Improving immune cell-based therapies against solid tumors with optogenetically engineered septin proteins

Abstract

A method for enhancing immune cell penetration into solid tumors, the method including at least one of the following: (a) obtaining a light-sensitive septin protein, the light-sensitive septin protein including a blue light-responsive domain, (b) transfecting an immune cell with the light-sensitive septin protein; and (c) periodically exposing the transfected immune cell to a blue light. Disclosed herein are also light-sensitive septin proteins that can be used for enhancing immune cell penetration into solid tumors.

Description

IMPROVING IMMUNE CELL-BASED THERAPIES AGAINST SOLID TUMORS WITHOPTOGENETICALLY ENGINEERED SEPTIN PROTEINSCROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of United States Provisional Application No. 63 / 514,017, filed July 17, 2023, the contents of which are incorporated herein by reference in their entireties for all purposes.FIELD OF THE INVENTION

[0002] The present disclosure relates to optogenetically engineered septin proteins and methods for improving cell-based therapies against solid tumors with optogenetically engineered septin proteins.STATEMENT CONCERNING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0003] This invention was made with government support under Grant No. GM134864 awarded by the National Institutes of Health. The United States Government has certain rights in the invention.BACKGROUND OF THE INVENTION

[0004] Cell-based immunotherapy has revolutionized the field of personalized medicine and has been recognized as an effective strategy for treating cancer (Chen, Q., Lu, L. & Ma, W. Efficacy, Safety, and Challenges of CAR T-Cells in the Treatment of Solid Tumors.Cancers (Basel). 14, 1-30 (2022)). One cell-based immunotherapy method that has recently been in the limelight is chimeric antigen receptor T (CAR-T) cell therapy. As of 2017, six CAR-T therapies have been approved by the US Food and Drug Administration (FDA).CAR-T cell therapy involves engineering native patient T cells to express chimeric antigen receptors that recognize tumor-specific antigens, thereby essentially ‘‘reprogramming” the patient's immune system to better recognize and attack cancerous cells. CAR T-cell therapyhas been shown to be successful in treating some liquid tumors, particularly hematopoietic malignancies (Filley. A. C., Henriquez, M. & Dey, M. CART immunotherapy: Development, success, and translation to malignant gliomas and other solid tumors. Front. Oncol. 8, 1-19 (2018); Yu, T., Yu, S. K., Xiang, Y., Lu, K. H. & Sun, M. Revolution of CAR Engineering For Next-Generation Immunotherapy In Solid Tumors. Front. Immunol. 13, 1-17 (2022)); however, CAR T-cell therapy has encountered challenges in treating solid tumors during preclinical studies and clinical trials (Drougkas, K. et al. Comprehensive clinical evaluation of CAR-T cell immunotherapy for solid tumors: a path moving forward or a dead end? J. Cancer Res. Clin. Oncol. (2022)).

[0005] Contrary to liquid tumors, solid tumors consist of abnormal and heterotypic cancerous cells that multiply uncontrollably and communicate through gap and tight junctions (Chen, K. et al. Clinical Investigations of CAR-T Cell Therapy for Solid Tumors. Front. Immunol. 13, 1-12 (2022)). These abnormal and heterotypic cancerous cells form a solid mass that can generate a unique immunosuppressive tumor microenvironment that can weaken CAR T-cell therapy or render it completely ineffective.

[0006] One of the critical obstacles preventing CAR-T cell therapy from being a highly efficacious treatment option for solid tumors is the dense extracellular matrix surrounding solid tumors. This dense extracellular matrix functions as a physical barrier and inhibits immune cell penetration into the tumor, thereby weakening the cytotoxicity of the CAR-T cells against the solid tumor. Another obstacle is the hostile tumor microenvironment surrounding the solid tumor. The tumor microenvironment typically contains areas of low oxygen (hypoxia) and nutrients. CAR-T cells are not designed to function under these environment conditions for long and, therefore, have a reduced vitality in these environments that ultimately impacts their antitumor activity. CAR-T cells also have to account for the highheterogeneity of solid tumors. Solid tumors are composed of a variety of different cell types, therefore making it more challenging for CAR-T cells to successfully identify specific and reliable tumor antigens (Castiello, L. et al. Chimeric Antigen Receptor Immunotherapy for Solid Tumors: Choosing the Right Ingredients for the Perfect Recipe. Cancers (Basel). 14, 5351 (2022)).

[0007] Solid tumors make up approximately 90% of adult human cancers and 40% of childhood cancers (Siegel, R. L., Miller, K. D., Fuchs, H. E. & Jemal, A. Cancer statistics, 2022. CA. Cancer J. Clin. 72, 7-33 (2022); Chhikara, B. S. & Parang, K. Global Cancer Statistics 2022: the trends projection analysis. Chem. Biol. Lett 2023, 451 (2022)). Due to the high proportion of solid tumors formed in all cancers and the low efficacy of current treatments, improving immunotherapy treatments for solid tumors is crucial.

[0008] The successful arrival of immune cells at tumor sites and infiltration into the targeted tumors are the prerequisite for effective cell-based immunotherapies (Chen, T. et al. Enhancement of T cell infiltration via tumor-targeted Th9 cell delivery improves the efficacy of antitumor immunotherapy of solid tumors. Bioact. Mater. 23, 508-523 (2023)). Indeed, increased immune cell penetration into solid tumors has been shown to lead to improved patient survival (Meissen, M. M., Sheybani, N. D., Leick, K. M. & Slingluff, C. L. Barriers to immune cell infiltration in tumors. J. Immunother. cancer 11, (2023)). Therefore, enhancing immune cell infiltration is a critical step to improve cell-based immunotherapies for solid tumors.

[0009] Several tumor-targeting light- or pH-inducible nanoplatforms have been developed to simultaneously modify the immunosuppressive microenvironment of solid tumors and promote intratumoral penetration of cytotoxic T cells through the co-delivery of drugs with various functionalities (Mohapatra, A. et al. Thermosusceptible Nitric-Oxide-Releasing Nitrogel for Strengthening Antitumor Immune Responses with Tumor Collagen Diminution and Deep Tissue Delivery during NIR Laser- Assisted Photoimmunotherapy. ACS Appl. Mater. Interfaces (2023); Feng, B. et al. Self-Amplified Drug Delivery with Light- Inducible Nanocargoes to Enhance Cancer Immunotherapy. A dv. Mater. 31, 1-10 (2019);Chen, Q. et al. Penetrable Nanoplatform for “Cold” Tumor Immune Microenvironment Reeducation. Adv. Sei. 7, (2020); Gong, Y. et al. Light-activated arginine-rich peptide- modified nanoparticles for deep- penetrating chemo-photo-immunotherapy of solid tumor. Nano Res. (2023)). For example, a pH-sensitive nanoliposome has been designed that disassembles and releases drugs losartan (LOS) and polyamidoamine-conjugated doxorubicin (DP) when exposed to an acidic tumor microenvironment (Li, X. et al. Multifunctional Liposomes Remodeling Tumor Immune Microenvironment for Tumor Chemoimmunotherapy. Small Methods 2201327, 1-14 (2023)). LOS improves T cell infiltration by inhibiting the activity of cancer-associated fibroblasts, while DP induces immunogenic cell death. This drug combination reversed the immunosuppressive tumor microenvironment and stimulated immune response.

