Use of virma protein in preparation of drug for regulating and controlling early development of nervous system

Abstract

The present invention provides a use of a VIRMA protein in preparation of a drug for regulating and controlling the early development of a nervous system, and early neural system-specific VIRMA knocked-out cells and animal models are also constructed. In the present invention, an important function of VIRMA in an m6A methyltransferase complex in the nervous system is disclosed.

Description

Application of VIRMA protein in the preparation of drugs regulating early developmental functions of the nervous system Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the use of VIRMA protein in preparing drugs for regulating the early developmental function of the nervous system. Background Art

[0002] VIRMA is an m6A methyltransferase. Early studies found that m6A modification is very abundant in the brain. Recent structural analysis of the VIRMA protein has found that VIRMA protein is a very important scaffold protein in the methyltransferase complex, suggesting that VIRMA protein plays an important role in m6A modification and may play a certain functional role in the nervous system. However, there have been few reports on the function and mechanism of action of VIRMA protein.

[0003] Currently, functional research on VIRMA protein has only partially focused on tumor-related functions and individual studies on its role in the reproductive system. Functional testing in the nervous system and its application in brain-related diseases have not yet been reported and urgently need further answers.

[0004] Currently, there are relatively few reported studies on the role of VIRMA proteins, which are concentrated in relatively small research areas. Research on the functional role of VIRMA proteins (vir-like m6A methyltransferase-associated protein) is extremely limited, especially its function and application in the nervous system are almost blank. Reported VIRMA-related research technical solutions are mostly applicable to the detection of human samples. There are very few reference solutions for the detection of mouse samples, and these are not suitable for research on the nervous system. The research techniques and methods used for different tissues in different species vary, and existing technical solutions for VIRMA protein function research are not fully applicable to studies on the mouse nervous system. Therefore, providing a method for in-depth research on VIRMA, a key component of m6A methylation modification, at the protein and molecular levels to explore the molecular mechanism of VIRMA proteins in the nervous system is of great research value for the study of brain-related diseases.

[0005] Summary of the Invention

[0006] To address the shortcomings of the prior art, the present invention aims to provide the use of VIRMA protein in the preparation of a drug for regulating early nervous system development. The present invention primarily provides VIRMA, an important protein for regulating early nervous system development, as well as the function and application of the protein in nervous system development.

[0007] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0008] In a first aspect, the present invention provides use of VIRMA protein in the preparation of a drug for regulating the early developmental function of the nervous system.

[0009] By exploring the functional role of the VIRMA protein in the nervous system, this study proposes for the first time a key role of VIRMA, namely its involvement in regulating early nervous system development. The authors constructed VIRMA knockout cell and animal models specific for the early nervous system. The knockout model cells and animals showed significantly reduced VIRMA protein expression in the forebrain tissue. By specifically knocking out the VIRMA protein early in the development of the nervous system, it was found that cell proliferation in the knocked-out tissues was significantly impaired, and cell apoptosis levels increased, suggesting that VIRMA protein plays a crucial regulatory role in the early stages of nervous system development.

[0010] This invention reveals the important functional role of VIRMA in the m6A methyltransferase complex in the nervous system, which is of great significance for a deeper understanding of the role of the m6A methyltransferase complex in the regulation of the higher nervous system, the importance of VIRMA in the m6A methyltransferase complex, and the functional diversity of VIRMA in different tissue cells.

[0011] Preferably, the amino acid sequence of the VIRMA protein includes that shown in SEQ ID NO: 1.

[0012] Preferably, the nucleotide sequence of the VIRMA encoding gene includes that shown in SEQ ID NO: 2.

[0013] Preferably, the VIRMA protein has one or more uses selected from the following:

[0014] (1) Maintaining normal proliferation of neurons in the forebrain region;

[0015] (2) inhibiting the abnormal expression of apoptosis-related proteins in the forebrain region;

[0016] (3) Maintain the normal function of ribosome production in nerve cells in the forebrain region.

[0017] In the present invention, it was verified that the proliferation of tissue cells in which VIRMA was specifically knocked out was significantly impaired and the apoptosis level was increased, suggesting that VIRMA plays an important regulatory role in the early development stage of the nervous system.

[0018] In a second aspect, the present invention provides a pharmaceutical composition for maintaining normal proliferation of nerve cells in the forebrain region, wherein the active ingredient of the pharmaceutical composition includes the VIRMA protein described in the first aspect.

[0019] Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

[0020] In a third aspect, the present invention provides a pharmaceutical composition for inhibiting abnormal expression of apoptosis-related proteins in forebrain neurons, wherein the active ingredient of the pharmaceutical composition includes the VIRMA protein described in the first aspect.

[0021] Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

[0022] In a fourth aspect, the present invention provides a pharmaceutical composition for maintaining the normal function of ribosome production in nerve cells in the forebrain region, wherein the active ingredient of the pharmaceutical composition includes the VIRMA protein described in the first aspect.

[0023] Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

[0024] In a fifth aspect, the present invention provides a method for constructing an animal model with brain-specific knockout of the VIRMA gene, the method comprising the following steps:

[0025] (1) Building VIRMA flox / flox The gene editing system was used to edit the gene of mouse fertilized eggs, and a loxp fragment was inserted before and after Exon2 of the VIRMA gene to screen VIRMA flox / flox mice;

[0026] (2) Building Virma flox / flox ; Emx1-Cre mice, and the resulting VIRMA flox / flox Mice were crossed with Emx1-Cre mice and Virma was screened flox / flox ;Emx1-Cre mice.

[0027] The present invention provides an efficient genotype identification scheme for VIRMA conditional knockout animals and constructs an animal model with brain-specific VIRMA gene knockout. The model can be used to study the regulation of nervous system function by VIRMA protein and has important application value for in-depth research on the functional mechanism of Virma gene.

