Trans-splicing systems

Abstract

The disclosure relates to compositions and methods to trans-splice RNA, as well as methods to treat, ameliorate, or a prevent a disease or disorder using the trans-splicing system described herein. Various compositions are described herein, including compositions comprising endonucleases, endonuclease systems, and chimeric proteins having the endonuclease and a nucleic-acid modulating domain or a nucleic acid modifying domain.

Description

[0001] TRANS-SPLICTNG SYSTEMS

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims priority to U.S. Provisional Application No. 63 / 520,838, filed on August 21, 2023, and U.S. Provisional Application No.: 63 / 602,529, filed on November 24, 2023, the entire contents of which are incorporated herein.

[0004] FIELD

[0005] The disclosure relates to compositions, systems, and methods that trans-splice RNA.

[0006] DESCRIPTION OF THE TEXT FILE SUBMITTED ELECTRONICALLY

[0007] The instant application contains a sequence listing, which has been submitted in XML format via EFS-Web. The contents of the XML copy named “AMR-0011PC_134241-5O1 l_Sequence Listing,” which was created on August 21, 2024 and is 114,688 bytes in size, the contents of which are incorporated herein by reference in their entirety.

[0008] BACKGROUND

[0009] Splicing is a reaction by which introns in the pre-mRNA are eliminated. Typically this is mediated by the spliceosome in eukaryotic cellular nuclei and is cis-splicing, i.e. a donor site, a branch point, and an acceptor site are all located on the same RNA molecule.

[0010] However, the spliceosome can also catalyze trans-splicing events i.e. splicing between two different RNA molecules. This results in a final mRNA which is composed of an exon of the first pre-mRNA and an exon of another pre-mRNA. Trans-splicing may be useful in molecular engineering, e.g. to treat various diseases. However, the efficiency and the specificity of trans- splicing of the current systems need to be improved upon to provide a more effective therapeutic strategy.

[0011] There is a need for improved compositions and methods for trans-splicing.

[0012] SUMMARY Therefore, the present disclosure provides, in aspects, atrans-splicing system comprising: a nucleic acid-targeting Type III CRISPR / Cas system; a nucleic acid guide; optionally, a specific RNA- binding domain; and a repair template comprising a splice donor and / or splice acceptor and an RNA sequence that associates with the Type III CRISPR / Cas system and / or specific RNA-binding domain.

[0013] In embodiments, the Type III CRISPR / Cas system is or comprises a Type IIIA, Type IIIB, Type I1IC, Type HID, Type II1E, or Type IIIF CRISPR / Cas system, optionally wherein the Type IIIA, Type IIIB, Type IIIC, Type IIID, Type IIIE, or Type IIIF CRISPR / Cas system is active, catalytically inactive or has reduced activity relative to wild type. In embodiments, the Type III CRISPR / Cas system is or comprises a Type IIIE CRISPR / Cas system, optionally wherein the Type IIIE CRISPR / Cas system is active, catalytically inactive or has reduced activity relative to wild type. In embodiments, the Type III CRISPR / Cas system is or comprises a CaslO (Csml), Csm2, Cas7 (Csm3), Csm4, Csm5, Cas6, and, Cas7-l l, or a fragment or variant thereof, optionally wherein the Type III CRISPR / Cas system is or comprises a CaslO (Csml), Csm2, Cas7 (Csm3), Csm4, Csm5, Cas 6, and, Cas7-11 is active, catalytically inactive or has reduced activity relative to wild type.

[0014] In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NOs: 1-39, or having about 1 to about 20 amino acid mutations, or a nucleic acid encoding the same. In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having about 1, or about 2, or about 3, or about 4, or about 5, or about 10, or about 15, or about 20 amino acid mutations, or a nucleic acid encoding the same.

[0015] In embodiments, the Type III CRISPR / Cas system comprises an active endonuclease, an endonuclease having reduced activity relative to wild type, or a catalytically inactive endonuclease.

[0016] In embodiments, the Type III CRISPR / Cas system comprises a domain from a different endonuclease. In embodiments, the Type III CRISPR / Cas system comprises one or more mutations to reduce activity relative to an unmutated form. In embodiments, the Type III CRISPR / Cas system comprises one or more mutations to substantially ablate activity relative to an unmutated form.

[0017] In embodiments, the Type III CRISPR / Cas system comprises one or more mutations to reduce activity but retain nucleic acid binding capability relative to an unmutated form.

[0018] In embodiments, the Type III CRISPR / Cas system comprises one or more mutations to substantially ablate activity but retain nucleic acid binding capability relative to an unmutated form.

[0019] In embodiments, the Type III CRISPR / Cas system comprises one or more of a substitution at positions D413 and D634 relative to SEQ ID NO: 1, or a position equivalent thereto, or the Type III CRISPR / Cas system comprises one or more of a substitution at positions H14, D15, G584, G585, D586, and D587 relative to SEQ ID NO: 35, or a position equivalent thereto, or wherein the Type III CRISPR / Cas system comprises a substitution at position D32 relative to SEQ ID NO: 37, or a position equivalent thereto. In embodiments, the Type III CRISPR / Cas system comprises one or more of D413A and D634A relative to SEQ ID NO: 1, or a position equivalent thereto, or the Type III CRISPR / Cas system comprises one or more of H14A, D15A, G584A, G585A, D586A, and D587A relative to SEQ ID NO: 35, or a position equivalent thereto, or wherein the Type III CRISPR / Cas system comprises at least D32A relative to SEQ ID NO: 37. In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NO: 1, or having about 1 to about 20 amino acid mutations or a nucleic acid encoding the same. In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NO: 35, or having about 1 to about 20 amino acid mutations or a nucleic acid encoding the same. In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NO: 37, or having about 1 to about 20 amino acid mutations or a nucleic acid encoding the same.

[0020] In embodiments, the Type III CRISPR / Cas system comprises a truncation of relative to SEQ ID NOs: 1-39, or a position equivalent thereto. In embodiments, the truncation is greater than about 10 amino acids, or greater than about 20 amino acids, or greater than about 30 amino acids, or greater than about 40 amino acids, or greater than about 50 amino acids, or greater than about 100 amino acids, or greater than about 150 amino acids, or greater than about 200 amino acids, or greater than about 250 amino acids. In embodiments, the truncation is within about 1000 residues from the C- terminus, or about 900 residues from the C- terminus, or about 800 residues from the C- terminus, or about 700 residues from the C- terminus, or about 600 residues from the C- terminus, or about 500 residues from the C- terminus.

[0021] In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NOs: 1-39, or having about 1 to about 20 amino acid mutations, or a nucleic acid encoding the same.

[0022] In embodiments, the nucleic acid guide is or comprises a RNA. In embodiments, the nucleic acid guide is or comprises a DNA. In embodiments, the trans-splicing system comprises one nucleic acid guide.

[0023] In embodiments, the trans-splicing system comprises more than one nucleic acid guide. In embodiments, the nucleic acid guides recognize multiple targets. In embodiments, the nucleic acid guide targets a splice acceptor site. In embodiments, the nucleic acid guide targets a splice donor site. In embodiments, the nucleic acid guide targets a region near a splice site.

[0024] In embodiments, the nucleic acid guide targets a region within about 200 nucleotides of a splice site, or within about 190 nucleotides of a splice site, or within about 180 nucleotides of a splice site, or within about 170 nucleotides of a splice site, or within about 160 nucleotides of a splice site, or within about 150 nucleotides of a splice site, or within about 140 nucleotides of a splice site, or within about 130 nucleotides of a splice site, or within about 120 nucleotides of a splice site, or within about 110 nucleotides of a splice site, or within about 100 nucleotides of a splice site, or within about 90 nucleotides of a splice site, or within about 80 nucleotides of a splice site, or within about 70 nucleotides of a splice site, or within about 60 nucleotides of a splice site, or within about 50 nucleotides of a splice site, or within about 40 nucleotides of a splice site, or within about 30 nucleotides of a splice site, or within about 20 nucleotides of a splice site, or within about 10 nucleotides of a splice site.

[0025] In embodiments, the nucleic acid guide targets a region less than or equal to 100 nucleotides from a splice site.

[0026] In embodiments, the more than one nucleic acid guides target one or more target nucleic acid of interest. In embodiments, the more than one nucleic acid guides target multiple nucleic acids of interest.

[0027] In embodiments, the nucleic acid guide interacts with the Type III CRISPR / Cas system. In embodiments, the Type III CRISPR / Cas system forms a complex with the nucleic acid guide.

[0028] In embodiments, the specific RNA-binding domain is suitable for binding an RNA aptamer.

[0029] In embodiments, the specific RNA-binding domain is or comprises a viral protein. In embodiments, the viral protein is or comprises a MS2 binding protein (MCP), a IN protein, a PP7 coat protein, or a QBeta coat protein. In embodiments, the specific RNA-binding domain is or comprises MS2, PP7, Q , F2, GA, fr, JP501, M12, R17, BZ13, JP34, JP500, KU1, MH, MX1, TW18, VK, SP, FI, ID2, NL95, TW19, AP205, (^Cb5, ^Cb8r, <^Cbl2r, ^Cb23r, 7s, or PRR1.

[0030] In embodiments, the specific RNA-binding domain is covalently bound to the Type III CRISPR / Cas system. In embodiments, the specific RNA-binding domain is not covalently bound to the Type III CRISPR / Cas system. In embodiments, the specific RNA-binding domain and Type III CRISPR / Cas system are present in a single polypeptide fusion protein.

[0031] In embodiments, the specific RNA-binding domain and Type III CRISPR / Cas system are joined by a linker. In embodiments, the linker is between about 4 and about 40 amino acids, or about 10 and about 40 amino acids, or about 20 and about 40 amino acids, or about 30 and about 40 amino acids, or about 4 and about 30 amino acids, or about 4 and about 20 amino acids, or about 4 and about 10 amino acids, or about 5 amino acids, or about 10 amino acids, or about 15 amino acids, or about 20 amino acids, or about 25 amino acids, or about 30 amino acids, or about 35 amino acids, or about 40 amino acids.

[0032] In embodiments, the linker is substantially comprised of glycine and serine residues. In embodiments, the linker is (GGS)n, whereinnis 1, or 2, or 3, or 4, or 5. In embodiments, the linker is GGSGGSGGSG (SEQ ID NO: 41), GGSGGSGGGGSGGGGS (SEQ ID NO: 42), GGGGS (SEQ ID NO: 43), GGS (SEQ ID NO: 44), (GGGGS)n (n=l-4) (SEQ ID NO: 45). (Gly)s (SEQ ID NO: 46), (Gly)6(SEQ ID NO: 47), (EAAAK)n(n=l-3) (SEQ ID NO: 48), A(EAAAK)nA (n = 2- 5) (SEQ ID NO: 49), AEAAAKEAAAKA (SEQ ID NO: 50), A(EAAAK)4ALEA(EAAAK)4A (SEQ ID NO: 51), PAPAP (SEQ ID NO: 52), KESGSVSSEQLAQFRSLD (SEQ ID NO: 53), EGKSSGSGSESKST (SEQ ID NO: 54), and GSAGSAAGSGEF (SEQ ID NO: 55), or a variant thereof, wherein the variant comprises about 1, or about 2, or about 3, or about 4, or about 5 mutations, the mutations selected from substitutions or deletions.

[0033] In embodiments, the trans-splicing system comprises one repair template. In embodiments, the trans-splicing system comprises a guide RNA operably linked to one repair template. In embodiments, the trans-splicing system comprises a guide RNA operably linked to one repair template by the same promoter. In embodiments, the trans-splicing system comprises a guide RNA operably linked to one repair template and is processed from an RNA transcript comprising the one repair template. In embodiments, the trans-splicing system comprises a guide RNA operably linked to one repair template and is not processed from an RNA transcript comprising the one repair template.

[0034] In embodiments, the trans-splicing system comprises more than one repair template. In embodiments, the trans-splicing system comprises a guide RNA operably linked to more than one repair template. In embodiments, the trans-splicing system comprises a guide RNA operably linked to more than one repair template by the same promoter. In embodiments, the trans-splicing system comprises a guide RNA operably linked to more than one repair template and is processed from an RNA transcript comprising the more than one repair template. In embodiments, the trans- splicing system comprises a guide RNA operably linked to more than one repair template and is not processed from an RNA transcript comprising the one repair template.

[0035] In embodiments, the repair template is delivered or deliverable to a cell as DNA. In embodiments, the repair template is delivered or deliverable to a cell as RNA. In embodiments, the repair template is expressed or suitable for expression as RNA.

[0036] In embodiments, the repair template comprises a splice acceptor. In embodiments, the repair template comprises a splice donor. In embodiments, the repair template comprises a splice acceptor and a splice donor.

[0037] In embodiments, the splice donor comprises a nucleic acid sequence encoding a functional gene product. In embodiments, the splice donor comprises a nucleic acid sequence encoding one or more exons. In embodiments, the splice donor comprises a nucleic acid sequence encoding a wild type gene or exon. In embodiments, the splice donor is suitable for replacement of a mutant gene in a pre-mRNA of a target nucleic acid of interest.

[0038] In embodiments, the repair template comprises one or more splice sites.

[0039] In embodiments, the repair template comprises an exon. In embodiments, the repair template comprises more than one exon.

[0040] In embodiments, the repair template comprises an intron. In embodiments, the repair template comprises more than one intron.

[0041] In embodiments, the repair template comprises one or multiple sequences that associate with the target nucleic acid of interest. In embodiments, at least one portion of the repair template comprises a ms2 hairpin that specifically binds or it suitable for binding to the MS2 binding protein.

[0042] In embodiments, the repair template comprises a boxB hairpin that specifically binds or it suitable for binding to the IN protein. In embodiments, the repair template comprises a PP7 hairpin that specifically binds or it suitable for binding to the PP7 coat protein. In embodiments, the repair template comprises a QBeta hairpin that specifically binds or it suitable for binding to the QBeta coat protein.

[0043] In embodiments, the repair template comprising a splice donor and / or splice acceptor and an RNA sequence associates with the Type III CRISPR / Cas system and / or specific RNA-binding domain under physiological conditions. In embodiments, the repair template comprising a splice donor and / or splice acceptor and an RNA sequence associates with the Type III CRISPR / Cas system and / or specific RNA-binding domain under stringent conditions.

[0044] In embodiments, the trans-splicing system is suitable for transient RNA repair. In embodiments, the trans-splicing system is suitable for trans-splicing at an intron-exon junction or exon-intron junctions of a pre-mRNA. In embodiments, the trans-splicing system is suitable for trans-splicing of a pre-mRNA at the 5' end of the pre-mRNA. In embodiments, the trans-splicing system is suitable for trans-splicing of a pre-mRNA at the 3' end of the pre-mRNA. In embodiments, the trans-splicing system is suitable for trans-splicing of a pre-mRNA at an internal site within a pre- mRNA. In embodiments, the trans-splicing system is suitable for replacing the 5' or the 3' end of the target mRNA.

[0045] In embodiments, at least one portion of the trans-splicing system is introduced into a cell.

[0046] In embodiments, the expression and / or activity of at least one portion of the trans-splicing system is transient.

[0047] In embodiments, the activity of at least one portion of the trans-splicing system is regulated by a small molecule. In embodiments, the small molecule is selected from abscisic acid (ABA), rapamycin (or rapalog), FK506, cyclosporine A, FK1012, Gibberellin3-AM, FKCsA, AP1903 / AP, and Auxin. In embodiments, the small molecule binding domain is an ABA-binding domain. In embodiments, the ABA-binding domain is or comprises an AB II polypeptide.

[0048] In embodiments, the trans-splicing system further comprises a viral protein. In embodiments, the viral protein further comprises a small molecule binding domain.

[0049] In embodiments, the viral protein and the small molecule binding domain are linked by a linker. In embodiments, the linker is substantially comprised of glycine and serine residues. In embodiments, the linker is (GGS)n, wherein nis 1, or 2, or 3, or 4, or 5. In embodiments, the linker is GGSGGSGGSG (SEQ ID NO: 41), GGSGGSGGGGSGGGGS (SEQ ID NO: 42), GGGGS (SEQ ID NO: 43), GGS (SEQ ID NO: 44), (GGGGS)n(n=l-4) (SEQ ID NO: 45), (Gly)s (SEQ ID NO: 46), (Gly)6(SEQ ID NO: 47), (EAAAK)n(n=l-3) (SEQ ID NO: 48), A(EAAAK)nA (n = 2- 5) (SEQ ID NO: 49), AEAAAKEAAAKA (SEQ ID NO: 50), A(EAAAK)4ALEA(EAAAK)4A (SEQ ID NO: 51), PAPAP (SEQ ID NO: 52), KESGSVSSEQLAQFRSLD (SEQ ID NO: 53), EGKSSGSGSESKST (SEQ ID NO: 54), and GSAGSAAGSGEF (SEQ ID NO: 55), or a variant thereof, wherein the variant comprises about 1, or about 2, or about 3, or about 4, or about 5 mutations, the mutations selected from substitutions or deletions.

[0050] In embodiments, the small molecule binding domain is an ABA-binding domain. In embodiments, ABA-binding domain the ABA-binding domain comprises a PYL1 polypeptide. In embodiments, the addition of ABA induces targeted trans-splicing of a target pre-mRNA.

[0051] In embodiments, the trans-splicing system further comprises a promoter operably linked to one or more of the components of the trans-splicing system. In embodiments, the promoter is an inducible promoter. In embodiments, the promoter is a tissue-specific promoter.

[0052] In embodiments, the trans-splicing system further comprises one or more self-cleaving ribozymes is association with one or more of the components of the trans-splicing system.

[0053] In embodiments, the Type III CRISPR / Cas system is targeted to a nucleic acid. In embodiments, the nucleic acid is RNA. In embodiments, the nucleic acid is DNA. In embodiments, the Type III CRISPR / Cas system is associated with RNA in a cell. In embodiments, the RNA is a pre-mRNA.

[0054] In embodiments, the CRISPR / Cas system is associated with DNA in a cell. In embodiments, the CRISPR / Cas system is not associated with DNA in a cell.

[0055] In embodiments, the CRISPR / Cas system mediates trans-splicing of pre-mRNA in the nucleus of a cell. In embodiments, the CRISPR / Cas system mediates trans-splicing of pre-mRNA in the cytoplasm of a cell. In embodiments, the trans-splicing occurs in dividing cells. In embodiments, the trans-splicing occurs in post-mitotic cells. In embodiments, post-mitotic cells are neurons, myocytes, or adipocytes.

[0056] In embodiments, expression of at least one portion of the trans-splicing system is inducible. In embodiments, activity of at least one portion of the trans-splicing system is inducible.

[0057] In embodiments, the trans-splicing system further comprises a viral vector or a non-viral vector. In embodiments, the viral vector is or comprises a retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, anellovirus, or baculovirus. In embodiments, the viral vector is or comprises a virus-like particle (VLP). In embodiments, the viral vector is or comprises an AAV. In embodiments, the AAV is or comprises one or more of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV1 1, AAV12, AAV13, AAV2 / 1, AAV2 / 5, AAV2 / 8, AAV2 / 9, AAV3 / 1, AAV3 / 5, AAV3 / 8, and AAV3 / 9.

[0058] In embodiments, the trans-splicing system is suitable for non-viral delivery selected from a cationic lipid vehicle, electroporation, calcium phosphate transfection, mechanical transfection, and nanoparticle delivery.

[0059] In embodiments, the trans-splicing system further comprises a lipid nanoparticle (LNP) liposomes, lipoplexes or polymeric nanoparticle. In embodiments, the LNP comprises one or more of ionizable lipids, amino lipids, anionic lipids, neutral lipids, amphipathic lipids, helper lipids, structural lipids, PEG lipids, and lipoids.

[0060] In aspects, the present disclosure provides a composition comprising a nucleic acid encoding any one of the embodiments and / or aspects disclosed herein, or a component thereof. In embodiments, the nucleic acid is or comprises a DNA molecule or an RNA molecule. In embodiments, the RNA is or comprises mRNA or modified mRNA (mmRNA). In embodiments, the DNA is or comprises a vector or plasmid. In embodiments, the nucleic acid comprises a codon optimized sequence. In embodiments, the nucleic acid comprises one or more modifications. In embodiments, the modifications are one or more of base modifications and backbone modifications.

[0061] In aspects, the present disclosure provides a viral vector comprising the nucleic acid of any one of the embodiments and / or aspects disclosed herein. In embodiments, the viral vector is or comprises an AAV or a virus-like particle (VLP). In embodiments, the AAV is or comprises one or more of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV2 / 1, AAV2 / 5, AAV2 / 8, AAV2 / 9, AAV3 / 1, AAV3 / 5, AAV3 / 8, and AAV3 / 9.

[0062] In aspects, the present disclosure provides a lipid nanoparticle comprising the nucleic acid of any one of the embodiments and / or aspects disclosed herein.

[0063] In aspects, the present disclosure provides a cell comprising the trans-splicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, or the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein. In embodiments, the cell is a prokaryotic cell. In embodiments, the cell is a eukaryotic cell. In embodiments, the cell is a mammalian cell. In embodiments, the cell is a human cell. In embodiments, the cell is an immortalized cell. In embodiments, the cell is harvested from a subject.

[0064] In aspects, the present disclosure provides a pharmaceutical composition comprising the transsplicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, or the cell of any one of the embodiments and / or aspects disclosed herein, and a pharmaceutically acceptable carrier.

[0065] In aspects, the present disclosure provides a kit comprising a container comprising the transsplicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, the cell of any one of the embodiments and / or aspects disclosed herein, or the pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein, and instructions for use in trans-splicing.

[0066] In aspects, the present disclosure provides a method of mediating a targeted trans-splicing event on a pre-mRNA in a cell, the method comprising contacting a cell with the trans-splicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, the cell of any one of the embodiments and / or aspects disclosed herein, or the pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein.

[0067] In aspects, the present disclosure provides a method of mediating a targeted trans-splicing event on a pre-mRNA in a cell in a subject in need thereof, comprising administering an effective amount of the trans-splicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, the cell of any one of the embodiments and / or aspects disclosed herein, or the pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein to the subject. In embodiments, the trans-splicing occurs at an intron-exon junction or exon-intron junctions of a pre-mRNA. In embodiments, the trans-splicing of a pre-mRNA occurs at the 5' end of the pre-mRNA. In embodiments, the trans- splicing of a pre-mRNA occurs at the 3' end of the pre-mRNA. In embodiments, the trans-splicing of a pre-mRNA occurs at an internal site within a pre-mRNA. In embodiments, the trans-splicing system replaces the 5' or the 3' end of the target mRNA.

[0068] In aspects, the present disclosure provides a method for replacing a mutant exon of a gene of interest in a cell, the method comprising contacting a cell with the trans-splicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, the cell of any one of the embodiments and / or aspects disclosed herein, or the pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein.

[0069] In aspects, the present disclosure provides a method for replacing a mutant exon of a gene of interest in a subject in need thereof, comprising administering an effective amount of the trans- splicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, the cell of any one of the embodiments and / or aspects disclosed herein, or the pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein to the subject.

[0070] In aspects, the present disclosure provides a method of treating, ameliorating or preventing a disease or disorder in a subject, comprising contacting a cell with the trans-splicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, the cell of any one of the embodiments and / or aspects disclosed herein, or the pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein, and administering an effective amount of the cell to the subject. In aspects, the present disclosure provides a method of treating, ameliorating or preventing a disease or disorder in a subject, comprising administering an effective amount of the trans-splicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, the cell of any one of the embodiments and / or aspects disclosed herein, or the pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein to the subject.

[0071] In embodiments, the disease or disorder is associated with a loss of protein function in the subject. In embodiments, the disease or disorder is associated with a dominant negative protein function in the subject. In embodiments, the method provides transient RNA repair.

[0072] In aspects, the present disclosure provides the trans-splicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, the cell of any one of the embodiments and / or aspects disclosed herein, or the pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein for use in treating, ameliorating or preventing a patient with a disease or disorder.

[0073] In aspects, the present disclosure provides use of the trans-splicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, the cell of any one of the embodiments and / or aspects disclosed herein, or the pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein the manufacture of a medicament for the treating, ameliorating or preventing of a disease or disorder.

[0074] In various aspects and embodiments, disclosed herein is a composition comprising an endonuclease comprising a sequence, or a fragment or variant thereof, and having at least about 70% identity to one or more of SEQ ID NOs: 1-3, or having about 1 to about 20 amino acid modifications. In various aspects and embodiments, disclosed herein is a composition comprising a nucleic acid encoding an endonuclease comprising a sequence, or a fragment or variant thereof, and having at least about 70% identity to one or more of SEQ ID NOs: 1-3 or having about 1 to about 20 amino acid modifications.

[0075] In various aspects and embodiments, disclosed herein is a composition comprising a nuclease system, comprising (a) an endonuclease comprising a sequence, or a fragment or variant thereof, and having at least about 70% identity to one or more of SEQ ID NOs: 1-3 or having about 1 to about 20 amino acid modifications; and (b) an RNA molecule comprising a sequence complementary to one strand of a target nucleic acid molecule.

[0076] In various aspects and embodiments, disclosed herein is a composition comprising a chimeric protein comprising: (a) an endonuclease comprising a sequence, or a fragment or variant thereof, and having at least about 70% identity to one or more of SEQ ID NOs: 1-3 or having about 1 to about 20 amino acid modifications; and (b) a nucleic acid-modulating domain or a nucleic acidmodifying domain comprising a sequence comprising a catalytic domain, or a fragment or variant thereof, wherein (a) and (b) do not naturally occur together in a same reading frame.

[0077] In various aspects and embodiments, disclosed herein is a composition comprising a complex comprising a chimeric protein and an RNA molecule, wherein the chimeric protein comprises: (a) an endonuclease, or a fragment or variant thereof, and having at least about 70% identity to one or more of SEQ ID NOs: 1-3 or having about 1 to about 20 amino acid modifications; and (b) a nucleic acid-modulating domain or a nucleic acid-modifying domain comprising a sequence comprising a catalytic domain, or a fragment or variant thereof, wherein (a) and (b) do not naturally occur together in a same reading frame and the RNA molecule comprises a sequence complementary to one strand of a target nucleic acid molecule.

[0078] In various aspects and embodiments, disclosed herein is a nucleic acid encoding the chimeric protein of any one of the embodiments and / or aspects disclosed herein.