[0010] Other strategies for assisting immune cell infiltration have been explored with different cell types. Neutrophils can cross tissue barriers and penetrate tumors through their self-deformation. Utilizing this capability, a tumor-penetrating neutrophil cytopharmaceutical has been engineered to carry agonists of the stimulator of interferon genes (STING).Activation of the STING pathway normalizes the tumor environment, thereby leading to enhanced infiltration and cytotoxicity of T cells. As a new member of CD4+T cells, Th9 cells are not only hyperproliferative, highly cytolytic, and less exhausted, they also can recruit / activate other immune cells (Lu, Y. et al. Th9 Cells Represent a Unique Subset ofCD4+ T Cells Endowed with the Ability to Eradicate Advanced Tumors. Cancer Cell 33,1048-106O.e7 (2018)). In a recent study. Th9 cells decorated with tumor-targeting peptides exhibited enhanced infiltration into solid tumors, thereby leading to improved antitumor efficacy (Chen, T. et al. Enhancement of T cell infiltration via tumor-targeted Th9 cell delivery' improves the efficacy of antitumor immunotherapy of solid tumors. Bioact. Mater. 23, 508-523 (2023)). Accordingly, Th9 cells can serve as promising candidates in treating solid tumors.

[0011] All the above strategies developed to enhance immune cell infiltration rely on the assistance of chemotherapeutic drugs or tumor-targeted peptides. These strategies can be cost intensive for patients since they involve the use of expensive chemotherapeutic drugs and require a rather complex process of reprogramming their immune cells. Additionally, there is an inherent risk that CAR-T therapies will activate an auto-immune response in the patient. Accordingly, the development of other novel and effective cell-based immunotherapy treatments that avoid the risks associated with current cell-based immunotherapy treatments would be beneficial.

[0012] Cellular functions and behaviors are orchestrated by protein activities in the cell; therefore, by controlling specific protein functions in the cell, one can control the cell’s behaviors and phenotypes. Septin proteins are cytoskeletal GTP-binding proteins that participate in various essential biological processes, such as cytokinesis, membrane remodeling, and cytoskeleton organization (Neubauer, K. & Zieger, B. The Mammalian Septin Interactome. Front. Cell Dev. Biol. 5, 1-9 (2017); Targa, B. et al. Septin filament coalignment with microtubules depends on SEPT9_il and tubulin polyglutamylation, and is an early feature of acquired cell resistance to paclitaxel. Cell Death Dis. 10, (2019);Marquardt. J., Chen, X. & Bi, E. Septin Assembly and Remodeling at the Cell Division SiteDuring the Cell Cycle. Front. Cell Dev. Biol. 9, 1-10 (2021)). A total of 13 mammalianseptin proteins (septin 1-12 and septin 14) have been identified and classified into four subgroups, i.e., septin 2, septin 3, septin 6, and septin 7. Septin 7 knockdown T cells have exhibited a fivefold improvement in transmigration efficiency through 3 and 5 -pm pores when compared to control cells (Tooley, A. J. et al. Amoeboid T lymphocytes require the septin cytoskeleton for cortical integrity and persistent motility. Nat. Cell Biol. 11, 17-26 (2009)).

[0013] In view of septin 7's impact on cell transmigration, a novel approach to improve immune cell penetration into solid tumors involving the direct manipulation of immune cell behaviors through the modification of septin 7 has been developed. The steps and components involved in this novel approach to improve immune cell penetration into solid tumors is described herein.SUMMARY

[0014] Disclosed herein are methods for enhancing immune cell penetration into solid tumors, the methods include at least one of the following: (a) obtaining a light-sensitive septin protein, the light-sensitive septin protein including a blue light-responsive domain, (b) transfecting an immune cell with the light-sensitive septin protein; and (c) periodically exposing the transfected immune cell to a blue light.

[0015] Disclosed herein are light sensitive septin proteins that include a blue light- responsive domain located at or near an allosteric site on the septin protein.BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The above and other objects, aspects, features, advantages and possible applications of embodiments of the present innovation will be more apparent from the following more particular description thereof, presented in conjunction with the following drawings. Like reference numbers used in the drawings may identify like components. Otheradvantages will become apparent as the description of the disclosure proceeds, taken in conjunction with the accompanying drawings.

[0017] FIG. 1 depicts the surface exposure, evolutionary' conservation, secondary structure (SS), and contact map used to identify potential LOV2 insertion sites into a septin 7.

[0018] FIG. 2 depicts the three-dimensional structure of a septin 7 protein predicted by AlphaFold (ID: AF-Q16181- Fl).

[0019] FIG. 3 depicts representative structures of a septin7-LOV2 dark and lit mutants after equilibrium DMD simulations.

[0020] FIG. 4 depicts the distribution of distances between the insertion sites of loop 5 for exemplary septin7-LOV2 (dark) and spetin7-LOV2 (lit) mutants during DMD simulations.

[0021] FIG. 5 depicts the transmigration efficiency of engineered MDA-MB-231 and NK92 cells expressing a septin7-LOV2-loop5 construct. Quantification of the number of transmigrated MDA-MB-231 and NK92 stable cells was examined under various conditions including dark for 4 hours, blue light for 4 hours, blue light 1 hour off and 1 hour on (4 hours total), and blue light 2 hours off and 2 hours on.

[0022] FIG. 6 depicts the cytotoxicity of NK92 cells expressing a septin7-LOV2-loop5 construct on MDA-MB-231 tumor spheroids. (A) depicts a generalization of the method used to create the MDA-MB-231 tumor spheroids. (B) depicts images of MDA-MB-231 tumor spheroids on each day after coculturing with NK92 cells expressing the septin7-LOV2-loop5 construct.

[0023] FIG. 7 depicts the cytotoxicity of engineered NK92 cells and CD8+T cells on Hela or B16.F10-TAG tumor spheroids. (A) depicts the cytotoxicity ofNK92 cells expressing a septin7-LOV2-loop5 construct on Hela tumor spheroids. (B) depicts thecytotoxicity' of CD8+T cells expressing a septin7-LOV2-loop5 construct on B16.F10-TAG tumor spheroids.DETAILED DESCRIPTION

[0024] The following description is of exemplary embodiments of the methods and products disclosed herein. This description is not to be taken in a limiting sense but is made merely for the purpose of describing the general principles and features of various aspects of the subject matter disclosed herein. The scope of the present disclosure is not limited by this description.

[0025] Disclosed herein is a method for enhancing immune cell penetration into solid tumors, the method includes at least one of the following: (a) obtaining a light-sensitive septin protein, the light-sensitive septin protein including a blue light-responsive domain, (b) transfecting an immune cell with the light-sensitive septin protein; and (c) periodically exposing the transfected immune cell to a blue light.

[0026] As used herein, the term '‘blue light” includes any wavelength having a frequency from about 450 nanometers to about 495 nanometers.