[0028] Preferably, in step (1), the screening VIRMA flox / flox Mice were treated using a method comprising the following steps:

[0029] A forward primer F1 was designed between Exon 1 of the VIRMA gene and the first loxP site, and a rear primer R1 was designed between the first loxP site and Exon 2 of the VIRMA gene, wherein Exon 1 is located before Exon 2. PCR amplification of the mouse genome was performed using F1 / R1, and three genotypes were determined based on the length of the amplified fragment: Virma flox / flox 、Virma flox / + or Virma + / + .

[0030] Preferably, the nucleotide sequence of the front primer F1 includes SEQ ID NO:3.

[0031] Preferably, the nucleotide sequence of the rear primer R1 includes that shown in SEQ ID NO:4.

[0032] SEQ ID NO: 3: tgccacatagatgcgatgcc;

[0033] SEQ ID NO: 4: caagaccctgggttgaaccc.

[0034] Preferably, the method for determining the genotype includes:

[0035] Genotype Virma flox / flox The corresponding band is 438 bp;

[0036] Genotype Virma flox / + The corresponding bands are 438 bp and 254 bp;

[0037] Genotype Virma + / + The corresponding band is 254 bp.

[0038] Preferably, in step (2), the screening Virma flox / flox Emx1-Cre mice were generated using a method comprising the following steps:

[0039] The mouse genome was amplified by PCR using the forward primer F1, the rear primer R1 and the CRE universal primer, and the animal was judged to be Virma according to the length of the amplified fragment. flox / flox ;Emx1-Cre mice.

[0040] Preferably, the nucleotide sequence of the CRE universal primer includes SEQ ID NO: 5 and SEQ ID NO: 6.

[0041] SEQ ID NO: 5: gtccaatttactgaccgtacacc.

[0042] SEQ ID NO: 6: gttattcggatcatcagctacacc.

[0043] Preferably, the judgment criteria are: Virma flox / flox ; The corresponding bands for Emx1-Cre mice are 438bp and 706bp.

[0044] Common genotyping protocols require two to three rounds of PCR and agarose gel electrophoresis per animal to determine the Virma and Emx1-Cre genotypes, respectively. To improve genotyping efficiency, this paper proposes an optimized protocol for genotyping VIRMA conditional knockout animals. This protocol reduces the genotyping workload by at least half, significantly improving efficiency.

[0045] In a sixth aspect, the present invention provides a device for screening drugs that regulate the early developmental functions of the nervous system. The device uses an animal model with brain-specific knockout of the VIRMA gene for drug screening. The animal model is constructed by the method for constructing an animal model with brain-specific knockout of the VIRMA gene described in the fifth aspect.

[0046] Compared with the prior art, the present invention has the following beneficial effects:

[0047] This study, published in Nature Communications, identifies VIRMA, a key protein that regulates nervous system development and proposes methods suitable for studying the functions and molecular mechanisms of VIRMA in the nervous system. VIRMA, a key methyltransferase, regulates early nervous system development. Knockout of VIRMA significantly reduces VIRMA protein expression in model cells and forebrain tissue of knockout animals. Specific knockout of VIRMA during early nervous system development revealed significant impairment of cell proliferation and increased apoptosis in the knocked-out tissues, suggesting a crucial regulatory role for VIRMA in the early stages of nervous system development. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] FIG1 is a graph showing the results of western blot analysis of VIRMA protein expression in forebrain tissues at different developmental stages.

[0049] FIG2 is a schematic diagram of the construction of the VIRMA conditional knockout animal model.

[0050] FIG3 is a diagram showing the optimized genotype identification results of conditional knockout animals.

[0051] FIG4 is a graph showing changes in body weight gain in conditional knockout animals.

[0052] FIG5 is a survival curve of conditional knockout animals.

[0053] FIG6 is a diagram showing the changes in brain tissue morphology of conditional knockout animals after birth.

[0054] FIG7 is a diagram showing changes in hippocampal cortex defects in conditional knockout animals after birth.

[0055] Figure 8 shows the changes in the forebrain tissue of conditional knockout animals during the embryonic stage.

[0056] FIG9 is a graph showing changes in VIRMA-Exon2 mRNA levels at embryonic day E13.5.

[0057] FIG10 shows the expression of VIRMA protein in the forebrain of cKO and WT animals at embryonic day E13.5.

[0058] FIG11 shows the proliferation of brain cells at embryonic day E13.5.

[0059] FIG12 shows apoptosis signals of brain tissue cells at embryonic day E13.5.

[0060] FIG13 shows the fluorescence expression of VIRMA protein in the NPC cell knockdown model.

[0061] FIG14 shows the cell proliferation in the NPC cell knockdown model.

[0062] FIG15 is a graph showing changes in ribosomal RNA content in the NPC cell knockdown model.

[0063] Figure 16 shows the expression of ribosomal functional proteins in the NPC cell knockdown model.

[0064] Figure 17 shows the changes in apoptosis pathway signal analysis in the NPC cell knockdown model. DETAILED DESCRIPTION

[0065] The present invention proposes for the first time the key role of VIRMA protein in the early development of the nervous system and its application research in the nervous system, and also provides a technical solution for realizing the functional research of VIRMA protein in the nervous system.

[0066] This study provides insights into the role of the VIRMA protein in different stages of brain development, identifies key periods of VIRMA protein regulation, and proposes a protocol for detecting VIRMA antibodies in brain tissue. This protocol, used in animal brain tissue collected from embryonic day 11.5 (E11.5) to postnatal day 60 (P60), determines VIRMA protein expression in the brain at different developmental stages. The results show that VIRMA is highly expressed in the embryonic brain, suggesting that VIRMA likely plays a role in embryonic brain development.

