional monoclonal antibodies, nanoantibodies have smaller molecular weight, stronger penetration, higher sensitivity, stronger specificity, and better stability. Once they enter the body, they can efficiently penetrate cells to quickly capture antigens for therapeutic purposes. In terms of disease diagnosis, although monoclonal antibodies are also used in the field of tumor imaging, their weak tumor penetration ability and long serum half-life make it difficult to form high-contrast images when imaging tumors, thus limiting their use to a certain extent. Nanoantibodies have the advantages of easy penetration and rapid renal clearance. They can be labeled with molecules such as fluorescent probes, enzyme tracers, and biotin as tracers. When combined with molecular imaging technology, the imaging system can be optimized, making them an ideal choice for in vitro and in vivo imaging.

[0005] Therefore, there is an urgent need in the art to develop various types of drugs based on nanobodies that specifically target HER2.

[0006] Summary of the Invention

[0007] The purpose of the present invention is to provide an anti-HER2 nanobody and its preparation method and application.

[0008] Another object of the present invention is to provide antibodies, chimeric antigen receptors, fusion proteins, recombinant proteins and their encoding nucleic acids, expression vectors, host cells, immunoconjugates, etc. based on anti-HER2 nanobodies, and to provide pharmaceutical compositions comprising the above active ingredients.

[0009] Another object of the present invention is to provide a method for preventing and / or treating HER2-overexpressing diseases, as well as a method for diagnosing HER2-overexpressing diseases.

[0010] In the first aspect of the present invention, an anti-HER2 nanobody is provided, wherein the anti-HER2 nanobody has one or more complementary determining regions (CDRs) selected from the following group:

[0011] (1) CDR1 shown in SEQ ID NO: 27, CDR2 shown in SEQ ID NO: 28, and CDR3 shown in SEQ ID NO: 29;

[0012] (2) CDR1 shown in SEQ ID NO: 34, CDR2 shown in SEQ ID NO: 35, and CDR3 shown in SEQ ID NO: 36;

[0013] (3) CDR1 shown in SEQ ID NO:40, CDR2 shown in SEQ ID NO:41, and CDR3 shown in SEQ ID NO:42;

[0014] (4) CDR1 shown in SEQ ID NO:46, CDR2 shown in SEQ ID NO:47, and CDR3 shown in SEQ ID NO:48;

[0015] (5) CDR1 shown in SEQ ID NO: 52, CDR2 shown in SEQ ID NO: 53, and CDR3 shown in SEQ ID NO: 54;

[0016] (6) CDR1 shown in SEQ ID NO: 57, CDR2 shown in SEQ ID NO: 58, and CDR3 shown in SEQ ID NO: 59;

[0017] (7) CDR1 shown in SEQ ID NO: 63, CDR2 shown in SEQ ID NO: 64, and CDR3 shown in SEQ ID NO: 65;

[0018] (8) CDR1 shown in SEQ ID NO: 69, CDR2 shown in SEQ ID NO: 70, and CDR3 shown in SEQ ID NO: 71;

[0019] (9) CDR1 shown in SEQ ID NO: 74, CDR2 shown in SEQ ID NO: 75, and CDR3 shown in SEQ ID NO: 76;

[0020] (10) CDR1 shown in SEQ ID NO: 27, CDR2 shown in SEQ ID NO: 28, and CDR3 shown in SEQ ID NO: 80;

[0021] (11) CDR1 shown in SEQ ID NO: 83, CDR2 shown in SEQ ID NO: 84, and CDR3 shown in SEQ ID NO: 85;

[0022] (12) CDR1 shown in SEQ ID NO: 57, CDR2 shown in SEQ ID NO: 58, and CDR3 shown in SEQ ID NO: 89;

[0023] (13) CDR1 shown in SEQ ID NO:91, CDR2 shown in SEQ ID NO:92, and CDR3 shown in SEQ ID NO:93;

[0024] (14) CDR1 shown in SEQ ID NO:97, CDR2 shown in SEQ ID NO:98, and CDR3 shown in SEQ ID NO:99.

[0025] In another preferred embodiment, any one of the above amino acid sequences further includes a derivative sequence that is optionally added, deleted, modified and / or substituted with at least one (such as 1-3, preferably 1-2, more preferably 1) amino acid and can retain the ability to specifically bind to HER2.

[0026] In another preferred embodiment, the derivative sequence that has been subjected to addition, deletion, modification and / or substitution of at least one amino acid and can retain the ability to specifically bind to HER2 is an amino acid sequence with a homology or sequence identity of at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%.

[0027] In another preferred embodiment, the CDR1, CDR2 and CDR3 are separated in sequence by the framework regions FR1, FR2, FR3 and FR4 of the VHH chain respectively.

[0028] In another preferred embodiment, the anti-HER2 nanobody has a structure shown in formula (I):

[0029] FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4 formula (I)

[0030] Wherein, the "-"s are each independently a connecting peptide or a peptide bond.

[0031] In another preferred embodiment, there is an inter-loop disulfide bond between the CDR1 region and the CDR3 region of the anti-HER2 nanobody.

[0032] In another preferred embodiment, the anti-HER2 nanobody further includes a framework region FR.

[0033] In another preferred embodiment, the framework region FR is one or more selected from the following groups:

[0034] (1) FR1 shown in SEQ ID NO: 30, FR2 shown in SEQ ID NO: 31, FR3 shown in SEQ ID NO: 32, and FR4 shown in SEQ ID NO: 33;

[0035] (2) FR1 shown in SEQ ID NO: 37, FR2 shown in SEQ ID NO: 38, FR3 shown in SEQ ID NO: 39, and FR4 shown in SEQ ID NO: 33;

[0036] (3) FR1 shown in SEQ ID NO:43, FR2 shown in SEQ ID NO:44, FR3 shown in SEQ ID NO:45, and FR4 shown in SEQ ID NO:33;

[0037] (4) FR1 shown in SEQ ID NO:37, FR2 shown in SEQ ID NO:49, FR3 shown in SEQ ID NO:50, and FR4 shown in SEQ ID NO:33;

[0038] (5) FR1 shown in SEQ ID NO: 51, FR2 shown in SEQ ID NO: 31, FR3 shown in SEQ ID NO: 32, and FR4 shown in SEQ ID NO: 33;

[0039] (6) FR1 shown in SEQ ID NO:37, FR2 shown in SEQ ID NO:55, FR3 shown in SEQ ID NO:56, and FR4 shown in SEQ ID NO:33;

[0040] (7) FR1 shown in SEQ ID NO:60, FR2 shown in SEQ ID NO:61, FR3 shown in SEQ ID NO:62, and FR4 shown in SEQ ID NO:33;

[0041] (8) FR1 shown in SEQ ID NO: 66, FR2 shown in SEQ ID NO: 67, FR3 shown in SEQ ID NO: 68, and FR4 shown in SEQ ID NO: 33;

[0042] (9) FR1 shown in SEQ ID NO: 37, FR2 shown in SEQ ID NO: 72, FR3 shown in SEQ ID NO: 73, and FR4 shown in SEQ ID NO: 33;

[0043] (10) FR1 shown in SEQ ID NO: 77, FR2 shown in SEQ ID NO: 78, FR3 shown in SEQ ID NO: 79, and FR4 shown in SEQ ID NO: 33;

[0044] (11) FR1 shown in SEQ ID NO:30, FR2 shown in SEQ ID NO:81, FR3 shown in SEQ ID NO:82, and FR4 shown in SEQ ID NO:33;

[0045] (12) FR1 shown in SEQ ID NO: 86, FR2 shown in SEQ ID NO: 87, FR3 shown in SEQ ID NO: 88, and FR4 shown in SEQ ID NO: 33;

[0046] (13) FR1 shown in SEQ ID NO:30, FR2 shown in SEQ ID NO:61, FR3 shown in SEQ ID NO:90, and FR4 shown in SEQ ID NO:33;

[0047] (14) FR1 shown in SEQ ID NO:94, FR2 shown in SEQ ID NO:95, FR3 shown in SEQ ID NO:96, and FR4 shown in SEQ ID NO:33;

[0048] (15) FR1 shown in SEQ ID NO: 100, FR2 shown in SEQ ID NO: 101, FR3 shown in SEQ ID NO: 102, and FR4 shown in SEQ ID NO: 33.

[0049] In another preferred example, the amino acid sequence of the VHH chain of the anti-HER2 nanobody is selected from one or more of SEQ ID NOs: 6-20.

[0050] In another preferred embodiment, the anti-HER2 nanobody includes humanized antibodies, camel-derived antibodies, and chimeric antibodies.

[0051] In the second aspect of the present invention, an anti-HER2 antibody is provided, which comprises one or more VHH chains of the anti-HER2 nanobody as described in the first aspect of the present invention.

[0052] In another preferred example, the amino acid sequence of the VHH chain of the anti-HER2 nanobody is selected from one or more of SEQ ID NOs: 6-20.

[0053] In another preferred embodiment, the anti-HER2 antibody may be a monomer, a bivalent antibody, and / or a multivalent antibody.

[0054] In another preferred embodiment, the anti-HER2 antibody is a bivalent antibody.

[0055] In the third aspect of the present invention, a chimeric antigen receptor (CAR) is provided, wherein the CAR contains an extracellular domain, and the extracellular domain comprises the anti-HER2 nanobody as described in the first aspect of the present invention, or the anti-HER2 antibody as described in the second aspect of the present invention.

[0056] In another preferred embodiment, the extracellular domain further includes a signal peptide.

[0057] In another preferred embodiment, the extracellular domain also includes other exogenous proteins.

[0058] In another preferred embodiment, the CAR has the structure shown in Formula Ia: L-Nb-H-TM-C-CD3ζ (Ia)

[0059] Where,

[0060] L is none or a signal peptide sequence;

[0061] Nb is the specific binding domain;

[0062] H is none or hinge region;

[0063] TM is the transmembrane domain;

[0064] C is the costimulatory signaling domain;

[0065] CD3ζ is a cytoplasmic signaling sequence derived from CD3ζ (including wild type, or mutants / modified forms thereof);

[0066] The "-" is a connecting peptide or peptide bond.

[0067] In another preferred embodiment, the L is selected from the signal peptides of the following histones: CD8, GM-CSF, CD4, CD28, CD137, or mutants / modified forms thereof, or a combination thereof.

[0068] In another preferred embodiment, the Nb targets HER2.

[0069] In another preferred embodiment, the Nb is an anti-HER2 nanobody.

[0070] In another preferred embodiment, the H is selected from the hinge region of the following histones: CD8, CD28, CD137, IgG, or a combination thereof.

[0071] In another preferred embodiment, the H is a human IgG1 Fc hinge region.

[0072] In another preferred embodiment, the TM is selected from the transmembrane region of the following histones: CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, CD278, CD152, CD279, CD233, or mutants / modified forms thereof, or combinations thereof.

[0073] In another preferred embodiment, the C is selected from the costimulatory domains of the following histones: OX40, CD2, CD7, CD27, CD28, CD30, CD40, CD70, CD134, 4-1BB (CD137), PD-1, Dap10, LIGHT, NKG2C, B7-H3, ICAM-1, LFA-1 (CD11a / CD18), ICOS (CD278), NKG2D, GITR, OX40L, 2B4, TLR, or mutants / modified forms thereof, or combinations thereof.

[0074] In another preferred embodiment, the CAR includes the intracellular domain of a cytokine.

[0075] In another preferred embodiment, the cytokine includes: interleukin (IL), interferon (IFN), tumor necrosis factor (TNF), colony stimulating factor (CSF), growth factor, chemokine, or a combination thereof; preferably, the cytokine is interleukin.

[0076] In another preferred embodiment, the CAR includes the intracellular domain of interleukin.