[0079] In various aspects and embodiments, disclosed herein is a viral vector comprising the nucleic acid of any one of the embodiments and / or aspects disclosed herein.

[0080] In various aspects and embodiments, disclosed herein is a lipid nanoparticle comprising the nucleic acid of any one of the embodiments and / or aspects disclosed herein. In various aspects and embodiments, disclosed herein is a cell comprising a nucleic acid of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, or the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein.

[0081] In various aspects and embodiments, disclosed herein is pharmaceutical composition comprising the composition of any one of the embodiments and / or aspects disclosed herein, a nucleic acid of any one of the embodiments and / or aspects disclosed herein, a viral vector of any one of the embodiments and / or aspects disclosed herein, or the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, or the cell of any one of the embodiments and / or aspects disclosed herein, and a pharmaceutically acceptable carrier.

[0082] In various aspects and embodiments, disclosed herein is a kit comprising a container comprising the composition of any one of the embodiments and / or aspects disclosed herein, a nucleic acid of any one of the embodiments and / or aspects disclosed herein, a viral vector of any one of the embodiments and / or aspects disclosed herein, or a lipid nanoparticle o of any one of the embodiments and / or aspects disclosed herein, or a cell of any one of the embodiments and / or aspects disclosed herein, or a pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein, and instructions for use in modulating and / or modifying a nucleic acid.

[0083] In various aspects and embodiments, disclosed herein is a method of modulating and / or modifying a nucleic acid in a cell, comprising contacting the cell with the composition of any one of the embodiments and / or aspects disclosed herein, a nucleic acid of any one of the embodiments and / or aspects disclosed herein, a viral vector of any one of the embodiments and / or aspects disclosed herein, or a lipid nanoparticle o of any one of the embodiments and / or aspects disclosed herein, or a cell of any one of the embodiments and / or aspects disclosed herein, or a pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein.

[0084] In various aspects and embodiments, disclosed herein is method of modulating and / or modifying a nucleic acid in a subject in need thereof, comprising administering an effective amount of the cell with the composition of any one of the embodiments and / or aspects disclosed herein, a nucleic acid of any one of the embodiments and / or aspects disclosed herein, a viral vector of any one of the embodiments and / or aspects disclosed herein, or a lipid nanoparticle o of any one of the embodiments and / or aspects disclosed herein, or a cell of any one of the embodiments and / or aspects disclosed herein, or a pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein to the subject.

[0085] In various aspects and embodiments, disclosed herein is method of disrupting, correcting, and / or replacing a gene in a cell, comprising contacting the cell with the composition of any one of the embodiments and / or aspects disclosed herein, a nucleic acid of any one of the embodiments and / or aspects disclosed herein, a viral vector of any one of the embodiments and / or aspects disclosed herein, or a lipid nanoparticle o of any one of the embodiments and / or aspects disclosed herein, or a cell of any one of the embodiments and / or aspects disclosed herein, or a pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein.

[0086] In various aspects and embodiments, disclosed herein is method of disrupting, correcting, and / or replacing a gene in a subject in need thereof, comprising administering an effective amount of the composition of any one of the embodiments and / or aspects disclosed herein, a nucleic acid of any one of the embodiments and / or aspects disclosed herein, a viral vector of any one of the embodiments and / or aspects disclosed herein, or a lipid nanoparticle o of any one of the embodiments and / or aspects disclosed herein, or a cell of any one of the embodiments and / or aspects disclosed herein, or a pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein to the subject.

[0087] In various aspects and embodiments, disclosed herein is method of treating, ameliorating or preventing a disease or disorder in a subject, comprising: (a) contacting a cell with the composition of any one of the embodiments and / or aspects disclosed herein, a nucleic acid of any one of the embodiments and / or aspects disclosed herein, a viral vector of any one of the embodiments and / or aspects disclosed herein, or a lipid nanoparticle o of any one of the embodiments and / or aspects disclosed herein, or a cell of any one of the embodiments and / or aspects disclosed herein, or a pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein and (b) administering an effective amount of the cell to the subject.

[0088] In various aspects and embodiments, disclosed herein is a method of treating, ameliorating or preventing a disease or disorder in a subject, comprising administering an effective amount of the composition of any one of the embodiments and / or aspects disclosed herein, a nucleic acid of any one of the embodiments and / or aspects disclosed herein, a viral vector of any one of the embodiments and / or aspects disclosed herein, or a lipid nanoparticle o of any one of the embodiments and / or aspects disclosed herein, or a cell of any one of the embodiments and / or aspects disclosed herein, or a pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein to the subject.

[0089] In various aspects and embodiments, disclosed herein is a use of the composition of any one of the embodiments and / or aspects disclosed herein, a nucleic acid of any one of the embodiments and / or aspects disclosed herein, a viral vector of any one of the embodiments and / or aspects disclosed herein, or a lipid nanoparticle o of any one of the embodiments and / or aspects disclosed herein, or a cell of any one of the embodiments and / or aspects disclosed herein, or a pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein in the manufacture of a medicament for the treating, ameliorating or preventing of a disease or disorder.

[0090] In various aspects and embodiments, disclosed herein is method of detecting and / or quantifying a nucleic acid in a sample, comprising contacting the sample with a composition of any one of the embodiments and / or aspects disclosed herein.

[0091] In various embodiments, the composition disclosed herein, or the trans-splicing system disclosed herein, comprises a repair RNA (repRNA) sequence, comprising: (a) one or more exons and / or introns; (b) a splice donor and / or splice acceptor, wherein the repRNA is suitable for trans-splicing. In embodiments, the trans-splicing system comprises a splice donor, a splice acceptor, and replaces an internal exon. In embodiments, the repRNA is operably linked to the RNA molecule comprising a sequence complementary to one strand of a target nucleic acid molecule or the gRNA.

[0092] In aspects, the present disclosure provides a system for targeting a nucleic acid for trans-splicing, the system comprising: (a) an endonuclease of any one of the embodiments disclosed herein, and optionally an RNA molecule comprising a sequence complementary to one strand of a target nucleic acid molecule; (b) an RNA-binding polypeptide that associates with the endonuclease; and (c) a repair RNA (repRNA) sequence, comprising: (i) one or more exons and / or introns; (ii) a splice donor and / or splice acceptor.

[0093] In embodiments, the RNA molecule is a gRNA.

[0094] In embodiments, the endonuclease is not linked, associated, and / or fused with an RNA binding protein. In embodiments, the repRNA is not operably linked to one or more gRNAs. In embodiments, the repRNA is provided in trans to one or more gRNAs.

[0095] In embodiments, the repRNA further comprises a ribozyme site. In embodiments, the ribozyme site is a hairpin, hammerhead, hepatitis delta virus (HDV), Varkud satellite (VS), or glmS ribozyme site, or a variant thereof. In embodiments, the ribozyme site is a HDV ribozyme site. In embodiments, the ribozyme site is upstream of the one or more exons and / or introns of the repRNA.

[0096] In aspects, the present disclosure provides a system for targeting a nucleic acid for trans-splicing, the system comprising: (a) an endonuclease of any one of claims 1-108 and an RNA molecule comprising a sequence complementary to one strand of a target nucleic acid molecule; and (b) a repair RNA (repRNA) sequence, comprising: (i) one or more exons and / or introns; (ii) a splice donor and / or splice acceptor.

[0097] In embodiments, the RNA molecule is a gRNA. In embodiments, the endonuclease is not linked, associated, and / or fused with an RNA binding protein. In embodiments, the repRNA is operably linked to one or more gRNAs.

[0098] In embodiments, the composition comprises a gRNA, repRNA, and a Cas endonuclease operably linked to a single promoter or a bidirectional promoter.

[0099] In embodiments, the gRNA and repRNA are located on a first side of the bidirectional promoter, and the Cas endonuclease is located on a second side of the bidirectional promoter.

[0100] The details of one or more examples of the disclosure are set forth in the description below. Other features or advantages of the present disclosure will be apparent from the following drawings, detailed description of several examples, and also from the appended claims. The details of the disclosure are set forth in the accompanying description below. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, illustrative methods and materials are now described. Other features, objects, and advantages of the disclosure will be apparent from the description and from the claims. In the specification and the appended claims, the singular forms also include the plural unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0101] DESCRIPTION OF THE DRAWINGS

[0102] FIG. 1A, FIG. IB, and FIG. 1C are non-limiting images showing the components of the CRISPR / Cas system, trans-splicing that can occur within a pre-mRNA, and the type III CRISPR- mediated trans-splicing.

[0103] FIG. l is a non-limiting image showing the components of trans-splicing with canonical Type III systems.

[0104] FIG. 3 is a non-limiting image showing the induction of the trans-splicing complex with a small molecule.

[0105] FIG. 4 is a non-limiting image showing a representative guide RNA structure for a trans-splicing system that is directed by a type III CRISPR effector.

[0106] FIG. 5 is a non-limiting image showing the components of the CRISPR / Cas system, trans-splicing that can occur within a pre-mRNA, and the type III CRISPR-mediated trans-splicing.

[0107] DETAILED DESCRIPTION

[0108] The present disclosure provides, inter alia, compositions and methods related to a trans-splicing system. The present disclosure is based, in part, on the discovery of compositions and methods related to a trans-splicing system comprising: a nucleic acid-targeting Type III CRISPR / Cas system; a nucleic acid guide; optionally, a specific RNA-binding domain; and a repair template comprising a splice donor and / or splice acceptor and an RNA sequence that associates with the Type III CRISPR / Cas system and / or specific RNA-binding domain.

[0109] Trans-Splicing System and Methods

[0110] In embodiments, there is provided trans-splicing systems and methods. In embodiments, the present disclosure promotes the catalysis of trans-splicing events. In embodiments, the splicing is between two different RNA molecules. In embodiments, the present trans-splicing produces an mRNA comprising an exon of a first pre-mRNA and an exon of a second pre-mRNA. In embodiments, the present disclosure provides trans-splicing-based molecular engineering, e g. to treat various diseases. For instance, in embodiments, the present trans-splicing systems and methods allow for splice editing, e.g. as in FIG. 1C, whereby a Type III CRISPR / Cas system allows for inclusion of a nucleic acid in a site-specific manner.

[0111] In embodiments, there is provided systems and methods that promote a trans-splicing reaction between an exogenous pre-trans-splicing RNA molecule and a target endogenous pre-mRNA that induces the formation of a chimeric mRNA.

[0112] Overview of the Type III CRISPR / Cas System

[0113] The clustered regularly interspaced short palindromic repeats (CRISPR) system is a natural adaptive immune system in bacteria and archaea that protects against viral infection by targeting specific invading nucleic acid sequences. Without wishing to be bound by theory, the CRISPR- Cas system is currently divided into two classes and six types: types I, III, and IV in class 1 systems, and types II, V, and VI in class 2 systems. The class 1 systems are represented by multiprotein effecter complexes, while the class 2 systems utilize a single, large, multi-domain Cas protein as the effecter module.

[0114] Transcription of the CRISPR array typically generates a multispacer precursor, referred to as CRISPR RNA (crRNA) molecule. cRNA is further processed to free individual short crRNA. The crRNAs subsequently assemble with Cas proteins to form ribonucleoproteins, called “effector complexes”, which monitor the cell in search of nucleic acids that base-pair with the loaded crRNA. Complementary binding of the crRNA and nucleic acids indicates the presence of an intruder, whereupon the effector complex initiates a protective response. Depending on the type of effector complex, two general strategies intended to abrogate infection are discernible: direct dismantling of the invading DNA via crRNA-guided cleavage; and interference with the invader’s replication cycle, often involving the activation of downstream immune proteins. The first strategy is used by effector complexes that belong to the DNA-targeting CRISPR-Cas systems (types I, II, IV and V).

[0115] Without wishing to be bound by theory, transcription of a viral target RNA, for example, is sensed by the multiple subunit type III CRISPR-Cas effector complex. Target recognition is typically initiated at the seed region in the 3' end of the CRISPR RNA, and sufficient binding in the Cas 10- activating region (CAR) results in CaslO activation. Type III CRISPR-Cas displays features of a sensor system, whereby recognition and cleavage of a target transcript leads to activation and deactivation, respectively, of the CaslO domains.

[0116] In embodiments, the Type III CRISPR / Cas system is or comprises a Type IIIA, Type IIIB, Type IIIC, Type IIID, Type IIIE, or Type IIIF CRISPR / Cas system, optionally wherein the Type IIIA, Type IIIB, Type IIIC, Type IIID, Type IIIE, or Type IIIF CRISPR / Cas system is active, catalytically inactive or has reduced activity relative to wild type. In embodiments, the Type III CRISPR / Cas system is or comprises a Type IIIE CRISPR / Cas system, optionally wherein the Type IIIE CRISPR / Cas system is active, catalytically inactive or has reduced activity relative to wild type. In embodiments, the Type III CRISPR / Cas system is or comprises a Casl O (Csml), Csm2, Cas7 (Csm3), Csm4, Csm5, Cas6, and, Cas7-l l, or a fragment or variant thereof, optionally wherein the Type III CRISPR / Cas system is or comprises a CaslO (Csml), Csm2, Cas7 (Csm3), Csm4, Csm5, Cas 6, and, Cas7-l l is active, catalytically inactive or has reduced activity relative to wild type.

[0117] In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NO: 1 (Table 1), or having about 1 to about 20 amino acid mutations, or a nucleic acid encoding the same. In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having about 1, or about 2, or about 3, or about 4, or about 5, or about 10, or about 15, or about 20 amino acid mutations, or a nucleic acid encoding the same.

[0118] In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NO: 2 (Table 1), or having about 1 to about 20 amino acid mutations, or a nucleic acid encoding the same. In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having about 1, or about 2, or about 3, or about 4, or about 5, or about 10, or about 15, or about 20 amino acid mutations, or a nucleic acid encoding the same.

[0119] In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NO: 3 (Table 1), or having about 1 to about 20 amino acid mutations, or a nucleic acid encoding the same. In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having about 1, or about 2, or about 3, or about 4, or about 5, or about 10, or about 15, or about 20 amino acid mutations, or a nucleic acid encoding the same.

[0120] In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to any one of SEQ ID NOs: 4-39 (Table 1), or having about 1 to about 20 amino acid mutations, or a nucleic acid encoding the same. In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having about 1, or about 2, or about 3, or about 4, or about 5, or about 10, or about 15, or about 20 amino acid mutations, or a nucleic acid encoding the same.

[0121] In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to a Cas7-11 selected from SEQ ID NO: 4-34, CaslO (Csml) selected from SEQ ID NO: 35, Csm2 selected from SEQ ID NO: 36, Cas7 (Csm3) selected from SEQ ID NO: 37, Csm4 selected from SEQ ID NO: 38, Csm5 selected from SEQ ID NO: 39, or a protease of SEQ ID NO: 40, or having about 1 to about 20 amino acid mutations, or a nucleic acid encoding the same. In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having about 1, or about 2, or about 3, or about 4, or about 5, or about 10, or about 15, or about 20 amino acid mutations, or a nucleic acid encoding the same.

[0122] Table 1: Amino Acid Sequences of SEQ ID NOs: 1-40

[0123]

[0124] In embodiments, the Type III CRISPR / Cas system comprises an active endonuclease, an endonuclease having reduced activity relative to wild type, or a catalytically inactive endonuclease. In embodiments, the Type III CRISPR / Cas system comprises a domain from a different endonuclease. In embodiments, the different endonuclease is a Cas endonuclease. In embodiments, the domain is one or more of a PAM-interacting domain. In embodiments, the domain is derived from one or more of Cas9, Casl2a (Cpfl), Casl2e (CasX), Casl2d (CasY), Casl2b (C2cl), Casl3a (C2c2), Casl3b, Casl3c, Casl3d, Casl3X / Casl3bt, Casl3Y, Casl2c (C2c3), GeoCas9, CjCas9, NmeCas9, Casl2J (CasPhi), Casl2L (CasLambda), Casl2f (Casl4),

[0125] Cas 12g, Casl2h, Casl2i, Cas 12k, NmeCas9, Nme2Cas9, CjCas9, GeoCas9, BlatCas9, PpCas9, and Casl4. In embodiments, the domain is derived from a Cas from one or more of Streptococcus pyogenes, Staphylococcus aureus, Neisseria meningitis, Streptococcus thermophilis, or Treponema denticola. In embodiments, the endonuclease (or chimeric protein) comprises a nuclear localization signal (NLS). Examples of NLSs are provided in Kosugi et al. (J Biol. Chem. (2009) 284:478-485; hereby incorporated by reference herein). In embodiments, the NLS comprises the consensus sequence K(K / R)X(K / R) (SEQ ID NO: 56). In embodiments, the NLS comprises the consensus sequence (K / R)(KZR)Xio-i2(K / R)3 / s (SEQ ID NO: 57), where (K / R)3 / s represents at least three of the five amino acids is either lysine or arginine. In embodiments, the NLS comprises the c-myc NLS. In embodiments, the c-myc NLS comprises the sequence PAAKRVKLD (SEQ ID NO: 58). In embodiments, the NLS is the nucleoplasmin NLS. In embodiments, the nucleoplasmin NLS comprises the sequence KRPAATKKAGQAKKKK (SEQ ID NO: 59). In embodiments, the NLS comprises the SV40 Large T-antigen NLS. In embodiments, the SV40 Large T-antigen NLS comprises the sequence PKKKRKV (SEQ ID NO: 60). In a particular embodiment, the NLS comprises three SV40 Large T-antigen NLSs (e.g, DPKKKRKVDPKKKRKVDPKKKRKV (SEQ ID NO: 61). In embodiments, the NLS is or comprises SEQ ID NO: 52. In embodiments, the NLS comprises mutations / variations in the above sequences such that they contain 1 or more substitutions, additions, or deletions (e.g., about 1, or about 2, or about 3, or about 4, or about 5, or about 10 substitutions, additions, or deletions).

[0126] In embodiments, the endonuclease (or chimeric protein) comprises a polypeptide permeant domain to promote uptake by a cell. In embodiments, the permeant domain is a peptide, peptidomimetic, or non-peptide carrier. In embodiments, the permeant peptide is derived from the third alpha helix of Drosophila melanogaster transcription factor Antennapaedia, referred to as penetratin, which comprises the amino acid sequence RQIKIWFQNRRMKWKK (SEQ ID NO: 62). In embodiments, the permeant peptide comprises the HIV-1 tat basic region amino acid sequence, which may include, for example, amino acids 49-57 of naturally occurring tat protein. In embodiments, the permeant peptide is a poly-arginine motif, for example, the region of amino acids 34-56 of HIV-1 rev protein, nona-arginine, octa-arginine, and the like. (See, for example, Futaki et al. (2003) Curr Protein Pept Sci. 2003 Apr; 4(2): 87-9 and 446; and Wender et al. (2000) Proc. Natl. Acad. Sci. U.S.A 2000 Nov. 21; 97(24): 13003-8; U.S. Patent Pub. 2003 / 0220334; 2003 / 0083256; 2003 / 0032593; and 2003 / 0022831, herein incorporated by reference in their entireties). In embodiments, the Type III CRISPR / Cas system comprises one or more mutations to reduce activity relative to an unmutated form. In embodiments, the Type III CRISPR / Cas system comprises one or more mutations to substantially ablate activity relative to an unmutated form.

[0127] In embodiments, the Type III CRISPR / Cas system comprises one or more mutations to reduce activity but retain nucleic acid binding capability relative to an unmutated form.

[0128] In embodiments, the Type III CRISPR / Cas system comprises one or more mutations to substantially ablate activity but retain nucleic acid binding capability relative to an unmutated form.

[0129] One of skill in the art may select the one or more mutations to reduce activity relative to an unmutated form by reference, e.g. Takeshita, et al. J Mol Biol. 2019 Feb 15;431(4):748-763; Numata, et al. J Mol Biol. 2015 Jan 30;427(2):259-73; and You, et al. Cell 2019 Jan 10;176(l- 2):239-253.el6 (each hereby incorporated by reference in their entireties), and the like.

[0130] In embodiments, one of skill in the art may select residues to alter in light of a desired percent sequence identity and / or select amino acid mutations by reference to e.g., by reference to structural information about other endonucleases known in the art, e.g. Takeshita, et al. J Mol Biol. 2019 Feb 15;431(4):748-763; Numata, et al. J Mol Biol. 2015 Jan 30;427(2):259-73; and You, et al. Cell 2019 Jan 10; 176(1 -2):239-253.el 6 (each hereby incorporated by reference in their entireties), and the like.

[0131] In embodiments, the Type III CRISPR / Cas system comprises one or more of a substitution at positions D413 and D634 relative to SEQ ID NO: 1, or a position equivalent thereto. In embodiments, the Type III CRISPR / Cas system comprises one or more of D413A and D634A relative to SEQ ID NO: 1, or a position equivalent thereto. In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NO: 1, or having about 1 to about 20 amino acid mutations or a nucleic acid encoding the same. In embodiments, the endonuclease has at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 91, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to SEQ ID NOs: 1-3 and an amino acid modification at position D413 and / or D634. In embodiments, the amino acid modifications are selected from substitutions and deletions. In embodiments, the amino acid modification to SEQ ID NOs: 1-3 at D413 and / or D634 is an essential or non-essential amino acid. In embodiments, the amino acid modification at D413 and / or D634 is a hydrophilic or hydrophobic amino acid. In embodiments, the amino acid modification at D413 and / or D634 is amino acid modification is a hydrophilic amino acid. In embodiments, the amino acid modification at D413 and / or D634 is a polar and positively charged hydrophilic amino acid. In embodiments, the amino acid modification at D413 and / or D634 is lysine (K). In embodiments, the amino acid modification at D413 and / or D634 is a polar and neutral charged hydrophilic amino acid. In embodiments, the amino acid modification at D413 and / or D634 is selected from asparagine (N), glutamine (Q), serine (S), threonine (T), proline (P), and cysteine (C). In embodiments, the amino acid modification at D413 and / or D634 is a polar and negatively charged hydrophilic amino acid. In embodiments, the amino acid modification at D413 and / or D634 is glutamate (E). In embodiments, the amino acid modification at D413 and / or D634 is an aromatic, polar and positively charged hydrophilic amino acid. In embodiments, the amino acid modification at D413 and / or D634 is arginine (R) or histidine (H). In embodiments, the amino acid modification at D413 and / or D634 is a hydrophobic amino acid. In embodiments, the amino acid modification at D413 and / or D634 is a hydrophobic, aliphatic amino acid. In embodiments, the amino acid modification at D413 and / or D634 is selected from glycine (G), alanine (A), leucine (L), isoleucine (I), methionine (M), or valine (V). In embodiments, the amino acid modification at D413 and / or D634is a hydrophobic, aromatic amino acid. In embodiments, the amino acid modification at D413 and / or D634 is selected from phenylalanine (F), tryptophan (W), or tyrosine (Y).

[0132] In embodiments, the Type III CRISPR / Cas system comprises one or more amino acid modifications to reduce or ablate DNA targeting and enable the Type III CRISPR / Cas system in trans-splicing. In embodiments, the amino acid modifications are selected from substitutions and deletions. In embodiments, the amino acid modification at position H14 and / or D15 relative to SEQ ID NO: 35 reduces or ablates DNA targeting and enables the Type III CRISPR / Cas system in trans-splicing. In embodiments, the Type III CRISPR / Cas system comprises one or more amino acid modifications to reduce or ablate cyclic oligo adenylate (cOA) synthesis and enable the Type III CRISPR / Cas system in trans-splicing. In embodiments, the amino acid modifications are selected from substitutions and deletions. In embodiments, the amino acid modification at position G584, G585, D586, and / or D587 relative to SEQ ID NO: 35 reduces or ablates cOA synthesis and enable the Type III CRISPR / Cas system in trans-splicing.

[0133] In embodiments, the Type III CRISPR / Cas system comprises one or more of a substitution at positions H14, D15, G584, G585, D586, and D587 relative to SEQ ID NO: 35, or a position equivalent thereto. In embodiments, the Type III CRISPR / Cas system comprises one or more of H14A, D15A, G584A, G585A, D586A, and D587A relative to SEQ ID NO: 35, or a position equivalent thereto. In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NO: 35, or having about 1 to about 20 amino acid mutations or a nucleic acid encoding the same.

[0134] In embodiments, the endonuclease has at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 91, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to SEQ ID NO: 35 and an amino acid modification at one or more positions of H14, D15, G584, G585, D586, and / or D587. In embodiments, the amino acid modifications are selected from substitutions and deletions. In embodiments, the amino acid modification relative to SEQ ID NO: 35 at H14, DI 5, G584, G585, D586, and / or D587 is an essential or non-essential amino acid. In embodiments, the amino acid modification at H14, D15, G584, G585, D586, and / or D587 is a hydrophilic or hydrophobic amino acid. In embodiments, the amino acid modification at H14, D15, G584, G585, D586, and / or D587 is a hydrophilic amino acid. In embodiments, the amino acid modification at H14, DI 5, G584, G585, D586, and / or D587 is a polar and positively charged hydrophilic amino acid. In embodiments, the amino acid modification at H14, D15, G584, G585, D586, and / or D587 is lysine (K). In embodiments, the amino acid modification at H14, D15, G584, G585, D586, and / or D587 is a polar and neutral charged hydrophilic amino acid. In embodiments, the amino acid modification atH14, DI 5, G584, G585, D586, and / or D587 is selected from asparagine (N), glutamine (Q), serine (S), threonine (T), proline (P), and cysteine (C). In embodiments, the amino acid modification at H14, DI 5, G584, G585, D586, and / or D587 is a polar and negatively charged hydrophilic amino acid. In embodiments, the amino acid modification at H14, D15, G584, G585, D586, and / or D587 is glutamate (E). In embodiments, the amino acid modification at H14, D15, G584, G585, D586, and / or D587 is an aromatic, polar and positively charged hydrophilic amino acid. In embodiments, the amino acid modification at H14, D15, G584, G585, D586, and / or D587 is arginine (R) or histidine (H). In embodiments, the amino acid modification at H14, D15, G584, G585, D586, and / or D587 is a hydrophobic amino acid. In embodiments, the amino acid modification at H14, D15, G584, G585, D586, and / or D587 is a hydrophobic, aliphatic amino acid. In embodiments, the amino acid modification atH14, D15, G584, G585, D586, and / or D587 is selected from glycine (G), alanine (A), leucine (L), isoleucine (I), methionine (M), or valine (V). In embodiments, the amino acid modification at H14, DI 5, G584, G585, D586, and / or D587 is a hydrophobic, aromatic amino acid. In embodiments, the amino acid modification atH14, DI 5, G584, G585, D586, and / or D587 is selected from phenylalanine (F), tryptophan (W), or tyrosine (Y).