[0067] The present invention provides a VIRMA protein that regulates the early development of the nervous system. Based on the detection results of high expression levels of VIRMA protein in the embryonic stage, an animal model with specific knockout of VIRMA protein in the early embryonic brain is constructed, and it is determined that VIRMA protein has the function of regulating the early development of the nervous system.

[0068] The screened VIRMA antibodies suitable for brain tissue detection were used to detect the expression of VIRMA protein in the target brain area of ​​the animal model, and qPCR primers specific for Virma Exon2 were designed to verify the changes in mRNA levels, and finally the successful construction of the VIRMA protein-deficient animal model was determined. Through phenotypic analysis of the model animals, it was observed that the weight of animals with VIRMA protein deficiency (cKO) grew slower than that of the control group (WT), and most of the mice died within one month. Starting from P0 after the animals were born, the entire brain tissue of cKO was significantly smaller than that of WT. Slice staining found that the hippocampus of cKO animals was completely missing and the cortex was significantly thinner. At an earlier embryonic stage of E15.5 days, the brain of cKO animals (including the length, width and thickness of the brain) had already become significantly smaller.

[0069] The present invention provides the use of VIRMA protein and its encoding gene in regulating the proliferation and apoptosis of neural progenitor cells. In VIRMA cKO animals, brain development is severely impaired, indicating that VIRMA protein plays a crucial role in early brain development. Testing of brain tissue cell proliferation and apoptosis in E13.5 animals revealed that neural progenitor cells (NPCs) in cKO animals showed reduced proliferation and significantly more apoptotic signals than in WT animals. This suggests that VIRMA protein affects the proliferation and apoptosis levels of animal NPCs, thereby affecting early brain development.

[0070] To facilitate in vitro research and further analyze the specific molecular mechanism by which VIRMA protein affects brain development, the present invention also provides a scheme for constructing an NPC cell model with specific knockout of VIRMA protein.

[0071] The present invention provides the use of VIRMA protein in regulating NPC proliferation in vitro. To verify the functional effect of VIRMA protein on NPC in vitro, the present invention provides a method for detecting the proliferation level of NPC cells.

[0072] The "early development" in the regulation of the early development function of the nervous system in the present invention refers to "embryonic development".

[0073] The technical solution of the present invention is further described below by way of specific embodiments. It should be understood by those skilled in the art that the embodiments are merely to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0074] If no specific techniques or conditions are specified in the examples, the experiments were carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0075] Example 1 The role of VIRMA protein in specific brain regions at different developmental stages

[0076] (1) Extraction of total protein from specific areas of brain tissue

[0077] Referencing mouse brain atlases at different developmental stages, forebrain tissue was isolated and collected from wild-type C57BL / 6J mice at various developmental stages from embryonic to adulthood (E11.5, E13.5, E15.5, E17.5, P0, P2, P4, P7, P15, P30, and P60). The tissues were homogenized in RIPA Lysis Buffer (Strong, HY-K1001, MCE) containing protease inhibitors (HY-13316, MCE) until no visible fragments were visible. After shaking on ice for 1 hour, the cells were centrifuged at low temperature (16,000 rcf) for 20 minutes, and the supernatant was collected. Protein was quantified using the BCA assay. All samples were adjusted to the same protein concentration using 3× SDS loading dye and 1× SDS loading dye. The adjusted protein samples were placed in a metal bath at 95°C for 5 min for denaturation, and the prepared samples were used for protein immunoblotting.

[0078] (2) Detection of VIRMA protein expression in brain tissue by Western blotting

[0079] Preparation of SDS-polyacrylamide gel: Use 10% PAGE rapid gel preparation kit (PG112, Yazyme) and refer to the actual kit instructions to prepare 1.5 mm thick SDS-polyacrylamide gel.

[0080] SDS-polyacrylamide gel electrophoresis: Load 20 μg of protein sample and run at 80 V for about 30 min. Once the bromophenol blue indicator runs through the compressed gel and reaches the separating gel, adjust the voltage to 100 V and continue running for about 2 h. Stop the electrophoresis when the bromophenol blue indicator runs out of the bottom of the gel.

[0081] Transfer: Nitrocellulose transfer membrane (NC membrane) was used for overnight transfer in transfer buffer (25 mM Tris, 190 mM glycine, 20% ethanol, pH 8.3) at room temperature and low current. That is, transfer was performed at a constant current of 65 mA at room temperature overnight.

[0082] Blocking: 0.5% skim milk powder dissolved in TBST (1×TBS + 20% tween 20) was used as the blocking solution. After the transfer, the NC membrane was placed in the blocking solution and shaken slowly on a shaker in a cold room at 4°C for overnight blocking.

[0083] Primary antibody incubation: After blocking, transfer the NC membrane to the primary antibody incubation solution diluted with blocking solution (VIRMA Ab#1, CST-88358S, 1:1000, VIRMA Ab#2, Proteintech 25712-1-AP, 1:2000) and shake slowly on a shaker in a cold room at 4°C overnight.

[0084] The NC membrane was transferred to TBST solution and washed three times within 30 min by shaking slowly on a shaker at room temperature;

[0085] Secondary antibody incubation: The NC membrane was transferred to the secondary antibody incubation solution (Anti-rabbit IgG, HRP-linked Antibody, CST-7074S, 1:2000) prepared with blocking solution and incubated on a shaker at room temperature for 2 h.

[0086] The NC membrane was transferred to TBST solution and washed five times within 30 min by shaking slowly on a shaker at room temperature;

[0087] Color development (HRP enzyme): Use the ultrasensitive ECL kit (YaZyme) to take 2 mL of ECL A solution and ECL B solution, mix them, transfer the NC membrane after secondary antibody incubation to the mixed color development solution, and expose and develop using the BIO-RED chemiluminescence imaging system.