[0077] In another preferred embodiment, the interleukin is selected from the following group: IL-12, IL-2, IL-15, IL-21, or a combination thereof; preferably IL-12.

[0078] In a fourth aspect of the present invention, a fusion protein is provided, wherein the fusion protein has:

[0079] (Z1) a first protein, comprising: the anti-HER2 nanobody as described in the first aspect of the invention, the anti-HER2 antibody as described in the second aspect of the invention, or an active fragment thereof;

[0080] (Z2) a second protein comprising a cytokine; and

[0081] (Z3) Optional linker between the first protein and the second protein.

[0082] In another preferred embodiment, the cytokines include: interleukin (IL), interferon (IFN), tumor necrosis factor (TNF), colony stimulating factor (CSF), growth factor, chemokine, or a combination thereof.

[0083] In another preferred embodiment, the second protein is interleukin.

[0084] In another preferred embodiment, the first protein is the anti-HER2 nanobody as described in the first aspect of the present invention, and the second protein is interleukin.

[0085] In another preferred embodiment, the interleukin is selected from the group consisting of IL-12, IL-2, IL-15, IL-21, or a combination thereof.

[0086] In another preferred embodiment, the interleukin is IL-12.

[0087] In a fifth aspect of the present invention, a recombinant protein is provided, wherein the recombinant protein has:

[0088] (i) the anti-HER2 Nanobody as described in the first aspect of the invention, the anti-HER2 antibody as described in the second aspect of the invention, the fusion protein as described in the fourth aspect of the invention, or an active fragment thereof; and

[0089] (ii) optionally a tag sequence to facilitate expression and / or purification.

[0090] In another preferred embodiment, the tag includes an Fc tag, an HA tag, a GGGS sequence, a FLAG tag, a Myc tag, a 6His tag, or a combination thereof.

[0091] In another preferred embodiment, the recombinant protein specifically binds to HER2.

[0092] In another preferred embodiment, the recombinant protein is a monomer, a dimer, or a multimer.

[0093] In another preferred embodiment, the tag is an Fc tag.

[0094] In the sixth aspect of the present invention, a polynucleotide is provided, which encodes a protein selected from the following group: the anti-HER2 nanobody as described in the first aspect of the present invention, the anti-HER2 antibody as described in the second aspect of the present invention, the chimeric antigen receptor as described in the third aspect of the present invention, the fusion protein as described in the fourth aspect of the present invention, the recombinant protein as described in the fifth aspect of the present invention, or a combination thereof.

[0095] In another preferred embodiment, the polynucleotide is RNA, DNA or cDNA.

[0096] In the seventh aspect of the present invention, an expression vector is provided, wherein the expression vector contains the polynucleotide according to the sixth aspect of the present invention.

[0097] In another preferred embodiment, the expression vector is selected from the group consisting of DNA, RNA, viral vectors, plasmids, transposons, other gene transfer systems, or combinations thereof. Preferably, the expression vector comprises a viral vector, such as a lentivirus, adenovirus, AAV virus, retrovirus, or combinations thereof.

[0098] In another preferred embodiment, the expression vector is selected from the following group: pTomo lentiviral vector, plenti, pLVTH, pLJM1, pHCMV, pLBS.CAG, pHR, pLV, etc.

[0099] In another preferred embodiment, the expression vector is a pcDNA3.1 vector, a pMES4 vector, or a pABG1 vector (including a pABG1-Fc vector).

[0100] In another preferred embodiment, the expression vector further comprises a member selected from the group consisting of: a promoter, a transcription enhancer element WPRE, a long terminal repeat sequence LTR, and the like.

[0101] In the eighth aspect of the present invention, a host cell is provided, wherein the host cell contains the expression vector according to the seventh aspect of the present invention, or the polynucleotide according to the sixth aspect of the present invention is integrated into its genome.

[0102] In another preferred embodiment, the host cell includes a prokaryotic cell or a eukaryotic cell.

[0103] In another preferred embodiment, the host cell is selected from the group consisting of Escherichia coli, yeast cells, and mammalian cells.

[0104] In the ninth aspect of the present invention, an engineered immune cell is provided, wherein the engineered immune cell contains the expression vector as described in the seventh aspect of the present invention or an exogenous polynucleotide as described in the sixth aspect of the present invention is integrated into its genome, or expresses the chimeric antigen receptor as described in the third aspect of the present invention.

[0105] In another preferred embodiment, the engineered immune cells are selected from the following group:

[0106] (i) Chimeric antigen receptor αβ T cells (CAR-T cells);

[0107] (ii) chimeric antigen receptor γδ T cells (CAR-T cells);

[0108] (iii) chimeric antigen receptor NKT cells (CAR-NKT cells);

[0109] (iv) Chimeric antigen receptor NK cells (CAR-NK cells).

[0110] In another preferred embodiment, the engineered immune cells include autologous or allogeneic αβT cells, γδT cells, NKT cells, NK cells, or a combination thereof.

[0111] In another preferred embodiment, the engineered immune cells are CAR-T cells.

[0112] In a tenth aspect of the present invention, a method for producing an anti-HER2 nanobody is provided, the method comprising the steps of:

[0113] (a) culturing the host cell as described in the eighth aspect of the invention under conditions suitable for the production of nanobodies, thereby obtaining a culture containing anti-HER2 nanobodies;

[0114] (b) separating and / or recovering said anti-HER2 Nanobody from said culture; and

[0115] (c) Optionally, purifying and / or modifying the anti-HER2 Nanobody obtained in step (b).

[0116] In the eleventh aspect of the present invention, an immunoconjugate is provided, comprising:

[0117] (a) the anti-HER2 Nanobody as described in the first aspect of the invention, the anti-HER2 antibody as described in the second aspect of the invention, the fusion protein as described in the fourth aspect of the invention, or the recombinant protein as described in the fifth aspect of the invention; and

[0118] (b) a conjugated moiety selected from the group consisting of a detectable label, a drug, a cytokine, a radionuclide, an enzyme, a gold nanoparticle / nanorod, a nanomagnetic particle, a viral coat protein or a VLP, or a combination thereof.

[0119] In another preferred embodiment, the part (a) is the anti-HER2 nanobody as described in the first aspect of the present invention, or the anti-HER2 antibody as described in the second aspect of the present invention.

[0120] In another preferred embodiment, the (a) part and the coupling part are coupled via a chemical bond or a linker.

[0121] In another preferred embodiment, the radioactive nuclides include:

[0122] (i) a diagnostic isotope selected from the group consisting of Tc-99m, Ga-68, F-18, I-123, I-125, I-131, In-111, Ga-67, Cu-64, Zr-89, C-11, Lu-177, Re-188, or a combination thereof; and / or

[0123] (ii) therapeutic isotopes, wherein the therapeutic isotopes are selected from the group consisting of Lu-177, Y-90, Ac-225, As-211, Bi-212, Bi-213, Cs-137, Cr-51, Co-60, Dy-165, Er-169, Fm-255, Au-198, Ho-166, I-125, I-131, Ir-192, Fe-59, Pb-212, Mo-99, Pd-103, P-32, K-42, Re-186, Re-188, Sm-153, Ra223, Ru-106, Na24, Sr89, Tb-149, Th-227, Xe-133, Yb-169, Yb-177, or a combination thereof.

[0124] In another preferred embodiment, the coupling moiety is a drug or a toxin.

[0125] In another preferred embodiment, the drug is a drug for the targeted treatment of diseases with high HER2 expression.

[0126] In another preferred embodiment, the HER2-high expression disease is selected from the group consisting of breast cancer, gastric cancer, colorectal cancer, ovarian cancer, lung cancer, prostate cancer, liver cancer, kidney tumor, small intestine cancer, large intestine cancer, bile duct cancer, cervical cancer, lymphoma, esophageal cancer, or a combination thereof.

[0127] In another preferred embodiment, the drug is a cytotoxic drug.

[0128] In another preferred embodiment, the cytotoxic drug is selected from the group consisting of anti-tubulin drugs, DNA minor groove binding agents, DNA replication inhibitors, alkylating agents, antibiotics, folic acid antagonists, antimetabolites, chemosensitizers, topoisomerase inhibitors, vinca alkaloids, or a combination thereof.

[0129] Examples of particularly useful cytotoxic drugs include, for example, DNA minor groove binding agents, DNA alkylating agents, and tubulin inhibitors. Typical cytotoxic drugs include, for example, auristatins, camptothecins, duocarmycins, etoposide, maytansines and maytansinoids (e.g., DM1 and DM4), taxanes, benzodiazepines or benzodiazepine-containing drugs (e.g., pyrrolo[1,4]benzodiazepines (PBDs), indolinobenzodiazepines, and oxazolidinobenzodiazepines), vinca alkaloids, or combinations thereof.

[0130] In another preferred embodiment, the toxin is selected from the group consisting of auristatins (e.g., auristatin E, auristatin F, MMAE and MMAF), chlortetracycline, maytansin, ricin, ricin A-chain, combretastatin, duocarmycin, dolastatin, adriamycin, daunorubicin, paclitaxel, cisplatin, cc1065, ethidium bromide, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, dihydroxybenzoate, daptomycin, acetaminophen, chlortetracycline, chloramphenicol, chloramphenicol, daptomycin, chlortetracycline, chloramphenicol, daptomycin, chlortetracycline, chloramphenicol, chlortetracycline ... anthracnose dione, actinomycin, diphtheria toxin, Pseudomonas exotoxin (PE) A, PE40, abrin, abrin A chain, modeccin A chain, alpha-sarcin, gelonin, Mitogellin, Retstrictocin, phenomycin, enomycin, curcin, crotin, calicheamicin, a Sapaonaria officinalis inhibitor, a glucocorticoid, or a combination thereof.

[0131] In another preferred embodiment, the coupling moiety is a detectable label.

[0132] In another preferred embodiment, the coupling portion is selected from the following group: fluorescent or luminescent markers, radioactive markers, MRI (magnetic resonance imaging) or CT (computer tomography) contrast agents, or enzymes capable of producing detectable products, radionuclides, biotoxins, cytokines (such as IL-2, etc.), antibodies, antibody Fc fragments, antibody scFv fragments, gold nanoparticles / nanorods, viral particles, liposomes, nanomagnetic particles, prodrug-activating enzymes (for example, DT-diaphorase (DTD) or biphenyl hydrolase-like protein (BPHL)) or any form of nanoparticles.

[0133] In another preferred embodiment, the immunoconjugate contains: a multivalent (such as bivalent) VHH chain of the anti-HER2 nanobody as described in the first aspect of the present invention.

[0134] In another preferred embodiment, the multivalency refers to the inclusion of multiple repeated identical or different VHH chains of the anti-HER2 nanoantibody as described in the first aspect of the present invention in the amino acid sequence of the immunoconjugate.

[0135] In the twelfth aspect of the present invention, there is provided a use of an active ingredient, wherein the active ingredient is selected from the group consisting of the anti-HER2 nanobody according to the first aspect of the present invention, the anti-HER2 antibody according to the second aspect of the present invention, the chimeric antigen receptor according to the third aspect of the present invention, the fusion protein according to the fourth aspect of the present invention, the recombinant protein according to the fifth aspect of the present invention, the host cell according to the eighth aspect of the present invention, the engineered immune cell according to the ninth aspect of the present invention, the immunoconjugate according to the eleventh aspect of the present invention, or a combination thereof, wherein the active ingredient is used to prepare:

[0136] (a) Drugs for preventing and / or treating diseases with high HER2 expression;

[0137] (b) Reagents for detecting HER2-overexpressing diseases.

[0138] In another preferred embodiment, the reagent is a diagnostic reagent, preferably, the diagnostic reagent is a detection sheet or a detection plate.

[0139] In another preferred embodiment, the diagnostic reagent is used to detect HER2 protein or a fragment thereof in a sample.