[0135] In embodiments, the Type III CRISPR / Cas system comprises one or more amino acid modifications to reduce or ablate RNA cleavage and enable the Type III CRISPR / Cas system in trans-splicing. In embodiments, the amino acid modifications are selected from substitutions and deletions. In embodiments, the Type III CRISPR / Cas system comprises one or more of a substitution at position D32 relative to SEQ ID NO: 37 to reduce or ablate RNA cleavage. In embodiments, the Type III CRISPR / Cas system comprises one or more of a substitution at position D32 relative to SEQ ID NO: 37, or a position equivalent thereto. In embodiments, the Type III CRISPR / Cas system comprises at least D32A relative to SEQ ID NO: 37, or a position equivalent thereto. In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NO: 37, or having about 1 to about 20 amino acid mutations or a nucleic acid encoding the same.

[0136] In embodiments, the endonuclease has at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 91, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to SEQ ID NO: 37 and an amino acid modification at position D32. In embodiments, the amino acid modifications are selected from substitutions and deletions. In embodiments, the amino acid modification relative to SEQ ID NO: 37 at D32 is an essential or non-essential amino acid. In embodiments, the amino acid modification at D32 is a hydrophilic or hydrophobic amino acid. In embodiments, the amino acid modification at D32 is amino acid modification is a hydrophilic amino acid. In embodiments, the amino acid modification at D32 is a polar and positively charged hydrophilic amino acid. In embodiments, the amino acid modification at D32 is lysine (K). In embodiments, the amino acid modification at D32 is a polar and neutral charged hydrophilic amino acid. In embodiments, the amino acid modification at D32 is selected from asparagine (N), glutamine (Q), serine (S), threonine (T), proline (P), and cysteine (C). In embodiments, the amino acid modification at D32 is a polar and negatively charged hydrophilic amino acid. In embodiments, the amino acid modification at D32 is glutamate (E). In embodiments, the amino acid modification at D32 is an aromatic, polar and positively charged hydrophilic amino acid. In embodiments, the amino acid modification at D32 is arginine (R) or histidine (H). In embodiments, the amino acid modification at D32 is a hydrophobic amino acid. In embodiments, the amino acid modification at D32 is a hydrophobic, aliphatic amino acid. In embodiments, the amino acid modification at D32 is selected from glycine (G), alanine (A), leucine (L), isoleucine (I), methionine (M), or valine (V). In embodiments, the amino acid modification at D32 is a hydrophobic, aromatic amino acid. In embodiments, the amino acid modification at D32 is selected from phenylalanine (F), tryptophan (W), or tyrosine (Y).

[0137] In embodiments, the crRNA of the trans-splicing system disclosed herein assembles with a Cas protein and associates with a protease. In embodiments, binding of the target RNA to the trans- splicing system comprising the protease leads to allosteric activation of protease activity and cleavage of one or more peptides that associate with the trans-splicing system. In some embodiments, activation of protease activity leads to cleavage of one or more peptides that do not associate with the trans-splicing system. In embodiments, the protease is SEQ ID NO. 40.

[0138] In embodiments, the Type III CRISPR / Cas system comprises a protease having one or more amino acid modifications to reduce or ablate catalytic activity and enable binding of the target RNA and allosteric activation of the protease activity. In embodiments, the amino acid modifications are selected from substitutions and deletions. In embodiments, the Type III CRISPR / Cas system comprises one or more of a substitution at position H630 and / or C671 relative to SEQ ID NO: 40 to reduce or ablate catalytic activity and enable binding of the target RNA. In embodiments, the Type III CRISPR / Cas system comprises one or more of a substitution at position D32 relative to SEQ ID NO: 37, or a position equivalent thereto. In embodiments, the Type III CRISPR / Cas system comprises at least H630A and / or C671A relative to SEQ ID NO: 40, or a position equivalent thereto. In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NO: 40, or having about 1 to about 20 amino acid mutations or a nucleic acid encoding the same.

[0139] In embodiments, the endonuclease has at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 91, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to SEQ ID NO: 40 and an amino acid modification at position H630 and / or C671. In embodiments, the amino acid modifications are selected from substitutions and deletions. In embodiments, the amino acid modification to SEQ ID NO: 40 at H630 and / or C671 is an essential or non-essential amino acid. In embodiments, the amino acid modification at H630 and / or C671 is a hydrophilic or hydrophobic amino acid. In embodiments, the amino acid modification at H630 and / or C671 is amino acid modification is a hydrophilic amino acid. In embodiments, the amino acid modification at H630 and / or C671 is a polar and positively charged hydrophilic amino acid. In embodiments, the amino acid modification at H630 and / or C671 is lysine (K). In embodiments, the amino acid modification at H630 and / or C671 is a polar and neutral charged hydrophilic amino acid. In embodiments, the amino acid modification at H630 and / or C671 is selected from asparagine (N), glutamine (Q), serine (S), threonine (T), proline (P), and cysteine (C). In embodiments, the amino acid modification at H630 and / or C671 is a polar and negatively charged hydrophilic amino acid. In embodiments, the amino acid modification at D32 is glutamate (E). In embodiments, the amino acid modification at H630 and / or C671 is an aromatic, polar and positively charged hydrophilic amino acid. In embodiments, the amino acid modification H630 and / or C671 is arginine (R) or histidine (H). In embodiments, the amino acid modification at D32 is a hydrophobic amino acid. In embodiments, the amino acid modification at H630 and / or C671 is a hydrophobic, aliphatic amino acid. In embodiments, the amino acid modification at H630 and / or C671 is selected from glycine (G), alanine (A), leucine (L), isoleucine (I), methionine (M), or valine (V). In embodiments, the amino acid modification at H630 and / or C671 is a hydrophobic, aromatic amino acid. In embodiments, the amino acid modification at H630 and / or C671 is selected from phenylalanine (F), tryptophan (W), or tyrosine (Y).

[0140] In embodiments, the Type III CRISPR / Cas system comprises a truncation of relative to SEQ ID NOs: 1-39, or a position equivalent thereto. In embodiments, the truncation is greater than about 10 amino acids, or greater than about 20 amino acids, or greater than about 30 amino acids, or greater than about 40 amino acids, or greater than about 50 amino acids, or greater than about 100 amino acids, or greater than about 150 amino acids, or greater than about 200 amino acids, or greater than about 250 amino acids. In embodiments, the truncation is within about 1000 residues from the C- terminus, or about 900 residues from the C- terminus, or about 800 residues from the C- terminus, or about 700 residues from the C- terminus, or about 600 residues from the C- terminus, or about 500 residues from the C- terminus.

[0141] In embodiments, the Type III CRISPR / Cas system comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NOs: 1-39, or having about 1 to about 20 amino acid mutations, or a nucleic acid encoding the same.

[0142] In embodiments, the amino acid mutations are amino acid mutations or amino acid substitutions. In embodiments, the amino acid substitutions are conservative and / or non-conservative substitutions. In embodiments, the amino acid mutations are amino acid truncations of two or more amino acids (e.g. about 1 to about 100, or about 2 to about 90, or about 2 to about 80, or about 2 to about 70, or about 2 to about 60, or about 2 to about 50, or about 2 to about 40, or about 2 to about 30, or about 2 to about 20, or about 2 to about 10, or about 20 to about 100, or about 50 to about 100, or about 70 to about 100 amino acids).

[0143] “Conservative substitutions” may be made, for instance, on the basis of similarity in polarity, charge, size, solubility, hydrophobicity, hydrophilicity, and / or the amphipathic nature of the amino acid residues involved. The 20 naturally occurring amino acids can be grouped into the following six standard amino acid groups: (1) hydrophobic: Met, Ala, Vai, Leu, He; (2) neutral hydrophilic: Cys, Ser, Thr; Asn, Gin; (3) acidic: Asp, Glu; (4) basic: His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; and (6) aromatic: Trp, Tyr, Phe.

[0144] As used herein, “conservative substitutions” are defined as exchanges of an amino acid by another amino acid listed within the same group of the six standard amino acid groups shown above. For example, the exchange of Asp by Glu retains one negative charge in the so modified polypeptide. In addition, glycine and proline may be substituted for one another based on their ability to disrupt a-helices.

[0145] As used herein, “non-conservative substitutions” are defined as exchanges of an amino acid by another amino acid listed in a different group of the six standard amino acid groups (1) to (6) shown above.

[0146] In embodiments, the substitutions may also include non-classical amino acids (e.g. selenocysteine, pyrrolysine, N-formylmethionine P-alanine, GABA and 8-Aminolevulinic acid, 4-aminobenzoic acid (PABA), D-isomers of the common amino acids, 2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, y-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosme, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, P-alanine, fluoro-amino acids, designer amino acids such as P methyl amino acids, C a-methyl amino acids, N a-methyl amino acids, and amino acid analogs in general).

[0147] In embodiments, the percent sequence identity between a particular nucleic acid or amino acid sequence and a sequence referenced by a particular sequence identification number is determined as follows. A nucleic acid or amino acid sequence is compared to the sequence set forth in a particular sequence identification number using, e.g., the BLAST 2 Sequences (B12seq) program from the stand-alone version of BLASTZ containing BLASTN version 2.0.14 and BLASTP version 2.0.14 or the like. This stand-alone version of BLASTZ can be obtained online at or at ncbi.nlm.nih.gov. Instructions explaining how to use the B12seq program can be found in the readme file accompanying BLASTZ. B12seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. To compare two nucleic acid sequences, the options may be set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C:\seql .txt); -j is set to a file containing the second nucleic acid sequence to be compared e.g., C:\seq2.txt); -p is set to blastn; -o is set to any desired file name (e.g., C:\output.txt); -q is set to -1; -r is set to 2; and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two sequences: C:\B12seq -i c:\seql.txt -j c:\seq2.txt -p blastn -o c:\output.txt -q -1 -r 2. To compare two amino acid sequences, the options of B12seq are set as follows: -i is set to a file containing the first amino acid sequence to be compared (e.g., C:\seql.txt); -j is set to a file containing the second amino acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastp; - o is set to any desired file name (e.g., C:\output.txt); and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\B12seq -i c:\seql.txt -j c:\seq2.txt -p blastp -o c:\output.txt. If the two compared sequences share homology, then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology, then the designated output file will not present aligned sequences. Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is presented in both sequences. The percent sequence identity is determined by dividing the number of matches either by the length of the sequence set forth in the identified sequence (e.g., any of SEQ ID NOs: 1-39), or by an articulated length (e.g., 100 consecutive nucleotides or amino acid residues from a sequence set forth in an identified sequence), followed by multiplying the resulting value by 100. It is noted that the percent sequence identity value is rounded to the nearest tenth. For example, 75.11, 75.12, 75.13, and 75.14 is rounded down to 75.1, while 75.15, 75. 16, 75.17, 75.18, and 75.19 is rounded up to 75.2. It also is noted that the length value will always be an integer.

[0148] Nucleic Acid Guide

[0149] In embodiments, the nucleic acid guide is or comprises a RNA. In embodiments, the nucleic acid guide is or comprises a DNA. In embodiments, the trans-splicing system comprises one nucleic acid guide.

[0150] In embodiments, the nucleic acid guide is or comprises SEQ ID NO: 62 (GTCCGGTGAGCTTCCCGGTTTTTGATGTCACGGAAC). In embodiments, the nucleic acid guide comprises a nucleotide sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NO: 4, or having about 1 to about 10, or about 1 to 20 nucleotide mutations, or an amino acid sequence encoding the same. In embodiments, the nucleic acid guide comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NO: 62 , or having about 1 to about 10, or about 1 to 20 amino acid mutations or a nucleic acid encoding the same.

[0151] In embodiments, the nucleic acid guide is or comprises SEQ ID NO: 63 (TTGATGTCACGGAAC). In embodiments, the nucleic acid guide comprises a nucleotide sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NO: 63, or having about 1 to about 10 nucleotide mutations, or an amino acid sequence encoding the same. In embodiments, the nucleic acid guide comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NO: 63, or having about 1 to about 10 amino acid mutations or a nucleic acid encoding the same.

[0152] In embodiments, the nucleic acid guide is or comprises a full repeat sequence. In embodiments, the nucleic acid guide is or comprises SEQ ID NO: 64 (GAUCGAUACCCACCCCGAAGAAAAGGGGACGAGAAC). In embodiments, the nucleic acid guide of SEQ ID NO: 64 has a repeat before a spacer before a repeat. In embodiments, the nucleic acid guide of SEQ ID NO: 64 has multiple spacers separated by multiple repeats. In embodiments, the nucleic acid guide comprises a nucleotide sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NO: 64, or having about 1 to about 10 nucleotide mutations, or an amino acid sequence encoding the same. In embodiments, the nucleic acid guide comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NO: 64, or having about 1 to about 10 amino acid mutations or a nucleic acid encoding the same.

[0153] In embodiments, the nucleic acid guide is or comprises a partial repeat sequence. In embodiments, In embodiments, the nucleic acid guide is or comprises SEQ ID NO: 65 (ACGAGAA). In embodiments, the nucleic acid guide of SEQ ID NO: 65 has a repeat before a spacer before a repeat. In embodiments, the nucleic acid guide of SEQ ID NO: 65 has multiple spacers separated by multiple repeats. In embodiments, the nucleic acid guide comprises a nucleotide sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NO: 65, or having about 1 to about 10 nucleotide mutations, or an amino acid sequence encoding the same. In embodiments, the nucleic acid guide comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NO: 65, or having about 1 to about 10 amino acid mutations or a nucleic acid encoding the same.

[0154] In embodiments, the guide ribonucleic structure (i) comprises (a) a CRISPR RNA (crRNA) suitable for associating with a target nucleic acid molecule and / or (b) a transactivating CRISPR RNA (tracrRNA) suitable for interacting with the endonuclease or (ii) lacks a (a) a crRNA suitable for associating with to a target nucleic acid molecule and / or (b) a tracrRNA suitable for interacting with the endonuclease. In embodiments, the trans-splicing system comprises more than one nucleic acid guide. In embodiments, the nucleic acid guides recognize multiple targets. In embodiments, the nucleic acid guide targets a splice acceptor site. In embodiments, the nucleic acid guide targets a splice donor site. In embodiments, the nucleic acid guide targets a region near a splice site.

[0155] In embodiments, the nucleic acid guide targets a region within about 200 nucleotides of a splice site, or within about 190 nucleotides of a splice site, or within about 180 nucleotides of a splice site, or within about 170 nucleotides of a splice site, or within about 160 nucleotides of a splice site, or within about 150 nucleotides of a splice site, or within about 140 nucleotides of a splice site, or within about 130 nucleotides of a splice site, or within about 120 nucleotides of a splice site, or within about 110 nucleotides of a splice site, or within about 100 nucleotides of a splice site, or within about 90 nucleotides of a splice site, or within about 80 nucleotides of a splice site, or within about 70 nucleotides of a splice site, or within about 60 nucleotides of a splice site, or within about 50 nucleotides of a splice site, or within about 40 nucleotides of a splice site, or within about 30 nucleotides of a splice site, or within about 20 nucleotides of a splice site, or within about 10 nucleotides of a splice site.

[0156] In embodiments, the nucleic acid guide targets a region less than or equal to 100 nucleotides from a splice site.

[0157] In embodiments, the more than one nucleic acid guides target one or more target nucleic acid of interest. In embodiments, the more than one nucleic acid guides target multiple nucleic acids of interest.

[0158] In embodiments, the nucleic acid guide interacts with the Type III CRISPR / Cas system. In embodiments, the Type III CRISPR / Cas system forms a complex with the nucleic acid guide.

[0159] RNA-Binding Domain

[0160] In embodiments, the specific RNA-binding domain is suitable for binding an RNA aptamer.

[0161] In embodiments, the specific RNA-binding domain is or comprises a viral protein. In embodiments, the viral protein is or comprises a MS2 binding protein (MCP), a IN protein, a PP7 coat protein, or a QBeta coat protein. In embodiments, the specific RNA-binding domain is or comprises MS2, PP7, Q , F2, GA, fr, JP501, M12, R17, BZ13, JP34, JP500, KU1, MH, MX1, TW18, VK, SP, FI, ID2, NL95, TW19, AP205, (^Cb5, ^Cb8r, <^Cbl2r, ^Cb23r, 7s, or PRR1. In embodiments, the specific RNA-binding domain is covalently bound to the Type III CRISPR / Cas system. In embodiments, the specific RNA-binding domain is not covalently bound to the Type III CRISPR / Cas system. In embodiments, the specific RNA-binding domain and Type III CRISPR / Cas system are present in a single polypeptide fusion protein.

[0162] In embodiments, the specific RNA-binding domain and Type III CRISPR / Cas system are joined by a linker. In embodiments, the linker is between about 4 and about 40 amino acids, or about 10 and about 40 amino acids, or about 20 and about 40 amino acids, or about 30 and about 40 amino acids, or about 4 and about 30 amino acids, or about 4 and about 20 amino acids, or about 4 and about 10 amino acids, or about 5 amino acids, or about 10 amino acids, or about 15 amino acids, or about 20 amino acids, or about 25 amino acids, or about 30 amino acids, or about 35 amino acids, or about 40 amino acids.

[0163] In embodiments, the linker is substantially comprised of glycine and serine residues. In embodiments, the linker is (GGS)n, whereinnis 1, or 2, or 3, or 4, or 5. In embodiments, the linker is GGSGGSGGSG (SEQ ID NO: 41), GGSGGSGGGGSGGGGS (SEQ ID NO: 42), GGGGS (SEQ ID NO: 43), GGS (SEQ ID NO: 44), (GGGGS)n(n=l-4) (SEQ ID NO: 45), (Gly)s (SEQ ID NO: 46), (Gly)6(SEQ ID NO: 47), (EAAAK)n(n=l-3) (SEQ ID NO: 48), A(EAAAK)nA (n = 2- 5) (SEQ ID NO: 49), AEAAAKEAAAKA (SEQ ID NO: 50), A(EAAAK)4ALEA(EAAAK)4A (SEQ ID NO: 51), PAPAP (SEQ ID NO: 52), KESGSVSSEQLAQFRSLD (SEQ ID NO: 53), EGKSSGSGSESKST (SEQ ID NO: 54), and GSAGSAAGSGEF (SEQ ID NO: 55), or a variant thereof, wherein the variant comprises about 1, or about 2, or about 3, or about 4, or about 5 mutations, the mutations selected from substitutions or deletions.

[0164] Repair Template

[0165] In embodiments, the trans-splicing system comprises one repair template. In embodiments, the trans-splicing system comprises a guide RNA operably linked to one repair template. In embodiments, the trans-splicing system comprises a guide RNA operably linked to one repair template by the same promoter. In embodiments, the trans-splicing system comprises a guide RNA operably linked to one repair template and is processed from an RNA transcript comprising the one repair template. In embodiments, the trans-splicing system comprises a guide RNA operably linked to one repair template and is not processed from an RNA transcript comprising the one repair template. In embodiments, the trans-splicing system comprises more than one repair template. In embodiments, the trans-splicing system comprises a guide RNA operably linked to more than one repair template. In embodiments, the trans-splicing system comprises a guide RNA operably linked to more than one repair template by the same promoter. In embodiments, the trans-splicing system comprises a guide RNA operably linked to more than one repair template and is processed from an RNA transcript comprising the more than one repair template. In embodiments, the trans- splicing system comprises a guide RNA operably linked to more than one repair template and is not processed from an RNA transcript comprising the one repair template.

[0166] In embodiments, the repair template is delivered or deliverable to a cell as DNA.

[0167] In embodiments, the repair template is delivered or deliverable to a cell as RNA. In embodiments, the repair template is expressed or suitable for expression as RNA.

[0168] In embodiments, the repair template comprises a splice acceptor. In embodiments, the repair template comprises a splice donor. In embodiments, the repair template comprises a splice acceptor and a splice donor.

[0169] In embodiments, the splice donor comprises a nucleic acid sequence encoding a functional gene product. In embodiments, the splice donor comprises a nucleic acid sequence encoding one or more exons. In embodiments, the splice donor comprises a nucleic acid sequence encoding a wild type gene or exon. In embodiments, the splice donor is suitable for replacement of a mutant gene in a pre-mRNA of a target nucleic acid of interest.

[0170] In embodiments, the repair template comprises one or more splice sites.

[0171] In embodiments, the repair template comprises an exon. In embodiments, the repair template comprises more than one exon.

[0172] In embodiments, the repair template comprises an intron. In embodiments, the repair template comprises more than one intron.

[0173] In embodiments, the repair template comprises one or multiple sequences that associate with the target nucleic acid of interest. In embodiments, at least one portion of the repair template comprises a ms2 hairpin that specifically binds or it suitable for binding to the MS2 binding protein. In embodiments, the repair template comprises a boxB hairpin that specifically binds or it suitable for binding to the IN protein. In embodiments, the repair template comprises a PP7 hairpin that specifically binds or it suitable for binding to the PP7 coat protein. In embodiments, the repair template comprises a QBeta hairpin that specifically binds or it suitable for binding to the QBeta coat protein.

[0174] Hybridizing

[0175] In embodiments, the association described herein is a hybridization.

[0176] In some embodiments, hybridization or hybridizes refers to a reaction in which one or more polynucleotides react to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding may occur by Watson-Crick base pairing, Hoogstein binding, or in any other sequence-specific manner. In embodiments, the complex comprises two strands forming a duplex structure, three or more strands forming a multi -stranded complex, a single self-hybridizing strand, or any combination of these.

[0177] In embodiments, the repair template comprising a splice donor and / or splice acceptor and an RNA sequence hybridizes to the Type III CRISPR / Cas system and / or specific RNA-binding domain under physiological conditions. In embodiments, physiological conditions typically refers to biologic parameters that are valid for an animal, e.g. a mammal, e.g. a human. In embodiments, physiological conditions relate to biochemical and biophysical parameters commonly found in mammals, e.g. in the human body (especially body fluids). In embodiments, physiological conditions include one or more of temperature (about 37° C. for human body), pH (about 7.35- 7.45 for human blood), osmotic pressure (about 280-300 mmol / Kg H2O) and protein content (about 66-85 g / 1 serum). Those skilled in the art will appreciate that these parameters may vary. For example, such temperature, pH, osmotic pressure, and protein content may be different in a given body or tissue. In embodiments, physiological conditions refers to conditions in a buffer system, solvent, and / or excipient that mimic conditions in an animal, e.g. a mammal, e.g. a human.

[0178] In embodiments, the repair template comprising a splice donor and / or splice acceptor and an RNA sequence hybridizes to the Type III CRISPR / Cas system and / or specific RNA-binding domain under stringent conditions. In embodiments, stringent conditions for hybridization refers to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with the target sequence, and substantially does not hybridize to non-target sequences. In embodiments, stringent conditions are generally sequence-dependent, and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. In embodiments, stringent conditions include hybridization in about 6* sodium chloride / sodium citrate (SSC) at about 45° C, followed by one or more washes in about 0.2><SSC, 0.1% SDS at 50-65° C. Other examples of stringent conditions are known to those skilled in the art (see, e.g. Molecular Cloning: A Laboratory Manual, Sambrook et al., Cold Spring Harbor Press, Cold Spring Harbor, N.Y. (1989)).

[0179] Trans-Splicing System

[0180] In embodiments, there is provided trans-splicing systems and methods. In embodiments, the present disclosure promotes the catalysis of trans-splicing events. In embodiments, there is provided systems and methods that promote a trans-splicing reaction between an exogenous pre- trans- splicing RNA molecule and a target endogenous pre-mRNA that induces the formation of a chimeric mRNA. In embodiments, trans-splicing system comprises: a nucleic acid-targeting Type III CRISPR / Cas system; a nucleic acid guide; optionally, a specific RNA-binding domain; and a repair template comprising a splice donor and / or splice acceptor and an RNA sequence that associates with the Type III CRISPR / Cas system and / or specific RNA-binding domain.

[0181] In embodiments, the trans-splicing system comprises a repair template comprising a splice donor and / or a splice acceptor. In embodiments, the trans-splicing system further comprises a repair template lacking a splice donor and / or a splice acceptor.

[0182] In embodiments, the trans-splicing system comprises a splice donor and a splice acceptor. In embodiments, the trans-splicing system comprises a splice donor, a splice acceptor, and the trans- splicing system is suitable for replacing an internal exon in a gene.

[0183] In embodiments, the trans-splicing system comprises a repair template comprising a splice donor and / or a splice acceptor. In embodiments, the trans-splicing system comprises a repair template comprising a splice donor and a splice acceptor. In embodiments, the trans-splicing system comprises a repair template comprising a splice donor and a splice acceptor, and the trans-splicing system and / or repair template is suitable for replacing an internal exon in a gene. In embodiments, there is provided a method of trans-splicing an exon in a target nucleic acid, e.g. a pre-mRNA in a cell, the method comprising contacting the cell with the trans-splicing system disclosed herein, wherein the trans-splicing system comprises a repair template comprising a splice donor and a splice acceptor. In embodiments, the present disclosure provides a method of trans-splicing an exon in a target nucleic acid, e.g. a pre-mRNA in a cell in a subject in need thereof, comprising administering an effective amount of the trans-splicing system disclosed herein, wherein the trans- splicing system comprises a repair template comprising a splice donor and a splice acceptor.

[0184] In embodiments, the trans-splicing system further comprises a repair template lacking a splice donor and / or a splice acceptor. In embodiments, the trans-splicing system is suitable for splicing of a target nucleic acid comprising a splice donor or a splice acceptor site. In embodiments, the trans-splicing system comprises an RNA molecule, e.g. gRNA that targets a splice acceptor site. In embodiments, the trans-splicing system comprises an RNA molecule, e.g. gRNA that targets a splice donor site. In embodiments, the trans-splicing system comprises is regulated or regulatable by a small molecule. In various embodiments, the small molecule is selected from abscisic acid (ABA), rapamycin (or rapalog), FK506, Cyclosporine A, FK1012, Gibberellin3-AM, FKCsA, AP1903 / AP20187, and auxin. In embodiments, the pre-mRNA is at an intron-exon junction or exon-intron junctions.