[0027] As used herein, the term “light-sensitive septin protein” includes any septin protein that has been genetically modified to include a stmcture (e g., a primary stmcture, a secondary structure, a tertiary structure or a quaternary structure) not naturally present, found or expressed in or by the septin protein that renders the septin protein sensitive to specific wavelengths of light.

[0028] As used herein, the term “blue light-responsive domain” includes any protein structure that undergoes a conformational change when exposed to blue light irradiation.

[0029] In exemplary embodiments of the method, the blue light-responsive domain is LOV-2.

[0030] In exemplary embodiments of the method, the blue light-responsive domain is located at an allosteric site on the light-sensitive septin protein.

[0031] As used herein, the tenn ‘‘allosteric site’' includes any site on the septin protein that is not an active site or a region that catalyzes a reaction and is a region on the protein that can either activate or inhibit protein activity of an active site on a septin protein.

[0032] In exemplary embodiments of the method, the allosteric site is a solvent accessible site of the septin protein.

[0033] In exemplary7embodiments of the method, the septin protein is septin 7. In other exemplary embodiments of the method, the septin protein is septin 7 and the blue light- responsive domain is located at or near loop 5 of septin 7.

[0034] In exemplary embodiments of the method, the light-sensitive septin protein is transfected into NK92 cells and / or CD8+T cells.

[0035] In exemplary embodiments of the method, the transfected immune cells are repeatedly exposed to blue light for one hour and not exposed to blue light for one hour.

[0036] In exemplary embodiments of the method, the transfected immune cells are repeatedly exposed to blue light for two hours and not exposed to blue light for two hours.

[0037] In exemplary embodiments of the method, the method further comprises coculturing the transfected immune cell with at least one solid tumor cell population. The at least one solid tumor cell population can include, but is not limited to, breast cancer cells, melanoma cells, carcinoma cells and / or any combination thereof.

[0038] It has been surprising discovered from performing the methods described herein that, through engineering a septin protein to include a blue light-responsive domain, a sensor- fused protein construct can be used to enhancing immune cell penetration into solid tumors.

[0039] Disclosed herein are light-sensitive septin proteins including a blue light- responsive domain located at or near an allosteric site on the septin proteins.

[0040] In exemplary embodiments, the light-sensitive septin protein is a light-sensitive septin 7 protein.

[0041] In exemplary embodiments, the light-sensitive septin protein is a light-sensitive septin 7 protein and the blue light-responsive domain is located at or near loop 5 of septin 7.

[0042] In exemplary7embodiments, the blue light-responsive domain is LOV-2. EXAMPLES

[0043] Example 1

[0044] This example investigates engineered septin 7 proteins and their ability to improve immune cell penetration into solid tumors.

[0045] Computer-aided design ofLCS7 construct and validation of the LCS7 construct by discrete molecular dynamics (DMD) simulations

[0046] The design of the LCS7 constructs with blue light sensing ability first involved identifying possible allosteric sites on septin 7 that the LOV2 domain could be inserted.

[0047] In biology, allostery is a common phenomenon whereby a perturbation occurs at one site (allosteric site) through ligand binding or light absorption, thereby inducing a conformational change of the molecule that influences the function / activity at a distal site (active site) (Wodak, S. J. et al. Allostery in Its Many Disguises: From Theory to Applications..S7 / / c7i / re 27, 566-578 (2019); Nussinov, R. & Tsai, C. J. Allostery in disease and in drug discovery. Cell 153, 293-305 (2013)). By engineering allostery, sensing modules have been integrated into target proteins to allow functional control via their sensor domains that undergo a conformational change upon detection of environmental cues including light, pH. temperature, and molecules (Dagliyan, O. et al. Engineering extrinsic disorder to controlprotein activity in living cells. Science 354, 1441-1444 (2016); Dagliyan, O. et al. Computational design of chemogenetic and optogenetic split proteins. Nat. Commun. 9, 4042 (2018); Dagliyan, O. et al. Engineering Pakl Allosteric Switches. ACS Synth. Biol. 6, 1257- 1262 (2017); Dagliyan, O. et al. Rational design of a ligand-controlled protein conformational switch. Proc. Natl. Acad Sci. U. S. A. 110, 6800-6804 (2013);Vishweshwaraiah, Y. L., Chen, J., Chirasani, V. R., Tabdanov, E. D. & Dokholyan, N. V. Two-input protein logic gate for computation in living cells. Nat. Commun. 12, 1-12 (2021)).

[0048] The creation of the LCS7 constructs involved introducing a blue light-responsive LOV2 domain into an allosteric site of septin 7. This LOV2 insertion site needed to satisfy two requirements.

[0049] One requirement was that the sensor domain insertion avoided disrupting the original structure and function of septin 7 when inactivated. Accordingly, surface exposed and evolutionarily non-conservative sites were selected as possible insertion sites. Five potential insertion sites were identified (loops 1-5, FIG. 1 and 2) by visually inspecting the three-dimensional structure of septin 7 (AlphaFold ID: AF-Q16181-F1) in PyMOL. The normalized solvent accessible surface area (SAS A) of the five potential insertion sites was calculated and the conservation scores for these sites were estimated (Table 1). All five insertion sites are surface exposed since most of their SASA values are larger than 40% (FIG.1 and 2, Table 1) (Stultz, C. M., White, J. V. & Smith, T. F. Structural analysis based on state-space modeling. Protein Sci. 2, 305-314 (1993); Ullman, O., Fisher, C. K. & Stultz, C. M. Explaining the structural plasticity of a- synuclein. J. Am. Chem. Soc. 133, 19536-19546 (2011)). Most of the residues at the predicted insertion sites are non-conservative except for loop2 in which both residues are relatively conserved (FIG. 1 and 2, Table 1).

[0050] Table 1: Analysis of the Potential Allosteric Sites for LOV2 insertionLoop number Insertion site Normalized solvent Secondary Normalized accessible surface area structure conservation scoresLoop 1 Lys89 60.7% Coil 0.425Thr90 15.9% -0.627Loop 2 Glyl03 82.5% Turn -0.309Glyl04 41.3% -0.580Loop 3 Asp229 92.4% Coil 0.502Asp230 43.9% 0.356Loop 4 Asn258 81.6% Turn 0.172Gly259 57.9% -0.873Loop 5 Glv277 44.7% Turn 0.562Glu278 79.8% 2.633

[0051] The conservation scores are normalized so that the average score for all amino acids is zero. Therefore, a normalized score larger than zero indicates the residue is not conserved compared to the average, while negative scores imply that the residues are relatively conserved. The normalized solvent accessible surface area is calculated by this formula: ASA / MaxASA, where ASA is the solvent accessible surface area and MaxASA is the maximum possible solvent accessible surface area for the residue.