[0140] In another preferred embodiment, the HER2-high expression disease is selected from the group consisting of breast cancer, gastric cancer, colorectal cancer, ovarian cancer, lung cancer, prostate cancer, liver cancer, kidney tumor, small intestine cancer, large intestine cancer, bile duct cancer, cervical cancer, lymphoma, esophageal cancer, or a combination thereof.

[0141] In a thirteenth aspect of the present invention, a method for detecting HER2 protein or a fragment thereof in a sample in vitro is provided, the method comprising the steps of:

[0142] (1) in vitro, contacting the sample with the anti-HER2 nanobody as described in the first aspect of the present invention, the anti-HER2 antibody as described in the second aspect of the present invention, the chimeric antigen receptor as described in the third aspect of the present invention, the fusion protein as described in the fourth aspect of the present invention, the recombinant protein as described in the fifth aspect of the present invention, the host cell as described in the eighth aspect of the present invention, the engineered immune cell as described in the ninth aspect of the present invention, the immunoconjugate as described in the eleventh aspect of the present invention, or a combination thereof;

[0143] (2) Detecting whether an antigen-antibody complex is formed, wherein the formation of the complex indicates the presence of HER2 protein or a fragment thereof in the sample.

[0144] In another preferred embodiment, the detection includes diagnostic or non-diagnostic detection.

[0145] In a fourteenth aspect of the present invention, a pharmaceutical composition is provided, comprising:

[0146] (i) the anti-HER2 nanobody as described in the first aspect of the invention, the anti-HER2 antibody as described in the second aspect of the invention, the chimeric antigen receptor as described in the third aspect of the invention, the fusion protein as described in the fourth aspect of the invention, the recombinant protein as described in the fifth aspect of the invention, the host cell as described in the eighth aspect of the invention, the engineered immune cell as described in the ninth aspect of the invention, the immunoconjugate as described in the eleventh aspect of the invention, or a combination thereof as an active ingredient; and

[0147] (ii) a pharmaceutically acceptable carrier, diluent or excipient.

[0148] In another preferred embodiment, the dosage form of the pharmaceutical composition is selected from the following group: injection and lyophilized preparation.

[0149] In another preferred example, the pharmaceutical composition comprises 0.01 to 99.99% of the anti-HER2 nanobody as described in the first aspect of the present invention, the anti-HER2 antibody as described in the second aspect of the present invention, the chimeric antigen receptor as described in the third aspect of the present invention, the fusion protein as described in the fourth aspect of the present invention, the recombinant protein as described in the fifth aspect of the present invention, the host cell as described in the eighth aspect of the present invention, the engineered immune cell as described in the ninth aspect of the present invention, the immunoconjugate as described in the eleventh aspect of the present invention, or a combination thereof and 0.01 to 99.99% of a pharmaceutically acceptable carrier, and the percentage is the mass percentage of the pharmaceutical composition.

[0150] In another preferred embodiment, the concentration of the engineered immune cells in the active ingredient is 1×10 3 -1×10 8 cells / mL, preferably 1×104 -1×10 7 cells / mL.

[0151] A fifteenth aspect of the present invention provides a kit, comprising:

[0152] (1) a first container, comprising the anti-HER2 nanobody as described in the first aspect of the present invention, the anti-HER2 antibody as described in the second aspect of the present invention, the chimeric antigen receptor as described in the third aspect of the present invention, the fusion protein as described in the fourth aspect of the present invention, the recombinant protein as described in the fifth aspect of the present invention, the host cell as described in the eighth aspect of the present invention, the engineered immune cell as described in the ninth aspect of the present invention, the immunoconjugate as described in the eleventh aspect of the present invention, or a combination thereof; and / or

[0153] (2) a second container containing a secondary antibody against the contents of the first container;

[0154] or,

[0155] The kit contains a detection plate, which includes: a substrate (support plate) and a test strip, wherein the test strip contains the anti-HER2 nanoantibody as described in the first aspect of the present invention, the anti-HER2 antibody as described in the second aspect of the present invention, the fusion protein as described in the fourth aspect of the present invention, the recombinant protein as described in the fifth aspect of the present invention, the immunoconjugate as described in the eleventh aspect of the present invention, or a combination thereof.

[0156] In another preferred embodiment, the kit further comprises an instruction manual, according to which the kit is used for non-invasively detecting HER2 expression in a subject to be tested.

[0157] In another preferred embodiment, the kit is used for detecting diseases with high HER2 expression.

[0158] In another preferred embodiment, the HER2-high expression disease is selected from the group consisting of breast cancer, gastric cancer, colorectal cancer, ovarian cancer, lung cancer, prostate cancer, liver cancer, kidney tumor, small intestine cancer, large intestine cancer, bile duct cancer, cervical cancer, lymphoma, esophageal cancer, or a combination thereof.

[0159] In the sixteenth aspect of the present invention, a method for preventing and / or treating HER2-overexpressing diseases is provided, the method comprising: administering to a subject in need thereof the anti-HER2 nanoantibody as described in the first aspect of the present invention, the anti-HER2 antibody as described in the second aspect of the present invention, the chimeric antigen receptor as described in the third aspect of the present invention, the fusion protein as described in the fourth aspect of the present invention, the recombinant protein as described in the fifth aspect of the present invention, the host cell as described in the eighth aspect of the present invention, the engineered immune cell as described in the ninth aspect of the present invention, the immunoconjugate as described in the eleventh aspect of the present invention, the pharmaceutical composition as described in the fourteenth aspect of the present invention, or a combination thereof.

[0160] In another preferred embodiment, the subject includes mammals, such as humans.

[0161] In another preferred embodiment, the HER2-high expression disease is selected from the group consisting of breast cancer, gastric cancer, colorectal cancer, ovarian cancer, lung cancer, prostate cancer, liver cancer, kidney tumor, small intestine cancer, large intestine cancer, bile duct cancer, cervical cancer, lymphoma, esophageal cancer, or a combination thereof.

[0162] In another preferred embodiment, the engineered immune cells or CAR immune cells contained in the pharmaceutical composition are cells derived from the subject (autologous cells).

[0163] In another preferred embodiment, the engineered immune cells or CAR immune cells contained in the pharmaceutical composition are cells derived from healthy individuals (allogeneic cells).

[0164] In another preferred embodiment, the method can be used in combination with other treatment methods.

[0165] In another preferred embodiment, the other treatment methods include chemotherapy, radiotherapy, targeted therapy and the like.

[0166] In the seventeenth aspect of the present invention, a method for diagnosing a disease with high HER2 expression is provided, comprising the steps of:

[0167] (i) obtaining a sample from a diagnostic subject, and contacting the sample with the anti-HER2 Nanobody as described in the first aspect of the invention, the anti-HER2 antibody as described in the second aspect of the invention, the chimeric antigen receptor as described in the third aspect of the invention, the fusion protein as described in the fourth aspect of the invention, the recombinant protein as described in the fifth aspect of the invention, the host cell as described in the eighth aspect of the invention, the engineered immune cell as described in the ninth aspect of the invention, the immunoconjugate as described in the eleventh aspect of the invention, or a combination thereof; and

[0168] (ii) detecting whether an antigen-antibody complex is formed, wherein the formation of the complex indicates that the subject is a confirmed patient of a disease with high HER2 expression.

[0169] In another preferred embodiment, the sample is a blood sample or a throat swab sample, or a sample from other tissues and organs.

[0170] In another preferred embodiment, the HER2-high expression disease is selected from the group consisting of breast cancer, gastric cancer, colorectal cancer, ovarian cancer, lung cancer, prostate cancer, liver cancer, kidney tumor, small intestine cancer, large intestine cancer, bile duct cancer, cervical cancer, lymphoma, esophageal cancer, or a combination thereof.

[0171] In the eighteenth aspect of the present invention, a method for preparing a recombinant polypeptide is provided, wherein the recombinant polypeptide is the anti-HER2 nanobody as described in the first aspect of the present invention, the anti-HER2 antibody as described in the second aspect of the present invention, the chimeric antigen receptor as described in the third aspect of the present invention, the fusion protein as described in the fourth aspect of the present invention, the recombinant protein as described in the fifth aspect of the present invention, or a combination thereof, the method comprising:

[0172] (a) culturing the host cell according to the eighth aspect of the present invention under conditions suitable for expression; and

[0173] (b) isolating the recombinant polypeptide from the culture.

[0174] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0175] Figure 1 shows the identification of the purified antigen protein by SDS-PAGE gel electrophoresis. 1: Non-reducing SDS-PAGE of HER2 protein, 2: Reducing SDS-PAGE of HER2 protein, M: Protein molecular weight standard.

[0176] Figure 2 shows the identification of purified nanobodies by non-reduced SDS-PAGE gel electrophoresis. 1-11 (left): 11 nanobodies (HER2-1, HER2-2, HER2-3, HER2-4, HER2-5, HER2-8, HER2-10, HER2-11, HER2-16, HER2-32, and HER2-34), 12 (left): protein molecular weight standard; 1-4 (right): 4 nanobodies (HER2-37, HER2-38, HER2-40, and HER2-41), 5 (right): protein molecular weight standard.

[0177] Figure 3 shows the identification of the purified HER2-Fc recombinant antigen protein by SDS-PAGE gel electrophoresis. 7: Non-reducing SDS-PAGE of HER2-Fc protein, 6: Protein molecular weight standard.

[0178] Figures 4-5 show the identification of nanobody affinity, where Figure 4 involves HER2-1, HER2-2, HER2-3, HER2-4, HER2-5, HER2-8, HER2-10, and HER2-11; Figure 5 involves HER2-16, HER2-32, HER2-34, HER2-37, HER2-38, HER2-40, and HER2-41.

[0179] Figure 6 shows the fitting curve corresponding to the single-concentration affinity screening test of the Nanobody.

[0180] Figure 7 shows the comparative results of single-concentration affinity screening tests of Nanobodies using surface plasmon resonance (SPR) technology.

[0181] Figures 8 and 9 show the FACS detection of the binding activity of 15 HER2 nanobodies to HER2 expressed in SKBR3 cells (HER2 nanobody cell-level affinity identification). Figure 8 involves HER2-2, HER2-3, HER2-8, HER2-11 HER2-38, HER2-5, HER2-10, and HER2-41; Figure 9 involves HER2-1, HER2-4, HER2-16, HER2-32, HER2-34, HER2-37, and HER2-40.

[0182] Figure 10 shows the identification of purified humanized Nanobodies by non-reduced SDS-PAGE gel electrophoresis. 1: HER2-3-hFc; 2: HER2-8-hFc; 3: HER2-10-hFc; 4: HER2-11-hFc; 5: HER2-38-hFc; 6: protein molecular weight standard.

[0183] Figure 11 shows the identification of the purified antibody protein by SDS-PAGE gel electrophoresis: 1: non-reducing SDS-PAGE of trastuzumab, 2: protein molecular weight standard, 3: reducing SDS-PAGE of trastuzumab.

[0184] Figure 12 shows the identification of the purified antibody protein by SDS-PAGE gel electrophoresis: 1: non-reducing SDS-PAGE of Pertuzumab, 2: protein molecular weight standard, 3: reducing SDS-PAGE of Pertuzumab.

[0185] FIG13 shows the binding activity analysis of the five purified Nanobody Fc fusion proteins and the positive control Trastuzumab to the HER2 protein by ELISA (affinity identification of Nanobody Fc fusion proteins).

[0186] Figure 14 shows the results of the affinity assay of Nanobody Fc fusion proteins at the cell level.

[0187] FIG15 shows the results of specific detection of HER2 nanobody Fc fusion protein.

[0188] Figure 16 shows the epitope validation of Nanobodies and Trastuzumab.