[0185] In embodiments, the trans-splicing system comprises a pre-trans-splicing (PTS) molecule, wherein the PTS molecule comprises: i) one or more guideRNAs (gRNAs) that target a pre-mRNA; ii) an intronic sequence having a splice signal; and iii) a donor sequence encoding a gene product of a gene of interest, or portion thereof. In embodiments, the gRNA or gRNAs are within the PTS and processed by the endonuclease. In embodiments, the gRNA or gRNAs are within the PTS and are not processed by the endonuclease. In embodiments, the gRNA or gRNAs are not within the PTS. In embodiments, the PTS is the repRNA.

[0186] In embodiments, the trans-splicing system comprises a repair RNA (repRNA) sequence, comprising: (a) one or more exons and / or introns; (b) a splice donor and / or splice acceptor, wherein the repRNA is suitable for trans-splicing. In embodiments, the trans-splicing system comprises a system for trans-splicing a target nucleic acid comprising a repRNA, the repRNA comprising: (a) one or more exons and / or introns; and (b) a splice donor and / or splice acceptor. In embodiments, the repRNA comprises one or more binding motifs that direct, and / or hybridizes, the repRNA to a target nucleic acid molecule. In embodiments, the repRNA further comprises a guide RNA (gRNA). In embodiments, the gRNA hybridizes to the target nucleic acid molecule. In embodiments, the gRNA directs the repRNA to a target nucleic acid molecule. In embodiments, the repRNA is operably linked to one or more sequences that are antisense to the target nucleic acid molecule. In embodiments, the repRNA is provided in cis to one or more sequences that bind to, and / or hybridize to, the target nucleic acid molecule. In embodiments, the repRNA is not operably linked to one or more sequences that bind to, and / or hybridize to, the target nucleic acid molecule. In embodiments, the repRNA is provided in trans to one or more sequences that bind to, and / or hybridize to, the target nucleic acid molecule. In embodiments, the repRNA is operably linked to one or more sequences that bind to, and / or hybridize to, an RNA- binding polypeptide. In embodiments, the repRNA is provided in cis to one or more sequences that bind to, and / or hybridize to, a RNA-binding polypeptide.

[0187] In embodiments, the repRNA is not operably to one or more sequences that bind to, and / or hybridize to, a RNA-binding polypeptide, which is herein described as a “grepRNA”.

[0188] In embodiments, the grepRNA comprises a repair RNA and a gRNA. In embodiments, “grepRNA” is used interchangeably with “PTS”.

[0189] In embodiments, the trans-splicing system is suitable for nucleic acid comprising a splice donor or a splice acceptor site. In embodiments, the trans-splicing system comprises an RNA molecule, e.g. gRNA that targets a splice acceptor site. In embodiments, the trans-splicing system comprises an RNA molecule, e.g. gRNA that targets a splice donor site. In embodiments, the trans-splicing system comprises is regulated or regulatable by a small molecule. In various embodiments, the small molecule is selected from abscisic acid (ABA), rapamycin (or rapalog), FK506, Cyclosporine A, FK1012, Gibberellin3-AM, FKCsA, AP1903 / AP20187, and auxin. In embodiments, the pre-mRNA is at an intron-exon junction or exon-intron junctions. In embodiments, the trans-splicing system comprises a pre-trans-splicing (PTS) molecule, wherein the PTS molecule comprises: i) one or more guideRNAs (gRNAs) that target a pre-mRNA; ii) an intronic sequence having a splice signal; and iii) a donor sequence encoding a gene product of a gene of interest, or portion thereof. In embodiments, the gRNA or gRNAs are within the PTS and processed by the endonuclease. In embodiments, the gRNA or gRNAs are within the PTS and are not processed by the endonuclease. In embodiments, the gRNA or gRNAs are not within the PTS. In embodiments, the endonuclease is fused to a nucleic acid-interacting domain (e.g. MCP) and the PTS is tethered by the nuclease by interacting with the nucleic acid-interacting domain. In embodiments, one or more gRNAs hybridize to one or more pre-mRNAs. In embodiments, the endonuclease is catalytically active. In embodiments the endonuclease is catalytically inactive. In embodiments the endonuclease (or chimera) is delivered to a cell with viral methods. In embodiments the endonuclease (or chimera), and gRNA(s) or PTS are delivered or deliverable with viral methods. In embodiments the endonuclease (or chimera), gRNA(s), and PTS are delivered or deliverable with viral methods. In embodiments the endonuclease (or chimera) is delivered or deliverable to a cell with non-viral methods. In embodiments the endonuclease (or chimera), and gRNA(s) or PTS are delivered or deliverable with non-viral methods. In embodiments the endonuclease (or chimera), gRNA(s), and PTS are delivered or deliverable with non-viral methods. In embodiments, the endonuclease (or chimera) is delivered or deliverable to a cell implicated in disease. In embodiments, the endonuclease (or chimera) mediates trans-splicing of a pre-mRNA implicated in disease.

[0190] General Features of the Compositions and Methods

[0191] In embodiments, the trans-splicing system is suitable for transient RNA repair. In embodiments, the trans-splicing system is suitable for trans-splicing at an intron-exon junction or exon-intron junctions of a pre-mRNA. In embodiments, the trans-splicing system is suitable for trans-splicing of a pre-mRNA at the 5' end of the pre-mRNA. In embodiments, the trans-splicing system is suitable for trans-splicing of a pre-mRNA at the 3' end of the pre-mRNA. In embodiments, the trans-splicing system is suitable for trans-splicing of a pre-mRNA at an internal site within a pre- mRNA. In embodiments, the trans-splicing system is suitable for replacing the 5' or the 3' end of the target mRNA.

[0192] In embodiments, at least one portion of the trans-splicing system is introduced into a cell.

[0193] In embodiments, the expression and / or activity of at least one portion of the trans-splicing system is transient.

[0194] In embodiments, the activity of at least one portion of the trans-splicing system is regulated by a small molecule. In embodiments, the small molecule is selected from abscisic acid (ABA), rapamycin (or rapalog), FK506, cyclosporine A, FK1012, Gibberellin3-AM, FKCsA, AP1903 / AP, and Auxin. In embodiments, the small molecule binding domain is an ABA-binding domain. In embodiments, the ABA-binding domain is or comprises an AB II polypeptide.

[0195] In embodiments, the trans-splicing system further comprises a viral protein. In embodiments, the viral protein further comprises a small molecule binding domain. In embodiments, the viral protein and the small molecule binding domain are linked by a linker. In embodiments, the linker is substantially comprised of glycine and serine residues. In embodiments, the linker is (GGS)n, wherein nis 1, or 2, or 3, or 4, or 5. In embodiments, the linker is GGSGGSGGSG (SEQ ID NO: 41), GGSGGSGGGGSGGGGS (SEQ ID NO: 42), GGGGS (SEQ ID NO: 43), GGS (SEQ ID NO: 44), (GGGGS)n(n=l-4) (SEQ ID NO: 45), (Gly)s (SEQ ID NO: 46), (Gly)6(SEQ ID NO: 47), (EAAAK)n(n=l-3) (SEQ ID NO: 48), A(EAAAK)nA (n = 2- 5) (SEQ ID NO: 49), AEAAAKEAAAKA (SEQ ID NO: 50), A(EAAAK)4ALEA(EAAAK)4A (SEQ ID NO: 51), PAPAP (SEQ ID NO: 52), KESGSVSSEQLAQFRSLD (SEQ ID NO: 53), EGKSSGSGSESKST (SEQ ID NO: 54), and GSAGSAAGSGEF (SEQ ID NO: 55), or a variant thereof, wherein the variant comprises about 1, or about 2, or about 3, or about 4, or about 5 mutations, the mutations selected from substitutions or deletions.

[0196] In embodiments, the small molecule binding domain is an ABA-binding domain. In embodiments, ABA-binding domain the ABA-binding domain comprises a PYL1 polypeptide. In embodiments, the addition of ABA induces targeted trans-splicing of a target pre-mRNA.

[0197] In embodiments, the trans-splicing system further comprises a promoter operably linked to one or more of the components of the trans-splicing system. In embodiments, the promoter is an inducible promoter. In embodiments, the promoter is a tissue-specific promoter.

[0198] In embodiments, the trans-splicing system further comprises one or more self-cleaving ribozymes is association with one or more of the components of the trans-splicing system.

[0199] In embodiments, the Type III CRISPR / Cas system is targeted to a nucleic acid. In embodiments, the nucleic acid is RNA. In embodiments, the nucleic acid is DNA. In embodiments, the Type III CRISPR / Cas system is associated with RNA in a cell. In embodiments, the RNA is a pre-mRNA.

[0200] In embodiments, the CRISPR / Cas system is associated with DNA in a cell. In embodiments, the CRISPR / Cas system is not associated with DNA in a cell.

[0201] In embodiments, the CRISPR / Cas system mediates trans-splicing of pre-mRNA in the nucleus of a cell. In embodiments, the CRISPR / Cas system mediates trans-splicing of pre-mRNA in the cytoplasm of a cell. In embodiments, the trans-splicing occurs in dividing cells. In embodiments, the trans-splicing occurs in post-mitotic cells. In embodiments, post-mitotic cells are neurons, myocytes, or adipocytes. In embodiments, expression of at least one portion of the trans-splicing system is inducible. In embodiments, activity of at least one portion of the trans-splicing system is inducible.

[0202] Delivery / LNP / Nucleic Acids / Cells

[0203] In embodiments, the endonuclease (or chimeric protein) comprises a polypeptide that promotes or is suitable for VLP delivery, including, without limitation, a retroviral gag polyprotein comprising a matrix polypeptide, a capsid polypeptide, and a nucleocapsid polypeptide (optionally with one or more heterologous protease cleavage sites (e.g. TEV cleavage site, a PreScission (fusion protein of glutathione S-transferase (GST) and human rhinovirus (HRV) type 14 3C protease) cleavage site, a human rhinovirus 3C protease cleavage site, an enterokinase cleavage site, an Epstein-Barr virus protease cleavage site, a cathepsin D cleavage site, and / or a thrombin cleavage site) between one or both of: the matrix polypeptide and the capsid polypeptide; and the capsid polypeptide and the nucleocapsid polypeptide, e.g., a lentiviral gag polyprotein, e.g., a bovine immunodeficiency virus gag polyprotein, a murine leukemia virus (MLV) a gag protein, a simian immunodeficiency virus gag polyprotein, a feline immunodeficiency virus gag polyprotein, a human immunodeficiency virus gag polyprotein, an equine infection anemia virus gag polyprotein, and a caprine arthritis encephalitis virus gag polyprotein or a gag polyprotein of an alpha retrovirus, a beta retrovirus, a gamma retrovirus, a delta retrovirus, an epsilon retrovirus, or a spumavirus. In embodiments, the polypeptide that promotes or is suitable for VLP delivery is co-delivered with a protease to promote cleavage of the chimeric protein. In embodiments, the cleavage of the chimeric protein occurs between the endonuclease and the polypeptide that promotes or is suitable for VLP delivery. In embodiments, the protease is fused to a polypeptide that promotes or is suitable for VLP delivery.

[0204] In embodiments, the trans-splicing system further comprises a viral vector or a non-viral vector. In embodiments, the viral vector is or comprises a retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, anellovirus, or baculovirus. In embodiments, the viral vector is or comprises a virus-like particle (VLP). In embodiments, the viral vector is or comprises an AAV. In embodiments, the AAV is or comprises one or more of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV2 / 1, AAV2 / 5, AAV2 / 8, AAV2 / 9, AAV3 / 1, AAV3 / 5, AAV3 / 8, and AAV3 / 9. In aspects, the present disclosure provides a viral vector comprising the nucleic acid of any one of the embodiments and / or aspects disclosed herein. In aspects, the present disclosure provides an expression vector comprising the nucleic acid of any one of the embodiments and / or aspects disclosed herein.

[0205] In embodiments, the expression vector is selected from viral expression vectors (e.g., viral vectors based on vaccinia virus; poliovirus; adenovirus (see, e.g., Li et al., Invest Opthalmol Vis Sci 35:2543 2549, 1994; Borras et al., Gene Ther 6:515 524, 1999; Li and Davidson, PNAS 92:7700 7704, 1995; Sakamoto et al., H Gene Ther 5: 1088 1097, 1999; WO 94 / 12649, WO 93 / 03769; WO 93 / 19191; WO 94 / 28938; WO 95 / 11984 and WO 95 / 00655); adeno-associated virus (AAV) (see, e.g., Ali et al., Hum Gene Ther 9:81 86, 1998, Flannery et al., PNAS 94:69166921, 1997; Bennett et al., Invest Opthalmol Vis Sci 38:2857 2863, 1997; Jomary et al., Gene Ther 4:683 690, 1997, Rolling et al., Hum Gene Ther 10:641 648, 1999; Ali et al., Hum Mol Genet 5:591 594, 1996; Srivastava in WO 93 / 09239, Samulski et al., J. Vir. (1989) 63:3822-3828; Mendelson et al., Virol. (1988) 166:154-165; and Flotte et al., PNAS (1993) 90:10613-10617); SV40; herpes simplex virus; human immunodeficiency virus (see, e.g., Miyoshi et al., PNAS 94: 10319 23, 1997; Takahashi et al., J Virol 73:7812 7816, 1999); a retroviral vector (e.g., Murine Leukemia Virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, a lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus); and the like. In embodiments, a recombinant expression vector of the present disclosure is a recombinant adeno-associated virus (AAV) vector. In embodiments, a recombinant expression vector of the present disclosure is a recombinant lentivirus vector. In embodiments, a recombinant expression vector of the present disclosure is a recombinant retroviral vector.

[0206] In embodiments, the composition further comprises a VLP, e.g. a structure that in at least one attribute resembles a virus, but which has not been demonstrated to be infectious. In embodiments, the VLP is a nonreplicating, noninfectious viral shell that contains a viral capsid but lacks all or part of the viral genome, in particular, the replicative components of the viral genome. In embodiments, the VLP is composed of one or more viral proteins, such as, but not limited to those proteins referred to as capsid, coat, shell, surface, and structural proteins (e.g., VP1, VP2). In embodiments, the VLP resembles the structure of a bacteriophage, being non-replicative and noninfectious, and lacking at least the gene or genes coding for the replication machinery of the bacteriophage, and also lacking the gene or genes encoding the protein or proteins responsible for viral attachment to or entry into the host. In embodiments, the VLP comprises a polypeptide that promotes or is suitable for VLP delivery, including, without limitation, a retroviral gag polyprotein comprising a matrix polypeptide, a capsid polypeptide, and a nucleocapsid polypeptide (optionally with one or more heterologous protease cleavage sites (e.g. TEV cleavage site, a PreScission (fusion protein of glutathione S-transferase (GST) and human rhinovirus (HRV) type 14 3C protease) cleavage site, a human rhinovirus 3C protease cleavage site, an enterokinase cleavage site, an Epstein-Barr virus protease cleavage site, a cathepsin D cleavage site, and / or a thrombin cleavage site) between one or both of: the matrix polypeptide and the capsid polypeptide; and the capsid polypeptide and the nucleocapsid polypeptide, e.g., a lentiviral gag polyprotein, e.g., a bovine immunodeficiency virus gag polyprotein, a murine leukemia virus (MLV) a gag protein, a simian immunodeficiency virus gag polyprotein, a feline immunodeficiency virus gag polyprotein, a human immunodeficiency virus gag polyprotein, an equine infection anemia virus gag polyprotein, and a caprine arthritis encephalitis virus gag polyprotein or a gag polyprotein of an alpha retrovirus, a beta retrovirus, a gamma retrovirus, a delta retrovirus, an epsilon retrovirus, or a spumavirus. In embodiments, the polypeptide that promotes or is suitable for VLP delivery is co-delivered with a protease to promote cleavage of the chimeric protein. In embodiments, the cleavage of the chimeric protein occurs between the endonuclease and the polypeptide that promotes or is suitable for VLP delivery. In embodiments, the protease is fused to a polypeptide that promotes or is suitable for VLP delivery.

[0207] Depending on the host / vector system utilized, in embodiments, any of a number of transcription and / or translation control elements, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, and the like may be used in the expression vector. In embodiments, a nucleotide sequence encoding a present RNA is operably linked to a control element, e.g., a transcriptional control element, such as a promoter. In embodiments, a nucleotide sequence encoding a present protein, or a present fusion polypeptide is operably linked to a control element, e.g., a transcriptional control element, such as a promoter. In embodiments, the transcriptional control element is a promoter. In embodiments, the promoter is a constitutively active promoter. In embodiments, the promoter is a regulatable promoter. In embodiments, the promoter is an inducible promoter. In embodiments, the promoter is a tissue-specific promoter. In embodiments, the promoter is a cell type-specific promoter. In embodiments, the transcriptional control element (e.g, the promoter) is functional in a targeted cell type or targeted cell population. For example, in embodiments, the transcriptional control element is functional in eukaryotic cells, e.g., hematopoietic stem cells (e.g., mobilized peripheral blood (mPB) CD34(+) cell, bone marrow (BM) CD34(+) cell, and the like). In embodiments, eukaryotic promoters (promoters functional in a eukaryotic cell) include EFla, those from cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, early and late SV40, long terminal repeats (LTRs) from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.

[0208] In embodiments, the promoter is derived from viruses and can therefore be referred to as viral promoters, or they are derived from any organism, including prokaryotic or eukaryotic organisms. In embodiments, the promoter is used to drive expression by any RNA polymerase (e.g., pol I, pol II, pol III). Exemplary promoters include, but are not limited to the SV40 early promoter, mouse mammary tumor virus long terminal repeat (LTR) promoter; adenovirus major late promoter (Ad MLP); a herpes simplex virus (HSV) promoter, a cytomegalovirus (CMV) promoter (e.g. is or comprising SEQ ID NO: 70, or a variant thereof) such as the CMV immediate early promoter region (CMVIE), a rous sarcoma virus (RSV) promoter, a human U6 small nuclear promoter (U6) (Miyagishi et al., Nature Biotechnology 20, 497 - 500 (2002)), an enhanced U6 promoter (e.g., Xia et al., Nucleic Acids Res. 2003 Sep 1 ;31(17)), a human Hl promoter (Hl), and the like.

[0209] In embodiments, a nucleotide sequence encoding a present RNA is operably linked to (under the control of) a promoter operable in a eukaryotic cell (e.g., a U6 promoter, an enhanced U6 promoter, an Hl promoter, and the like). As would be understood by one of ordinary skill in the art, when expressing an RNA e.g., a guide RNA) from a nucleic acid (e.g., an expression vector) using a U6 promoter (e.g., in a eukaryotic cell), or another PolIII promoter, the RNA may need to be mutated if there are several Ts in a row (coding for Us in the RNA). This is because a string of Ts (e.g., about 5 Ts) in DNA can act as a terminator for polymerase III (PolIII). Thus, in order to ensure transcription of an RNA in a eukaryotic cell it may be desirable to modify the sequence encoding the RNA to eliminate runs of Ts. In embodiments, a nucleotide sequence encoding a present protein (e.g., a disclosed protein or chimeric protein) is operably linked to a promoter operable in a eukaryotic cell (e.g., a CMV promoter, an EFla promoter, an estrogen receptor- regulated promoter, and the like).

[0210] In embodiments, the inducible promoter includes, but are not limited to, one of T7 RNA polymerase promoter, T3 RNA polymerase promoter, Isopropyl-beta-D-thiogalactopyranoside (IPTG)-regulated promoter, lactose induced promoter, heat shock promoter, Tetracycline- regulated promoter, Steroid-regulated promoter, Metal -regulated promoter, estrogen receptor- regulated promoter, and the like. Inducible promoters can therefore be regulated by molecules including, but not limited to, doxycycline; estrogen and / or an estrogen analog; IPTG; and the like. Examples of inducible promoters include, without limitation, chemically / biochemically-regulated and physically-regulated promoters such as alcohol -regulated promoters, tetracycline-regulated promoters (e.g., anhydrotetracycline (aTc)-responsive promoters and other tetracycline-responsive promoter systems, which include a tetracycline repressor protein (tetR), a tetracycline operator sequence (tetO) and a tetracycline transactivator fusion protein (tTA)), steroid-regulated promoters (e.g., promoters based on the rat glucocorticoid receptor, human estrogen receptor, moth ecdysone receptors, and promoters from the steroid / retinoid / thyroid receptor superfamily), metal-regulated promoters (e.g., promoters derived from metallothionein (proteins that bind and sequester metal ions) genes from yeast, mouse and human), pathogenesis-regulated promoters (e.g., induced by salicylic acid, ethylene or benzothiadiazole (BTH)), temperature / heat-inducible promoters (e.g., heat shock promoters), and light-regulated promoters (e.g., light responsive promoters from plant cells).

[0211] In embodiments, the promoter is a spatially restricted promoter (e.g., cell type specific promoter, tissue specific promoter, and the like) such that in a multi-cellular organism, the promoter is active (e.g., “ON”) in a subset of specific cells. Spatially restricted promoters may also be referred to as enhancers, transcriptional control elements, control sequences, etc. Any convenient spatially restricted promoter may be used as long as the promoter is functional in the targeted host cell (e.g., eukaryotic cell; prokaryotic cell).

[0212] In embodiments, the promoter is a reversible promoter. Suitable reversible promoters, including reversible inducible promoters are known in the art. Such reversible promoters may be isolated and derived from many organisms, e.g., eukaryotes and prokaryotes. Modification of reversible promoters derived from a first organism for use in a second organism, e.g., a first prokaryote and a second a eukaryote, a first eukaryote and a second a prokaryote, etc., is well known in the art. Such reversible promoters, and systems based on such reversible promoters but also comprising additional control proteins, include, but are not limited to, alcohol regulated promoters (e.g., alcohol dehydrogenase I (alcA) gene promoter, promoters responsive to alcohol transactivator proteins (AlcR), and the like), tetracycline regulated promoters, (e.g., promoter systems including TetActivators, TetON, TetOFF, and the like), steroid regulated promoters (e.g., rat glucocorticoid receptor promoter systems, human estrogen receptor promoter systems, retinoid promoter systems, thyroid promoter systems, ecdysone promoter systems, mifepristone promoter systems, and the like), metal regulated promoters (e.g., metallothionein promoter systems, and the like), pathogenesis-related regulated promoters (e.g., salicylic acid regulated promoters, ethylene regulated promoters, benzothiadiazole regulated promoters, and the like), temperature regulated promoters (e.g., heat shock inducible promoters (e.g., HSP-70, HSP-90, soybean heat shock promoter, and the like), light regulated promoters, synthetic inducible promoters, and the like.

[0213] In embodiments, the vector contains a ribosome binding site for translation initiation and a transcription terminator. In embodiments, the vector includes appropriate sequences for amplifying expression. In embodiments, the vector includes nucleotide sequences encoding protein tags (e.g, 6xHis tag, hemagglutinin tag (e.g., GSGPKKKRKVAAAYPYDVPDYA (SEQ ID NO: 66)), fluorescent protein, and the like) that are fused to the present protein, e.g., at the N- or C- terminus or between the N- or C- terminus, thus resulting in a fusion present polypeptide.

[0214] In embodiments, methods of introducing a nucleic acid (e.g., a nucleic acid comprising a donor polynucleotide sequence, one or more nucleic acids encoding a present protein and / or a present RNA, and the like) into a host cell are known in the art, and any convenient method is used to introduce a nucleic acid (e.g., an expression construct) into a cell. Suitable methods include e.g., viral infection, transfection, lipofection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome- mediated transfection, particle gun technology, calcium phosphate precipitation, direct microinjection, nanoparticle-mediated nucleic acid delivery, and the like.

[0215] In embodiments, introducing the recombinant expression vector into cells can occur in any culture media and under any culture conditions that promote the survival of the cells. In embodiments, introducing the recombinant expression vector into a target cell is carried out in vivo or ex vivo. In embodiments, introducing the recombinant expression vector into a target cell is carried out in vitro.

[0216] In embodiments, the present protein (e.g., endonuclease, chimeric protein) is provided as a nucleic acid. In embodiments, the present protein (e.g., endonuclease, chimeric protein) is provided as RNA. In embodiments, the present protein (e.g., endonuclease, chimeric protein) is provided as DNA. In embodiments, the RNA is generated by direct chemical synthesis or may be transcribed in vitro from a DNA (e.g., encoding the present protein). Once synthesized, the RNA may be introduced into a cell by any of the well-known techniques for introducing nucleic acids into cells (e.g., microinjection, electroporation, transfection, and the like).

[0217] Methods of introducing a nucleic acid into a host cell are known in the art, and any convenient method can be used to introduce a present composition into a target cell (e.g., prokaryotic cell, eukaryotic cell, plant cell, animal cell, mammalian cell, human cell, and the like). Suitable methods include, e.g., viral infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, calcium phosphate precipitation, polyethyleneimine (PEI)-mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct micro injection, nanoparticle-mediated nucleic acid delivery, and the like.

[0218] In embodiments, nucleic acids may be provided to the cells using well-developed transfection techniques; see, e.g., Angel and Yanik (2010) PLoS ONE 5(7): el 1756, and the commercially available TRANSMESSENGER reagents from Qiagen, STEMFECT RNA Transfection Kit from Stemgent, and TRANSIT-mRNA Transfection Kit from Mirus Bio LLC. See also Beumer et al. (2008) PNAS 105(50): 19821-19826.

[0219] In embodiments, the trans-splicing system is suitable for non-viral delivery selected from a cationic lipid vehicle, electroporation, calcium phosphate transfection, mechanical transfection, and nanoparticle delivery.

[0220] In embodiments, the trans-splicing system further comprises a lipid nanoparticle (LNP) liposomes, lipoplexes or polymeric nanoparticle. In embodiments, the LNP comprises one or more of ionizable lipids, amino lipids, anionic lipids, neutral lipids, amphipathic lipids, helper lipids, structural lipids, PEG lipids, and lipoids. In embodiments, the present compositions take the form of, or delivery of the present compositions is effected using, a nanoparticle, e.g., any particle having a diameter of less than about 1000 nm. In embodiments, nanoparticles suitable for use in delivering the present compositions to a target cell have a diameter of about 500 nm or less, e.g., from about 25 nm to about 35 nm, from about 35 nm to about 50 nm, from about 50 nm to about 75 nm, from about 75 nm to about 100 nm, from about 100 nm to about 150 nm, from about 150 nm to about 200 nm, from about 200 nm to about 300 nm, from about 300 nm to about 400 nm, or from about 400 nm to about 500 nm. In embodiments, nanoparticles suitable for use in delivering the present compositions to a target cell have a diameter of from about 25 nm to about 200 nm. In embodiments, nanoparticles suitable for use in delivery have a diameter of about 100 nm or less. In embodiments, nanoparticles suitable for use in delivery have a diameter of from about 35 nm to about 60 nm.