[0088] Figure 1 shows the immunoblot results of VIRMA protein expression in forebrain tissue at different developmental stages. Based on the immunoblot results, the VIRMA protein marker antibody (VIRMA Ab#1, CST-88358S) was confirmed to be more specific in mouse brain tissue compared to an existing antibody for detecting mouse samples (VIRMA Ab#2, Proteintech 25712-1-AP).

[0089] The results showed that VIRMA protein was expressed at a high level during the embryonic stage of forebrain tissue development, suggesting that VIRMA is likely to play a role in the early stages of brain development.

[0090] Example 2 VIRMA protein regulates early embryonic brain development

[0091] (1) Construction of an animal model for early embryonic brain-specific knockout of VIRMA protein

[0092] To further reveal the functional role of VIRMA protein in the nervous system, this example constructed transgenic animals with VIRMA gene specifically knocked out in the forebrain. The schematic diagram of the construction of VIRMA conditional knockout animal model is shown in FIG2 .

[0093] VIRMA flox / flox Mice were mated with Emx1-Cre mice to achieve specific shearing of the second exon (Exon2) of the Virma gene in the forebrain tissue starting from embryonic stage E10.5, thereby establishing an animal model that specifically knocks out VIRMA protein in the forebrain tissue. flox / flox ;Emx1-Cre conditional knockout animals (cKO), Virma flox / flox or VIRMA flox / + littermate control animals (WT).

[0094] wherein the VIRMA flox / flox In order to edit the gene of mouse fertilized eggs using the gene editing system, a loxp fragment was inserted before and after Exon2 of the VIRMA gene, and the VIRMA obtained by screening was flox / flox Mice. The VIRMA flox / flox Mice were obtained from the State Key Laboratory of Reproductive Medicine, Nanjing Medical University.

[0095] The Emx1-Cre tool mice were from The Jackson Laboratory: B6.129S2-Emx1tm1(cre)Krj / J.

[0096] (2) Optimized genotyping scheme

[0097] The commonly used genotyping scheme requires 2-3 PCR and agarose gel electrophoresis to identify the Virma genotype and Emx1-cre genotype of each animal, respectively.

[0098] The steps of the commonly used genotyping scheme mainly include:

[0099] It is necessary to perform PCR and agarose gel electrophoresis for the Emx1-cre enzyme and the Virma gene respectively to obtain the animal genotype.

[0100] First, according to the identification protocol provided on The Jackson Laboratory's website, perform PCR using two pairs of primers: Mutant (F:gcggtctggcagtaaaaactatc; R:gtgaaacagcattgctgtcactt) and Wild type (F:aaggtgtggttccagaatcg; R:ctctccaccagaaggctgag). The PCR products were then subjected to agarose gel electrophoresis. If only the Wild type primers amplify a 378bp band, the animal does not carry the Emx1-cre enzyme. If only the Mutant primers amplify a 102bp band, or if both the Mutant and Wild type primers amplify both 102 and 378bp bands, the animal carries the Emx1-cre enzyme.

[0101] According to the Virma gene identification protocol provided by the collaborating institution, PCR is performed using two pairs of primers: FLOX (F: ttgcctacttcatttctattcat; R: caagaccctgggttgaaccc) and KO (F: ttgcctacttcatttctattcat; R: agctcagaccataacttcgt). The PCR products are then subjected to agarose gel electrophoresis. If the FLOX primer-amplified product shows a 704-bp band, the animal carries the loxP site. Absence of this band or a 520-bp band indicates the animal lacks the loxP site. Finally, combined with the KO primer results, if the KO primer-amplified product shows a 628-bp band, the animal is a Virma knockout.

[0102] Using this conventional identification protocol, at least four amplification products must be obtained from each experimental animal and subjected to separate agarose gel electrophoresis. Because this project requires rapid identification of a large number of embryonic animals for each batch of experiments, only after the embryonic genotypes are determined can the next step of the experiment proceed. This cumbersome genotyping method cannot meet practical needs, as it requires genotyping results for a large number of individual animals within a short period of time after sample acquisition.

[0103] SEQ ID NO: 11: F: gcggtctggcagtaaaaactatc;

[0104] SEQ ID NO: 12: R: gtgaaacagcattgctgtcactt;

[0105] SEQ ID NO: 13: F: aaggtgtggttccagaatcg;

[0106] SEQ ID NO: 14: R: ctctccaccagaaggctgag;

[0107] SEQ ID NO:7:F:ttgcctacttcatttctattcat;

[0108] SEQ ID NO: 4: R: caagaccctgggttgaaccc;

[0109] SEQ ID NO:7:F:ttgcctacttcatttctattcat;

[0110] SEQ ID NO:8: R:agctcagaccataacttcgt.

[0111] To improve the efficiency of genotyping, this example proposes an optimized VIRMA conditional knockout animal genotyping protocol. This protocol can reduce the workload of genotyping by at least half, significantly improving work efficiency. The steps of this protocol are as follows:

[0112] Virma flox / flox Animals have loxP fragments inserted before and after Exon 2 (see Figure 2 for a schematic diagram). Exon 2 is cleaved in the presence of Cre enzyme. In this example, a forward primer F1 (SEQ ID NO: 3): tgccacatagatgcgatgcc, was designed between Exon 1 and the first loxP site. A rear primer R1 (SEQ ID NO: 4): caagaccctgggttgaaccc, was designed between the first loxP site and Exon 2. Using F1 / R1, three genotypes of animals can be distinguished simultaneously: Virma flox / flox , Virma flox / + , Virma + / + .