[0189] Figure 17 shows epitope validation of Nanobodies with Pertuzumab.

[0190] Figure 18 shows the internalization rate of Nanobodies in SKBR3 cells. DETAILED DESCRIPTION

[0191] After extensive and in-depth research and extensive screening, the inventors unexpectedly obtained for the first time an anti-HER2 nanobody with high affinity and high specificity. Specifically, the inventors designed and constructed a corresponding vector containing the HER2 extracellular region gene, obtained the HER2 extracellular region protein, and used this protein to immunize healthy adult alpacas, thereby obtaining high-quality 10 11 Immune library. Phage display technology was used to screen the immune library, thereby obtaining a class of specific nanoantibodies targeting HER2. The anti-HER2 nanoantibodies of the present invention have high affinity, simple structure, are easy to prepare, and bind to different antigenic epitopes than trastuzumab and pertuzumab, and have broad application prospects in the fields of tumor treatment and immune detection. For example, the HER2-targeting nanoantibodies developed by the present invention can be used as a new therapeutic method for targeted treatment of diseases such as breast cancer, gastric cancer, colorectal cancer, ovarian cancer, lung cancer, prostate cancer, liver cancer, kidney tumors, small intestine cancer, large intestine cancer, bile duct cancer, cervical cancer, lymphoma, and esophageal cancer. The present invention was completed on this basis.

[0192] the term

[0193] In order that the present disclosure may be more readily understood, certain terms are first defined. As used in this application, unless otherwise expressly provided herein, each of the following terms shall have the meaning given below.

[0194] Definitions of Abbreviations and Key Terms

[0195] The term "about" can refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined.

[0196] The term "administering" refers to the physical introduction of the product of the invention into a subject using any of a variety of methods and delivery systems known to those skilled in the art, including intravenous, intratumoral, intramuscular, subcutaneous, intraperitoneal, spinal or other parenteral routes of administration, such as by injection or infusion.

[0197] The terms "nanoantibody", "single domain antibody", "antibody of the present invention", "nanoantibody of the present invention" and the like are used interchangeably and refer to antibodies as described in the first aspect of the present invention that specifically recognize and bind to HER2 protein (including human HER2 protein).

[0198] The antibody numbers and corresponding sequence numbers of the Nanobodies of the present invention are shown in Table A below.

[0199] Table A

[0200] Note: Each numerical value in the table represents a sequence number, i.e., "1" represents "SEQ ID NO: 1", and the sequence numbers of CDR1, CDR2, CDR3, FR1, FR2, FR3, and FR4 shown in the table are the numbers of their amino acid sequences.

[0201] As used herein, the terms "antibody" or "immunoglobulin" are heterotetrameric glycoproteins of approximately 150,000 daltons with identical structural features, consisting of two identical light chains (L) and two identical heavy chains (H). Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide bonds varies between heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bonds. Each heavy chain has a variable region (VH) at one end, followed by multiple constant regions. Each light chain has a variable region (VL) at one end and a constant region at the other end; the constant region of the light chain is opposite the first constant region of the heavy chain, and the variable region of the light chain is opposite the variable region of the heavy chain. Specific amino acid residues form an interface between the variable regions of the light and heavy chains.

[0202] As used herein, the terms "single-domain antibody," "VHH," "Nanobody," and "single-domain antibody (sdAb, or nanobody)" have the same meaning and are used interchangeably. They refer to the construction of a single-domain antibody (VHH) consisting solely of a single heavy chain variable region by cloning the variable region of an antibody heavy chain. This is the smallest fully functional antigen-binding fragment. Typically, antibodies naturally lacking the light chain and heavy chain constant region 1 (CH1) are first obtained, and then the variable region of the antibody heavy chain is cloned to construct a single-domain antibody (VHH) consisting solely of a single heavy chain variable region.

[0203] As used herein, the term "variable" refers to certain portions of the variable region in an antibody that differ in sequence, which form the binding and specificity of various specific antibodies to their specific antigens. However, variability is not evenly distributed throughout the variable region of an antibody. It is concentrated in three segments called complementarity determining regions (CDRs) or hypervariable regions in the light and heavy chain variable regions. The more conserved portions of the variable region are called framework regions (FRs). The variable regions of native heavy and light chains each contain four FR regions, which are generally in a β-sheet configuration, connected by three CDRs that form a connecting loop, and in some cases can form a partial β-sheet structure. The CDRs in each chain are closely together through the FR region and, together with the CDRs of the other chain, form the antigen-binding site of the antibody (see Kabat et al., NIH Publ. No. 91-3242, Vol. 1, pp. 647-669 (1991)). The constant regions do not directly participate in the binding of the antibody to the antigen, but they exhibit different effector functions, such as participating in the antibody-dependent cytotoxicity of the antibody.

[0204] As known to those skilled in the art, immunoconjugates and fusion expression products include: drugs, toxins, cytokines (Cytokines), radionuclides, enzymes and other diagnostic or therapeutic molecules combined with the antibodies of the present invention or their fragments to form conjugates. The present invention also includes cell surface markers or antigens combined with the nanobodies against HER2 or their fragments.

[0205] As used herein, the terms "hypervariable region," "hypervariable region," "complementarity determining region," and "complementarity determining region (CDR)" are used interchangeably.

[0206] In a preferred embodiment of the present invention, the heavy chain variable region of the Nanobody or antibody comprises three complementarity determining regions CDR1, CDR2, and CDR3.

[0207] In a preferred embodiment of the present invention, the heavy chain of the Nanobody or antibody comprises the above-mentioned heavy chain variable region and heavy chain constant region.

[0208] In the present invention, the terms "Nanobodies of the invention", "antibodies of the invention", "proteins of the invention", or "polypeptides of the invention" are used interchangeably to refer to polypeptides that specifically bind to HER2 protein, such as proteins or polypeptides having a heavy chain variable region. They may or may not contain an initial methionine.

[0209] The present invention also provides other proteins or fusion expression products comprising the antibodies of the present invention. Specifically, the present invention includes any protein or protein conjugate and fusion expression product (i.e., immunoconjugate and fusion expression product) comprising a heavy chain containing a variable region, as long as the variable region is identical to or at least 90% homologous to the heavy chain variable region of the antibodies of the present invention, preferably at least 95% homologous.

[0210] Generally, an antibody's antigen-binding properties are described by three specific regions within the variable region of the heavy chain, known as the variable regions (CDRs). This region is divided into four framework regions (FRs). The amino acid sequences of the four FRs are relatively conserved and do not directly participate in the binding reaction. These CDRs form a ring structure, spatially close to each other through the β-sheet formed by the FRs between them. The CDRs on the heavy chain and the corresponding CDRs on the light chain constitute the antibody's antigen-binding site. The amino acid sequences of antibodies of the same type can be compared to determine which amino acids constitute the FR or CDR regions.

[0211] The heavy chain variable regions of the Nanobodies or antibodies of the invention are of particular interest, as they are at least partly involved in binding to the antigen. Thus, the invention includes molecules having antibody heavy chain variable regions with CDRs, as long as their CDRs are more than 90% (preferably more than 95%, most preferably more than 98%) homologous to the CDRs identified herein.

[0212] The present invention includes not only complete antibodies, but also fragments of antibodies with immunological activity or fusion proteins formed by antibodies and other sequences. Therefore, the present invention also includes fragments, derivatives and analogs of the antibodies.

[0213] As used herein, the terms "fragment," "derivative," and "analog" refer to polypeptides that substantially retain the same biological function or activity as the antibodies of the present invention. A polypeptide fragment, derivative, or analog of the present invention may be (i) a polypeptide having one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, where such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a polypeptide formed by fusion of a mature polypeptide with another compound (e.g., a compound that extends the half-life of the polypeptide, such as polyethylene glycol), or (iv) a polypeptide formed by fusion of an additional amino acid sequence to the polypeptide sequence (e.g., a leader sequence or secretory sequence, or a sequence or proprotein sequence used to purify the polypeptide, or a fusion protein formed with a 6His tag). Based on the teachings herein, these fragments, derivatives, and analogs are well known to those skilled in the art.

[0214] The antibodies of the present invention refer to polypeptides that have HER2 protein binding activity and include the above-mentioned CDR regions. The term also includes variant forms of polypeptides that include the above-mentioned CDR regions and have the same function as the antibodies of the present invention. These variant forms include (but are not limited to): deletion, insertion, and / or substitution of one or more (usually 1-50, preferably 1-30, more preferably 1-20, and most preferably 1-10) amino acids, and addition of one or more (usually within 20, preferably within 10, and more preferably within 5) amino acids to the C-terminus and / or N-terminus. For example, in the art, substitution with amino acids with similar or similar properties generally does not alter the function of the protein. For another example, addition of one or more amino acids to the C-terminus and / or N-terminus generally does not alter the function of the protein. The term also includes active fragments and active derivatives of the antibodies of the present invention.

[0215] Variant forms of the polypeptide include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that can hybridize with the encoding DNA of the antibody of the present invention under high or low stringency conditions, and polypeptides or proteins obtained using antiserum against the antibody of the present invention.

[0216] The present invention also provides other polypeptides, such as fusion proteins comprising antibodies or fragments thereof. In addition to substantially full-length polypeptides, the present invention also encompasses fragments of the antibodies of the invention. Typically, the fragments comprise at least about 50 contiguous amino acids of the antibodies of the invention, preferably at least about 50 contiguous amino acids, more preferably at least about 80 contiguous amino acids, and most preferably at least about 100 contiguous amino acids.

[0217] In the present invention, "conservative variants of the antibodies of the present invention" refer to polypeptides in which no more than 10, preferably no more than 8, more preferably no more than 5, and most preferably no more than 3 amino acids are replaced with amino acids having similar or similar properties, compared to the amino acid sequence of the antibodies of the present invention. These conservative variant polypeptides are preferably generated by making amino acid substitutions according to Table B.

[0218] Table B

[0219] The present invention also provides polynucleotide molecules encoding the above-mentioned antibodies, fragments thereof, or fusion proteins thereof. The polynucleotides of the present invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA may be single-stranded or double-stranded. DNA may be a coding strand or a non-coding strand.

[0220] The polynucleotide encoding the mature polypeptide of the present invention includes: a coding sequence encoding only the mature polypeptide; a coding sequence of the mature polypeptide and various additional coding sequences; a coding sequence of the mature polypeptide (and optional additional coding sequences) and non-coding sequences.

[0221] The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide, or may also include additional coding and / or non-coding sequences.

[0222] The present invention also relates to polynucleotides that hybridize to the above-mentioned sequences and have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides that hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, "stringent conditions" refer to: (1) hybridization and elution at relatively low ionic strength and relatively high temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) the addition of a denaturing agent during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C; or (3) hybridization occurs only when the identity between the two sequences is at least 90%, more preferably at least 95%. Furthermore, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide.

[0223] The full-length nucleotide sequence of the antibody of the present invention or its fragments can generally be obtained by PCR amplification, recombinant methods, or artificial synthesis methods. One feasible method is to synthesize the relevant sequence by artificial synthesis, especially when the fragment length is relatively short. Generally, by first synthesizing multiple small fragments and then ligating them, very long fragments of sequence can be obtained. In addition, the coding sequence of the heavy chain can be fused with an expression tag (such as 6His) to form a fusion protein.

[0224] Once the relevant sequence is obtained, recombinant methods can be used to obtain it in large quantities. This is typically accomplished by cloning it into a vector, transferring it into cells, and then isolating the relevant sequence from the proliferated host cells using conventional methods. The biomolecules (nucleic acids, proteins, etc.) referred to in the present invention include biomolecules in isolated form.

[0225] Currently, DNA sequences encoding proteins of the present invention (or fragments thereof, or derivatives thereof) can be obtained entirely by chemical synthesis. This DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into protein sequences of the present invention by chemical synthesis.