[0221] In embodiments, the composition further comprises a lipid nanoparticle (LNP) liposomes, lipoplexes or polymeric nanoparticle. In embodiments, the LNP comprises one or more of ionizable lipids, amino lipids, anionic lipids, neutral lipids, amphipathic lipids, helper lipids, structural lipids, PEG lipids, and lipoids.

[0222] In embodiments there is provided a particle, e.g., a delivery particle comprising lipid or lipidoid and hydrophilic polymer, e.g., a cationic lipid and a hydrophilic polymer, for instance where the cationic lipid comprises l,2-dioleoyl-3-trimethylammonium-propane (DOTAP) or 1,2- ditetradecanoyl-sn-glycero-3-phosphocholine (DMPC) and / or where the hydrophilic polymer comprises ethylene glycol or polyethylene glycol (PEG); and / or where the particle further comprises cholesterol.

[0223] In embodiments, a liposome is used to deliver a composition of the present disclosure to a target cell. Liposomes are spherical vesicle structures composed of a uni- or multilamellar lipid bilayer surrounding internal aqueous compartments and a relatively impermeable outer lipophilic phospholipid bilayer. Liposomes can be made from several different types of lipids; however, phospholipids are most commonly used to generate liposomes. Although liposome formation is spontaneous when a lipid fdm is mixed with an aqueous solution, it can also be expedited by applying force in the form of shaking by using a homogenizer, sonicator, or an extrusion apparatus. Several other additives may be added to liposomes in order to modify their structure and properties. For instance, either cholesterol or sphingomyelin may be added to the liposomal mixture in order to help stabilize the liposomal structure and to prevent the leakage of the liposomal inner cargo. A liposome formulation may be mainly comprised of natural phospholipids and lipids such as 1,2- distearoryl-sn-glycero-3-phosphatidyl choline (DSPC), sphingomyelin, egg phosphatidylcholines and monosialoganglioside.

[0224] In embodiments, the composition is in the form of a lipoplex. Lipoplexes that utilize cationic lipids have proven utility for gene transfer. Cationic lipids, due to their positive charge, naturally complex with the negatively charged DNA. Also, as a result of their charge, they interact with the cell membrane. Endocytosis of the lipoplex then occurs, and the DNA is released into the cytoplasm. The cationic lipids also protect against degradation of the DNA by the cell.

[0225] In embodiments, the composition is in the form of a polyplex. Most polyplexes consist of cationic polymers and their production is regulated by ionic interactions. One large difference between the methods of action of polyplexes and lipoplexes is that polyplexes cannot release their DNA load into the cytoplasm, so to this end, co-transfection with endosome-lytic agents (to lyse the endosome that is made during endocytosis) such as inactivated adenovirus must occur. However, this is not always the case; polymers such as polyethylenimine have their own method of endosome disruption as does chitosan and trimethylchitosan.

[0226] In embodiments, the composition is in the form of a dendrimer, a highly branched macromolecule with a spherical shape may be also be used to genetically modify stem cells. The surface of the dendrimer particle may be functionalized to alter its properties. In particular, it is possible to construct a cationic dendrimer (e.g, one with a positive surface charge). When in the presence of genetic material such as a DNA plasmid, charge complementarity leads to a temporary association of the nucleic acid with the cationic dendrimer. On reaching its destination, the dendrimer-nucleic acid complex can be taken up into a cell by endocytosis.

[0227] In embodiments, the trans-splicing system further comprises a polypeptide or other moiety that interacts with an targeting moiety, e.g. an antibody or antibody-like molecule, a ligand to bind a receptor or a receptor (or fragment thereof) to bind a ligand, aptamer, and the like, for targeted delivery. In embodiments, the endonuclease (or chimeric protein) or a delivery vehicle, e.g. one or more lipids, associated therewith comprises a targeting moiety, e.g., an antibody or antibody-like molecule, a ligand to bind a receptor or a receptor (or fragment thereof) to bind a ligand, aptamer, and the like, for targeted delivery. In aspects, the present disclosure provides a composition comprising a nucleic acid encoding any one of the embodiments and / or aspects disclosed herein, or a component thereof. In embodiments, the nucleic acid is or comprises a DNA molecule or an RNA molecule. In embodiments, the RNA is or comprises mRNA or modified mRNA (mmRNA). In embodiments, the DNA is or comprises a vector or plasmid. In embodiments, the nucleic acid comprises a codon optimized sequence. In embodiments, the nucleic acid comprises one or more modifications. In embodiments, the modifications are one or more of base modifications and backbone modifications.

[0228] In aspects, the present disclosure provides a viral vector comprising the nucleic acid of any one of the embodiments and / or aspects disclosed herein. In embodiments, the viral vector is or comprises an AAV or a virus-like particle (VLP). In embodiments, the AAV is or comprises one or more of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV2 / 1, AAV2 / 5, AAV2 / 8, AAV2 / 9, AAV3 / 1, AAV3 / 5, AAV3 / 8, and AAV3 / 9.

[0229] In aspects, the present disclosure provides a lipid nanoparticle comprising the nucleic acid of any one of the embodiments and / or aspects disclosed herein.

[0230] In aspects, the present disclosure provides a cell comprising the trans-splicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, or the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein. In embodiments, the cell is a prokaryotic cell. In embodiments, the cell is a eukaryotic cell. In embodiments, the cell is a mammalian cell. In embodiments, the cell is a human cell. In embodiments, the cell is an immortalized cell. In embodiments, the cell is harvested from a subject.

[0231] In embodiments, the cell derived from the subject is derived from a biological sample. In embodiments, the biological sample comprises a biopsy, tissue or bodily fluid. In embodiments, the biological sample comprises one or more of tumor cells, cultured cells, stem cells, and differentiated cells. In embodiments, biological sample refers to a sample obtained or derived from a source of interest (e.g., a cell), as described herein. In embodiments, a source of interest comprises an organism, such as an animal or human. In embodiments, a biological sample is a biological tissue or fluid. Non-limiting examples of biological samples include bone marrow, blood, blood cells, ascites, (tissue or fine needle) biopsy samples, cell-containing body fluids, free floating nucleic acids, sputum, saliva, urine, cerebrospinal fluid, peritoneal fluid, pleural fluid, feces, lymph, gynecological fluids, swabs (e.g., skin swabs, vaginal swabs, oral swabs, and nasal swabs), washings or lavages such as a ductal lavages or broncheoalveolar lavages, aspirates, scrapings, specimens (e.g., bone marrow specimens, tissue biopsy specimens, and surgical specimens), feces, other body fluids, secretions, and / or excretions, and cells therefrom, and the like.

[0232] In embodiments, the present disclosure provides a modified cell comprising a composition of the present disclosure. In embodiments, the present disclosure provides a modified cell comprising a composition of the present disclosure, where the modified cell is a cell that does not normally comprise a composition of the present disclosure. In embodiments, the present disclosure provides a modified cell (e.g., a genetically modified cell) comprising nucleic acid comprising a nucleotide sequence encoding a composition of the present disclosure. In embodiments, there is provided a genetically modified cell that is genetically modified with an mRNA comprising a nucleotide sequence encoding a composition of the present disclosure. In embodiments, there is provided a genetically modified cell that is genetically modified with a recombinant expression vector comprising a composition of the present disclosure.

[0233] In embodiments, the cells are primary cells; cancer cells; animal cells; plant cells; algal cells; fungal cells; and the like. In embodiments, a cell that serves as a recipient for a composition of the present disclosure is referred to as a “host cell” or a “target cell.” In embodiments, the host cell or a target cell can be a recipient of a composition or system of the present disclosure. A host cell or a target cell can be a recipient of a RNP of the present disclosure. A host cell or a target cell can be a recipient of a single component of a k system of the present disclosure.

[0234] Non-limiting examples of cells (target cells) include: a prokaryotic cell, eukaryotic cell, a bacterial cell, an archaeal cell, a cell of a single-cell eukaryotic organism, a protozoa cell, a cell from a plant (e.g., cells from plant crops, fruits, vegetables, grains, soy bean, com, maize, wheat, seeds, tomatoes, rice, cassava, sugarcane, pumpkin, hay, potatoes, cotton, cannabis, tobacco, flowering plants, conifers, gymnosperms, angiosperms, ferns, clubmosses, homworts, liverworts, mosses, dicotyledons, monocotyledons, and the like), an algal cell, (e.g., Botryococcus braunii, Chlamydomonas reinhardtii, Nannochloropsis gaditana, Chlorella pyrenoidosa, Sargassum patens, C. agardh, and the like), seaweeds (e.g. kelp) a fungal cell (e.g., a yeast cell, a cell from a mushroom), an animal cell, a cell from an invertebrate animal (e.g, fruit fly, cnidarian, echinoderm, nematode, and the like), a cell from a vertebrate animal (e.g., fish, amphibian, reptile, bird, mammal), a cell from a mammal (e.g., an ungulate (e.g., a pig, a cow, a goat, a sheep); a rodent e.g., a rat, a mouse); a non-human primate; a human; a feline (e.g., a cat); a canine (e.g., a dog); and the like), and the like. In embodiments, the cell is a cell that does not originate from a natural organism (e.g., the cell can be a synthetically made cell; also referred to as an artificial cell).

[0235] In embodiments, the cell is an in vitro cell (e.g., established cultured cell line). A cell can be an ex vivo cell (cultured cell from an individual). In embodiments, the cell is in vivo cell (e.g., a cell in an individual). In embodiments, the cell is an isolated cell. In embodiments, the cell is a cell inside of an organism. In embodiments, the cell is an organism. In embodiments, the cell is a cell in a cell culture (e.g., in vitro cell culture). In embodiments, the cell is cell in a collection of cells. In embodiments, the cell is a prokaryotic cell or derived from a prokaryotic cell, cell culture (e.g., in vitro cell culture). In embodiments, the cell is cell in a collection of cells. In embodiments, the cell is a bacterial cell or can be derived from a bacterial cell. In embodiments, the cell is an archaeal cell or derived from an archaeal cell. In embodiments, the cell is an eukaryotic cell or derived from a eukaryotic cell. In embodiments, the cell is a plant cell or derived from a plant cell. In embodiments, the cell is an animal cell or derived from an animal cell. In embodiments, the cell is an invertebrate cell or derived from an invertebrate cell. In embodiments, the cell is a vertebrate cell or derived from a vertebrate cell. In embodiments, the cell is a mammalian cell or derived from a mammalian cell. In embodiments, the cell is a rodent cell or derived from a rodent cell. In embodiments, the cell is a human cell or derived from a human cell. In embodiments, the cell is a microbe cell or derived from a microbe cell. In embodiments, the cell is a fungal cell or derived from a fungal cell. In embodiments, the cell is an insect cell. In embodiments, the cell is an arthropod cell. In embodiments, the cell is a protozoan cell.

[0236] In embodiments, the suitable cells include a stem cell (e.g., an embryonic stem (ES) cell, an induced pluripotent stem (iPS) cell; a germ cell (e.g., an oocyte, a sperm, an oogonia, a spermatogonia, and the like); a somatic cell, e.g., a fibroblast, an oligodendrocyte, a glial cell, a hematopoietic cell, a neuron, a muscle cell, a bone cell, a hepatocyte, a pancreatic cell, and the like. In embodiments, the suitable cells include human embryonic stem cells, fetal cardiomyocytes, myofibroblasts, mesenchymal stem cells, autotransplated expanded cardiomyocytes, adipocytes, totipotent cells, pluripotent cells, blood stem cells, myoblasts, adult stem cells, bone marrow cells, mesenchymal cells, embryonic stem cells, parenchymal cells, epithelial cells, endothelial cells, mesothelial cells, fibroblasts, osteoblasts, chondrocytes, exogenous cells, endogenous cells, stem cells, hematopoietic stem cells, bone-marrow derived progenitor cells, myocardial cells, skeletal cells, fetal cells, undifferentiated cells, multi-potent progenitor cells, unipotent progenitor cells, monocytes, cardiac myoblasts, skeletal myoblasts, macrophages, capillary endothelial cells, xenogenic cells, allogenic cells, and post-natal stem cells.

[0237] In embodiments, the cell is an immune cell, a neuron, an epithelial cell, and endothelial cell, or a stem cell. In embodiments, the immune cell is a T cell, a B cell, a monocyte, a natural killer cell, a dendritic cell, or a macrophage. In embodiments, the immune cell is a cytotoxic T cell. In embodiments, the immune cell is a helper T cell. In embodiments, the immune cell is a regulatory T cell (Treg).

[0238] In embodiments, the cell is a stem cell. Stem cells include adult stem cells. Adult stem cells are also referred to as somatic stem cells. Adult stem cells are resident in differentiated tissue but retain the properties of self-renewal and ability to give rise to multiple cell types, usually cell types typical of the tissue in which the stem cells are found. Numerous examples of somatic stem cells are known to those of skill in the art, including muscle stem cells; hematopoietic stem cells; epithelial stem cells; neural stem cells; mesenchymal stem cells; mammary stem cells; intestinal stem cells; mesodermal stem cells; endothelial stem cells; olfactory stem cells; neural crest stem cells; and the like. Stem cells of interest include mammalian stem cells, where the term “mammalian” refers to any animal classified as a mammal, including humans; non-human primates; domestic and farm animals; and zoo, laboratory, sports, or pet animals, such as dogs, horses, cats, cows, mice, rats, rabbits, etc. In embodiments, the stem cell is a human stem cell. In embodiments, the stem cell is a rodent (e.g., a mouse; a rat) stem cell. In embodiments, the stem cell is a non-human primate stem cell.

[0239] In embodiments, the stem cell is a hematopoietic stem cell (HSC). HSCs are mesoderm-derived cells that can be isolated from bone marrow, blood, cord blood, fetal liver and yolk sac. HSCs are characterized as CD34+and CD3". HSCs can repopulate the erythroid, neutrophil-macrophage, megakaryocyte and lymphoid hematopoietic cell lineages in vivo. Jn vitro, HSCs can be induced to undergo at least some self-renewing cell divisions and can be induced to differentiate to the same lineages as is seen in vivo. As such, HSCs can be induced to differentiate into one or more of erythroid cells, megakaryocytes, neutrophils, macrophages, and lymphoid cells.

[0240] In embodiments, the stem cell is a neural stem cell (NSC). Neural stem cells (NSCs) are capable of differentiating into neurons, and glia (including oligodendrocytes, and astrocytes). A neural stem cell is a multipotent stem cell which is capable of multiple divisions, and under specific conditions can produce daughter cells which are neural stem cells, or neural progenitor cells that can be neuroblasts or glioblasts, e.g., cells committed to become one or more types of neurons and glial cells respectively. Methods of obtaining NSCs are known in the art.

[0241] In embodiments, the stem cell is a mesenchymal stem cell (MSC). MSCs originally derived from the embryonal mesoderm and isolated from adult bone marrow, can differentiate to form muscle, bone, cartilage, fat, marrow stroma, and tendon. Methods of isolating MSC are known in the art; and any known method can be used to obtain MSC. See, e.g., U.S. Pat. No. 5,736,396, which describes isolation of human MSC.

[0242] In embodiments, the cell is a plant cell. For example, the cell can be a cell of a major agricultural plant, e.g., Barley, Beans (Dry Edible), Canola, Corn, Cotton (Pima), Cotton (Upland), Flaxseed, Hay (Alfalfa), Hay (Non-Alfalfa), Oats, Peanuts, Rice, Sorghum, Soybeans, Sugarbeets, Sugarcane, Sunflowers (Oil), Sunflowers (Non-Oil), Sweet Potatoes, Tobacco (Burley), Tobacco (Flue-cured), Tomatoes, Wheat (Durum), Wheat (Spring), Wheat (Winter), and the like. As another example, the cell is a cell of a vegetable crops which include but are not limited to, e.g., alfalfa sprouts, aloe leaves, arrow root, arrowhead, artichokes, asparagus, bamboo shoots, banana flowers, bean sprouts, beans, beet tops, beets, bittermelon, bok choy, broccoli, broccoli rabe (rappini), brussels sprouts, cabbage, cabbage sprouts, cactus leaf (nopales), calabaza, cardoon, carrots, cauliflower, celery, chayote, Chinese artichoke (crosnes), Chinese cabbage, Chinese celery, Chinese chives, choy sum, chrysanthemum leaves (tung ho), collard greens, com stalks, corn-sweet, cucumbers, daikon, dandelion greens, dasheen, dau mue (pea tips), donqua (winter melon), eggplant, endive, escarole, fiddle head ferns, field cress, frisee, gai choy (Chinese mustard), gailon, galanga (siam, Thai ginger), garlic, ginger root, gobo, greens, Hanover salad greens, huauzontle, Jerusalem artichokes, jicama, kale greens, kohlrabi, lamb’s quarters (quilete), lettuce (bibb), lettuce (Boston), lettuce (Boston red), lettuce (green leaf), lettuce (iceberg), lettuce (lolla rossa), lettuce (oak leaf - green), lettuce (oak leaf - red), lettuce (processed), lettuce (red leaf), lettuce (romaine), lettuce (ruby romaine), lettuce (Russian red mustard), linkok, lo bok, long beans, lotus root, mache, maguey (agave) leaves, malanga, mesculin mix, mizuna, moap (smooth luffa), moo, moqua (fuzzy squash), mushrooms, mustard, nagaimo, okra, ong choy, onions green, opo (long squash), ornamental corn, ornamental gourds, parsley, parsnips, peas, peppers (bell type), peppers, pumpkins, radicchio, radish sprouts, radishes, rape greens, rape greens, rhubarb, romaine (baby red), rutabagas, salicornia (sea bean), sinqua (angled / ridged luffa), spinach, squash, straw bales, sugarcane, sweet potatoes, Swiss chard, tamarindo, taro, taro leaf, taro shoots, tatsoi, tepeguaje (guaje), tindora, tomatillos, tomatoes, tomatoes (cherry), tomatoes (grape type), tomatoes (plum type), tumeric, turnip tops greens, turnips, water chestnuts, yampi, yams (names), yu choy, yuca (cassava), and the like.

[0243] In embodiments, the cell is an arthropod cell. For example, the cell can be a cell of a sub-order, a family, a sub-family, a group, a sub-group, or a species of, e.g., Chelicerata, Myriapodia, Hexipodia, Arachnida, Insecta, Archaeognatha, Thysanura, Palaeoptera, Ephemeroptera, Odonata, Anisoptera, Zygoptera, Neoptera, Exopterygota, Plecoptera, Embioptera, Orthoptera, Zoraptera, Dermaptera, Dictyoptera, Notoptera, Grylloblaltidae, Mantophasmatidae, Phasmatodea, Blattaria, Isoptera, Mantodea, Parapneuroptera, Psocoptera, Thysanoptera, Phthiraptera, Hemiptera, Endopterygota or Holometabola, Elymenoptera, Coleoptera, Strepsiptera, Raphidioptera, Megaloptera, Neuroptera, Mecoptera, Siphonaptera, Diptera, Trichoptera, or Lepidoptera.

[0244] In embodiments, the cell is an insect cell. For example, in embodiments, the cell is a cell of a mosquito, a grasshopper, a true bug, a fly, a flea, a bee, a wasp, an ant, a louse, a moth, or a beetle.

[0245] In aspects, the present disclosure provides a pharmaceutical composition comprising the composition of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, or the cell of any one of the embodiments and / or aspects disclosed herein, and a pharmaceutically acceptable carrier. The compositions described herein can possess a sufficiently basic functional group, which can react with an inorganic or organic acid, or a carboxyl group, which can react with an inorganic or organic base, to form a pharmaceutically acceptable salt. A pharmaceutically acceptable acid addition salt is formed from a pharmaceutically acceptable acid, as is well known in the art. Such salts include the pharmaceutically acceptable salts listed in, for example, Journal of Pharmaceutical Science, 66, 2-19 (1977) and The Handbook of Pharmaceutical Salts; Properties, Selection, and Use. P. H. Stahl and C. G. Wermuth (eds.), Verlag, Zurich (Switzerland) 2002, which are hereby incorporated by reference in their entirety.

[0246] Pharmaceutically acceptable salts include, by way of non-limiting example, sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, acid phosphate, isonicotinate, lactate, salicylate, acid citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, camphorsulfonate, pamoate, phenylacetate, trifluoroacetate, acrylate, chlorobenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, methylbenzoate, o-acetoxy benzoate, naphthalene-2 -benzoate, isobutyrate, phenylbutyrate, a-hydroxybutyrate, butyne- 1,4- di carb oxy late, hexyne- 1,4-dicarboxylate, caprate, caprylate, cinnamate, glycollate, heptanoate, hippurate, malate, hydroxymaleate, malonate, mandelate, mesylate, nicotinate, phthalate, teraphthalate, propiolate, propionate, phenylpropionate, sebacate, suberate, p- bromobenzenesulfonate, chlorobenzenesulfonate, ethylsulfonate, 2-hydroxyethylsulfonate, methylsulfonate, naphthalene- 1 -sulfonate, naphthalene-2-sulfonate, naphthalene-l,5-sulfonate, xylenesulfonate, and tartarate salts.

[0247] The term “pharmaceutically acceptable salt” also refers to a salt of the compositions of the present invention having an acidic functional group, such as a carboxylic acid functional group, and a base. Suitable bases include, but are not limited to, hydroxides of alkali metals such as sodium, potassium, and lithium; hydroxides of alkaline earth metal such as calcium and magnesium; hydroxides of other metals, such as aluminum and zinc; ammonia, and organic amines, such as unsubstituted or hydroxy-substituted mono-, di-, or tri-alkylamines, dicyclohexylamine; tributyl amine; pyridine; N-methyl, N-ethylamine; diethylamine; triethylamine; mono-, bis-, or tris-(2-OH- lower alkylamines), such as mono-; bis, or tris-(2-hydroxyethyl)amine, 2-hydroxy-tert- butylamine, or tris-(hydroxymethyl)methylamine, N,N-di-lower alkyl-N-(hydroxyl-lower alkyl)- amines, such as N,N-dimethyl-N-(2 -hydroxy ethyl)amine or tri-(2 -hydroxy ethyljamine; N-methyl- D-glucamine; and amino acids such as arginine, lysine, and the like.

[0248] In embodiments, the compositions described herein are in the form of a pharmaceutically acceptable salt.

[0249] In various embodiments, the present invention pertains to pharmaceutical compositions comprising the compositions described herein and a pharmaceutically acceptable carrier or excipient. Any pharmaceutical compositions described herein can be administered to a subject as a component of a composition that comprises a pharmaceutically acceptable carrier or vehicle. Such compositions can optionally comprise a suitable amount of a pharmaceutically acceptable excipient so as to provide the form for proper administration.

[0250] In various embodiments, pharmaceutical excipients can be liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. The pharmaceutical excipients can be, for example, saline, gum acacia, gelatin, starch paste, talc, keratin, colloidal silica, urea and the like. In addition, auxiliary, stabilizing, thickening, lubricating, and coloring agents can be used. In embodiments, the pharmaceutically acceptable excipients are sterile when administered to a subject. Water is a useful excipient when any agent described herein is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid excipients, specifically for injectable solutions. Suitable pharmaceutical excipients also include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. Any agent described herein, if desired, can also comprise minor amounts of wetting or emulsifying agents, or pH buffering agents. Other examples of suitable pharmaceutical excipients are described in Remington ’s Pharmaceutical Sciences 1447-1676 (Alfonso R. Gennaro eds., 19th ed. 1995), incorporated herein by reference.

[0251] The present invention includes the described pharmaceutical compositions (and / or additional therapeutic agents) in various formulations. Any inventive pharmaceutical composition (and / or additional therapeutic agents) described herein can take the form of solutions, suspensions, emulsion, drops, tablets, pills, pellets, capsules, capsules containing liquids, gelatin capsules, powders, sustained-release formulations, suppositories, emulsions, aerosols, sprays, suspensions, lyophilized powder, frozen suspension, desiccated powder, or any other form suitable for use. In embodiments, the composition is in the form of a capsule. In another embodiment, the composition is in the form of a tablet. In embodiments, the pharmaceutical composition is formulated in the form of a soft-gel capsule. In a further embodiment, the pharmaceutical composition is formulated in the form of a gelatin capsule. In embodiments, the pharmaceutical composition is formulated as a liquid.

[0252] Where necessary, the inventive pharmaceutical compositions (and / or additional agents) can also include a solubilizing agent. Also, the agents can be delivered with a suitable vehicle or delivery device as known in the art. Combination therapies outlined herein can be co-delivered in a single delivery vehicle or delivery device.

[0253] The formulations comprising the inventive pharmaceutical compositions (and / or additional agents) of the present invention may conveniently be presented in unit dosage forms and may be prepared by any of the methods well known in the art of pharmacy. Such methods generally include the step of bringing the therapeutic agents into association with a carrier, which constitutes one or more accessory ingredients. Typically, the formulations are prepared by uniformly and intimately bringing the therapeutic agent into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product into dosage forms of the desired formulation (e. ., wet or dry granulation, powder blends, etc., followed by tableting using conventional methods known in the art).

[0254] In various embodiments, any pharmaceutical compositions (and / or additional agents) described herein is formulated in accordance with routine procedures as a composition adapted for a mode of administration described herein.