[0052] The other requirement was that the structural disorder induced by LOV2 domain needed to inactivate septin 7’s active protein conformation when activated by blue light. Septin 7 interacts with other septin proteins forming core septin hexamers (septin2-septin6- septin7-septin7-septin6-septin2) and octamers (septin2-septin6- septin7-speitn9-septin9- septin7-septin6-septin2), which further polymerize into filaments and higher-order structures (Wang, X. et al. The role of septin 7 in physiology and pathological disease: A systematic review of current status. J. Cell. Mol. Med. 22, 3298-3307 (2018)). These assembled septin structures integrate with actin and microtubule cytoskeletal networks to give a cell its shape. The hetero-oligomer assembly mediated by septin 7 is regulated by a potentialphosphorylation site Y319 in septin 7 (Sandrock, K. et al. Characterization of human septin interactions. Biol. Chem. 392, 751- 761 (2011)). The constitutive phosphorylation of another active site, T198, was found to inhibit septin7-septin7 interactions, but maintained the interactions within septin7-septin6-septin2 (Wang, H. Y. et al. Protein kinase a-mediated septin7 phosphorylation disrupts septin filaments and ciliogenesis. Cells 10, 1-16 (2021)). The disruption of septin hexamer formation disturbs septin filament formation and ciliogenesis. Since both Y319 and T198 are essential for septin oligomer formation, the allosteric communication pathw ays from each of the five identified insertion sites (loop 1-5) to these two active sites were examined. Among the predicted top 10 allosteric communication pathways, loop5 ranked at the first place, meaning that loop5 had a stronger allosteric regulation than the other insertion sites. Utilizing these findings, a septin7-LOV2- loop5 construct was created in silico, that had the LOV2 domain inserted into loop 5 of septin 7, and subjected to Discrete Molecular Dynamics (DMD) simulations to determine whether activated LOV2 would cause a conformational change in septin 7 that leads to its inactivation.

[0053] LOV2 dark and lit mutants were used in the DMD simulations as the LOV2 domain in the septin7-LOV2-loop5 construct to simulate the dark-inactivated and blue light- activated protein structures of the fused construct. During simulations, the lit mutate of the LOV2 domain had residues R265-G277 of septin 7 stretched out forming a 0-sheet structure with the lit LOV2 domain (FIG. 3). This secondary structure pulled residues R265-G277 and the lit LOV2 domain closer together, thus resulting in a more compact septin7-LOV2 conformation. The structural change was predicted to prevent septin 7 from interacting with other septins due to steric hindrance around septin 7's active sites. During simulations, theLOV2 dark mutant had residues R265-G277 of septin 7 in a disordered conformation sittingbetween septin 7’s active sites and L0V2 (FIG. 3). The L0V2 dark mutant's domain was located further away from septin 7's active sites when compared to the lit mutant (FIG. 4) and therefore was predicted to not interfere with septin 7's ability to forms oligomers with other septin proteins. Accordingly, blue light illumination was expected to inhibit the oligomer forming function of the septin7-LOV2-loop5 construct.

[0054] Evaluating the septin7-LOV2-loop5 construct in live cells with blue light illumination

[0055] A plasmid bearing the septin7-LOV24oop5 construct was synthesized for transient expression in mammalian cells. The LOV2 domain was interested into loop 5 of septin 7 with a GSG linker. The plasmid was transfected into COS-7 cells and live cell imaging experiments were performed under dark and blue light exposure conditions to determine if any cell morphological changes occurred upon blue light irradiation. In the dark, COS-7 cells expressing the septin7-LOV2-loop5 construct spread on collagen grids with a dendritic phenotype. Upon blue light irradiation, extended cell protrusions formed. To quantify elongated cell protrusions, we selected six snapshots of cells evenly distributed within six hours in both dark and blue light conditions, respectively, and measured cell width and height. For wild type COS-7 cells, cell width and height are similar under both dark and blue light conditions, indicating that application of blue light didn’t affect the cell morphology of wild-type COS-7 cells. On the contrary, a significant increase in cell width and height was observed upon blue light illumination in COS-7 cells expressing the septin7- LOV2-loop5 construct, thereby demonstrating that the activation of the LOV2 domain disrupts septin 7’s ability to oligomerize with other septins. Again, one of septin 7’s primary functions is to aid in the production of cytoskeletal GTP -binding proteins that promotecytoskeleton organization. If this function is inhibited, then the cell’s cytoskeletal structure weakens, thereby causing the cell to adopt more elongated protrusions.

[0056] The morphological changes observed during the live cell imaging experiments are indicative that blue light activates the LOV2 domain in septin7-LOV2-loop5 construct and causes a structural disturbance in septin 7 that prevents its oligomerization with other septins. This experimental evidence supports the predictions gathered from the computational DMD experiments.

[0057] Evaluating the cell transmigration efficiency of live cells expressing the septin7- LOV2-loop5 construct

[0058] Protrusion formation is the first step for a cell to migrate and thus plays an essential role in cell migration and invasion (Gagliardi, P. A. et al. Real-time monitoring of cell protrusion dynamics by impedance responses. Sci. Rep. 5, 1-12 (2015); Zhu, J. & Mogilner, A. Comparison of cell migration mechanical strategies in three- dimensional matrices: A computational study. Interface Focus 6, (2016); Bergert, M., Chandradoss, S. D., Desai, R. A. & Paluch, E. Cell mechanics control rapid transitions between blebs and lamellipodia during migration. Proc. Natl. Acad. Sci. U. S. A. 109, 14434-14439 (2012)). To investigate whether inhibition of septin 7 affects cell transmigration, MDA-MB-231 and NK92 stable cell lines were generated that constitutively expressed the septin7-LOV2-loop5 construct. Transwell inserts with 8 pm and 3 pm pore sizes were used for MDA-MB-231 and NK92, respectively, based on their cell sizes. MDA-MB-231 and NK92 cells treated with blue light for four hours showed a similar transmigration efficiency that is not significantly different from cells in the dark (see FIG. 5). When different blue light frequencies (blue light Ih off / on and 2h off / on) were tested; however, a significant increase of transmigrated cells was observed. A possible explanation for the similar transmigration efficiencies under darkand constant blue light conditions could be that constant exposure of blue light to the cells causes toxic effects (Alghamdi, R. A., Exposito-Rodriguez, M., Mullineaux, P. M., Brooke, G. N. & Laissue, P. P. Assessing Phototoxicity in a Mammalian Cell Line: How Low Levels of Blue Light Affect Motility in PC3 Cells. Front. Cell Dev. Biol. 9, 1-11 (2021)).

[0059] Overall, the results from the cell transmigration experiments indicate that the septin7-LOV2-loop5 construct can be used to improve a cell’s transmigration efficiency when the cell is subjected to periodic blue light exposure.

[0060] Evaluating the cytotoxicity of engineered immune cells expressing the septin7- LOV2-loop5 construct against 3D tumor spheroids

[0061] To explore whether increased transmigration efficiency can assist immune cells in penetrating solid tumors, 3D tumor spheroids models were established using human breast cancer cell line, MDA-MB-231, and cocultured with lenti viral transduced NK92 cells expressing the septin7-LOV2-loop5 construct (NK92-LCS7). Solid tumors in vivo are protected by a dense extracellular matrix that prohibits immune cell infiltration. To mimic this in vivo environment, collagen was supplemented in the cell culture during tumor spheroid formation (FIG. 6). Collagen addition was found to be crucial to the formation of round, uniform, and solid tumor spheroids. Tumor spheroids were cocultured with NK92-LCS7 or wild type NK92 (NK92-WT) cells and cultured under dark and various blue light conditions (FIG. 6). Tumor spheroids started to fade after two days of incubation with NK92-LCS7 under blue light conditions (FIG. 6), indicating that the NK92-LCS7 cells were capable of killing tumor cells. When the solid tumors were cocultured with NK92-WT in both dark and blue light conditions or incubated with NK92-LCS7 in the dark (FIG. 6), an initial increase in integrated density of tumor spheroids was observed before the integrated density decreased slowly during the incubation period.