[0226] The present invention also relates to vectors comprising the above-mentioned appropriate DNA sequence and appropriate promoter or control sequence. These vectors can be used to transform appropriate host cells to enable them to express proteins.

[0227] Host cells can be prokaryotic cells, such as bacterial cells; lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells, such as yeast; insect cells such as Drosophila S2 or Sf9; and animal cells such as CHO, COS7, and 293 cells.

[0228] Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl2, using procedures well known in the art. Another method is to use MgCl2. If desired, transformation can also be performed using electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0229] The obtained transformants can be cultured using conventional methods to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the culture medium used can be selected from various conventional culture media. Culture is carried out under conditions suitable for the growth of the host cells. After the host cells grow to an appropriate cell density, the selected promoter is induced using a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0230] The recombinant polypeptide in the above method can be expressed intracellularly, on the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various separation methods utilizing its physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to, conventional renaturation treatment, treatment with a protein precipitant (salting out method), centrifugation, osmotic sterilization, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.

[0231] The Nanobodies or antibodies of the invention can be used alone or in combination or coupled to a detectable label (for diagnostic purposes), a therapeutic agent, a PK (protein kinase) modifying moiety or any combination of these.

[0232] Detectable labels for diagnostic purposes include, but are not limited to, fluorescent or luminescent labels, radioactive labels, MRI (magnetic resonance imaging) or CT (computed tomography) contrast agents, or enzymes capable of producing a detectable product.

[0233] Therapeutic agents that can be combined or coupled with the antibodies of the present invention include but are not limited to: 1. radionuclides; 2. biological toxins; 3. cytokines such as IL-2; 4. gold nanoparticles / nanorods; 5. viral particles; 6. liposomes; 7. nanomagnetic particles; 8. prodrug activating enzymes (for example, DT-diaphorase (DTD) or biphenyl hydrolase-like protein (BPHL)), etc.

[0234] HER2 protein

[0235] Human epidermal growth factor receptor 2 (HER2, ERBB2) is a tyrosine kinase receptor membrane glycoprotein encoded by the ErbB gene and a member of the epidermal growth factor receptor family. In humans, this gene is located on chromosome 17q21 and is a proto-oncogene. The encoded product, HER2, is a 185 kDa transmembrane protein, abbreviated as p185, consisting of 1255 amino acids, with amino acids 720-987 belonging to the tyrosine kinase domain. The HER2 protein structure consists of three parts: the extracellular domain (ECD), a transmembrane domain (TM), and an intracellular domain (ICD). The extracellular domain is divided into four subdomains (I-IV). Subdomains I and III serve as ligand binding sites, while subdomains II and IV are rich in cysteine ​​residues, enabling homo- and heterodimer formation. The transmembrane domain is an α-helical structure. The intracellular region contains several important ring structures that constitute the active site of tyrosine kinase.

[0236] The HER2 protein primarily binds to its respective ligands by forming heterodimers with other members of the HER2 family, including HER1 (EGFR), HER3, and HER4. HER2 is often the preferred partner for heterodimerization and is often more active than other heterodimers. Upon ligand binding, HER2 activates tyrosine kinase activity primarily by causing receptor dimerization and autophosphorylation of the cytoplasmic tyrosine kinase domain. HER2-mediated signal transduction pathways primarily include the RAS / RAF / mitogen-activated protein kinase (MAPK) pathway, the phosphatidylinositol 3-hydroxykinase (PI3K) / AKT pathway, the signal transduction and activation of transcription (STAT) pathway, and the phosphatase C (PLC) pathway. HER2 variants include overexpression, mutation, and amplification.

[0237] By targeting overexpressed HER2 protein, the anti-HER2 nanoantibodies of the present invention can be used for targeted treatment of HER2-overexpressing diseases, including but not limited to: breast cancer, gastric cancer, colorectal cancer, ovarian cancer, lung cancer, prostate cancer, liver cancer, kidney tumors, small intestine cancer, large intestine cancer, bile duct cancer, cervical cancer, lymphoma, esophageal cancer, or a combination thereof.

[0238] Anti-HER2 nanoantibodies

[0239] In the present invention, the anti-HER2 nanobody includes monomers, bivalents (divalent antibodies), tetravalents (tetravalent antibodies), and / or multivalents (multivalent antibodies).

[0240] In a preferred example of the present invention, the amino acid sequence of the VHH chain of the anti-HER2 nanobody is selected from one or more of SEQ ID NOs: 6-20.

[0241] Labeled antibodies

[0242] In a preferred embodiment of the present invention, the nanobody or antibody may carry a detectable label. More preferably, the label is selected from the group consisting of an isotope, a colloidal gold label, a colored label, or a fluorescent label.

[0243] Colloidal gold labeling can be performed using methods known to those skilled in the art. In a preferred embodiment of the present invention, the anti-HER2 nanobody or antibody is labeled with colloidal gold to obtain a colloidal gold-labeled antibody. The anti-HER2 nanobody or antibody of the present invention can effectively bind to the HER2 protein.

[0244] Detection method

[0245] The present invention also relates to a method for detecting HER2 protein or a fragment thereof. The method generally comprises the following steps: obtaining a cell and / or tissue sample; dissolving the sample in a medium; and detecting the level of HER2 protein in the dissolved sample.

[0246] In the detection method of the present invention, the sample used is not particularly limited, and a representative example is a sample containing cells in a cell storage medium.

[0247] Reagent test kit

[0248] The present invention also provides a kit containing the anti-HER2 nanobody or antibody (or fragment thereof) or detection plate of the present invention. In a preferred embodiment of the present invention, the kit further includes a container, instructions for use, a buffer, etc.

[0249] The present invention also provides a detection kit for detecting HER2 protein levels, which includes an antibody that recognizes HER2 protein, a lysis medium for dissolving the sample, and common reagents and buffers required for detection, such as various buffers, detection labels, and detection substrates. The detection kit can be an in vitro diagnostic device.

[0250] Pharmaceutical composition

[0251] The present invention also provides a pharmaceutical composition. The pharmaceutical composition comprises the anti-HER2 nanobody described in the first aspect of the present invention, the anti-HER2 antibody described in the second aspect of the present invention, the chimeric antigen receptor described in the third aspect of the present invention, the fusion protein described in the fourth aspect of the present invention, the recombinant protein described in the fifth aspect of the present invention, the host cell described in the eighth aspect of the present invention, the engineered immune cell described in the ninth aspect of the present invention, the immunoconjugate described in the eleventh aspect of the present invention, or a combination thereof as an active ingredient, and a pharmaceutically acceptable carrier.

[0252] Typically, these substances are formulated in a non-toxic, inert, and pharmaceutically acceptable aqueous carrier medium, wherein the pH is generally about 5-8, preferably about 6-8, although the pH value may vary depending on the nature of the substance being formulated and the condition to be treated. The formulated pharmaceutical composition can be administered by conventional routes, including (but not limited to): intraperitoneal, intravenous, or topical administration.

[0253] The pharmaceutical composition of the present invention contains a safe and effective amount (such as 0.001-99wt%, preferably 0.01-90wt%, more preferably 0.1-80wt%) of the above-mentioned antibody of the present invention (or its conjugate) and a pharmaceutically acceptable carrier or excipient. Such carriers include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. The pharmaceutical preparation should match the mode of administration. The pharmaceutical composition of the present invention can be prepared in the form of an injection, for example, using physiological saline or an aqueous solution containing glucose and other adjuvants by conventional methods. Pharmaceutical compositions such as injections and solutions are preferably manufactured under sterile conditions. The dosage of the active ingredient is a therapeutically effective amount, for example, about 10 micrograms / kg body weight to about 50 mg / kg body weight per day. In addition, the polypeptide of the present invention can also be used in conjunction with other therapeutic agents.

[0254] When using a pharmaceutical composition, a safe and effective amount of the immunoconjugate is administered to a mammal, wherein the safe and effective amount is generally at least about 10 μg / kg body weight and, in most cases, does not exceed about 50 mg / kg body weight. Preferably, the dose is about 10 μg / kg body weight to about 10 mg / kg body weight. Of course, the specific dosage will also take into account factors such as the route of administration and the patient's health status, which are all within the skill of a skilled physician.

[0255] application

[0256] As described above, the Nanobodies and antibodies of the present invention have broad biological and clinical applications, including in the diagnosis and treatment of diseases related to the HER2 protein, basic medical research, biological research, and other fields. A preferred application is in the clinical diagnosis, prevention, and treatment of HER2 protein-related diseases.

[0257] The present invention also provides a method for stimulating an immune response mediated by T cells targeting a tumor cell population or tissue in a mammal, comprising the following steps: administering the CAR-T cells of the present invention to the mammal.

[0258] In one embodiment, the present invention comprises a type of cell therapy in which a patient's own T cells (or those of an allogeneic donor) are isolated, activated, and genetically modified to produce CAR-T cells, which are then infused back into the same patient. This approach minimizes the likelihood of a graft-versus-host reaction, as antigens are recognized by T cells in an MHC-free manner. Furthermore, a single CAR-T cell can treat all cancers expressing that antigen. Unlike antibody therapies, CAR-T cells are able to replicate in vivo, resulting in long-term persistence that can lead to sustained tumor control.

[0259] In one embodiment, the CAR-T cells of the present invention can undergo stable in vivo expansion and can persist for months to years. In addition, the CAR-mediated immune response can be part of an adoptive immunotherapy procedure, wherein the CAR-T cells can induce a specific immune response against tumor cells that overexpress the antigen recognized by the CAR antigen binding domain. For example, the CAR-T cells of the present invention induce a specific immune response against tumor cells that overexpress HER2.

[0260] Treatable cancers include tumors that are not vascularized or substantially not vascularized, as well as vascularized tumors. Cancer types treated with the CAR of the present invention include, but are not limited to, breast cancer, gastric cancer, colorectal cancer, ovarian cancer, lung cancer, prostate cancer, liver cancer, kidney tumors, small intestine cancer, colorectal cancer, bile duct cancer, cervical cancer, lymphoma, esophageal cancer, etc.

[0261] Generally, cells activated and expanded as described herein can be used to treat and prevent diseases such as tumors. Therefore, the present invention provides a method for treating cancer, which comprises administering to a subject in need thereof a therapeutically effective amount of the CAR-T cells of the present invention.

[0262] The CAR-T cells of the present invention can be administered alone or as a pharmaceutical composition in combination with a diluent and / or with other components such as IL-2, IL-17 or other cytokines or cell populations. Briefly, the pharmaceutical compositions of the present invention may include a target cell population as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients.

[0263] The pharmaceutical composition of the present invention can be administered in a manner suitable for the disease to be treated (or prevented). The amount and frequency of administration will be determined by factors such as the patient's condition, and the type and severity of the patient's disease, or may be determined by clinical trials.

[0264] When an "immunologically effective amount," "anti-tumor effective amount," "tumor-inhibitory effective amount," or "therapeutic amount" is indicated, the precise amount of the composition of the present invention to be administered can be determined by a physician, who takes into account individual differences in the patient's (subject's) age, weight, tumor size, degree of infection or metastasis, and condition. The pharmaceutical composition comprising the T cells described herein can be administered in an amount of 10 4 to 10 9 The dose of cells / kg body weight is preferably 10 5 to 10 7 The T cell composition can be administered at a dose of 10 cells / kg body weight (including all integer values ​​within the range). The T cell composition can also be administered multiple times at these doses. The cells can be administered using infusion techniques known in immunotherapy (see, for example, Rosenberg et al., New Eng. J. of Med. 319: 1676, 1988). The optimal dosage and treatment regimen for a specific patient can be easily determined by a person skilled in the art of medicine by monitoring the patient's signs of disease and adjusting the treatment accordingly.