[0255] Routes of administration include, for example: oral, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, sublingual, intranasal, intracerebral, intravaginal, transdermal, rectally, by inhalation, or topically. Administration can be local or systemic. In embodiments, the administration is by parenteral injection. The mode of administration can be left to the discretion of the practitioner and depends in-part upon the site of the medical condition. In most instances, administration results in the release of any agent described herein into the bloodstream. In embodiments, the compositions described herein is formulated in accordance with routine procedures as a composition adapted for oral administration. Compositions for oral delivery can be in the form of tablets, lozenges, aqueous or oily suspensions, granules, powders, emulsions, capsules, syrups, or elixirs, for example. Orally administered compositions can comprise one or more agents, for example, sweetening agents such as fructose, aspartame or saccharin; flavoring agents such as peppermint, oil of wintergreen, or cherry; coloring agents; and preserving agents, to provide a pharmaceutically palatable preparation. Moreover, where in tablet or pill form, the compositions can be coated to delay disintegration and absorption in the gastrointestinal tract thereby providing a sustained action over an extended period of time. Selectively permeable membranes surrounding an osmotically active driving any compositions described herein are also suitable for orally administered compositions. In these latter platforms, fluid from the environment surrounding the capsule is imbibed by the driving compound, which swells to displace the agent or agent composition through an aperture. These delivery platforms can provide an essentially zero order delivery profile as opposed to the spiked profiles of immediate release formulations. A timedelay material such as glycerol monostearate or glycerol stearate can also be useful. Oral compositions can include standard excipients such as mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, and magnesium carbonate. In embodiments, the excipients are of pharmaceutical grade. Suspensions, in addition to the active compounds, may contain suspending agents such as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, tragacanth, etc., and mixtures thereof.

[0256] Dosage forms suitable for parenteral administration (e.g., intravenous, intramuscular, intraperitoneal, subcutaneous and intra-articular injection and infusion) include, for example, solutions, suspensions, dispersions, emulsions, and the like. They may also be manufactured in the form of sterile solid compositions (e.g., lyophilized composition), which can be dissolved or suspended in sterile injectable medium immediately before use. They may contain, for example, suspending or dispersing agents known in the art. Formulation components suitable for parenteral administration include a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl paraben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as EDTA; buffers such as acetates, citrates or phosphates; and agents for the adjustment of tonicity such as sodium chloride or dextrose.

[0257] For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). The carrier should be stable under the conditions of manufacture and storage and should be preserved against microorganisms. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol), and suitable mixtures thereof.

[0258] The compositions provided herein, alone or in combination with other suitable components, can be made into aerosol formulations (e.g., “nebulized”) to be administered via inhalation. Aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and the like.

[0259] Any inventive pharmaceutical compositions (and / or additional agents) described herein can be administered by controlled-release or sustained-release means or by delivery devices that are well known to those of ordinary skill in the art. Examples include, but are not limited to, those described in U.S. Patent Nos. 3,845,770; 3,916,899; 3,536,809; 3,598,123; 4,008,719; 5,674,533; 5,059,595; 5,591,767; 5,120,548; 5,073,543; 5,639,476; 5,354,556; and 5,733,556, each of which is incorporated herein by reference in its entirety. Such dosage forms can be useful for providing controlled-or sustained-release of one or more active ingredients using, for example, hydropropyl cellulose, hydropropylmethyl cellulose, polyvinylpyrrolidone, other polymer matrices, gels, permeable membranes, osmotic systems, multilayer coatings, microparticles, liposomes, microspheres, or a combination thereof to provide the desired release profile in varying proportions. Suitable controlled- or sustained-release formulations known to those skilled in the art, including those described herein, can be readily selected for use with the active ingredients of the agents described herein. The invention thus provides single unit dosage forms suitable for oral administration such as, but not limited to, tablets, capsules, gelcaps, and caplets that are adapted for controlled- or sustained-release.

[0260] Controlled- or sustained-release of an active ingredient can be stimulated by various conditions, including but not limited to, changes in pH, changes in temperature, stimulation by an appropriate wavelength of light, concentration or availability of enzymes, concentration or availability of water, or other physiological conditions or compounds.

[0261] In another embodiment, a controlled-release system can be placed in proximity of the target area to be treated, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138 (1984)). Other controlled-release systems discussed in the review by Langer, 1990, Science 249: 1527-1533) may be used.

[0262] Pharmaceutical formulations preferably are sterile. Sterilization can be accomplished, for example, by filtration through sterile filtration membranes. Where the composition is lyophilized, filter sterilization can be conducted prior to or following lyophilization and reconstitution.

[0263] In aspects, the present disclosure provides a pharmaceutical composition comprising the transsplicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, or the cell of any one of the embodiments and / or aspects disclosed herein, and a pharmaceutically acceptable carrier.

[0264] Kits

[0265] In aspects, the present disclosure provides a kit comprising a container comprising the transsplicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, the cell of any one of the embodiments and / or aspects disclosed herein, or the pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein, and instructions for use in trans-splicing.

[0266] Nucleic Acid Modifications

[0267] In embodiments, a nucleic acid disclosed herein has one or more modifications, e.g., a base modification, a backbone modification, and the like, to provide the nucleic acid with a new or enhanced feature (e.g., improved stability). A nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a heterocyclic base. The two most common classes of such heterocyclic bases are the purines and the pyrimidines. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', the 3', or the 5' hydroxyl moiety of the sugar. In forming oligonucleotides, the phosphate groups covalently link adjacent nucleosides to one another to form a linear polymeric compound. In turn, the respective ends of this linear polymeric compound can be further joined to form a circular compound, however, linear compounds are suitable. In addition, linear compounds may have internal nucleotide base complementarity and may therefore fold in a manner as to produce a fully or partially double-stranded compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside backbone of the oligonucleotide. The normal linkage or backbone of RNA and DNA is a 3' to 5' phosphodiester linkage.

[0268] In embodiments, a suitable nucleic acid modification include, but are not limited to: 2'0 methyl modified nucleotides, 2' Fluoro modified nucleotides, locked nucleic acid (LNA) modified nucleotides, peptide nucleic acid (PNA) modified nucleotides, nucleotides with phosphorothioate linkages, and a 5' cap (e.g., a 7-methylguanylate cap (m7G)). A 2’-0-Methyl modified nucleotide (also referred to as 2’-0-Methyl RNA) is a naturally occurring modification of RNA found in tRNA and other small RNAs that arises as a post-transcriptional modification. Oligonucleotides can be directly synthesized that contain 2'-0-Methyl RNA. Without wishing to be bound by theory, this modification increases Tm of RNA:RNA duplexes but results in only small changes in RNA:DNA stability. It is stabile with respect to attack by single-stranded ribonucleases and is typically about 5 to about 10-fold less susceptible to DNases than DNA. 2' Fluoro modified nucleotides (e.g., 2' Fluoro bases) have a fluorine modified ribose which increases binding affinity (Tm) and also confers some relative nuclease resistance when compared to native RNA. LNA bases have a modification to the ribose backbone that locks the base in the C3'-endo position, which favors RNA A-type helix duplex geometry. Without wishing to be bound by theory, this modification significantly increases Tm and is also very nuclease resistant. Multiple LNA insertions can be placed in an oligo at any position except the 3'-end. Applications have been described ranging from antisense oligos to hybridization probes to SNP detection and allele specific PCR. Due to the large increase in Tm conferred by LNAs, they also can cause an increase in primer dimer formation as well as self-hairpin formation. In embodiments, the number of LNAs incorporated into a single oligo is 10 bases or less. The phosphorothioate (PS) bond (e.g., a phosphorothioate linkage) substitutes a sulfur atom for a non-bridging oxygen in the phosphate backbone of a nucleic acid (e.g., an oligo). Without wishing to be bound by theory, this modification renders the internucleotide linkage resistant to nuclease degradation. Phosphorothioate bonds can be introduced between the last 3-5 nucleotides at the 5'- or 3'-end of the oligo to inhibit exonuclease degradation. Including phosphorothioate bonds within the oligo (e.g., throughout the entire oligo) can help reduce attack by endonucleases as well.

[0269] Modified Backbones and Modified Internucleoside Linkages

[0270] In embodiments, a nucleic acid disclosed herein, optionally containing modifications, include nucleic acids containing modified backbones or non-natural intemucleoside linkages. In embodiments, nucleic acids having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.

[0271] In embodiments, oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothi oates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3 '-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphorami dates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, phosphorodiamidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3 ’-5’ linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Suitable oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3'-most internucleotide linkage i.e a single inverted nucleoside residue which may be a basic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts (such as, for example, potassium or sodium), mixed salts and free acid forms are also included.

[0272] In embodiments, the present nucleic acids comprise one or more phosphorothioate and / or heteroatom internucleoside linkages, in particular -CH2-NH-O-CH2-, -CH2-N(CH3)-O-CH2- (known as a methylene (methylimino) or MMI backbone), -CH2-O-N(CH3)-CH2-, -CH2-N(CH )- N(CH3)-CH2- and -O-N(CH3)-CH2-CH2- (wherein the native phosphodiester internucleotide linkage is represented as -0-P(=0)(0H)-0-CH2-). MMI type intemucleoside linkages are disclosed in the above referenced U.S. Pat. No. 5,489,677, the disclosure of which is incorporated herein by reference in its entirety. Suitable amide internucleoside linkages are disclosed in U.S. Pat. No. 5,602,240, the disclosure of which is incorporated herein by reference in its entirety.

[0273] Suitable modified polynucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; riboacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.

[0274] Mimetics

[0275] In embodiments, a nucleic acid diclosed herein is in the form of or comprises a nucleic acid mimetic. In embodiments, the term “mimetic” as it is applied to polynucleotides is intended to include polynucleotides where only the furanose ring or both the furanose ring and the internucleotide linkage are replaced with non-furanose groups, replacement of only the furanose ring is also referred to in the art as being a sugar surrogate. The heterocyclic base moiety or a modified heterocyclic base moiety is maintained for hybridization with an appropriate target nucleic acid. One such nucleic acid, a polynucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA, the sugar-backbone of a polynucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleotides are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.

[0276] In embodiments, a nucleic acid diclosed herein is or comprises a mimetic based on morpholino units (morpholino nucleic acid), having heterocyclic bases attached to the morpholino ring. A number of linking groups have been reported that link the morpholino monomeric units in a morpholino nucleic acid. One class of linking groups has been selected to give a non-ionic oligomeric compound. The non-ionic morpholino-based oligomeric compounds are less likely to have undesired interactions with cellular proteins. Morpholino-based polynucleotides are non- ionic mimics of oligonucleotides which are less likely to form undesired interactions with cellular proteins (Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510). Morpholino-based polynucleotides are disclosed in U.S. Pat. No. 5,034,506, the disclosure of which is incorporated herein by reference in its entirety. A variety of compounds within the morpholino class of polynucleotides have been prepared, having a variety of different linking groups joining the monomeric subunits.

[0277] In embodiments, a nucleic acid diclosed herein is a mimetic is in the form of or comprises cyclohexenyl nucleic acids (CeNA). The furanose ring normally present in a DNA / RNA molecule is replaced with a cyclohexenyl ring. CeNA DMT protected phosphoramidite monomers have been prepared and used for oligomeric compound synthesis following classical phosphoramidite chemistry. Fully modified CeNA oligomeric compounds and oligonucleotides having specific positions modified with CeNA have been prepared and studied (see Wang et al., J. Am. Chem. Soc., 2000, 122, 8595-8602, the disclosure of which is incorporated herein by reference in its entirety). In general, the incorporation of CeNA monomers into a DNA chain increases its stability of a DNA / RNA hybrid. CeNA oligoadenylates formed complexes with RNA and DNA complements with similar stability to the native complexes. The study of incorporating CeNA structures into natural nucleic acid structures was shown by NMR and circular dichroism to proceed with easy conformational adaptation.

[0278] In embodiments, a nucleic acid diclosed herein Locked Nucleic Acids (LNAs) in which the 2'- hydroxyl group is linked to the 4' carbon atom of the sugar ring thereby forming a 2'-C, 4'-C- oxymethylene linkage thereby forming a bicyclic sugar moiety. The linkage can be a methylene (- CH2-), group bridging the 2' oxygen atom and the 4' carbon atom wherein n is 1 or 2 (Singh et al., Chem. Commun., 1998, 4, 455-456, the disclosure of which is incorporated herein by reference in its entirety). LNA and LNA analogs display very high duplex thermal stabilities with complementary DNA and RNA (Tm=+3 to +10° C), stability towards 3'-exonucleolytic degradation and good solubility properties. Potent and nontoxic antisense oligonucleotides containing LNAs have been described (e.g., Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638, the disclosure of which is incorporated herein by reference in its entirety).

[0279] Modified Sugar Moieties

[0280] In embodiments, a nucleic acid diclosed herein comprises one or more substituted sugar moieties. Suitable polynucleotides comprise a sugar substituent group selected from: OH; F; O-, S-, or N- alkyl; 0-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Ci to Cio alkyl or C2 to C10 alkenyl and alkynyl. Particularly suitable are O((CH2)nO)mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON((CH2)nCH3)2, where n and m are from 1 to about 10. Other suitable polynucleotides comprise a sugar substituent group selected from: Ci to Cio lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. A suitable modification includes 2'- methoxyethoxy (2'-O-CH2 CH2OCH3, also known as 2'-O-(2 -methoxyethyl) or 2'-M0E) (Martin et al., Helv. Chim. Acta 1995, 78, 486-504, the disclosure of which is incorporated herein by reference in its entirety) i.e., an alkoxyalkoxy group. A further suitable modification includes 2'- dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2group, also known as 2'-DMA0E, as described in examples hereinbelow, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethyl-amino-ethoxy -ethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH3)2.

[0281] Other suitable sugar substituent groups include methoxy (-O-CFE), aminopropoxy (—0 CH2 CH2NH2), allyl (-CH2-CH=CH2), -O-allyl (-0- CH2 CH=CH2) and fluoro (F). 2'-sugar substituent groups may be in the arabino (up) position or ribo (down) position. A suitable 2'- arabino modification is 2'-F. Similar modifications may also be made at other positions on the oligomeric compound, particularly the 3' position of the sugar on the 3' terminal nucleoside or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligomeric compounds may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.

[0282] Base Modifications and Substitutions

[0283] In embodiments, a nucleic acid diclosed herein comprises one or more nucleobase (often referred to in the art simply as “base”) modifications or substitutions. In embodiments, as used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C=C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8- substituted adenines and guanines, 5-halo particularly 5-bromo, 5 -trifluoromethyl and other 5- substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-aminoadenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3 -deazaguanine and 3 -deazaadenine. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine(lH-pyrimido(5,4-b)(l,4)benzoxazin-2(3H)-one), phenothiazine cytidine (lH-pyrimido(5,4-b)(l,4)benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g. 9-(2-aminoethoxy)-H-pyrimido(5,4-(b) (l,4)benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido(4,5-b)indol-2-one), pyridoindole cytidine (H-pyrido(3',2':4,5)pyrrolo(2,3- d)pyrimidin-2-one).

[0284] In embodiments, heterocyclic base moieties may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7- deazaguanosine, 2-aminopyridine and 2-pyridone. Certain nucleobases are, without wishing to be bound by theory, useful for increasing the binding affinity of an oligomeric compound. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability and are suitable base substitutions, e.g., when combined with 2'-O-methoxyethyl sugar modifications.

[0285] Conjugates

[0286] In embodiments, the present compositions are chemically linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. In embodiments, the moieties or conjugates include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Suitable conjugate groups include, but are not limited to, cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties include groups that improve uptake, enhance resistance to degradation, and / or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties include groups that improve uptake, distribution, metabolism or excretion of a subject nucleic acid.

[0287] In embodiments, the conjugate may include a Protein Transduction Domain or PTD (also known as a CPP - cell penetrating peptide), which may refer to a polypeptide, polynucleotide, carbohydrate, or organic or inorganic compound that facilitates traversing a lipid bilayer, micelle, cell membrane, organelle membrane, or vesicle membrane. A PTD attached to another molecule, which can range from a small polar molecule to a large macromolecule and / or a nanoparticle, facilitates the molecule traversing a membrane, for example going from extracellular space to intracellular space, or cytosol to within an organelle (e.g., the nucleus). In embodiments, a PTD is covalently linked to the 3' end of an exogenous polynucleotide. In embodiments, a PTD is covalently linked to the 5' end of an exogenous polynucleotide.

[0288] Methods

[0289] In aspects, the present disclosure provides a method of mediating a targeted trans-splicing event on a pre-mRNA in a cell, the method comprising contacting a cell with the trans-splicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, the cell of any one of the embodiments and / or aspects disclosed herein, or the pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein.

[0290] In aspects, the present disclosure provides a method of mediating a targeted trans-splicing event on a pre-mRNA in a cell in a subject in need thereof, comprising administering an effective amount of the trans-splicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, the cell of any one of the embodiments and / or aspects disclosed herein, or the pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein to the subject. In embodiments, the trans-splicing occurs at an intron-exon junction or exon-intron junctions of a pre-mRNA. In embodiments, the trans-splicing of a pre-mRNA occurs at the 5' end of the pre-mRNA. In embodiments, the trans- splicing of a pre-mRNA occurs at the 3' end of the pre-mRNA. In embodiments, the trans-splicing of a pre-mRNA occurs at an internal site within a pre-mRNA. In embodiments, the trans-splicing system replaces the 5' or the 3' end of the target mRNA.

[0291] In aspects, the present disclosure provides a method for replacing a mutant exon of a gene of interest in a cell, the method comprising contacting a cell with the trans-splicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, the cell of any one of the embodiments and / or aspects disclosed herein, or the pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein.

[0292] In aspects, the present disclosure provides a method for replacing a mutant exon of a gene of interest in a subject in need thereof, comprising administering an effective amount of the trans- splicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, the cell of any one of the embodiments and / or aspects disclosed herein, or the pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein to the subject.

[0293] In aspects, the present disclosure provides a method of treating, ameliorating or preventing a disease or disorder in a subject, comprising contacting a cell with the trans-splicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, the cell of any one of the embodiments and / or aspects disclosed herein, or the pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein, and administering an effective amount of the cell to the subject. In aspects, the present disclosure provides a method of treating, ameliorating or preventing a disease or disorder in a subject, comprising administering an effective amount of the trans-splicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, the cell of any one of the embodiments and / or aspects disclosed herein, or the pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein to the subject.

[0294] In embodiments, the disease or disorder is associated with a loss of protein function in the subject. In embodiments, the disease or disorder is associated with a dominant negative protein function in the subject. In embodiments, the method provides transient RNA repair.

[0295] In aspects, the present disclosure provides the trans-splicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, the cell of any one of the embodiments and / or aspects disclosed herein, or the pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein for use in treating, ameliorating or preventing a patient with a disease or disorder.

[0296] In aspects, the present disclosure provides use of the trans-splicing system of any one of the embodiments and / or aspects disclosed herein, the nucleic acid of any one of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, the cell of any one of the embodiments and / or aspects disclosed herein, or the pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein the manufacture of a medicament for the treating, ameliorating or preventing of a disease or disorder.

[0297] Compositions

[0298] In various aspects and embodiments, disclosed herein is a composition comprising an endonuclease comprising a sequence, or a fragment or variant thereof, and having at least about 70% identity to one or more of SEQ ID NOs: 1-3, or having about 1 to about 20 amino acid modifications.

[0299] In various aspects and embodiments, disclosed herein is a composition comprising a nucleic acid encoding an endonuclease comprising a sequence, or a fragment or variant thereof, and having at least about 70% identity to one or more of SEQ ID NOs: 1-3 or having about 1 to about 20 amino acid modifications.

[0300] In various aspects and embodiments, disclosed herein is a composition comprising a nuclease system, comprising (a) an endonuclease comprising a sequence, or a fragment or variant thereof, and having at least about 70% identity to one or more of SEQ ID NOs: 1-3 or having about 1 to about 20 amino acid modifications; and (b) an RNA molecule comprising a sequence complementary to one strand of a target nucleic acid molecule.

[0301] In various aspects and embodiments, disclosed herein is a composition comprising a chimeric protein comprising: (a) an endonuclease comprising a sequence, or a fragment or variant thereof, and having at least about 70% identity to one or more of SEQ ID NOs: 1-3 or having about 1 to about 20 amino acid modifications; and (b) a nucleic acid-modulating domain or a nucleic acidmodifying domain comprising a sequence comprising a catalytic domain, or a fragment or variant thereof, wherein (a) and (b) do not naturally occur together in a same reading frame.

[0302] In various aspects and embodiments, disclosed herein is a composition comprising a complex comprising a chimeric protein and an RNA molecule, wherein the chimeric protein comprises: (a) an endonuclease, or a fragment or variant thereof, and having at least about 70% identity to one or more of SEQ ID NOs: 1-3 or having about 1 to about 20 amino acid modifications; and (b) a nucleic acid-modulating domain or a nucleic acid-modifying domain comprising a sequence comprising a catalytic domain, or a fragment or variant thereof, wherein (a) and (b) do not naturally occur together in a same reading frame and the RNA molecule comprises a sequence complementary to one strand of a target nucleic acid molecule.

[0303] In various aspects and embodiments, disclosed herein is a nucleic acid encoding the chimeric protein of any one of the embodiments and / or aspects disclosed herein.

[0304] In various aspects and embodiments, disclosed herein is a viral vector comprising the nucleic acid of any one of the embodiments and / or aspects disclosed herein. In various aspects and embodiments, disclosed herein is a lipid nanoparticle comprising the nucleic acid of any one of the embodiments and / or aspects disclosed herein.

[0305] In various aspects and embodiments, disclosed herein is a cell comprising a nucleic acid of any one of the embodiments and / or aspects disclosed herein, the viral vector of any one of the embodiments and / or aspects disclosed herein, or the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein.

[0306] In various aspects and embodiments, disclosed herein is pharmaceutical composition comprising the composition of any one of the embodiments and / or aspects disclosed herein, a nucleic acid of any one of the embodiments and / or aspects disclosed herein, a viral vector of any one of the embodiments and / or aspects disclosed herein, or the lipid nanoparticle of any one of the embodiments and / or aspects disclosed herein, or the cell of any one of the embodiments and / or aspects disclosed herein, and a pharmaceutically acceptable carrier.

[0307] In various aspects and embodiments, disclosed herein is a kit comprising a container comprising the composition of any one of the embodiments and / or aspects disclosed herein, a nucleic acid of any one of the embodiments and / or aspects disclosed herein, a viral vector of any one of the embodiments and / or aspects disclosed herein, or a lipid nanoparticle o of any one of the embodiments and / or aspects disclosed herein, or a cell of any one of the embodiments and / or aspects disclosed herein, or a pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein, and instructions for use in modulating and / or modifying a nucleic acid.

[0308] In various aspects and embodiments, disclosed herein is a method of modulating and / or modifying a nucleic acid in a cell, comprising contacting the cell with the composition of any one of the embodiments and / or aspects disclosed herein, a nucleic acid of any one of the embodiments and / or aspects disclosed herein, a viral vector of any one of the embodiments and / or aspects disclosed herein, or a lipid nanoparticle o of any one of the embodiments and / or aspects disclosed herein, or a cell of any one of the embodiments and / or aspects disclosed herein, or a pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein.

[0309] In various aspects and embodiments, disclosed herein is method of modulating and / or modifying a nucleic acid in a subject in need thereof, comprising administering an effective amount of the cell with the composition of any one of the embodiments and / or aspects disclosed herein, a nucleic acid of any one of the embodiments and / or aspects disclosed herein, a viral vector of any one of the embodiments and / or aspects disclosed herein, or a lipid nanoparticle o of any one of the embodiments and / or aspects disclosed herein, or a cell of any one of the embodiments and / or aspects disclosed herein, or a pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein to the subject.

[0310] In various aspects and embodiments, disclosed herein is method of disrupting, correcting, and / or replacing a gene in a cell, comprising contacting the cell with the composition of any one of the embodiments and / or aspects disclosed herein, a nucleic acid of any one of the embodiments and / or aspects disclosed herein, a viral vector of any one of the embodiments and / or aspects disclosed herein, or a lipid nanoparticle o of any one of the embodiments and / or aspects disclosed herein, or a cell of any one of the embodiments and / or aspects disclosed herein, or a pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein.

[0311] In various aspects and embodiments, disclosed herein is method of disrupting, correcting, and / or replacing a gene in a subject in need thereof, comprising administering an effective amount of the composition of any one of the embodiments and / or aspects disclosed herein, a nucleic acid of any one of the embodiments and / or aspects disclosed herein, a viral vector of any one of the embodiments and / or aspects disclosed herein, or a lipid nanoparticle o of any one of the embodiments and / or aspects disclosed herein, or a cell of any one of the embodiments and / or aspects disclosed herein, or a pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein to the subject.

[0312] In various aspects and embodiments, disclosed herein is method of treating, ameliorating or preventing a disease or disorder in a subject, comprising: (a) contacting a cell with the composition of any one of the embodiments and / or aspects disclosed herein, a nucleic acid of any one of the embodiments and / or aspects disclosed herein, a viral vector of any one of the embodiments and / or aspects disclosed herein, or a lipid nanoparticle o of any one of the embodiments and / or aspects disclosed herein, or a cell of any one of the embodiments and / or aspects disclosed herein, or a pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein and (b) administering an effective amount of the cell to the subject.

[0313] In various aspects and embodiments, disclosed herein is a method of treating, ameliorating or preventing a disease or disorder in a subject, comprising administering an effective amount of the composition of any one of the embodiments and / or aspects disclosed herein, a nucleic acid of any one of the embodiments and / or aspects disclosed herein, a viral vector of any one of the embodiments and / or aspects disclosed herein, or a lipid nanoparticle o of any one of the embodiments and / or aspects disclosed herein, or a cell of any one of the embodiments and / or aspects disclosed herein, or a pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein to the subject.

[0314] In various aspects and embodiments, disclosed herein is a use of the composition of any one of the embodiments and / or aspects disclosed herein, a nucleic acid of any one of the embodiments and / or aspects disclosed herein, a viral vector of any one of the embodiments and / or aspects disclosed herein, or a lipid nanoparticle o of any one of the embodiments and / or aspects disclosed herein, or a cell of any one of the embodiments and / or aspects disclosed herein, or a pharmaceutical composition of any one of the embodiments and / or aspects disclosed herein in the manufacture of a medicament for the treating, ameliorating or preventing of a disease or disorder.

[0315] In various aspects and embodiments, disclosed herein is method of detecting and / or quantifying a nucleic acid in a sample, comprising contacting the sample with a composition of any one of the embodiments and / or aspects disclosed herein.

[0316] It is to be understood that, in embodiments, while a method of binding may result in nothing more than binding of the target nucleic acid, in other embodiments, the method can have different final results (e.g., the method can result in modification of the target nucleic acid, e.g., cleavage / methylation / and the like, modulation of transcription from the target nucleic acid; modulation of translation of the target nucleic acid; genome editing; modulation of a protein associated with the target nucleic acid; isolation of the target nucleic acid; and the like).