[0113] Using the universal CRE primers Cre-F (SEQ ID NO: 5): gtccaatttactgaccgtacacc; Cre-R (SEQ ID NO: 6): gttattcggatcatcagctacacc, you can determine whether an animal carries Cre. Knockdown is achieved by the presence of Cre expression, so there is no need to distinguish between homozygotes and heterozygotes.

[0114] Place the previously collected tissue from the animal to be genotyped into an EP tube containing 50 μL of tissue lysis buffer (1× PBS, 0.1% Triton X-100, 100 μg / mL Proteinase K (Invitrogen, 25530049)). Incubate in a 55°C water bath for 3 hours, followed by a final treatment at 95°C for 10 minutes to terminate the lysis reaction. Vortex and centrifuge to obtain the supernatant, which will serve as the DNA template for the genotyping reaction.

[0115] use Prepare the PCR Master Mix kit according to the instructions. Add two primer pairs, Virma's F1 / R1 and CRE's Cre-F / Cre-R, to the mixture. Finally, add 0.5 μL of the DNA template to the PCR mixture, mix thoroughly, and centrifuge. Perform PCR amplification according to the instructions.

[0116] The amplified products were subjected to agarose gel electrophoresis, and animals of different genotypes were distinguished based on the electrophoresis bands. The optimized genotype identification results of the conditional knockout animals are shown in Figure 3. In Figure 3, Emx1-Cre indicates that the animal carries the Emx1-Cre enzyme; Virma + / + Indicates that the animal does not carry the Virma Loxp site; Virma flox / + Indicates that the animal carries a Virma Loxp site; Virma flox / flox Indicates that both strands of the animal have Virma LoxP sites and can be used as the control group WT animal; Virma flox / flox Emx1-Cre means that the animal with Virma Loxp sites on both chains also carries Emx1-Cre enzyme, that is, the Viirma Exon2 of this animal is specifically knocked out in cells expressing Emx1. This animal is a target genotype animal with VIRMA protein deficiency, i.e., a cKO animal; Virma flox / + Emx1-Cre indicates that this animal carries only a single strand of the Virma LoxP and the Emx1-Cre enzyme, but the Virma target fragment is not specifically deleted. This animal can serve as a WT control.

[0117] The optimized protocol only requires one PCR reaction and electrophoresis system for each animal, which can simultaneously distinguish the three genotypes of Virma inserted at the loxp site and whether or not they carry CRE expression. The Virma floxed band is 438bp, the Virma WT band is 254bp, and the Virma heterozygote carries both the floxed band and the Virma WT band. The CRE band is 706bp in size, and animals with Emx1-Cre can run out of the CRE band. The target cKO animal of the knockout model constructed is Virma flox / flox; Emx1-Cre can only see two bands of 438bp and 706bp.

[0118] In order to verify the reliability of the optimized identification scheme, a pair of primers used in the old identification scheme for identifying Virma cKO, F2: (SEQ ID NO: 7) ttgcctacttcatttctattcat; R2: (SEQ ID NO: 8) agctcagaccataacttcgt, were selected for PCR amplification and agarose gel electrophoresis. As long as Virma Exon2 cleavage occurs, a 628bp Virma cKO band can be seen, but it is impossible to distinguish whether both strands are cleaved. As can be seen from the gel electrophoresis diagram below in Figure 3, Virma cKO is more likely to be found in the samples after the optimized scheme. flox / flox ;Emx1-Cre and Virma flox / + cKO bands were accurately identified in animals with both Emx1-Cre and Emx1-Cre genotypes, indicating that this optimized protocol can more accurately distinguish different target genotypes while saving time and effort.

[0119] (3) Phenotypic analysis of VIRMA conditional knockout animals

[0120] By analyzing the phenotype of the model animals and continuously recording the animal weight and death time from birth, it was observed that the weight of animals deficient in VIRMA protein (cKO) increased more slowly than that of the control group (WT) animals (Figure 4), and most of the mice died within one month (Figure 5).

[0121] After perfusion with PBS and 4% PFA, the complete brain tissue of P0 / P5 / P10 / P20 animals was peeled off and the tissue morphology was observed. Starting from P0 after birth, the entire brain tissue of cKO was significantly smaller than that of WT animals (Figure 6). After the tissue was frozen and sectioned, Hoechst staining was performed for 15 minutes. Through the tissue cell nuclear signal, it was observed that the hippocampal tissue cells of the cKO animals were completely missing, and the cortex was also significantly thinned (Figure 7). Earlier, after the brain tissue of embryonic E15.5 days was stained with eosin-hematoxylin staining reagent, the imaging results showed that the cortical thickness had decreased significantly (Figure 8). The significantly abnormal phenotype of brain development in VIRMA conditional knockout animals determined that VIRMA is involved in regulating the development of the nervous system.

[0122] The cKO animals in this model have developmental defects and cannot be used to reproduce offspring. This invention proposes an optimal mating strategy that can be achieved: Virma flox / + -Emx1-Cre (with cre and Virma flox Heterozygous male mice) and Virma flox / flox (Virma without cre flox Homozygous female mice) were bred.

[0123] (4) Real-time fluorescence quantitative PCR (qPCR) verification of VIRMA knockout

[0124] Mating and plug inspection: Mating and reproduction are carried out according to the mating strategy, and the exact pregnancy date of pregnant mice is determined by daily inspection of the vaginal plug.

[0125] Fetal Mouse Sample Collection: At embryonic day (E13.5), pregnant mice were dissected by cervical dissection, and the embryos were rapidly dissected on ice and placed in HBSS-equilibrated solution. Forebrain tissue from E13.5 fetuses was isolated and collected, along with a small amount of tissue for genotyping. The collected forebrain tissue was snap-frozen in liquid nitrogen and stored at -80°C until further use.