[0062] Interestingly, the tumor spheroids became hollow inside after two days of coculturing with NK92-LCS7 under blue light conditions. Though the dark circle on the outer side of the spheroids could be collagen matrix mixed with tumor cells, the fact that the tumor spheroids became hollow on the inside indicates that the NK92-LCS7 immune cells can penetrate the dense extracellular matrix and reach tumor cells located inside the solid tumor mass. This finding further demonstrates that inactivating septin 7’s abili ty to fonn oligomers is an effective strategy7for improving immune cell infiltration into tumor spheroids.

[0063] The percent changes in integrated density7of tumor spheroids after five days of incubation with either NK92-WT or NK92-LCS7 under dark or various blue light conditions was calculated. Compared to the NK92-WT control and NK92-LCS7 in the dark, the integrated density decreased significantly for tumor spheroids cocultured with NK92-LCS7 under different blue light conditions.

[0064] Next, the generalizability7of enhancing immune cell infiltration and cytotoxicity7against tumor spheroids with the septin7-LOV2-loop5 construct was investigated. 3D tumor spheroids were fabricated using human cervical carcinoma HeLa cells or mouse B16.F10- TAG melanoma cells, respectively. Hela tumor spheroids were synthesized with the same method used to synthesize the MDA-MB-231 tumor spheroids and cocultured with either NK92-LCS7 orNK92-WT cells. The integrated density of tumor spheroids increased initially and then decreased slowly during the incubation, as seen with the MDA-MB-231 tumor spheroids. The Hela tumor spheroids incubated with NK92-LCS7 under blue light irradiation had a significantly reduced integrated density, thus indicating that the NK92-LCS7 are capable of eliciting a massive tumor killing potential and high cytotoxicity7when septin 7 is inactivated. After five days incubation, about 95% of the tumor spheroids were eliminated byNK92-LCS7 with blue light treatment, while only 65% of the tumor spheroids were destroyed by NK92-WT in both dark and blue light conditions or NK92-LCS7 in the dark (FIG. 7).

[0065] 3D tumor spheroids of mouse B16.F10-TAG melanoma cells were loosely- packed with random shapes when growing in ultralow attachment 96-well plates. Therefore, a hanging drop approach was applied to establish the melanoma tumor spheroids. The number of seeded cells and the volume of hanging drops was optimized to produce melanoma tumor spheroids with a round and uniform shape. B16.F10-TAG tumor spheroids were cocultured with either lentiviral transduced mouse primary CD8+T cells expressing the septin7-LOV2- loop5 construct (T-LCS7) or wild ty pe CD8+T cells (T-WT). The integrated density of B16.F10-TAG tumor spheroids decreased substantially since the beginning of incubation for all the four different conditions (FIG. 4A and FIG. 4B). An increase in tumor density- was not observed, which is distinct from the observations gathered from the Hela and MDA-MB-231 tumor spheroids. As B16.F10-TAG cells don’t aggregate as tightly as Hela or MDA-MB-231 cells, the loose structure of B16.F10-TAG tumor spheroids are easier for immune cells to penetrate. Therefore, solidity- of tumor spheroids is an important feature, which protects cancer cells from immune cell attacking.

[0066] Overall, the integrated density of tumor spheroids incubated with T-LCS7 under blue light illumination decreased faster than those cocultured with T-WT or T-LCS7 in the dark. After five days of coculturing, 99% of the tumor spheroids were devoured by T-LCS7 under blue light, while about 90% of the tumor spheroids were eliminated by T-WT or T- LCS7 in the dark.

[0067] Overall, the above example clearly demonstrates that the methods and constructs described herein are effective at improving immune cell penetration into solid tumors and killing cancerous cells located within solid tumors.

[0068] Materials and Methods for Example 1

[0069] Structural Bioinformatics of Septin 7, DMD simulations, and Simulation Data Analysis:

[0070] Structural bioinformatics analysis of septin 7 was performed using the three- dimensional structure predicted by AlphaFold (ID: AF-Q16181-F1). The conservation value for every residue was calculated using ConSurf (Celniker, G. et al. ConSurf: Using evolutionary data to raise testable hypotheses about protein function. Isr. J. Chem. 53, 199- 206 (2013); Ashkenazy', H. et al. ConSurf 2016: an improved methodology' to estimate and visualize evolutionary' conservation in macromolecules. Nucleic Acids Res. 44, W344-W350 (2016); Ashkenazy7, H., Erez, E., Martz, E., Pupko, T. & Ben-Tai, N. ConSurf 2010: Calculating evolutionary conservation in sequence and structure of proteins and nucleic acids. Nucleic Acids Res. 38, 529-533 (2010)). The secondary' structure and the solvent-accessible surface area were calculated and predicated using STRIDE (Heinig, M. & Frishman, D. STRIDE: A web server for secondary structure assignment from known atomic coordinates of proteins. Nucleic Acids Res. 32, 500-502 (2004)). The contact map of septin 7 was plotted using lupyter Notebook.

[0071] The in silico septin7-LOV2-loop5 construct was constructed according to the following steps. First, the N- and C-termini of LOV2 (PDB ID: 2V1A) were manually attached to the loop5 insertion site of septin 7, loop 5 was then cut and all the residues were renumbered based on the septin7-LOV2-loop5 design in PyMOL. Then, the unconnected structure was used as a template in SWISS-MODEL (Waterhouse, A. et al. SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res. 46, W296- W303 (2018)) to create the complete septin7-LOV2-loop5 amino acid sequence for homology modeling. The LOV2 dark mutant (C450A) and lit (I510E / I539E) mutant wereintroduced into the sequence during homology' modeling to build their corresponding structures. Finally, the flavin mononucleotide cofactor was reinstalled into the septin7-LOV2- loop5 (dark) and septin7-LOV2-loop5 (lit) structures in PyMOL. These structures were then used to initiate DMD simulations. DMD simulations were conducted for 2 x 106time steps (~50 ps per step) with a constant temperature at 0.62 kcal / mol kB. The distance between residues at the insertion site was calculated using GROMACS (Abraham, M. J. et al.Gromacs: High performance molecular simulations through multi- level parallelism from laptops to supercomputers. SoftwareX 1-2, 19-25 (2015)).