[0317] For examples of suitable methods related to binding, such as binding of the target nucleic acid, see, for example, Jinek et al., Science. 2012 Aug 17;337(6096):816-21 ; Chylinski et al., RNABiol. 2013 May;10(5):726-37; Ma et al., Biomed Res Int. 2013 ;2013:270805; Hou et al., Proc Natl Acad Sci U S A. 2013 Sep 24; 110(39): 15644-9; Jinek et al., Elife. 2013;2:e00471; Pattanayak et al., Nat Biotechnol. 2013 Sep;31(9):839-43; Qi et al, Cell. 2013 Feb 28;152(5):1173-83; Wang et al., Cell. 2013 May 9; 153(4):910-8; Auer et al., Genome Res. 2013 Oct 31; Chen et al., Nucleic Acids Res. 2013 Nov l;41(20):el9; Cheng et al., Cell Res. 2013 Oct;23(10):l 163-71; Cho et al., Genetics. 2013 Nov;195(3): 1177-80; DiCarlo et al., Nucleic Acids Res. 2013 Apr;41(7):4336-43; Dickinson et al., Nat Methods. 2013 Oct; 10(10): 1028-34; Ebina et al., Sci Rep. 2013;3:2510; Fujii et al, Nucleic Acids Res. 2013 Nov 1 ;41 (20):e187; Hu et al., Cell Res. 2013 Nov;23(l 1): 1322-5; Jiang et al., Nucleic Acids Res. 2013 Nov l;41(20):el88; Larson et al., Nat Protoc. 2013 Nov;8(l l):2180-96; Mali et. at., Nat Methods. 2013 Oct; 10(10):957-63; Nakayama et al., Genesis. 2013 Dec;51(12):835-43; Ran et al., Nat Protoc. 2013 Nov;8(l l):2281-308; Ran et al., Cell. 2013 Sep 12;154(6):1380-9; Upadhyay et al., G3 (Bethesda). 2013 Dec 9;3(12):2233-8; Walsh et al., Proc Natl Acad Sci U S A. 2013 Sep 24;110(39): 15514-5; Xie et al., Mol Plant. 2013 Oct 9; Yang et al., Cell. 2013 Sep 12; 154(6): 1370-9; and U.S. patents and patent applications: 8,906,616;

[0318] 8,895,308; 8,889,418; 8,889,356; 8,871,445; 8,865,406; 8,795,965; 8,771,945; 8,697,359;

[0319] 20140068797; 20140170753; 20140179006; 20140179770; 20140186843; 20140186919

[0320] 20140186958; 20140189896; 20140227787; 20140234972; 20140242664; 20140242699

[0321] 20140242700; 20140242702; 20140248702; 20140256046; 20140273037; 20140273226

[0322] 20140273230; 20140273231; 20140273232; 20140273233; 20140273234; 20140273235

[0323] 20140287938; 20140295556; 20140295557; 20140298547; 20140304853; 20140309487

[0324] 20140310828; 20140310830; 20140315985; 20140335063; 20140335620; 20140342456

[0325] 20140342457; 20140342458; 20140349400; 20140349405; 20140356867; 20140356956

[0326] 20140356958; 20140356959; 20140357523; 20140357530; 20140364333; and 20140377868; each of which is hereby incorporated by reference in its entirety.

[0327] In embodiments, the terms “contact a target nucleic acid” and “contacting a target nucleic acid”, for example, encompass all methods for contacting the target nucleic acid. For example, a present polypeptide (e.g. of the present endonuclease and / or chimeric protein) is provided to a cell as protein, RNA (encoding the present polypeptide), or DNA (encoding the present polypeptide); while a present RNA can be provided as a RNA or as a nucleic acid encoding the RNA. As such, when, for example, performing a method in a cell (e. ., inside of a cell in vitro, inside of a cell in vivo, inside of a cell ex vivo), a method that includes contacting the target nucleic acid encompasses the introduction into the cell of any or all of the components in their active / final state (e.g., in the form of a protein(s) for a polypeptide; in the form of a protein for a chimeric polypeptide; in the form of an RNA in embodiments for the present RNA), and also encompasses the introduction into the cell of one or more nucleic acids encoding one or more of the components (e.g., nucleic acid(s) comprising nucleotide sequence(s) encoding a present polypeptide or a present chimeric polypeptide, nucleic acid(s) comprising nucleotide sequence(s) encoding guide RNA(s), nucleic acid comprising a nucleotide sequence encoding a donor template, and the like). Because the methods can also be performed in vitro outside of a cell, a method that includes contacting a target nucleic acid, (unless otherwise specified) encompasses contacting outside of a cell in vitro, inside of a cell in vitro, inside of a cell in vivo, or inside of a cell ex vivo.

[0328] In embodiments, the method of the present disclosure for modifying a target nucleic acid comprises introducing into a target cell a present locus, e.g., a nucleic acid comprising a nucleotide sequence encoding a present polypeptide as well as nucleotide sequences of about 1 kilobase (kb) to 5 kb in length surrounding the present-encoding nucleotide sequence from a cell e.g., in embodiments, a cell that in its natural state (the state in which it occurs in nature) comprises a present locus) comprising a present locus, where the target cell does not normally (in its natural state) comprise a present locus. However, one or more spacer sequences, encoding guide sequences for the encoded crRNA(s), can be modified such that one or more target sequences of interest are targeted. Thus, for example, in embodiments, a method of the present disclosure for modifying a target nucleic acid comprises introducing into a target cell a present locus, e.g., a nucleic acid obtained from a source cell (e.g., in embodiments, a cell that in its natural state (the state in which it occurs in nature) comprises a present locus), where the nucleic acid has a length of from 100 nucleotides (nt) to 5 kb in length (e.g., from 100 nt to 500 nt, from 500 nt to 1 kb, from 1 kb to 1.5 kb, from 1.5 kb to 2 kb, from 2 kb to 2.5 kb, from 2.5 kb to 3 kb, from 3 kb to 3.5 kb, from 3.5 kb to 4 kb, or from 4 kb to 5 kb in length) and comprises a nucleotide sequence encoding a present polypeptide. As noted above, in some such embodiments, one or more spacer sequences, encoding guide sequences for the encoded crRNA(s), can be modified such that one or more target sequences of interest are targeted. In embodiments, the method comprises introducing into a target cell: i) a present locus; and ii) a donor DNA template. In embodiments, the target nucleic acid is in a cell- free composition in vitro. In embodiments, the target nucleic acid is present in a target cell. In embodiments, the target nucleic acid is present in a target cell, where the target cell is a prokaryotic cell. In embodiments, the target nucleic acid is present in a target cell, where the target cell is a eukaryotic cell. In embodiments, the target nucleic acid is present in a target cell, where the target cell is a mammalian cell. In embodiments, the target nucleic acid is present in a target cell, where the target cell is a plant cell.

[0329] In embodiments, a method of the present disclosure for modifying a target nucleic acid comprises contacting a target nucleic acid with a present polypeptide of the present disclosure, or with a present chimeric polypeptide of the present disclosure. In embodiments, a method of the present disclosure for modifying a target nucleic acid comprises contacting a target nucleic acid with a present polypeptide and a present guide RNA. In embodiments, a method of the present disclosure for modifying a target nucleic acid comprises contacting a target nucleic acid with a present polypeptide, a first present guide RNA, and a second present guide RNA In embodiments, a method of the present disclosure for modifying a target nucleic acid comprises contacting a target nucleic acid with a present polypeptide of the present disclosure and a present guide RNA and a donor DNA template.

[0330] In various embodiments, the “subject” refers to any animal (e.g., a mammal), including, but not limited to, humans, and non-human animals (including, but not limited to, non-human primates, dogs, cats, rodents, horses, cows, pigs, mice, rats, hamsters, rabbits, and the like (e.g., which is to be the recipient of a particular treatment, or from whom cells are harvested)). In embodiments, the subject is a human.

[0331] It will also be understood that, although the terms first, second, etc., may be used herein to describe various elements, these elements should not be limited by these terms. These terms are only used to distinguish one element from another. For example, a first subject could be termed a second subject, and, similarly, a second subject could be termed a first subject, without departing from the scope of the present disclosure. The first subject and the second subject are both subjects, but they are not the same subject. Furthermore, the terms “subject,” “user,” and “patient” are used interchangeably herein.

[0332] As used herein, the word “include,” and its variants, is intended to be non-limiting, such that recitation of items in a list is not to the exclusion of other like items that may also be useful in the materials, compositions, devices, and methods of this technology. Similarly, the terms “can” and “may” and their variants are intended to be non-limiting, such that recitation that an embodiment can or may comprise certain elements or features does not exclude other embodiments of the present technology that do not contain those elements or features. Although the open-ended term “comprising,” as a synonym of terms such as including, containing, or having, is used herein to describe and claim the disclosure, the present technology, or embodiments thereof, may alternatively be described using more limiting terms such as “consisting of’ or “consisting essentially of’ the recited ingredients. Unless defined otherwise, all technical and scientific terms herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials, similar or equivalent to those described herein, can be used in the practice or testing of the present disclosure, the preferred methods and materials are described herein. All publications, patents, and patent publications cited are incorporated by reference herein in their entirety for all purposes.

[0333] This disclosure is further illustrated by the following non-limiting examples.

[0334] EXAMPLES

[0335] Example 1: Engineering of the CRISPR-based Trans-Splicing System

[0336] The experiments of this example evaluated a CRISPR-based trans-splicing system engineered to comprise a guide RNA (e.g., FIG. 4), an exon or a group of exons of interest conjugated to an engineered intron with ms2 hairpins, and a catalytically inactive protein linked to a MS2 binding protein (FIG. 1A, FIG. IB, FIG. 1C, FIG. 3, and FIG. 5). In these experiments, the catalytically inactive protein is a Csm4-RBP fusion protein, or a CaslO (Csml)-RBP fusion protein, or a Csm5- RBP fusion protein, or a Cas7 (Csm3)-RBP fusion protein (FIG. 2).

[0337] Assembly of the trans-splicing system relies on a catalytically inactive or active protein recognizing the gRNA scaffold, and the MS2 binding protein recognizing the ms2 hairpins of the engineered intron (FIG. 1A, FIG. IB, FIG. 1C, FIG. 3, and FIG. 5). Instead of inducing a cissplicing reaction, the trans-splicing system induces a trans-splicing event similar to an endogenous spliceosome based reaction. In the CRISPR Cas-based system, the trans-splicing event occurs when the catalytically inactive or active protein assembly binds to a pre-mRNA. When the catalytically inactive or active protein that is linked to a MS2 binding protein binds to the pre- mRNA, the cis-splice acceptor is blocked. The MS2 binding protein tethers a trans-splicing RNA molecule of interest, and with the binding of the catalytically inactive or active protein to the target pre-mRNA, directs the trans-splicing RNA to the pre-mRNA.

[0338] These experiments further compared the Cas7-11 system sequences disclosed herein to other CAS systems by phylogenetic analysis. Compared to other CAS systems, the Cas7-11 systems disclosed herein are novel and show low sequence similarity to other systems. The results are in Table 2 below. Altogether, these experiments demonstrate highly efficient trans-splicing.

[0339] Example 2: Characterization of Type III CRISRR ( 'as system

[0340] The experiments of this example demonstrate the novelty of the Type III CRISPR / Cas system disclosed herein (e.g., the system comprising an amino acid sequence of one of SEQ ID NOs: 1- 3), as disclosed herein), as well as an in vitro characterization of the enzymatic ability of the novel Type III CRISPR / Cas system of SEQ ID NOs: 1-3 to target and knockdown a nucleic acid (e.g., an illustrative gene being eGFP RNA). In these experiments, for each Cas open reading frame (“ORF”), an SV40 NLS sequence may be added to the N-terminus (MSPKKKRKVEAS (SEQ ID NO: 67)) and an SV40 NLS with an appended HA tag may be added to the C-terminus (GSGPKKKRKVAAAYPYDVPDYA (SEQ ID NO: 68)). The resulting ORFs are then mammalian codon optimized and synthesized into mammalian expression vectors. Transcription is driven by a CMV promoter, and an SV40 poly adenylation signal is used to terminate transcription. The sequence of the CMV promoter is the following:

[0341] CGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCA GAGCTGGTTTAGTGAACCGTCAGATC (SEQ ID NO: 69)

[0342] The sequence of the SV40 polyadenylation signal is the following:

[0343] CAGCTCACAGACATGATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAAT GCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACC ATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAG GTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGG TATTGGC (SEQ ID NO: 70)

[0344] A plasmid expressing eGFP and plasmids expressing a Type III CRISPR / Cas system (e.g., the system comprising an amino acid sequence of one of SEQ ID NOs: 1-3, as disclosed herein) and gRNAs are co-transfected into HEK293T cells (bio reps n=2) using lipofectamine 2000 per manufacturer’s instructions. Protein expression is confirmed by observing fluorescence via fluorescent microscopy on a Bio-Rad ZOE Fluorescent Cell Imager, and flow cytometry is performed 48 hours following transfection on a Sartorius iQue3. Cell and singlet gating is performed with Sartorius iQue3 instrument software, and median GFP intensity of singlets is calculated in python using FlowCytometryTools. Results are plotted using Matplotlib. These experiments can further compare the Type III CRISPR / Cas system disclosed herein to other Cas systems by phylogenetic analysis. Compared to other Cas systems, the Type III CRISPR / Cas systems disclosed herein are novel and show low sequence similarity to other systems.

[0345] Accordingly, the results of the experiments of this example demonstrate the Type III CRISPR / Cas systems disclosed herein are novel and capable of targeting and knocking down a nucleic acid.

[0346] Example 3: Targeted trans-splicing for Type 111 CRlSPR'Cas system and dPspCas!3b

[0347] In the experiments of this example, the Type III CRISPR / Cas system (e.g., the system comprising an amino acid sequence of one of SEQ ID NOs: 1-3, as disclosed herein) is evaluated for targeted trans-splicing using a truncated GFP reporter assay. In this assay, the truncated GFP exons (5' GFP, 3 ' GFP) introduced by the splice donor and acceptor reporters are spliced together, generating a transcript that contains a complete GFP mRNA sequence capable of creating a functional GFP protein product, and thereby demonstrating successful trans-splicing.

[0348] HEK293T cells are transfected with a Type III CRISPR / Cas system gRNA targeting the splice donor (SD) reporter, a fusion of catalytically inactive Type III CRISPR / Cas system orthologue and MS2, and the splice acceptor (SA) reporter having MS2 stem loops. In these experiments, HEK293T cells (Thermo Fisher Scientific Cat. No. R70007) are cultured in a humidified incubator at 5% CO2 at 37°C using high-glucose DMEM (Invitrogen) complemented with 10% FBS and 1% penicillin / streptomycin. Cell cultures are kept at low passage (<20) and regularly tested for mycoplasma contamination. Cells are plated in 96-well format at 15,000 cells per well with 100 uL of media. Cells are transfected 24 hours later with 25 ng gRNA plasmid (U6 driven expression), 25 ng Casl3-RBP plasmid, 25 ng of the SD reporter, and 25 ng of the SA reporter using 0.32 uL lipofectamine and 10 uL of OptiMEM total. Flow cytometry is performed 48 hours after transfection on a Sartorius iQue3 flow cytometer.

[0349] For comparison, HEK293T cells can be transfected using a dCasl3b variant from Prevotella sp. (“dPspCasl3b”), fused to a panel of RBPs sourced from RNA bacteriophage genomes. The experiments of this example will show that cells undergo successful trans-splicing using the Type III CRISPR / Cas system (e.g., the system comprising an amino acid sequence of one of SEQ ID NOs: 1-3, as disclosed herein), which is a level of trans-splicing comparable to that achieved using the dPspCasl3b system. The experiments of this example will further evaluate the Type III CRISPR / Cas system (e.g., the system comprising an amino acid sequence of one of SEQ ID NOs: 1-3, as disclosed herein) and / or dPspCas!3b systems using different RNA binding proteins. These experiments measure transsplicing between the SD reporter encoding a 5'GFP upstream of a splice donor, and a SA reporter having two sequence motifs upstream a splice donor and exon encoding 3'GFP. The SA reporters that are tested have sequence motifs recognized by RNA binding proteins (RBPs). The sequence motif and corresponding RBP that will be evaluated includes: (i) a MS2 hairpin and a MS2 coat protein (“MS2”); (ii) a PP7 hairpin and a PP7 coat protein (“PP7”); (iii) a M hairpin and a phage M coat protein (“M”); (iv) a PRR1 hairpin and a PRR1 coat protein (“PRR1”); and (v) a Qbeta hairpin and Qbeta coat protein (“QB”). HEK293T cells are transfected with the SD reporter, splice editor (i.e., PspCasl3b gRNA and a fusion of the Type III CRISPR / Cas system (e.g., the system comprising an amino acid sequence of one of SEQ ID NOs: 1-3, as disclosed herein) or dPspCas!3b to an RBP), and an SA reporter with the corresponding RBP sequence motif. Control cells were transfected with the SD reporter and SA reporter only. Trans-splicing between the SD reporter and SA reporter is expected to yield a measurable GFP signal. The experiments of this example will demonstrate how each of the splice editors that is evaluated will result in a level of trans-splicing that is higher than that observed in control cells.

[0350] Additionally, the experiments of this example will evaluate the Type III CRISPR / Cas system (e.g., the system comprising an amino acid sequence of one of SEQ ID NOs: 1-3, as disclosed herein) for trans-splicing using an alternate reporter system having a target nucleic acid containing distinct gene segments from an SD reporter (the target nucleic acid (“target”)). In these experiments, the target contains from 5' to 3': the 5' portion of GFP, a first intron from a human protein-coding gene (“gene A”), a splice acceptor, and an exon from gene A. The trans-splicing template (the “template”) contains from 5' to 3': an intron containing two MS2 stem loops, a splice acceptor, and the 3' portion of GFP. The constructs are designed such that successful trans-splicing between the splice donor of the target and the splice acceptor of the template yields a GFP signal. HEK293T cells are transfected using lipofectamine 2000 per manufacturer’s instructions in 96-well format. Each plasmid (target, template, Casl3K2E-MCP+gRNA) is one-third (33 ng) of the total DNA transfection. A non-coding dummy DNA is included in conditions where less than four components are delivered, such that there would be a total of 100 ng of DNA in each transfection. Media is changed 12 hours after the transfection. Protein expression is confirmed by observing fluorescence via fluorescent microscopy on a Bio-rad ZOE Fluorescent Cell Imager, and flow cytometry was performed 48 hours following transfection on a Sartorius iQue3. Cell and singlet gating is performed with Sartorius iQue3 instrument software, and the percentage of GFP+ singlets is calculated in python. HEK293T cells are transfected with constructs encoding a Type III CRISPR / Cas system (e.g., the system comprising an amino acid sequence of one of SEQ ID NOs: 1-3, as disclosed herein) fused to a MS2 coat protein, a gRNA directed to the target, the target, and the template. Control cells are transfected with a non-targeting gRNA or target only. The experiments in this example will show that the editing performance is dramatically increased using the Type III CRISPR / Cas system (e.g, the system comprising an amino acid sequence of one of SEQ ID NOs: 1-3, as disclosed herein), indicating successful trans-splicing of the target.

[0351] Example 4: RNA-Binding Protein-Free Trans-splicing and grepRNA Design

[0352] The experiments of this example demonstrate how internal exon replacement is achieved with two gRNAs, two nucleases and RBPs (in this case, PCP and MCP) in combination with, or without, a binding motif (BM) in the repRNA. The experiments in this example show targeting (T) or nontargeting (NT) of two gRNAs, two nucleases and RBPs in combination with, or without, a binding motif (BM) in the repRNA to facilitate internal exon replacement.

[0353] The experiments of this example demonstrate the design of a guide repair RNA (“grepRNA”), which is devoid of an RBP. The Type III CRISPR / Cas system (e.g., the system comprising an amino acid sequence of one of SEQ ID NOs: 1-3, as disclosed herein) can be used with or without an RBP fusion. In these experiments, internal exon replacement across two different RNA targets can be shown. In addition, HEK293T cells are transfected in these experiments with pA0120 reporter plasmid (for example, 25 ng), grepRNA (for example, 50 ng), and the Type III CRISPR / Cas system-MCP (for example, 25 ng).

[0354] The experiments of this example will show targeting (T) or non-targeting (NT) of an integrated target to facilitate internal exon replacement. In these experiments, transient transfection of the Type III CRISPR / Cas system-MCP, grepRNA (targeting (T) or non-targeting (NT)), and pUC19 in HEK293FT cells are performed with an integrated USH2A target. Each splice editor (SE) component receives 25 ng for a total of 100 ng / transfection / well in a 96-well plate. Table 2: Percent Identity Matrix

[0355]

[0356] EQUIVALENTS

[0357] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth and as follows in the scope of the appended claims.

[0358] Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific embodiments described specifically herein. Such equivalents are intended to be encompassed in the scope of the following claims.

[0359] INCORPORATION BY REFERENCE

[0360] All patents and publications referenced herein are hereby incorporated by reference in their entireties.

[0361] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention.

[0362] As used herein, all headings are simply for organization and are not intended to limit the disclosure in any manner. The content of any individual section may be equally applicable to all sections.

Claims

CLAIMSWhat is claimed is:

1. A trans-splicing system comprising: a nucleic acid-targeting Type III CRISPR / Cas system; a nucleic acid guide; optionally, a specific RNA-binding domain; and a repair template comprising a splice donor and / or splice acceptor and an RNA sequence that associates with the Type III CRISPR / Cas system and / or specific RNA-binding domain.

2. The trans-splicing system of claim 1, wherein the Type III CRISPR / Cas system is or comprises a Type IIIA, Type IIIB, Type IIIC, Type IIID, Type IIIE, or Type IIIF CRISPR / Cas system, optionally wherein the Type IIIA, Type IIIB, Type IIIC, Type IIID, Type IIIE, or Type IIIF CRISPR / Cas system is active, catalytically inactive or has reduced activity relative to wild type.

3. The trans-splicing system of any one of claims 1 or 2, wherein the Type III CRISPR / Cas system is or comprises a Type IIIE CRISPR / Cas system, optionally wherein the Type IIIE CRISPR / Cas system is active, catalytically inactive or has reduced activity relative to wild type.

4. The trans-splicing system of any one of claims 1-3, wherein the Type III CRISPR / Cas system is or comprises a CaslO (Csml), Csm2, Cas7 (Csm3), Csm4, Csm5, Cas 6, and, Cas7-l l, or a fragment or variant thereof, optionally wherein the Type III CRISPR / Cas system is or comprises a CaslO (Csml), Csm2, Cas7 (Csm3), Csm4, Csm5, Cas 6, and, Cas7-11 is active, catalytically inactive or has reduced activity relative to wild type.

5. The trans-splicing system of any one of claims 1-4, wherein the Type III CRISPR / Cas system comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%,or 100% identity to SEQ ID NOs: 1 -39, or having about 1 to about 20 amino acid mutations, or a nucleic acid encoding the same.

6. The trans-splicing system of any one of claims 1-5, wherein the Type III CRISPR / Cas system comprises an amino acid sequence having about 1, or about 2, or about 3, or about 4, or about 5, or about 10, or about 15, or about 20 amino acid mutations, or a nucleic acid encoding the same.

7. The trans-splicing system of any one of claims 1-6, wherein the Type III CRISPR / Cas system comprises a domain from a different endonuclease.

8. The trans-splicing system of any one of claims 1-7, wherein the Type III CRISPR / Cas system comprises one or more mutations to reduce activity relative to an unmutated form.

9. The trans-splicing system of any one of claims 1-7, wherein the Type III CRISPR / Cas system comprises one or more mutations to substantially ablate activity relative to an unmutated form.

10. The trans-splicing system of any one of claims 1-7, wherein the Type III CRISPR / Cas system comprises one or more mutations to reduce activity but retain nucleic acid binding capability relative to an unmutated form.

11. The trans-splicing system of any one of claims 1-7, wherein the Type III CRISPR / Cas system comprises one or more mutations to substantially ablate activity but retain nucleic acid binding capability relative to an unmutated form.

12. The trans-splicing system of any one of claims 1-11, wherein the Type III CRISPR / Cas system comprises one or more of a substitution at positions D413 and D634 relative to SEQ ID NO: 1, or a position equivalent thereto, or wherein the Type III CRISPR / Cas system comprises one or more of a substitution at positions H14, D15, G584, G585, D586, and D587 and relative to SEQ ID NO: 35, or a position equivalent thereto, or wherein the Type III CRISPR / Cas system comprises a substitution at position D32 relative to SEQ ID NO: 37, or a position equivalent thereto.

13. The trans- splicing system of any one of claims 1-12, wherein the Type III CRISPR / Cas system comprises one or more of D413A and D634A relative to SEQ ID NO: 1, or a position equivalent thereto, or wherein the Type III CRISPR / Cas system comprises one or more of H14A, D15A, G584A, G585A, D586A, and D587A relative to SEQ ID NO: 35, or a position equivalent thereto, or wherein the Type III CRISPR / Cas system comprises at least D32A relative to SEQ ID NO: 37.

14. The trans-splicing system of any one of claims 1-13, wherein the Type III CRISPR / Cas system comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NOs: 1-39, or having about 1 to about 20 amino acid mutations or a nucleic acid encoding the same.

15. The trans-splicing system of claim 14, wherein the Type III CRISPR / Cas system comprises a truncation of relative to SEQ ID NOs: 1-39, or a position equivalent thereto.

16. The trans-splicing system of claim 15, wherein the truncation is greater than about 10 amino acids, or greater than about 20 amino acids, or greater than about 30 amino acids, or greater than about 40 amino acids, or greater than about 50 amino acids, or greater than about 100 amino acids, or greater than about 150 amino acids, or greater than about 200 amino acids, or greater than about 250 amino acids.

17. The trans-splicing system of claim 15, wherein the truncation is within about 1000 residues from the C- terminus, or about 900 residues from the C- terminus, or about 800 residues from the C- terminus, or about 700 residues from the C- terminus, or about 600 residues from the C- terminus, or about 500 residues from the C- terminus.

18. The trans-splicing system of claim 15, wherein the Type III CRISPR / Cas system comprises an amino acid sequence having at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 91%, or at least about 92%, or at least about 93%, or at least about 94%, or at least about 95%, or at least about96%, or at least about 97%, or at least about 98%, or at least about 99%, or 100% identity to SEQ ID NOs: 1-39, or having about 1 to about 20 amino acid mutations, or a nucleic acid encoding the same.