[0126] Total RNA was extracted from forebrain tissue using TRIzol method (Invitrogen, 15596018).

[0127] 1 μg of total RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Vazyme, R212-02).

[0128] Primers Virma-exon2-F (SEQ ID NO: 9) and Virma-exon2-R (SEQ ID NO: 10) for dye-based real-time quantitative PCR were designed at both ends of Exon2:

[0129] SEQ ID NO:9: caaagttctcatatagatgtggttc;

[0130] SEQ ID NO: 10: ccatatgctctgttgtcaggtaag.

[0131] A mixed system was prepared according to the SYBR dye fluorescence quantitative kit (Vazyme, Q511-02), and the VIRMA Exon2 mRNA level was detected using a fluorescence quantitative PCR instrument (Quant Studio 3, Applied Biosystems).

[0132] The results showed that the genotype was Emx1-Cre (KI / + )Kiaa1429 flox / flox In animals with WT mice, the VIRMA Exon2 mRNA level was significantly decreased compared with that in WT animals ( FIG9 ).

[0133] (5) Validation of VIRMA knockout by immunoblotting

[0134] Sample Collection: At embryonic day E13.5, pregnant mice were dissected by cervical dissection and the embryos were rapidly dissected on ice. Forebrain tissue from E13.5 fetuses was isolated and collected, along with a small amount of tissue for genotyping. The collected forebrain tissue was snap-frozen in liquid nitrogen and stored at -80°C until further use.

[0135] Genotyping: The optimized genotyping protocol was used to determine the genotypes of all fetal mice, and only fetal mice with the target cKO and WT genotypes were selected for western blotting.

[0136] Extract total tissue protein: Add protein lysis buffer containing protease inhibitors and homogenize the tissue using a tissue homogenizer until no tissue fragments are visible to the naked eye. After shaking and lysing on ice for 1 hour, centrifuge at low temperature (16,000 rcf) for 20 minutes and collect the supernatant. Quantify protein using the BCA assay. Add 3× SDS loading dye and adjust all samples to the same protein concentration using 1× SDS loading dye. Denature the adjusted protein samples in a metal bath at 95°C for 5 minutes. Prepare the samples for Western blotting.

[0137] Protein immunoblotting: For specific methods, see the previous protein immunoblotting method for detecting VIRMA protein expression in brain tissue.

[0138] Western blotting confirmed that the VIRMA conditional knockout animal model successfully knocked out VIRMA in the forebrain, as shown in Figure 10.

[0139] (6) BRDU labeling detection at the somatic cell proliferation level

[0140] On embryonic day E13.5, BRDU solution was injected intraperitoneally into pregnant mice before cervical dissection. 15 minutes later, fetal brain tissue was dissected by cervical dissection and fixed in 4% PFA overnight.

[0141] After fixation, fetal brain tissue was embedded in OCT tissue embedding medium and stored at -80°C.

[0142] E13.5 fetal brains were sliced ​​with a Leica cryostat to a thickness of 10 mm. The slices were immediately attached to adhesive slides, air-dried, and stored at -80°C until use.

[0143] The fetal brain patch was removed from -80°C, dried at 46°C for 8 minutes, placed in a special slide staining box, and washed with PBS buffer for 5 minutes.

[0144] Brain slices were treated with sodium citrate antigen retrieval solution at 95°C for 15 min. After the temperature dropped to room temperature, they were treated with 2M HCl at room temperature for 30 min and washed with PBS for 5 min.

[0145] The membrane was permeabilized with 3% Triton X-100 for 20 min and then blocked with 5% goat serum for 2 h.

[0146] The cells were incubated with the BRDU primary antibody at 4°C overnight (Abcam-ab6326, 1:1000).

[0147] After washing with PBST for 15 min, the membranes were incubated with secondary antibodies (Rat-488, 1:1000; Hoechst-405, 1:5000) for 2 h at room temperature.

[0148] The sections were washed with PBS three times for a total of 30 min, mounted with a quenching mounting medium, and fluorescence imaging was performed using a slide scanner.

[0149] The BRDU signal in the forebrain tissue of cKO animals was significantly lower than that of WT animals (see Figure 11), indicating that the loss of VIRMA protein significantly affected the proliferation function of neurons in the forebrain region.

[0150] (7) Tunel marker detection of somatic cell apoptosis level

[0151] The fetal brain patch was taken out from -80℃, dried at 46℃ for 8 minutes, placed in a special box for glass slide staining, and washed with PBS buffer for 5 minutes. The membrane was broken with 3% Triton X-100 for 20 minutes, and then the biotin-DeadEnd was detected using a Tunel kit (Biotin-DeadEnd). TM Colorimetric TUNEL System) was used to label fetal brain patches with Tunel signals.

[0152] The test results showed that the Tunel signal in the forebrain tissue of cKO animals was significantly higher than that of WT animals (see Figure 12), indicating that the loss of VIRMA protein would regulate the apoptosis of neurons in the forebrain region (see Figure 12).

[0153] Example 3 VIRMA protein regulates the development of neural progenitor cells

[0154] (1) Specific knockout of VIRMA protein in primary neural progenitor cells (NPCs)

[0155] Isolation of primary neural progenitor cells: Virma flox / flox Mating of male and female mice was performed. At embryonic day E13.5, the pregnant mice were dissected by cervical dissection. Forebrain tissues of 2-3 E13.5 fetal mice were isolated in ice-cold PBS (containing 2% glucose) and placed in a 15 mL EP tube filled with HBSS. After the tissues were allowed to settle to the bottom, the HBSS liquid was removed. 1 mL complete medium (45 mL basal medium NeuroCult®) was added. TMAdd 5mL of supplements + 100μL of EGF growth factor + 5% double-antibody) to the culture flask, pipette 2-3 times, and let it sit for 3 minutes to allow the clumps to precipitate. Transfer the supernatant to a new 15mL EP tube, centrifuge at 150g for 3 minutes, and discard the supernatant. Add 6mL of culture medium to the culture flask in advance. Pipette 1mL of culture medium from the culture flask into the EP tube, pipette twice, resuspend the cells, count them, and then add them directly to the culture flask. This method obtains the genotype of Virma. flox / flox of primary NPC cells.