[0072] Molecular cloning of septin7-LOV2-loop5 construct:

[0073] The cloning plasmid Septin-7_pET-28a(+)-TEV with septin 7 DNA sequence was purchased from GenScript® and used as the template for PCR reactions. Primers (sept7-F and sept7-R) with Hindlll and Sall restriction sites were designed and used to amplify septin 7 sequence from the template. The resulting PCR product was isolated by DNA gel electrophoresis and purified using Monarch® DNA Gel Extraction Kit (Cat# T1020L). Then, the PCR product and plasmid pmCherry-Cl_SEPT9 il (Addgene® item# 71622) were digested separately by incubating them with Hindlll (NEB™, Cat# R3104S) and Sall (NEB™, Cat# R3138S) enzymes according to the manufacturer’s protocol. The digested DNA sequences were isolated and purified. The septin 7 DNA sequence was ligated to vector pmCherry-Cl through DNA ligation.The ligation mixture was transformed into homemade DH5a Escherichia coli competent cells (Zymo Research, Cat#T3002). The transformed E. coli cells were grown on LB plates with kanamycin at 37 °C overnight. On the next day, single colonies were picked and cultured in LB medium with kanamycin at 220 rpm, 37 °C overnight. The plasmids were extracted using Monarch® Plasmid Miniprep Kit (NEB™, Cat#T1010L) and sent for Sanger sequencing (EtonBiosciences). The constructed plasmid, pmCherry-Cl_SEPT7, can be used to express septin 7 protein with mCherry tag at the N-tenninus in mammalian cells.

[0074] To integrate the LOV2 domain into septin 7 at the loop 5 insertion site, first the LOV2 DNA sequence was amplified using designed primers (SEQ. ID. NO. 1 and 2) and the template (pBabe-PI(WT)- Src(WT)-mCherry. Addgene® item # 87356). Amplified DNA products of LOV2 were isolated and purified by DNA electrophoresis and DNA gel extraction. Then, the LOV2 DNA products were used as the mega primer and pmCheny- C1_SEPT7 was used as the template in a PCR reaction. After the PCR reaction, the original template was digested by adding Dpnl (NEB™, Cat# R0176S) enzy me based on the manufacturer’s instructions. The PCR mixture was transformed into DH5a competent cells and cultured overnight on LB plates with kanamycin at 37 °C. Single colonies were selected, cultured, and subjugated to extraction processes to isolate plasmid DNA. The plasmid DNA sequence was confirmed using the protocol described above. The generated plasmid carrying the septin7-LOV2-loop5 construct was named pmCheny-C l_SEPT7-LOV2-Loop5.

[0075] To generate stable cell lines, lentiviral vectors were designed encoding the septin7-LOV2-loop5 construct. Primers (sept7-Lentil-F and sept7-Lentil-R, SEQ. ID. NO. 3 and 4) were used to amplify septin7-LOV2 from plasmid pmCherry-Cl_SEPT7-LOV2- Loop5. The PCR product was isolated and purified by DNA electrophoresis and DNA gel extraction. Then, Notl (NEB™, Cat# R3189S) and Avril (NEB™, Cat# R0174S) were used as restriction enzymes to digest the PCR product and the plasmid pLV-EFla-IRES- Blast (Addgene® item# 85133), respectively. After DNA digestion, the products were isolated and purified by DNA electrophoresis and DNA gel extraction. The septin7-LOV2 fragment was ligated to pLV-EFla-IRES-Blast vector and the plasmid sequence was confirmed by sequencing.

[0076] All of the above PCR reactions were performed using Q5 high-fidelity' master mix (NEB™, Cat#M0492S). The primers w ere ordered from Millipore Sigma®. The complete gene sequence of Septin7-LOV2-mCherry is SEQ. ID. NO. 5.

[0077] Cell Culture:

[0078] HeLa (ATCC® CCL-2), COS-7 (ATCC® CRL-1651), and MDA-MB-231 (ATCC® HTB-26) cells were grown under 37 °C and 5% CO2 in complete Dulbecco’s modified eagle medium (BioWhittaker™, Cat# 12-604Q) that was supplemented with 10% fetal bovine serum (Coming™, Cat# MT35010CV), streptomycin / penicillin solution (Gibco™, Cat# 15070063), and non-essential amino acid (Cytiva™, Cat# SH30238.01). B16.F10-TAG cells were cultured in RPMI-1640 Media (Gibco™, Cat# 61870036) containing 10 mM HEPES (DOT™ Scientific, DSH75050-1000), 50 pM 2- mercaptoethanol (Thermo Fisher® Scientific, Cat# AC125470100), 25 pg / mL sodium pyruvate (Spectrum Chemical, Cat# SO193), 10% fetal bovine serum (Coming™, Cat# MT35010CV), and streptomycin / penicillin solution (Gibco™, Cat# 15070063). Mouse primary CD8+T cell were isolated using Easy Sep™ mouse CD8+T cell isolation kit (STEMCELL Technologies, Cat# 19853). Mouse primary CD8+T cells were grown in the above RMPI media supplemented with 30 U / mL IL- 2 (Miltenyi®, Cat# 130-097-744) and Dynabeads™ mouse T-activator CD3 / CD28 (Thermo Fisher® Scientific, Cat# 11456D). NK92 (ATCC CRL-2407) cells were cultured in the complete medium prepared by mixing 500 mL MyeloCult™ H5100 (STEMCELL Technologies, Cat# 05150) with 63 mL Gibco™ Horse Serum (Thermo Fisher® Scientific, Cat# 16050130) and 10 pg IL-2 (Miltenyi®. Cat# 130-097-744).

[0079] Transient expression of the septin7-LOV2-loop5 construct and lentiviral transduction:

[0080] To transiently express the septin7-LOV2-loop5 construct in cells, 50,000 COS-7 cells were seeded on a 24-well plate and cultured overnight. On the following day, transfection buffer and reagent were mixed with 500 ng of plasmid. Then, the mixture was transferred to a cell culture according to the manufacturer’s protocol (Avantor®, Cat#76299- 634). After 24 hours of incubation, transfection efficiency was checked, and protein expression was confirmed by inspecting the red fluorescence under a fluorescent microscope.

[0081] To generate stable cell lines expressing the septin7-LOV2-loop5 construct, lentiviral transduction was performed. First, lenti virus containing the septin7-LOV2-loop5 construct was produced and transfected into HEK cells. The lentivirus containing the septin7- LOV2-loop5 construct was produced from the lentiviral packaging plasmid psPAX2 (Addgene®, item# 12260), the envelope plasmid pMD2.G (Addgene®, item# 12259), and the engineered plasmid pLV-EFla-IRES -Blast containing LCSP. The HEK cells were incubated at 37 °C and 5% CO2. Cell media containing lentivirus was collected following two days of incubation. Lentiviral supernatant was filtered through a 0.45 pm sterile PVDF membrane to remove cell debris and the lentivirus solution was stored at -80 °C. Then, lentiviral transduction was performed on different cell lines. The lentivirus was concentrated by mixing lentiviral supernatant with 1 / 3 volume of PEG 6000 solution for 4 hours under 4 °C. The PEG 6000 solution was prepared by dissolving 80 g PEG 6000 and 14 g NaCl in ultrapure water and 20 mL lOx PBS. After the chemicals were completely dissolved, we adjusted the pH to 7.0 ~ 7.2 and the final volume to 200 mL. The solution was sterilized through filtration of 0.2 pm membrane. The lentiviral solution with PEG 6000 was centrifuged at 1600 g, 4 °C for 1 hour. After centrifugation, the supernatant was removed and the lentivirus was resuspended with corresponding cell media. To generate MDA-MB-231 stable cell lines. lentivirus and 8 pg / mL polybrene was added into the cell media (complete DMEM media)and incubated overnight. To transduce NK92 cells, lentivirus and 8 pg / mL polybrene were mixed with dispersed NK92 cells, and then the cells were centrifuged at 1000 g for 1 hour.To transduce mouse primary CD8+T cells, lentivirus and 8 pg / mL polybrene were added into the cell culture that contained IL-2 and Dynabeads and the cells were cultured overnight. Successfully transduced cells were identified by red fluorescence and the cells were sorted by flow7cytometry.