[0265] Administration of the subject composition can be carried out in any convenient manner, including by spraying, injection, swallowing, infusion, implantation or transplantation. The compositions described herein can be administered to the patient subcutaneously, intradermally, intratumorally, intranodally, intraspinal, intramuscularly, by intravenous injection or intraperitoneally. In one embodiment, the T cell composition of the present invention is administered to the patient by intradermal or subcutaneous injection. In another embodiment, the T cell composition of the present invention is preferably administered by intravenous injection. The T cell composition can be injected directly into the tumor, lymph node or infection site.

[0266] In certain embodiments of the present invention, cells activated and expanded using the methods described herein or other methods known in the art for expanding T cells to therapeutic levels are administered to a patient in combination with (e.g., before, simultaneously, or after) any number of related treatment modalities, including, but not limited to, treatment with agents such as antiviral therapy, cidofovir and interleukin-2, cytarabine (also known as ARA-C), or natalizumab treatment for MS patients, or efavirenz treatment for psoriasis patients, or other treatments for PML patients. In further embodiments, the T cells of the present invention may be used in combination with chemotherapy, radiation, immunosuppressants such as cyclosporine, azathioprine, methotrexate, mycophenolate mofetil, and FK506, antibodies, or other immunotherapeutic agents. In further embodiments, the cell compositions of the present invention are administered to a patient in combination with (e.g., before, simultaneously, or after) bone marrow transplantation, chemotherapy agents such as fludarabine, external beam radiation therapy (XRT), or cyclophosphamide. For example, in one embodiment, a subject may undergo standard treatment with high-dose chemotherapy followed by a peripheral blood stem cell transplant. In some embodiments, the subject receives an infusion of the expanded immune cells of the invention following transplantation. In an additional embodiment, the expanded cells are administered before or after surgery.

[0267] The dosage of the above treatments administered to a patient will vary with the precise nature of the condition being treated and the recipient of the treatment. Dosage ratios for human administration may be implemented according to practices accepted in the art. Typically, 1×10 5 to 1×10 10 The modified T cells of the present invention are administered to the patient, for example, by intravenous infusion.

[0268] Main advantages of the present invention

[0269] 1. The anti-HER2 nanoantibody of the present invention has high affinity, simple structure, is easy to prepare, and binds to different antigen epitopes from trastuzumab and pertuzumab, and has broad application prospects in the fields of tumor treatment, immune detection, etc.

[0270] 2. The present invention also utilizes the constructed anti-HER2 nanoantibody and cytokine (e.g., IL-12 protein) to prepare a fusion protein that can both target tumor lesions and precisely release cytokines, thereby stimulating immune cells to exert their immune killing function. The above fusion protein can precisely increase the effective concentration of cytokines in the tumor, thereby avoiding systemic toxic reactions.

[0271] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight.

[0272] Sequence Listing

[0273] Example 1 Screening of heavy chain single domain antibodies against HER2

[0274] 1.1 Preparation of immune antigens

[0275] The extracellular segment of the HER2 antigen (23-652) was synthesized, a 6-histidine tag was added to the C-terminus, and the fragment was subcloned into the eukaryotic expression vector pcDNA3.1 to construct an expression vector for the HER2 recombinant protein (HER2-His). The amino acid sequence is shown below:

[0276] The constructed HER2-His plasmid was extracted and sequenced correctly, and then the FreeStyle TM 293-F cells were cultured in a horizontal shaker at 37°C, 120 rpm, and 5% CO2 for 3 to 4 days. The expression supernatant was collected by centrifugation, filtered through a 0.45 μm filter membrane, and purified using HisTrap TM Affinity purification was performed using FF, samples were collected by elution with 500 mM imidazole, buffer replacement and concentration were performed using ultrafiltration concentrators, protein purity was determined by SDS-PAGE, and protein concentration was quantified by spectrophotometer.

[0277] The results are shown in Figure 1. The electrophoretic position of the antigen protein was consistent with expectations, with clear bands and high purity. No fragmentation or degradation bands were observed for the HER2 protein, indicating that the purified antigen protein prepared can be used in subsequent immunization procedures.

[0278] 1.2 Library Construction

[0279] A healthy alpaca (1.5 years old, male, weighing approximately 160 catties, raised and immunized by Qingdao Kangda Biotechnology Co., Ltd.) was selected for immunization, with multiple subcutaneous injections in the neck and shoulder. After five immunizations, 100 ml of peripheral blood lymphocytes were extracted from the alpaca. PBMCs were isolated using the Tianjin Haoyang Biotechnology Co., Ltd. Alpaca Peripheral Blood Lymphocyte Separation Kit. RNA was extracted using the RNA Keeper Tissue Atabilizer kit from Novazines. The extracted RNA was reverse transcribed into cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (Novazines, R312-01). Nested PCR was then used to amplify the variable region of the heavy chain antibody:

[0280] First round of PCR:

[0281] Upstream primer F1: GTCCTGGCTGCTCTTCTACAAGG (SEQ ID NO: 2)

[0282] Downstream primer R1: GGTACGTGCTGTTGAACTGTTCC (SEQ ID NO: 3)

[0283] The Fab of the heavy chain antibody was obtained by PCR amplification using cDNA as a template. The reaction procedure is as shown in Table 1:

[0284] Table 1

[0285] Electrophoresis was performed using a 2% agarose gel, and a band of about 700 bp was cut out. The target gene was recovered using a GelExtraction Kit (Novozymes) according to the instructions.

[0286] Second round of PCR:

[0287] The first round PCR product was used as a template and PCR amplification was performed again to obtain the nanobody. The reaction system and reaction procedure are shown in the table.

[0288] Upstream primer F2: ATGGCCCAGGTGCAGCTGCAGGAGTCTGGRGGAGG (SEQ ID NO: 4)

[0289] Downstream primer R2: GTGGTGTGAGGAGACGGTGACCTGGGT (SEQ ID NO: 5)

[0290] The reaction system is shown in Table 2 below:

[0291] Table 2

[0292] The PCR reaction program is as follows:

[0293] Table 3

[0294] The target heavy chain single domain antibody nucleic acid fragment was recovered and cloned into the phage display vector pMES4 using restriction endonucleases PstⅠ and BsteⅡ (purchased from NEB). Fresh competent cells TG1 were prepared, the product was electroporated into competent cells TG1, and the efficiency and accuracy of electroporation were tested. The library size was calculated by gradient dilution plating. 11 20 clones were randomly selected for colony PCR and sequencing verification, and the results showed that the insertion rate reached 100%, completing the construction of a phage display library of heavy chain single domain antibodies targeting HER2.

[0295] 1.3 Selection of HER2 heavy chain single domain antibodies

[0296] The immunotubes were coated with 10 μg / ml of HER2-His fusion protein and incubated at 4°C overnight. The next day, the immunotubes were blocked with 1 ml of PBS milk (PBS containing 2% skim milk powder) at 37°C for 1 h. At the same time, 100 μl of the phage library (the heavy chain single-domain antibody phage display library constructed in Example 1.2) was also blocked.

[0297] The blocked phage antibody library was added to the immune tube and combined at 4°C overnight; the liquid in the immune tube was discarded and washed with PBS, PBST and PBS+NaCl respectively, with the washing intensity increasing in each round.

[0298] After three rounds of washing, discard the liquid in the immunotube, add 1 ml of 0.2 mol / L glycine-hydrochloric acid (pH 2.2) for elution, and neutralize to pH 7.4 with 1 mol / L Tris. Add logarithmically growing Escherichia coli TG1 to the immunotube for infection. Resuspend the eluted infected bacterial solution and evenly spread it on a 2YT-AG (A: ampicillin sodium; G: glucose) plate. Incubate at 37°C overnight and collect all colonies.

[0299] Add an appropriate amount of bacterial suspension to 100 ml of 2YT-AG liquid medium and incubate until the absorbance (A) at 600 nm reaches 0.7. Add helper phage M13KO7 at a multiplicity of infection (MOI) of 50:1. Incubate at room temperature for 30 minutes, then at 37°C, 150 rpm for 1 hour. Add IPTG to a final concentration of 0.15 mmol / L and incubate at 30°C, 200 rpm for 10 hours. Recover phage antibodies by PEG8000 precipitation and reserve a certain amount for the next round of screening.

[0300] After three rounds of screening, positive clones were finally enriched, achieving the goal of screening HER2-specific antibodies using phage display technology.

[0301] 1.4 Screening of positive clones using phage enzyme-linked immunosorbent assay (ELISA)

[0302] Single colonies were selected and cultured overnight in a 96-well plate containing 2×YT-AG medium at 37°C and 220 rpm until saturated. The saturated culture was transferred to an OD600 of approximately 0.5, and helper phage M13KO7 was added at an MOI of 50:1. After standing at room temperature for 30 minutes, the cells were incubated at 37°C and 150 rpm for 1 hour. Kanamycin was added to a final concentration of 20 μg / ml and IPTG to a final concentration of 0.15 mM, and induction was performed at 30°C and 200 rpm for 12 hours.

[0303] The supernatant was collected by centrifugation as phage antibody, coated with the target antigen (HER2-His) and control antigen (BSA) at 4°C overnight, and the phage antibody was bound at 37°C for 1 hour, washed, and the anti-M13 antibody (anti-M13 phage polyclonal antibody (HRP), secondary antibody) was bound at 37°C for 45 minutes. After washing, TMB single-component colorimetric solution was added. The absorption peak was measured at a wavelength of 450nm. The OD value of the sample well was greater than 3 times the OD value of the control well. Positive monoclonal colonies were identified and sent for sequencing to obtain the variable region genes of the candidate antibodies. The antibody sequence information is as follows:

[0304] HER2-1:

[0305] HER2-2:

[0306] HER2-3:

[0307] HER2-4:

[0308] HER2-5:

[0309] HER2-8:

[0310] HER2-10:

[0311] HER2-11:

[0312] HER2-16:

[0313] HER2-32:

[0314] HER2-34:

[0315] HER2-37:

[0316] HER2-38:

[0317] HER2-40:

[0318] HER2-41:

[0319] Example 2 Evaluation and Identification of Heavy Chain Single Domain Antibodies Against HER2

[0320] 2.1 Expression and purification of heavy chain single domain antibodies in Escherichia coli

[0321] After plasmid extraction from the 15 single-domain antibodies obtained through sequencing analysis, the plasmids were transformed into BL21(DE3) competent cells via heat shock. In a clean room, 1 mL of positive clone culture was added to 100 mL of LB liquid medium (containing 100 μg / mL ampicillin). The cells were cultured with shaking at 37°C until the OD600nm reached approximately 0.8. IPTG was then added to a final concentration of 1 mM and cultured with shaking at 30°C overnight.

[0322] The next day, centrifuge at 8000rpm for 10 minutes, collect the bacteria, add 1.5mL of pre-cooled TES buffer to resuspend the precipitate and stir in an ice bath for 30 minutes. Add 3.0mL TES / 4 (dilute TES 4 times with pure water) and continue stirring in an ice bath for 30 minutes. Centrifuge at 9000rpm and 4℃ for 10 minutes, collect the supernatant (periplasmic extract) and perform SDS-PAGE electrophoresis analysis. Furthermore, based on the protein purification system, affinity purification was performed using a nickel pre-packed column, and the sample was eluted and collected with 300mM imidazole buffer. The antibody concentration was quantified by spectrophotometer, and the purity of the purified antibody was identified by SDS-PAGE.

[0323] As shown in Figure 2, the results showed that the molecular weights of the 15 nanobodies (single domain antibodies) expressed and purified in E. coli were in line with expectations, with clear bands and high purity.