[0156] Primary neural progenitor cell culture: The cells formed into spherical clusters and did not adhere to the wall. After 3 days of culture, the cells were dispersed using a cell dispersion kit (NeuroCult TM NPCs were digested into single cells using a Chemical Dissociation Kit-Mouse for passaging. If adherent cell culture is desired, the cell culture plate should be coated with poly-L-ornithine for 2 hours, washed twice with PBS, and then coated with laminin overnight. Wash twice with PBS and then add complete culture medium for later use.

[0157] Lentiviral infection: After at least two passages, count NPCs and plate them into coated 12-well cell culture plates (200,000 cells per well). After 24 hours of culture, add 5 μL of the CRE lentivirus LV-CRE (titer: 7.34E+9 TU / mL) to 500 μL of culture medium and mix thoroughly (add the control virus LV-GFP to another well as a control). Remove excess culture medium from the wells and add the mixed LV-CRE-containing medium. 48 hours after lentiviral infection, remove the old medium, add prewarmed fresh medium, and continue culturing.

[0158] Cell culture: On the fifth day after lentiviral infection, digest the cells with Accutase cell detachment solution for 5 minutes. Passage the cells into well plates with pre-coated 14 mm round coverslips for fluorescent labeling experiments, or plate into well plates without coverslips for collecting protein immunoblots or RNA extraction samples.

[0159] Cell samples were collected 7 days after lentiviral infection.

[0160] (2) Immunofluorescence labeling to verify VIRMA knockout

[0161] Cell fixation: Place the cell slide in PBS to wash away excess dead cells, and fix the cells with 4% PFA for 15 minutes.

[0162] Membrane blocking: permeabilize with 3% Triton X-100 for 15 min, wash once with PBS, and then block with 5% goat serum for 2 h.

[0163] Primary antibody incubation: Prepare primary antibody incubation solution with 1% goat serum (VIRMA Ab#1, CST-88358S, 1:100, VIRMA Ab#3, Sigma-Atlas-HPA031530, 1:100) and incubate overnight at 4°C.

[0164] Secondary antibody incubation: After washing with PBST for 15 min, secondary antibody incubation solution (rabbit-647, Hoechst-405) was prepared with 1% goat serum and incubated at room temperature for 2 h.

[0165] The sections were washed three times with PBS for a total of 30 min, and the sections were mounted with a quenching mounting medium. Fluorescence imaging was performed using a slide scanner.

[0166] Figure 13 shows the fluorescence expression of VIRMA protein in the NPC cell knockdown model. Compared to an existing antibody for immunofluorescence detection of mouse samples (VIRMA Ab#3, Sigma-Atlas-HPA031530), the VIRMA protein-labeled antibody (VIRMA Ab#1, CST-88358S) was confirmed to be more specific in primary mouse neural progenitor cells. The results showed that cells expressing green virus in the LV-CRE group showed no yellow VIRMA protein signal, while all cells in the LV-GFP control group expressed VIRMA protein, confirming the successful establishment of an in vitro VIRMA protein knockdown model in neural progenitor cells.

[0167] (3) Detection of NPC proliferation level by BRDU labeling

[0168] BRDU labeling: BRDU was added at a final concentration of 10 μM. After incubation for 1 h, the cell slides were placed in PBS to wash away excess dead cells, and the cells were fixed with 4% PFA for 15 min.

[0169] Antigen retrieval: Brain slices were treated with sodium citrate antigen retrieval solution at 95°C for 15 min. After cooling to room temperature, the slices were treated with 2M HCl at room temperature for 30 min and washed with PBS for 5 min.

[0170] The subsequent steps are shown in Example 2 for the protocol flow for BRDU labeling detection at the somatic cell proliferation level.

[0171] Figure 14 shows the cell proliferation profile of the NPC knockdown model. Fluorescence images of somatic cell proliferation revealed that BRDU signaling in NPC cells following LV-CRE infection was significantly reduced compared to the control group, indicating that VIRMA protein deficiency significantly impaired the proliferation of neural progenitor cells. This result is consistent with in vivo findings, demonstrating that the in vitro VIRMA protein knockdown model in neural progenitor cells can effectively mimic in vivo cellular state changes and is suitable for in vitro studies of the molecular mechanisms underlying VIRMA regulation of neural development.

[0172] Example 4 VIRMA protein affects neural progenitor cell development by regulating ribosome biogenesis

[0173] (1) Detection of ribosome synthesis function

[0174] Ribosomal subunit signal: According to Example 3, NPCs of the control group and the knockout group with the same cell number were collected, and total RNA was extracted using the Trizol method. The extracted total RNA was subjected to agarose gel electrophoresis. All operations in the control group and the knockout group were consistent. According to the gel electrophoresis results, the content of the main ribosomal RNA subunits 28S and 18S in the knockout group NPC was significantly lower than that in the control group (see Figure 15).

[0175] Expression of proteins related to ribosome function: According to the total protein extraction and protein immunoblotting methods in Example 1, the total protein of NPC in the control group and the knockout group was extracted using RIPA, and the expression changes of functional proteins related to ribosome synthesis function (NPM1, RPS7, RPS20, RPL11, RPL17, FBL) were detected (see Figure 16). The results showed that the expression level of proteins related to ribosome synthesis function was significantly reduced after the loss of VIRMA protein.