[0082] Coculture of engineered immune cells with tumor spheroids:

[0083] To generate MDA-MB-231 or Hela tumor spheroids, Nunclon™ Sphera™ ultralow attachment 96-well plate with U-shaped bottom (Thermo Fisher® Scientific, Cat# 174925) were used. Specifically, on day 0, 104cells were seeded in 100 pL of complete DMEM media for each well. The plate was centrifuged at 290 g for 3 min, and placed back into an incubator at 37°C. On day 1, 100 pL of the media containing 6 pg / mL collagen I w as gently added into each w ell at room temperature and the plate was centrifuged at 100 g for 3 min. The tumor spheroids were cultured for another three days at 37°C. On day 4, the media was changed in each well to NK92 media and 3x105engineered or wild type NK92 cells were added. The effector over target ratio is 10: 1. The tumor spheroids w ere cocultured with NK92 cells for another five days at 37°C.

[0084] To make B16.F 10-TAG tumor spheroids, the hanging drop method was performed. On day 0, 5000 cells were seeded in 20 pL RPMI media containing 0.25% methyl cellulose on the lid of a 100 mm petri dish. 10 mL sterile water was added to the petri dish and the lid was turned over and placed in an incubator. The cell droplet would hang on the lid and the water would prevent the droplet from evaporating. The B16.F10-TAG cells were cultured for four days. On day 4. the B16.F 10-TAG tumor spheroids were transferred toa normal 96-well plate that was previously covered with 1% agarose at the bottom. 1.5 x 105engineered or wild type T cells were added to each well and cocultured for five days.

[0085] Preparation of elastic collagen grids:

[0086] 2D collagen grids were fabricated based on a previous protocol (Tabdanov, E. D. et al. Bimodal sensing of guidance cues in mechanically distinct microenvironments. Nat. Commun. 9, (2018)). Specifically, rabbit polyclonal anti-collagen-1 antibody (Abeam®, Cat# ab34710) was labeled with biotin (Sigma- Aldrich®, Cat# H1759) and Alexa Fluor® 488 (Invitrogen™, Cat# A20000) following the manufacturer’s instructions. After the reaction, the mixture was transferred to a Slide- A-Lyzer™ MINI Dialysis Device (Thermo Fisher® Scientific, Cat# 69560) and dialysis was performed overnight in cold PBS. The labeled anticollagen antibody was kept at 4 °C for future usage. To make collagen grids, 3 pL of labeled anti-collagen antibody solution was added on top of a composite elastomeric stamp printed with parallel 15 pm spaced lines. The antibody droplet was covered with a 15 mm round glass coverslip for 2 hours at room temperature to make an effective stamp surface coating. Then, the stamps were rinsed in ultrapure water and dried under flowing nitrogen gas. The first anti-collagen antibody pattern was printed horizontally onto a square glass coverslip and then a second layer was printed vertically onto the same coverslip to make a grid pattern. 10 pL of polymerizing polyacrylamide (PAA) gel with G' = 8.6 kPa, which was prepared according to a reported protocol, was added onto an activated 35 mm glass-bottom Petri dish (MatTek Corp., Part# P35G- 1.0-20-C) and the PAA gel was immediately covered with the gnd pattern. The Petri dish was previously activated by 3-(tnmethoxysilyl) propyl methacrylate (Sigma- Aldrich®, Cas#2530-85-0) in acetic acid and ethanol solution. After the PAA gel polymerized, the PAA “sandwich” was incubated with ultrapure water for 10 min and the glass coverslip was gently removed. Finally, the water was aspirated.1 mL of 1mg / mL rat collagen type-1 (Coming, Cat#354249) in cold PBS was added, and the Petri dish was incubated at 4 °C overnight. On the following day, the collagen solution was aspirated, and the collagen grids were rinsed with cold PBS three times. The collagen grids were stored in cold sterile PBS before usage.

[0087] Cell imaging and data analysis:

[0088] 100,000 of transfected COS-7 cells w ere seeded onto collagen grids per Petri dish in complete DMEM media. The cells were place in the incubator for 4 hours to let them attach to the collagen grids. Then, the culture media w as changed, and the unattached cells were removed before live cell imaging experiments.

[0089] High-resolution cell imaging experiments were performed using a 10X objective on a Leica SP8 confocal microscope with sequential lasers (405, 488, 561, and 647 nm). 561 nm (0.7% laser intensity) was used to visualize COS-7 cells expressing LCS7, w ich included a mCherry tag, and 488 nm (0.2% laser intensity) was applied to image collagen girds, as well as activate the LOV2 domain. The live cell imaging experiments were conducted in a Tokai Hit stage top incubator under 37 °C and 5% CO2. Cell behavior in the dark was recorded for 6 hours, and then the blue light was switched on and the live cells were imaged for 12 hours. ImageJ 1.52k was utilized to measure the width and height of each cell and the Leica software w as used to produced cell images and videos.

[0090] Statistical analysis:

[0091] A two-sample t-test was used to calculate the p values of two samples. For multiple populations, one-way analysis of variance (ANOVA) and Tukey’s multiple comparison post-hoc test were adopted. A two-sided 95% confidence interval was used for all the statistical analysis. The statistical analysis was performed using R version 3.5.2. All the figures were generated and assembled using Jupyter Notebook and Adobe Illustrator.

[0092] It should be understood that modifications to the embodiments disclosed herein can be made to meet a particular set of design criteria. For instance, the number of or configuration of components or parameters may be used to meet a particular obj ective.

[0093] It will be apparent to those skilled in the art that numerous modifications and variations of the described examples and embodiments are possible in light of the above teachings of the disclosure. The disclosed examples and embodiments are presented for purposes of illustration only. Other alternative embodiments may include some or all of the features of the various embodiments disclosed herein. For instance, it is contemplated that a particular feature described, either individually or as part of an embodiment, can be combined with other individually described features, or parts of other embodiments. The elements and acts of the various embodiments described herein can therefore be combined to provide further embodiments.

[0094] It is the intent to cover all such modifications and alternative embodiments as may come within the true scope of this disclosure, which is to be given the full breadth thereof. Additionally, the disclosure of a range of values is a disclosure of every numerical value within that range, including the end points. Thus, while certain exemplary embodiments of the apparatus and process for biopolymer scaffold formation and / or utilization and methods of making and using the same have been discussed and illustrated herein, it is to be distinctly understood that the disclosure is not limited thereto but may be otherwise variously embodied and practiced within the scope of the following claims.

[0095] Sequence Disclosure

[0096] SEQ. ID. NO. 1 is a forward primer used to amplify the LOV2 DNA sequence and its sequence is as follows:GGGGTGTGGCGGAAGTGGAAAACGGCGGGTCAGGGTTGGCTACTACACTTGAACG (SEQ ID NO: 1).