[0324] 2.2 Construction of antigen recombinant protein

[0325] Construct the expression vector of HER2 and human Fc recombinant protein (HER2-Fc). HER2 gene and human Fc gene were cloned into pcDNA3.1 vector. After sequencing was correct, the FreeStyle TM293-F cells were cultured in a horizontal shaker at 37°C, 120 rpm, and 5% CO2 for 3.5 days. The supernatant was collected and purified using a Protein A column. Elution was performed with citric acid-sodium citrate buffer. Buffer exchange and concentration were performed using ultrafiltration concentrators. The purity of the HER2-Fc recombinant protein was assessed by SDS-PAGE.

[0326] As shown in Figure 3, the results showed that the electrophoretic position of the HER2-Fc recombinant protein was consistent with expectations, the bands were clear, and the purity was high. No broken or degraded bands were observed for the HER2-Fc recombinant protein.

[0327] Furthermore, the concentration of HER2-Fc recombinant protein was quantified by spectrophotometer, and the protein concentration was 2 mg / mL.

[0328] 2.3 Detection of Binding of Candidate HER2 Heavy Chain Single Domain Antibodies to Human HER2 Protein

[0329] The human HER2-Fc fusion protein was coated on the plate at 200 ng / well at 4°C overnight. The heavy chain single domain antibody obtained in Example 2.1 was then diluted 3-fold from 10 μg / ml in 12 gradients, blocked at 37°C for 1 hour, and the blocked whole antibody was added at 100 μl / well, and allowed to stand at 37°C for 1 hour. After washing, HRP-labeled anti-His tag antibody was added, and 100 μl / well was added to the enzyme-linked plate, and allowed to stand at 37°C for 45 minutes. After washing, TMB substrate colorimetric solution was added at 100 μl / well, and allowed to stand at room temperature for 10 minutes. 1M H2SO4 100 μl / well was used for termination. The absorbance value at a wavelength of 450 nm was measured by an enzyme-linked microplate reader. Graphd Prism Software 5.0 was used for data processing and parameter fitting, and EC was calculated. 50 value.

[0330] The binding activity of the 15 purified nanobodies to the HER2-Fc protein was analyzed by ELISA. The results are shown in Figures 4-5, indicating that HER2-1, HER2-2, HER2-3, HER2-4, HER2-5, HER2-8, HER2-10, HER2-11, HER2-16, HER2-32, HER2-34, HER2-37, HER2-38, HER2-40, and HER2-41 all have high binding activity to the HER2-Fc recombinant protein, and exhibit a typical dose-dependent pattern.

[0331] EC 50 The results of the values ​​are shown in Tables 4 and 5 below:

[0332] Table 4

[0333] Table 5

[0334] 2.4 SPR (i.e., BIcore) identification of HER2 single-domain antibody protein binding ability to HER2

[0335] Using a single-concentration affinity screening approach, all test Nanobodies were tested at the same single concentration, allowing for parallel comparisons and detection of differences in binding activity between Nanobodies. The capture antibody was coupled to the CM5 chip surface using the Human Antibody Capture Kit, and multi-cycle kinetics was used to determine the kinetic parameters of the antibody-antigen interaction.

[0336] Purified HER2-His was diluted to 1 μg / mL in HBS-EP buffer and captured on the chip surface at 25°C at 5 μl / min for 1 minute, achieving a capture target response of approximately 400 RU. Nanobodies HER2-1, HER2-2, HER2-3, HER2-4, HER2-5, HER2-8, HER2-10, HER2-11, HER2-16, HER2-32, HER2-34, HER2-37, HER2-38, HER2-40, and HER2-41 were diluted to 1.5 μg / ml in HBS-EP buffer as the mobile phase. The assay was performed at 25°C at 30 μl / min for 60 seconds of binding and 120 seconds of dissociation. Regeneration was performed at 10 mM glycine-HCl buffer, pH 2.5, at 30 μl / min for 90 seconds. Results were analyzed.

[0337] The results are shown in FIG6 . The fitting curve diagram clearly and intuitively shows the binding process between the antibody and the antigen and the dissociation process of the antigen-antibody complex.

[0338] Antibody affinity is an important indicator for evaluating antibody molecules, and surface plasmon resonance (SPR) technology is recognized as the gold standard for detecting antibody affinity. Further, the inventors used the BIAcore T100 system and a single-concentration affinity screening test method. The binding activity parameters of HER2-1, HER2-2, HER2-3, HER2-4, HER2-5, HER2-8, HER2-10, HER2-11, HER2-16, HER2-32, HER2-34, HER2-37, HER2-38, HER2-40, and HER2-41 are shown in Figure 7.

[0339] 2.5 Detection of the binding activity of antibodies to SKBR3 cells using FACS

[0340] SKBR3 cells (Shanghai Cell Bank, Chinese Academy of Sciences) were purchased and cultured to the logarithmic growth phase. The cells were resuspended in FACS buffer and the cell density was adjusted to 3E6 / ml. 100 μl was plated per well. The heavy chain single domain antibody obtained in Example 2.1 was then diluted 5-fold with FACS buffer to 30 μg / ml of primary antibody, and the cells were resuspended in 100 μl / well and incubated at 4°C for 60 min. PBS was used to wash three times and the secondary antibody was added. TM Resuspend cells with His Tag Antibody [FITC], mAb, and mouse and incubate at 4°C for 60 min. Wash three times with PBS and resuspend cells in 100-200 μl / well of PBS. MFI was measured using Beckman / CytoFLEX. Data processing and parameter fitting were performed using Graphd Prism Software 5.0 to calculate EC. 50 value.

[0341] The analysis results are shown in Figures 8-9, indicating that HER2-3, HER2-5, HER2-8, HER2-10, HER2-11, and HER2-38 have high binding activity to the HER2 protein expressed in SKBR3 cells and have typical dose-dependent characteristics.

[0342] EC 50 The results of the values ​​are shown in Tables 6 and 7 below:

[0343] Table 6

[0344] Table 7

[0345] 2.6 Preparation of anti-HER2-Fc nanobody fusion protein in mammalian cells

[0346] The clones identified as positive single-chain antibodies were sequenced and the sequencing results were analyzed. The positive single-chain variable region genes were amplified using primers HF (CCTTAAGGGCGTGCAGTGCCAGGTGCAGCTGCAGGAGTC, SEQ ID NO: 21) and HR (GATTTGGGCTCGCTAGCTGAGGAGACGGTGACCTGGG, SEQ ID NO: 22). The positive single-chain antibody genes were cloned into the vector pABG1-Fc (pABG1 vector with human Fc, available in the laboratory) by homologous recombination.

[0347] The amplification reaction system is shown in Table 8 below:

[0348] Table 8

[0349] The amplification PCR reaction program is as follows Table 9:

[0350] Table 9

[0351] The homologous recombination reaction system is as shown in Table 10:

[0352] Table 10

[0353] The plasmid was extracted with endotoxin-free plasmid extraction reagent, quantified by spectrophotometer and sent for sequencing. FreeStyle was collected by centrifugation one day before transfection. TM 293-F cells, adjust the cell density to 1×10 6 cells / mL, transfection ratio: (cells: culture medium = 20:1); Polyethylenimine Lineae (PEI) 2μL / mL; plasmid 1μg / mL; that is, aspirate 40μg of plasmid and dissolve it in 2mL Opti-MEM medium, mix gently, then add 80μL of PEI transfection reagent, vortex for 10s, mix thoroughly, and let it stand at room temperature for 10min-15min; add 2mL of the mixed solution to 40mL of FreeStyle in good condition TM Gently mix 293-F cells and culture in a horizontal shaker at 37°C, 120 rpm, and 5% CO2 for 3-4 days. Collect the supernatant and analyze by SDS-PAGE. Based on the protein purification system, use Protein A affinity purification and elute the sample with 0.1 M citric acid-sodium citrate buffer.

[0354] The results are shown in FIG10 , which indicate that the molecular weight of the humanized nanobody Fc as shown by protein electrophoresis is consistent with expectations.

[0355] 2.7 Preparation of Trastuzumab

[0356] Trastuzumab light and heavy chain genes were synthesized by gene synthesis:

[0357] Trastuzumab light chain:

[0358] Trastuzumab heavy chain:

[0359] Subcloned into the eukaryotic expression vector pcDNA3.1, the light and heavy chains were co-transfected with FreeStyle TM 293-F cells were cultured in a horizontal shaker at 37°C, 120 rpm, and 5% CO2 for 3.5 days. The supernatant was collected and purified using a Protein A column. Elution was performed with 0.1 M citric acid-sodium citrate buffer. Buffer exchange and concentration were performed using an ultrafiltration concentrator. Protein purity was assessed by SDS-PAGE.

[0360] As shown in FIG11 , the identification results of the trastuzumab protein are shown, indicating that the protein molecular weight is consistent with expectations and the purity is high.

[0361] Furthermore, the protein concentration was quantified by spectrophotometer and was 1 mg / mL.

[0362] 2.8 Preparation of Pertuzumab

[0363] Pertuzumab light and heavy chain genes were synthesized by gene synthesis:

[0364] Pertuzumab light chain:

[0365] Pertuzumab heavy chain:

[0366] Subcloned into the eukaryotic expression vector pcDNA3.1, the light and heavy chains were co-transfected with FreeStyle TM 293-F cells were cultured in a horizontal shaker at 37°C, 120 rpm, and 5% CO2 for 3.5 days. The supernatant was collected and purified using a Protein A column. Elution was performed with 0.1 M citric acid-sodium citrate buffer. Buffer exchange and concentration were performed using an ultrafiltration concentrator. Protein purity was assessed by SDS-PAGE.

[0367] As shown in FIG12 , the identification results of the Pertuzumab protein are shown, indicating that the protein molecular weight is consistent with expectations and the purity is high.

[0368] Furthermore, the protein concentration was quantified by spectrophotometer and was 1 mg / mL.

[0369] 2.9 Detection of Binding of Candidate Anti-HER2-Fc Nanobody Fusion Proteins to Human HER2 Protein

[0370] The human HER2-His protein was coated on the plate at 200 ng / well and incubated at 4°C overnight. The nanoantibody fusion protein obtained in Example 2.6 (the positive control group was Trastuzumab) was then diluted 3-fold from 20 μg / ml in 12 gradients, blocked at 37°C for 1 hour, and the blocked whole antibody was added at 100 μl / well. The plate was allowed to stand at 37°C for 1 hour. After washing, 100 μl / well of HRP-labeled anti-human IgG tag antibody was added. The plate was allowed to stand at 37°C for 45 minutes. After washing, 100 μl / well of TMB substrate colorimetric solution was added and the plate was allowed to stand at room temperature for 10 minutes. 1M H2SO4 100 μl / well was used for termination. The absorbance at a wavelength of 450 nm was measured using an enzyme reader. Graphd Prism Software 5.0 was used for data processing and parameter fitting, and EC was calculated. 50 value.

[0371] The binding activity of the five purified Nanobody Fc fusion proteins to the HER2 protein was analyzed by ELISA. The results are shown in Figure 13, indicating that HER2-3-hFc, HER2-8-hFc, HER2-10-hFc, and HER2-11-hFc had better binding activity than the control antibody trastuzumab, and showed a typical dose-dependent characteristic.

[0372] EC 50 The results of the values ​​are shown in Table 11 below:

[0373] Table 11

[0374] 2.10 Detection of the binding activity of HER2 nanobody Fc fusion protein and SKBR3 cells using FACS

[0375] SKBR3 cells were cultured to the logarithmic growth phase, resuspended in FACS buffer, and the cell density was adjusted to 3E6 / ml, with 100 μl per well. The nanoantibody Fc fusion protein obtained in Example 2.6 (the positive control group was Trastuzumab) was then diluted 5-fold with FACS buffer to 30 μg / ml of primary antibody, resuspended in 100 μl / well, and incubated at 4°C for 60 min. Washed three times with PBS, resuspended in the secondary antibody anti-Human IgG, Fc Fragment (Alexa Fluor 488-conjugated AffiniPure), and incubated at 4°C for 60 min. Washed three times with PBS, resuspended in 100 μl / well of PBS, and the MFI was detected by Beckman / CytoFLEX. Graphd Prism Software 5.0 was used for data processing and parameter fitting, and EC was calculated. 50 value.