[0176] (2) Detection of apoptosis signaling pathway

[0177] Similarly, protein immunoblotting was used to detect changes in signaling molecules in the P53 apoptosis pathway. It was found that after the loss of VIRMA protein, signaling molecules in the apoptosis pathways such as P53, P21 and BAX were significantly increased (see Figure 17), indicating that the apoptosis pathway was activated in NPC cells.

[0178] The above results suggest that VIRMA protein deficiency may damage the ribosome generation process, thereby causing a p53-dependent nucleolar stress response, activating the p53 apoptosis pathway, and ultimately leading to increased NPC cell apoptosis and no abnormalities in proliferation.

[0179] In summary, the present invention, by exploring the functional role of VIRMA in the nervous system, has proposed for the first time an important functional role of VIRMA, namely, VIRMA is involved in regulating the early development of the nervous system. The present invention also provides an efficient VIRMA conditional knockout animal genotype identification scheme, constructs VIRMA knockout cells and animal models specific to the early nervous system, and determines that VIRMA is localized in nuclear spots in the cell nucleus through immunofluorescence localization of VIRMA protein. The expression level of VIRMA protein in the knockout model cells and the forebrain tissue of the knockout animals was significantly reduced. By specifically knocking out VIRMA in the early development of the nervous system, the results showed that the proliferation of tissue cells specifically knocked out was significantly impaired, and the level of apoptosis increased. This suggests that VIRMA plays an important regulatory role in the early developmental stage of the nervous system. At the same time, the important mechanism by which VIRMA protein affects the development of neural progenitor cells by regulating ribosome generation function was proposed for the first time.

[0180] The applicant declares that the above is only a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention fall within the scope of protection and disclosure of the present invention.

Claims

1. Application of VIRMA protein in the preparation of drugs for regulating the early developmental functions of the nervous system.

2. The use according to claim 1, characterized in that: The amino acid sequence of the VIRMA protein includes that shown in SEQ ID NO: 1; Preferably, the nucleotide sequence of the VIRMA encoding gene includes that shown in SEQ ID NO:

2.

3. The use according to claim 1 or 2, characterized in that: The VIRMA protein has one or more uses selected from the following: (1) Maintaining normal proliferation of neurons in the forebrain region; (2) Inhibit the abnormal expression of apoptosis-related proteins in neurons in the forebrain region; (3) Maintain the normal function of ribosome production in nerve cells in the forebrain region.

4. A pharmaceutical composition for maintaining normal proliferation of neurons in the forebrain region, characterized in that: The active ingredient of the pharmaceutical composition comprises the VIRMA protein according to any one of claims 1 to 3; Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

5. A pharmaceutical composition for inhibiting abnormal expression of apoptosis-related proteins in forebrain neurons, characterized in that: The active ingredient of the pharmaceutical composition comprises the VIRMA protein according to any one of claims 1 to 3; Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

6. A pharmaceutical composition for maintaining the normal function of ribosome production in nerve cells in the forebrain region, characterized in that: The active ingredient of the pharmaceutical composition comprises the VIRMA protein according to any one of claims 1 to 3; Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

7. A method for constructing an animal model of brain-specific knockout of VIRMA gene, characterized in that: The construction method comprises the following steps: (1) Building VIRMA flox / flox Mice, the gene editing system was used to edit the gene of mouse fertilized eggs, a loxp fragment was inserted before and after Exon2 of the VIRMA gene, and VIRMA was screened flox / flox Mice; (2) Building Virma flox / flox ; Emx1-Cre mice, and the resulting VIRMA flox / flox Mice were crossed with Emx1-Cre mice and Virma was screened flox / flox ;Emx1-Cre mice.

8. The method for constructing an animal model of brain-specific knockout of VIRMA gene according to claim 7, characterized in that: In step (1), the screening VIRMA flox / flox Mice were subjected to a method comprising the following steps: A front primer F1 was designed between Exon1 of the VIRMA gene and the first loxp site, and a rear primer R1 was designed between the first loxp site and Exon2 of the VIRMA gene, wherein Exon1 was before Exon2; F1 / R1 was used to perform PCR amplification on the mouse genome, and three genotypes were determined according to the length of the amplified fragment: Virma flox / flox , Virma flox / + or Virma + / + ; Preferably, the nucleotide sequence of the front primer F1 includes that shown in SEQ ID NO: 3; Preferably, the nucleotide sequence of the rear primer R1 includes that shown in SEQ ID NO:4; Preferably, the method for determining the genotype comprises: Genotype Virma flox / flox The corresponding band is 438 bp; Genotype Virma flox / + The corresponding bands are 438 bp and 254 bp; Genotype Virma + / + The corresponding band is 254 bp.

9. The method for constructing an animal model of brain-specific knockout of VIRMA gene according to claim 7 or 8, characterized in that: In step (2), the screening of Virma flox / flox ; Emx1-Cre mice were produced using a method comprising the following steps: The front primer F1, the rear primer R1 and the CRE universal primer are used to perform PCR amplification on the mouse genome, and the length of the amplified fragment is used to determine whether the animal is Virma flox / flox ;Emx1-Cre mice; Preferably, the nucleotide sequence of the CRE universal primer includes those shown in SEQ ID NO: 5 and SEQ ID NO: 6; Preferably, the judgment criteria are: Virma flox / flox ; The corresponding bands for Emx1-Cre mice are 438bp and 706bp.

10. A device for screening drugs that regulate the early developmental function of the nervous system, characterized in that: The device uses a brain-specific VIRMA gene knockout animal model for drug screening, and the animal model is constructed by the method for constructing a brain-specific VIRMA gene knockout animal model according to any one of claims 7 to 9.

Images