[0097] SEQ. ID. NO. 2 is a reverse primer used to amplify the LOV2 DNA sequence and its sequence is as follows:CGCAGGATGGTGAAATCGCAGTGCTCCCCTGACCCAAGTTCTTTTGCCGCCTCAT(SEQ ID NO: 2).

[0098] SEQ. ID. NO. 3 is a forward primer used to amplify' the septin-7-LOV2 from plasmid pmCheny-Cl_SEPT7-LOV2-Loop5 and its sequence is as follows:CTTCCATTTCAGGTGTCGTGAGGATCCATGGTGAGCAAGGGCGAGGAGG (SEQ ID NO: 3).

[0099] SEQ. ID. NO. 4 is a reverse primer used to amplify the septin-7-LOV2 from plasmid pmCherry-Cl_SEPT7-LOV2-Loop5 and its sequence is as follows:GGCCCGTCGACTCTAGAGCGGCCGCTTAGAAGATTTTACCTTTCTTTT (SEQ ID NO: 4).

[0100] SEQ. ID. NO. 5 is the complete gene sequence of the Septin7-LOV2-mCherry construct and its sequence is as follows:ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGT GAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTCCGGACTCAGATCTCGAGCTCAAGCTTGCATGAGCGTTAGCGCGCGTAGCGCGGCGGCGGAAGAGCGTAGCGTGAATAGCAGCACCATGGTGGCGCAACAGAAAAACCTGGAAGGCTACGTTGGTTTCGCGAACCTGCCGAACCAGGTGTATCGTAAAAGCGTTAAGCGTGGTTTCGAATTTACCCTGATGGTGGTTGGCGAGAGCGGTCTGGGCAAAAGCACCCTGATCAACAGCCTGTTTCTGACCGACCTGTATAGCCCGGAATATCCGGGTCCGAGCCACCGTATTAAGAAAACCGTGCAGGTTGAACAAAGCAAAGTGCTGATCAAAGAGGGTGGTGTGCAGCTGCTGCTGACCATTGTGGATACCCCGGGTTTCGGCGACGCGGTTGATAACAGCAACTGCTGGCAACCGGTGATCGACTACATTGATAGCAAATTTGAAGACTATCTGAACGCGGAGAGCCGTGTTAACCGTCGTCAGATGCCGGATAACCGTGTGCAATGCTGCCTGTACTTCATTGCGCCGAGCGGTCATGGCCTGAAGCCGCTGGACATTGAATTTATGAAACGTCTGCACGAGAAGGTTAACATCATTCCGCTGATCGCGAAAGCGGATACCCTGACCCCGGAGGAATGCCAGCAATTCAAGAAACAGATCATGAAGGAAATTCAAGAGCACAAGATCAAAATTTACGAATTTCCGGAAACCGACGATGAGGAAGAGAACAAACTGGTGAAGAAAATTAAGGACCGTCTGCCGCTGGCGGTGGTTGGTAGCAACACCATCATTGAAGTGAACGGTAAACGTGTTCGTGGCCGTCAGTATCCGTGGGGTGTGGCGGAAGTGGAAAACGGCGGGTCAGGGTTGGCTACTACACTTGAACGTATTGAGAAGAACTTTGTCATTACTGACCCAAGATTGCCAGATAATCCCATTATATTCGCGTCCGATAGTTTCTTGCAGTTGACAGAATATAGCCGTGAAGAAATTTTGGGAAGAAACTGCAGGTTTCTACAAGGTCCTGAAACTGATCGCGCGACAGTGAGAAAAATTAGAGATGCCATAGATAACCAAACAGAGGTCACTGTTCAGCTGATTAATTATACAAAGAGTGGTAAAAAGTTCTGGAACCTCTTTCACTTGCAGCCTATGCGAGATCAGAAGGGAGATGTCCAGTACTTTATTGGGGTTCAGTTGGATGGAACTGAGCATGTCCGAGATGCTGCCGAGAGAGAGGGAGTCATGCTGATTAAGAAAACTGCAGAAAATATTGATGAGGCGGCAAAAGAACTTGGGTCAGGGGAGCACTGCGATTTCACCATCCTGCGTAACATGCTGATTCGTACCCACATGCAGGACCTGAAAGATGTGACCAACAACGTTCACTACGAAAACTATCGTAGCCGTAAGCTGGCGGCGGTGACCTATAACGGTGTTGACAACAACAAGAACAAAGGCCAGCTGACCAAAAGCCCGCTGGCGCAAATGGAAGAGGAACGTCGTGAGCACGTTGCGAAGATGAAGAAAATGGAGATGGAAATGGAGCAGGTGTTCGAAATGAAGGTGAAAGAGAAGGTTCAAAAACTGAAGGACAGCGAAGCGGAGCTGCAGCGTCGTCACGAACAAATGAAGAAAAACCTGGAAGCGCAGCACAAAGAGCTGGAGGAAAAGCGTCGTCAATTTGAAGATGAGAAGGCGAACTGGGAGGCGCAGCAACGTATCCTGGAACAGCAGAATAGCAGCCGCACCCTGGAGAAAAATAAAAAGAAAGGTAAAATCTTCTAA (SEQ ID NO: 5).

Claims

What is claimed is:

1. A method for enhancing immune cell penetration into solid tumors, the method comprising: obtaining a light-sensitive septin protein, the light-sensitive septin protein including a blue light-responsive domain; transfecting an immune cell wi th the light-sensitive septin protein; and periodically exposing the transfected immune cell to a blue light.

2. The method according to claim 1, wherein the blue light-responsive domain is LOV-2.

3. The method according to claim 1, wherein the septin protein is septin 7.

4. The method according to claim 1, wherein the blue light-responsive domain is located at an allosteric site on the light-sensitive septin protein.

5. The method according to claim 4, wherein the light-sensitive septin protein is septin 7 and the allosteric site is located at or near loop 5 of septin 7.

6. The method according to claim 1, wherein the immune cell is selected from the group consisting of NK.92 cells and CD8+T cells.

7. The method according to claim 1, wherein the transfected immune cell is repeatedly exposed to blue light for one hour and not exposed to blue light for one hour.

8. The method according to claim 1, wherein the transfected immune cell is repeatedly exposed to blue light for two hours and not exposed to blue light for two hours.

9. The method according to claim 1, the method further comprising: co-culturing the transfected immune cell with at least one solid tumor cell population.

10. The method according to claim 9, wherein the at least one solid tumor cell population includes breast cancer cells, melanoma cells, carcinoma cells and / or any combination thereof.1 1. A light-sensitive septin protein comprising a blue light-responsive domain located at or near an allosteric site of the septin protein.

12. The light-sensitive septin protein according to claim 11 , wherein the blue light- responsive domain is LOV-2.

13. The light-sensitive septin protein according to claim 11 , wherein the light-sensitive septin protein is a light-sensitive septin 7 protein.

14. The light-sensitive septin protein according to claim 13. wherein the allosteric site that the blue light-responsive domain is located at or near is loop 5 of the septin 7 protein.

Images