[0376] The results are shown in FIG14 , which indicate that HER2-3-hFc, HER2-8-hFc, HER2-10-hFc, and HER2-11-hFc have better binding activity than Trastuzumab at the cellular level.

[0377] EC 50 The results of the values ​​are shown in Table 12 below:

[0378] Table 12

[0379] 2.11 Analysis of the specificity of HER2 nanobody Fc fusion protein binding to HER2 protein

[0380] The plates were coated with 200 ng / well of various proteins (HER2, PDL1, BCMA, CD38, TSLP, IL-18, IL-15, IL-23, HAS, BSA, TNF-α, and IL-4, all obtained from the inventors' laboratory). Coating was performed overnight at 4°C. The plates were then assayed with 0.2 μg of HER2-3-Fc, 0.2 μg of HER2-8-Fc, 0.2 μg of HER2-10-Fc, and 0.2 μg of HER2-11-Fc antibodies in duplicate. The plates were incubated at 37°C for 1 hour. After washing, HRP-conjugated anti-IgG antibody was added to the plate at 100 μl / well. The plates were incubated at 37°C for 45 minutes. After washing, TMB substrate was added and color development was terminated with 1 M H2SO4. Absorbance was measured at 450 nm using a microplate reader. Data were processed using Graphd Prism Software 5.0.

[0381] The specificity experimental results shown in Figure 15 indicate that HER2-3-Fc, HER2-8-Fc, HER2-10-Fc, and HER2-11-Fc specifically bind to human HER2 protein with high affinity, and no cross-reaction with other tested proteins was found.

[0382] 2.12 Epitope Analysis of HER2 Nanobodies, Trastuzumab, and Pertuzumab

[0383] The capture antibody was coupled to the CM5 chip surface using the Human Antibody Capture Kit, and the kinetic parameters of the antibody-antigen-antibody interaction were determined by multi-cycle kinetics. Purified HER2-his and trastuzumab / pertuzumab were diluted to 1 μg / mL in HBS-EP buffer, respectively. Trastuzumab or pertuzumab were captured and immobilized on the chip surface at 25°C and 5 μl / min for 1 minute, achieving a capture target response of approximately 400 RU. The HER2-his antigen was bound for 100 s, and the nanoantibodies HER2-3, HER2-8, HER2-10, and HER2-11 were diluted to 1.5 μg / mL in HBS-EP buffer as the mobile phase. The assay conditions were 25°C, 30 μl / min, 120 s for association and 120 s for dissociation, and regeneration conditions were 10 mM glycine-HCl buffer, pH 2.5, at 30 μl / min for 90 s. The results were analyzed.

[0384] The results of the epitope validation experiments of the nanobodies and trastuzumab / pertuzumab in Figures 16 and 17 show that the epitopes of HER2-3-Fc, HER2-8-Fc, HER2-10-Fc, and HER2-11-Fc antibodies are different from those of trastuzumab and pertuzumab.

[0385] 2.13 Endocytosis assay

[0386] For endocytosis assay, SKBR3 cells / NCI-N87 2E5 were plated per well (100 μl / well was plated to adjust the cell density to 4E6 and diluted with culture medium), 50 μl was added to each well, and antibodies HER2-3, HER2-8, HER2-10, HER2-11, trastuzumab, and pertuzumab were added, 20 μg / ml plus 50 μl (i.e., 1 μg / well), incubated on ice at 4°C for 30 min, 37°C for 0 h, 30 min, 1 h, 2 h, 4 h, 10 h, 24 h, centrifuged at 1500 r / 5 min, washed three times with PBS, 200 μl / well; secondary antibody 1 / 200 anti-Fc-FITC secondary antibody was added at 100 μl / well (using FACS buffer: 2% serum), 4°C for 1 h, centrifuged at 1500 r / 5 min, washed three times with PBS, 200 μl / well; and finally 100 μl Resuspend by FACS and measure the endocytosis effect at different time periods by flow cytometry.

[0387] Table 13

[0388] As shown in Figure 18 and Table 13, HER2-10-Fc has a higher endocytosis rate and is a preferred sequence for ADC drug conjugation. HER2-3-Fc, HER2-8-Fc, and HER2-11-Fc have relatively low endocytosis efficiencies and can be used as target proteins for cancer drug therapy.

[0389] All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

Claims

1. An anti-HER2 nanobody, characterized in that: The anti-HER2 nanobody has one or more complementary determining regions (CDRs) selected from the following group: (1) CDR1 shown in SEQ ID NO:27, CDR2 shown in SEQ ID NO:28, and CDR3 shown in SEQ ID NO:29; (2) CDR1 shown in SEQ ID NO:34, CDR2 shown in SEQ ID NO:35, and CDR3 shown in SEQ ID NO:36; (3) CDR1 shown in SEQ ID NO:40, CDR2 shown in SEQ ID NO:41, and CDR3 shown in SEQ ID NO:42; (4) CDR1 shown in SEQ ID NO:46, CDR2 shown in SEQ ID NO:47, and CDR3 shown in SEQ ID NO:48; (5) CDR1 shown in SEQ ID NO:52, CDR2 shown in SEQ ID NO:53, and CDR3 shown in SEQ ID NO:54; (6) CDR1 shown in SEQ ID NO:57, CDR2 shown in SEQ ID NO:58, and CDR3 shown in SEQ ID NO:59; (7) CDR1 shown in SEQ ID NO:63, CDR2 shown in SEQ ID NO:64, and CDR3 shown in SEQ ID NO:65; (8) CDR1 shown in SEQ ID NO:69, CDR2 shown in SEQ ID NO:70, and CDR3 shown in SEQ ID NO:71; (9) CDR1 shown in SEQ ID NO:74, CDR2 shown in SEQ ID NO:75, and CDR3 shown in SEQ ID NO:76; (10) CDR1 shown in SEQ ID NO:27, CDR2 shown in SEQ ID NO:28, and CDR3 shown in SEQ ID NO:80; (11) CDR1 shown in SEQ ID NO:83, CDR2 shown in SEQ ID NO:84, and CDR3 shown in SEQ ID NO:85; (12) CDR1 shown in SEQ ID NO:57, CDR2 shown in SEQ ID NO:58, and CDR3 shown in SEQ ID NO:89; (13) CDR1 shown in SEQ ID NO:91, CDR2 shown in SEQ ID NO:92, and CDR3 shown in SEQ ID NO:93; (14) CDR1 shown in SEQ ID NO:97, CDR2 shown in SEQ ID NO:98, and CDR3 shown in SEQ ID NO:

99.

2. The anti-HER2 nanobody according to claim 1, characterized in that The anti-HER2 nanobody further comprises a framework region FR, wherein the framework region FR is one or more selected from the following groups: (1) FR1 shown in SEQ ID NO:30, FR2 shown in SEQ ID NO:31, FR3 shown in SEQ ID NO:32, and FR4 shown in SEQ ID NO:33; (2) FR1 shown in SEQ ID NO:37, FR2 shown in SEQ ID NO:38, FR3 shown in SEQ ID NO:39, and FR4 shown in SEQ ID NO:33; (3) FR1 shown in SEQ ID NO:43, FR2 shown in SEQ ID NO:44, FR3 shown in SEQ ID NO:45, and FR4 shown in SEQ ID NO:33; (4) FR1 shown in SEQ ID NO:37, FR2 shown in SEQ ID NO:49, FR3 shown in SEQ ID NO:50, and FR4 shown in SEQ ID NO:33; (5) FR1 shown in SEQ ID NO:51, FR2 shown in SEQ ID NO:31, FR3 shown in SEQ ID NO:32, and FR4 shown in SEQ ID NO:33; (6) FR1 shown in SEQ ID NO:37, FR2 shown in SEQ ID NO:55, FR3 shown in SEQ ID NO:56, and FR4 shown in SEQ ID NO:33; (7) FR1 shown in SEQ ID NO:60, FR2 shown in SEQ ID NO:61, FR3 shown in SEQ ID NO:62, and FR4 shown in SEQ ID NO:33; (8) FR1 shown in SEQ ID NO:66, FR2 shown in SEQ ID NO:67, FR3 shown in SEQ ID NO:68, and FR4 shown in SEQ ID NO:33; (9) FR1 shown in SEQ ID NO:37, FR2 shown in SEQ ID NO:72, FR3 shown in SEQ ID NO:73, and FR4 shown in SEQ ID NO:33; (10) FR1 shown in SEQ ID NO:77, FR2 shown in SEQ ID NO:78, FR3 shown in SEQ ID NO:79, and FR4 shown in SEQ ID NO:33; (11) FR1 shown in SEQ ID NO:30, FR2 shown in SEQ ID NO:81, FR3 shown in SEQ ID NO:82, and FR4 shown in SEQ ID NO:33; (12) FR1 shown in SEQ ID NO:86, FR2 shown in SEQ ID NO:87, FR3 shown in SEQ ID NO:88, and FR4 shown in SEQ ID NO:33; (13) FR1 shown in SEQ ID NO:30, FR2 shown in SEQ ID NO:61, FR3 shown in SEQ ID NO:90, and FR4 shown in SEQ ID NO:33; (14) FR1 shown in SEQ ID NO:94, FR2 shown in SEQ ID NO:95, FR3 shown in SEQ ID NO:96, and FR4 shown in SEQ ID NO:33; (15) FR1 shown in SEQ ID NO: 100, FR2 shown in SEQ ID NO: 101, FR3 shown in SEQ ID NO: 102, and FR4 shown in SEQ ID NO:

33.

3. The anti-HER2 nanobody according to claim 1, characterized in that The amino acid sequence of the VHH chain of the anti-HER2 nanobody is selected from one or more of SEQ ID NOs: 6-20.

4. An anti-HER2 antibody, characterized in that The anti-HER2 antibody comprises one or more VHH chains of the anti-HER2 Nanobody according to any one of claims 1 to 3.

5. The anti-HER2 antibody according to claim 4, characterized in that The anti-HER2 antibodies include monomers, bivalent antibodies, and / or multivalent antibodies.

6. A chimeric antigen receptor (CAR), characterized in that The CAR contains an extracellular domain, which comprises the anti-HER2 nanobody as described in any one of claims 1-3, or the anti-HER2 antibody as described in any one of claims 4-5.

7. A fusion protein, characterized in that The fusion protein has: (Z1) a first protein, comprising: an anti-HER2 Nanobody according to any one of claims 1 to 3, an anti-HER2 antibody according to any one of claims 4 to 5, or an active fragment thereof; (Z2) a second protein comprising a cytokine; and (Z3) optionally a linker between the first protein and the second protein.

8. A recombinant protein, characterized in that The recombinant protein has: (i) an anti-HER2 Nanobody according to any one of claims 1 to 3, an anti-HER2 antibody according to any one of claims 4 to 5, a fusion protein according to claim 7, or an active fragment thereof; and (ii) optionally a tag sequence to facilitate expression and / or purification.

9. A polynucleotide, characterized in that The polynucleotide encodes a protein selected from the following group: an anti-HER2 nanobody as described in any one of claims 1-3, an anti-HER2 antibody as described in any one of claims 4-5, a chimeric antigen receptor as described in claim 6, a fusion protein as described in claim 7, a recombinant protein as described in claim 8, or a combination thereof.

10. An expression vector, characterized in that: The expression vector contains the polynucleotide according to claim 9.

Images