19. The trans-splicing system of any one of claims 1-18, wherein the nucleic acid guide is or comprises a RNA.

20. The trans-splicing system of any one of claims 1-19, wherein the nucleic acid guide is or comprises a DNA.

21. The trans-splicing system of any one of claims 1-20, wherein the trans-splicing system comprises one nucleic acid guide.

22. The trans-splicing system of any one of claims 1-20, wherein the trans-splicing system comprises more than one nucleic acid guide.

23. The trans-splicing system of any one of claims 1-22, wherein the nucleic acid guides recognize multiple targets.

24. The trans-splicing system of any one of claims 1-23, wherein the nucleic acid guide targets a splice acceptor site.

25. The trans-splicing system of any one of claims 1-23, wherein the nucleic acid guide targets a splice donor site.

26. The trans-splicing system of any one of claims 1-23, wherein the nucleic acid guide targets a region near a splice site.

27. The trans-splicing system of any one of claims 1-23, wherein the nucleic acid guide targets a region within about 200 nucleotides of a splice site, or within about 190 nucleotides of a splice site, or within about 180 nucleotides of a splice site, or within about 170 nucleotides of a splice site, or within about 160 nucleotides of a splice site, or within about 150 nucleotides of a splice site, or within about 140 nucleotides of a splice site, or within about 130 nucleotides of a splice site, or within about 120 nucleotides of a splice site, or within about 110 nucleotides of a splice site, or within about 100 nucleotides of a splice site, orwithin about 90 nucleotides of a splice site, or within about 80 nucleotides of a splice site, or within about 70 nucleotides of a splice site, or within about 60 nucleotides of a splice site, or within about 50 nucleotides of a splice site, or within about 40 nucleotides of a splice site, or within about 30 nucleotides of a splice site, or within about 20 nucleotides of a splice site, or within about 10 nucleotides of a splice site.

28. The trans-splicing system of any one of claims 1-23, wherein the nucleic acid guide targets a region less than or equal to 100 nucleotides from a splice site.

29. The trans-splicing system of any one of claims 1-28, wherein the more than one nucleic acid guides target one or more target nucleic acid of interest.

30. The trans-splicing system of any one of claims 1-28, wherein the more than one nucleic acid guides target multiple nucleic acids of interest.

31. The trans-splicing system of any one of claims 1-30, wherein the nucleic acid guide interacts with the Type III CRISPR / Cas system.

32. The trans-splicing system of any one of claims 1-31, wherein the Type III CRISPR / Cas system forms a complex with the nucleic acid guide.

33. The trans-splicing system of any one of claims 1-32, wherein the specific RNA-binding domain is suitable for binding an RNA aptamer.

34. The trans-splicing system of any one of claims 1-33, wherein the specific RNA-binding domain is or comprises a viral protein.

35. The trans-splicing system of claim 34, wherein the viral protein is or comprises a MS2 binding protein (MCP), a IN protein, a PP7 coat protein, or a QBeta coat protein.

36. The trans-splicing system of any one of claims 1-35, wherein the specific RNA-binding domain is or comprises MS2, PP7, Q , F2, GA, fr, JP501, M12, R17, BZ13, JP34, JP500, KU1, Mi l, MX1, TW18, VK, SP, FI, ID2, NL95, TW19, AP205, ^Cb5, <^Cb8r, (^Cbl2r, (^Cb23r, 7s, or PRRl.

37. The trans-splicing system of any one of claims 1-36, wherein the specific RNA-binding domain is covalently bound to the Type III CRISPR / Cas system.

38. The trans-splicing system of any one of claims 1-36, wherein the specific RNA-binding domain is not covalently bound to the Type III CRISPR / Cas system.

39. The trans-splicing system of any one of claims 1-38, wherein the specific RNA-binding domain and Type III CRISPR / Cas system are present in a single polypeptide fusion protein.

40. The trans-splicing system of any one of claims 1-39, wherein the specific RNA-binding domain and Type III CRISPR / Cas system are joined by a linker.

41. The trans-splicing system of claim 40, wherein the linker is between about 4 and about 40 amino acids, or about 10 and about 40 amino acids, or about 20 and about 40 amino acids, or about 30 and about 40 amino acids, or about 4 and about 30 amino acids, or about 4 and about 20 amino acids, or about 4 and about 10 amino acids, or about 5 amino acids, or about 10 amino acids, or about 15 amino acids, or about 20 amino acids, or about 25 amino acids, or about 30 amino acids, or about 35 amino acids, or about 40 amino acids.

42. The trans-splicing system of claim 40 or 41 , wherein the linker is substantially comprised of glycine and serine residues.

43. The trans-splicing system of claim 40, wherein the linker is (GGS)n, whereinnis 1, or 2, or 3, or 4, or 5.

44. The trans-splicing system of claim 43, wherein the linker is GGSGGSGGSG (SEQ ID NO: 41), GGSGGSGGGGSGGGGS (SEQ ID NO: 42), GGGGS (SEQ ID NO: 43), GGS (SEQ ID NO: 44), (GGGGS)n (n=l-4) (SEQ ID NO: 45), (Gly)s (SEQ ID NO: 46), (Gly)6(SEQ ID NO: 47), (EAAAK)n(n=l-3) (SEQ ID NO: 48), A(EAAAK)nA (n = 2-5) (SEQ ID NO: 49), AEAAAKEAAAKA (SEQ ID NO: 50), A(EAAAK)4ALEA(EAAAK)4A (SEQ ID NO: 51), PAPAP (SEQ ID NO: 52), KESGSVSSEQLAQFRSLD (SEQ ID NO: 53), EGKSSGSGSESKST (SEQ ID NO: 54), and GSAGSAAGSGEF (SEQ ID NO: 55), or a variant thereof, wherein the variant comprises about 1, or about 2, or about 3, or about 4, or about 5 mutations, the mutations selected from substitutions or deletions.

45. The trans-splicing system of any one of claims 1-44, wherein the trans- splicing system comprises one repair template, optionally wherein the trans-splicing system comprises a guide RNA operably linked to one repair template, optionally wherein the trans-splicing system comprises a guide RNA operably linked to one repair template by the same promoter, optionally wherein the trans-splicing system comprises a guide RNA operably linked to one repair template and is processed from an RNA transcript comprising the one repair template, and optionally wherein the trans-splicing system comprises a guide RNA operably linked to one repair template and is not processed from an RNA transcript comprising the one repair template.

46. The trans-splicing system of any one of claims 1-44, wherein the trans-splicing system comprises more than one repair template, optionally wherein the trans-splicing system comprises a guide RNA operably linked to more than one repair template, optionally wherein the trans-splicing system comprises a guide RNA operably linked to more than one repair template by the same promoter, optionally wherein the trans-splicing system comprises a guide RNA operably linked to more than one repair template and is processed from an RNA transcript comprising the more than one repair template, and optionally wherein the trans-splicing system comprises a guide RNA operably linked to more than one repair template and is not processed from an RNA transcript comprising the one repair template.

47. The trans-splicing system of any one of claims 45-46, wherein the repair template is delivered or deliverable to a cell as DNA.

48. The trans-splicing system of any one of claims 45-47, wherein the repair template is delivered or deliverable to a cell as RNA.

49. The trans-splicing system of any one of claims 45-48, wherein the repair template is expressed or suitable for expression as RNA.

50. The trans-splicing system of any one of claims 45-49, wherein the repair template comprises a splice acceptor.

51. The trans- splicing system of any one of claims 45-50, wherein the repair template comprises a splice donor.

52. The trans-splicing system of any one of claims 45-51, wherein the repair template comprises a splice acceptor and a splice donor.

53. The trans-splicing system of claim 52, wherein the splice donor comprises a nucleic acid sequence encoding a functional gene product.

54. The trans-splicing system of any one of claims 52-53, wherein the splice donor comprises a nucleic acid sequence encoding one or more exons.

55. The trans-splicing system of any one of claims 52-54, wherein the splice donor comprises a nucleic acid sequence encoding a wild type gene or exon.

56. The trans-splicing system of any one of claims 52-55, wherein the splice donor is suitable for replacement of a mutant gene in a pre-mRNA of a target nucleic acid of interest.

57. The trans-splicing system of any one of claims 45-56, wherein the repair template comprises one or more splice sites.

58. The trans-splicing system of any one of claims 45-57, wherein the repair template comprises an exon.

59. The trans-splicing system of any one of claims 45-58, wherein the repair template comprises more than one exon.

60. The trans-splicing system of any one of claims 45-59, wherein the repair template comprises an intron.

61. The trans-splicing system of any one of claims 45-60, wherein the repair template comprises more than one intron.

62. The trans-splicing system of any one of claims 45-61, wherein the repair template comprises one or multiple sequences that associate with the target nucleic acid of interest.

63. The trans- splicing system of any one of claims 45-62, wherein at least one portion of the repair template comprises a ms2 hairpin that specifically binds or it suitable for binding to the MS2 binding protein.

64. The trans-splicing system of any one of claims 45-63, wherein the repair template comprises a boxB hairpin that specifically binds or it suitable for binding to the IN protein.

65. The trans-splicing system of any one of claims 45-64, wherein the repair template comprises a PP7 hairpin that specifically binds or it suitable for binding to the PP7 coat protein.

66. The trans-splicing system of any one of claims 45-65, wherein the repair template comprises a QBeta hairpin that specifically binds or it suitable for binding to the QBeta coat protein.

67. The trans-splicing system of any one of claims 45-66, wherein the repair template comprising a splice donor and / or splice acceptor and an RNA sequence associates with the Type III CRISPR / Cas system and / or specific RNA-binding domain under physiological conditions.

68. The trans-splicing system of any one of claims 45-67, wherein the repair template comprising a splice donor and / or splice acceptor and an RNA sequence associates with the Type III CRISPR / Cas system and / or specific RNA-binding domain under stringent conditions.

69. The trans-splicing system of any one of claims 1-68, wherein the system is suitable for transient RNA repair.

70. The trans-splicing system of any one of claims 1-69, wherein the system is suitable for trans-splicing at an intron-exon junction or exon-intron junctions of a pre-mRNA.

71. The trans-splicing system of any one of claims 1-69, wherein the system is suitable for trans-splicing of a pre-mRNA at the 5' end of the pre-mRNA.

72. The trans-splicing system of any one of claims 1-69, wherein the system is suitable for trans-splicing of a pre-mRNA at the 3' end of the pre-mRNA.

73. The trans- splicing system of any one of claims 1-69, wherein the system is suitable for trans-splicing of a pre-mRNA at an internal site within a pre-mRNA.

74. The trans-splicing system of any one of claims 1-69, wherein the system is suitable for replacing the 5' or the 3' end of the target mRNA.

75. The trans-splicing system of any one of claims 1-74, wherein at least one portion of the trans-splicing system is introduced into a cell.

76. The trans-splicing system of any one of claims 1-75, wherein expression and / or activity of at least one portion of the trans-splicing system is transient.

77. The trans-splicing system of any one of claims 1-76, wherein the activity of at least one portion of the trans-splicing system is regulated by a small molecule.

78. The trans-splicing system of claim 77, wherein the small molecule is selected from abscisic acid (ABA), rapamycin (or rapalog), FK506, cyclosporine A, FK1012, Gibberellin3-AM, FKCsA, AP1903 / AP, and Auxin.

79. The trans-splicing system of claim 78, wherein the small molecule binding domain is an ABA-binding domain.

80. The trans-splicing system of claim 79, wherein the ABA-binding domain is or comprises an AB II polypeptide.

81. The trans-splicing system of any one of claims 1-80, further comprising a viral protein.

82. The trans-splicing system of claim 81, wherein the viral protein further comprises a small molecule binding domain.

83. The trans-splicing system of any one of claims 1-82, wherein the viral protein and the small molecule binding domain are linked by a linker.

84. The trans-splicing system of claim 83, wherein the linker is substantially comprised of glycine and serine residues.

85. The trans- splicing system of claim 84, wherein the linker is (GGS)n, whereinnis 1, or 2, or 3, or 4, or 5.

86. The trans-splicing system of claim 85, wherein the linker is GGSGGSGGSG (SEQ ID NO: 41), GGSGGSGGGGSGGGGS (SEQ ID NO: 42), GGGGS (SEQ ID NO: 43), GGS (SEQ ID NO: 44), (GGGGS )n(n= 1-4) (SEQ ID NO: 45), (Gly)s (SEQ ID NO: 46), (Gly)e (SEQ ID NO: 47), (EAAAK)„ (n=l-3) (SEQ ID NO: 48), A(EAAAK)„A (n = 2-5) (SEQ ID NO: 49), AEAAAKEAAAKA (SEQ ID NO: 50), A(EAAAK)4ALEA(EAAAK)4A (SEQ ID NO: 51), PAPAP (SEQ ID NO: 52), KESGSVSSEQLAQFRSLD (SEQ ID NO: 53), EGKSSGSGSESKST (SEQ ID NO: 54), and GSAGSAAGSGEF (SEQ ID NO: 55), or a variant thereof, wherein the variant comprises about 1, or about 2, or about 3, or about 4, or about 5 mutations, the mutations selected from substitutions or deletions.

87. The trans-splicing system of any one of claims 1-86, wherein the small molecule binding domain is an ABA-binding domain.

88. The trans-splicing system of any one of claims 1-87, wherein the ABA-binding domain comprises a PYL1 polypeptide.

89. The trans-splicing system of any one of claims 1-88, wherein the addition of ABA induces targeted trans-splicing of a target pre-mRNA.

90. The trans-splicing system of any one of claims 1-89, further comprising a promoter operably linked to one or more of the components of the trans-splicing system.

91. The trans-splicing system of claim 90, wherein the promoter is an inducible promoter.

92. The trans-splicing system of any one of claims 90-91, wherein the promoter is a tissuespecific promoter.

93. The trans-splicing system of any one of claims 1-92, further comprising one or more selfcleaving ribozymes is association with one or more of the components of the trans-splicing system.

94. The trans- splicing system of any one of claims 1-93, wherein the Type III CRISPR / Cas system is targeted to a nucleic acid.

95. The trans-splicing system of any one of claims 1-94 wherein the nucleic acid is RNA.

96. The trans-splicing system of any one of claims 1-94, wherein the nucleic acid is DNA.

97. The trans-splicing system of any one of claims 1-96, wherein the Type III CRISPR / Cas system is associated with RNA in a cell.

98. The trans-splicing system of claim 97, wherein the RNA is a pre-mRNA.

99. The trans-splicing system of any one of claims 1-96, wherein the CRISPR / Cas system is associated with DNA in a cell.

100. The trans-splicing system of any one of claims 1-96, wherein the CRISPR / Cas system is not associated with DNA in a cell.

101. The trans-splicing system of any one of claims 1-100, wherein the CRISPR / Cas system mediates trans-splicing of pre-mRNA in the nucleus of a cell.

102. The trans-splicing system of any one of claims 1-100, wherein the CRISPR / Cas system mediates trans-splicing of pre-mRNA in the cytoplasm of a cell.

103. The trans-splicing system of any one of claims 1-102, wherein the trans-splicing occurs in dividing cells.

104. The trans-splicing system of any one of claims 1-102, wherein the trans-splicing occurs in post-mitotic cells.

105. The trans-splicing system of claim 104, wherein post-mitotic cells are neurons, myocytes, or adipocytes.

106. The trans-splicing system of any one of claims 1-105, wherein expression of at least one portion of the trans-splicing system is inducible.

107. The trans- splicing system of any one of claims 1-106, wherein activity of at least one portion of the trans-splicing system is inducible.

108. The trans-splicing system of any one of claims 1-107, further comprising a viral vector or a non-viral vector.

109. The trans-splicing system of claim 108, wherein the viral vector is or comprises a retrovirus, adenovirus, adeno-associated virus, herpes simplex virus, anellovirus, or baculovirus.

110. The trans-splicing system of claim 108 or 109, wherein the viral vector is or comprises a virus-like particle (VLP).

111. The trans-splicing system of any one of claims 108-110, wherein the viral vector is or comprises an AAV.

112. The trans-splicing system of claim 111, wherein the AAV is or comprises one or more of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV2 / 1, AAV2 / 5, AAV2 / 8, AAV2 / 9, AAV3 / 1, AAV3 / 5, AAV3 / 8, and AAV3 / 9.

113. The trans-splicing system of claim 108, wherein the trans-splicing system is suitable for non-viral delivery selected from a cationic lipid vehicle, electroporation, calcium phosphate transfection, mechanical transfection, and nanoparticle delivery.

114. The trans-splicing system of any one of claims 1-107, further comprising a lipid nanoparticle (LNP) liposomes, lipoplexes or polymeric nanoparticle.

115. The trans-splicing system of claim 114, wherein the LNP comprises one or more of ionizable lipids, amino lipids, anionic lipids, neutral lipids, amphipathic lipids, helper lipids, structural lipids, PEG lipids, and lipoids.

116. A nucleic acid encoding the trans-splicing system of any one of claims 1-115 or a component thereof.

117. The nucleic acid of claim 116, wherein the nucleic acid is or comprises a DNA molecule or an RNA molecule.

118. The nucleic acid of claim 116, wherein the RNA is or comprises mRNA or modified mRNA (mmRNA).

119. The nucleic acid of claim 116, wherein the DNA is or comprises a vector or plasmid.

120. The nucleic acid of any one of claims 116-119, wherein the nucleic acid comprises a codon optimized sequence.

121. The nucleic acid of any one of claims 116-120, wherein the nucleic acid comprises one or more modifications.

122. The nucleic acid of claim 121, wherein the modifications are one or more of base modifications and backbone modifications.

123. A viral vector comprising the nucleic acid of claim of any one of claims 116-122.

124. The viral vector of claim 123, wherein the viral vector is or comprises an AAV or a viruslike particle (VLP).

125. The viral vector of claim 124, wherein the AAV is or comprises one or more of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV2 / 1, AAV2 / 5, AAV2 / 8, AAV2 / 9, AAV3 / 1, AAV3 / 5, AAV3 / 8, and AAV3 / 9.

126. A lipid nanoparticle comprising the nucleic acid of any one of claims 116-122.

127. A cell comprising the trans-splicing system of any one of claims 1-115, the nucleic acid of any one of claims 116-122, the viral vector of any one of claims 108-112 or 123-125, or the lipid nanoparticle of any one of claims 114 or 126.

128. The cell of claim 127, wherein the cell is a prokaryotic cell.

129. The cell of claim 127, wherein the cell is a eukaryotic cell.

130. The cell of claim 127, wherein the cell is a mammalian cell.

131. The cell of claim 127, wherein the cell is a human cell.

132. The cell of claim 127, wherein the cell is an immortalized cell.

133. The cell of claim 127, wherein the cell is harvested from a subject.

134. A pharmaceutical composition comprising the trans-splicing system of any one of claims 1-115, the nucleic acid of any one of claims 116-122, the viral vector of any one of claims 108-112 or 123-125, the lipid nanoparticle of any one of claims 114 or 126, or the cell of any one of claims 127-133, and a pharmaceutically acceptable carrier.

135. A kit comprising a container comprising the trans-splicing system of any one of claims 1- 115, the nucleic acid of any one of claims 116-122, the viral vector of any one of claims 108-122 or 123-125, the lipid nanoparticle of any one of claims 114 or 126, the cell of any one of claims 127-133, or the pharmaceutical composition of claim 134, and instructions for use in trans-splicing.

136. A method of mediating a targeted trans-splicing event on a pre-mRNA in a cell, the method comprising contacting a cell with the trans-splicing system of any one of claims 1-115, the nucleic acid of any one of claims 116-122, the viral vector of any one of claims 108-122 or 123-125, the lipid nanoparticle of any one of claims 114 or 126, the cell of any one of claims 127-133, or the pharmaceutical composition of claim 134.

137. A method of mediating a targeted trans-splicing event on a pre-mRNA in a cell in a subject in need thereof, comprising administering an effective amount of the trans-splicing system of any one of claims 1-115, the nucleic acid of any one of claims 116-122, the viral vector of any one of claims 108-122 or 123-125, the lipid nanoparticle of any one of claims 114 or 126, the cell of any one of claims 127-133, or the pharmaceutical composition of claim 134 to the subject.

138. The method of any one of claims 136-137, wherein trans-splicing occurs at an intron-exon junction or exon-intron junctions of a pre-mRNA.

139. The method of any one of claims 136-137, wherein trans-splicing of a pre-mRNA occurs at the 5' end of the pre-mRNA.

140. The method of any one of claims 136-137, wherein trans-splicing of a pre-mRNA occurs at the 3 ' end of the pre-mRNA.

141. The method of any one of claims 136-137, wherein trans-splicing of a pre-mRNA occurs at an internal site within a pre-mRNA.

142. The method of any one of claims 136-141, wherein the trans-splicing system replaces the 5' or the 3' end of the target mRNA.

143. A method for replacing a mutant exon of a gene of interest in a cell, the method comprising contacting a cell with the trans-splicing system of any one of claims 1-115, the nucleic acid of any one of claims 116-122, the viral vector of any one of claims 108-122 or 123-125, the lipid nanoparticle of any one of claims 114 or 126, the cell of any one of claims 127- 133, or the pharmaceutical composition of claim 134.

144. A method for replacing a mutant exon of a gene of interest in a subject in need thereof, comprising administering an effective amount of the trans-splicing system of any one of claims 1-115, the nucleic acid of any one of claims 116-122, the viral vector of any one of claims 108-122 or 123-125, the lipid nanoparticle of any one of claims 114 or 126, the cell of any one of claims 127-133, or the pharmaceutical composition of claim 134 to the subject.

145. A method of treating, ameliorating or preventing a disease or disorder in a subject, comprising a. contacting a cell with the trans-splicing system of any one of claims 1-115, the nucleic acid of any one of claims 116-122, the viral vector of any one of claims 108-122 or 123-125, the lipid nanoparticle of any one of claims 114 or 126, the cell of any one of claims 127-133, or the pharmaceutical composition of claim 134, and b. administering an effective amount of the cell to the subject.

146. A method of treating, ameliorating or preventing a disease or disorder in a subject, comprising administering an effective amount of the trans-splicing system of any one of claims 1-115, the nucleic acid of any one of claims 116-122, the viral vector of any one of claims 108-122 or 123-125, the lipid nanoparticle of any one of claims 114 or 126, the cell of any one of claims 127-133, or the pharmaceutical composition of claim 134 to the subject.

147. The method of any one of claims 145-146, wherein the disease or disorder is associated with a loss of protein function in the subject.

148. The method of any one of claims 145-146, wherein the disease or disorder is associated with a dominant negative protein function in the subject.

149. The method of any one of claims 136-148, wherein the method provides transient RNA repair.

150. The trans-splicing system of any one of claims 1-115, the nucleic acid of any one of claims 116-122, the viral vector of any one of claims 108-122 or 123-125, the lipid nanoparticle of any one of claims 114 or 126, the cell of any one of claims 127-133, or the pharmaceutical composition of claim 134 for use in treating, ameliorating or preventing a patient with a disease or disorder.

151. Use of the trans-splicing system of any one of claims 1-115, the nucleic acid of any one of claims 116-122, the viral vector of any one of claims 108-122 or 123-125, the lipid nanoparticle of any one of claims 114 or 126, the cell of any one of claims 127-133, or the pharmaceutical composition of claim 134 in the manufacture of a medicament for the treating, ameliorating or preventing of a disease or disorder.

152. A composition comprising an endonuclease comprising a sequence, or a fragment or variant thereof, and having at least about 70% identity to one or more of SEQ ID NOs: 1- 3, or having about 1 to about 20 amino acid modifications.

153. A composition comprising a nucleic acid encoding an endonuclease comprising a sequence, or a fragment or variant thereof, and having at least about 70% identity to one or more of SEQ ID NOs: 1-3 or having about 1 to about 20 amino acid modifications.

154. A composition comprising a nuclease system, comprising:(a) an endonuclease comprising a sequence, or a fragment or variant thereof, and having at least about 70% identity to one or more of SEQ ID NOs: 1-3 or having about 1 to about 20 amino acid modifications; and(b) an RNA molecule comprising a sequence complementary to one strand of a target nucleic acid molecule.

155. A composition comprising a chimeric protein comprising:(a) an endonuclease comprising a sequence, or a fragment or variant thereof, and having at least about 70% identity to one or more of SEQ ID NOs: 1-3 or having about 1 to about 20 amino acid modifications; and(b) a nucleic acid-modulating domain or a nucleic acid-modifying domain comprising a sequence comprising a catalytic domain, or a fragment or variant thereof, wherein (a) and (b) do not naturally occur together in a same reading frame.

156. A composition comprising a complex comprising a chimeric protein and an RNA molecule, wherein the chimeric protein comprises:(a) an endonuclease, or a fragment or variant thereof, and having at least about 70% identity to one or more of SEQ ID NOs: 1-3 or having about 1 to about 20 amino acid modifications; and(b) a nucleic acid-modulating domain or a nucleic acid-modifying domain comprising a sequence comprising a catalytic domain, or a fragment or variant thereof, wherein (a) and (b) do not naturally occur together in a same reading frame and the RNA molecule comprises a sequence complementary to one strand of a target nucleic acid molecule.

157. A nucleic acid encoding the chimeric protein of any one of claims 155-156.

158. A viral vector comprising the nucleic acid of claim 153 or 157.

159. A lipid nanoparticle comprising the nucleic acid of 153 or 157.

160. A cell comprising a nucleic acid of claim 157, the viral vector of claim 158, or the lipid nanoparticle of claim 159.

161. A pharmaceutical composition comprising the composition of any one of claims 152-156, nucleic acid of claim 157, the viral vector of claim 158, or the lipid nanoparticle of claim 159, or the cell of claim 160, and a pharmaceutically acceptable carrier.

162. A kit comprising a container comprising the composition of any one of claims 152-156, nucleic acid of claim 157, the viral vector of claim 158, or the lipid nanoparticle of claim 159, or the cell of claim 160, or the pharmaceutical composition of claim 161 and instructions for use in modulating and / or modifying a nucleic acid.

163. A method of modulating and / or modifying a nucleic acid in a cell, comprising contacting the cell with the composition of any one of claims 152-156, nucleic acid of claim 157, the viral vector of claim 158, or the lipid nanoparticle of claim 159, or the cell of claim 160, or the pharmaceutical composition of claim 161.

164. A method of modulating and / or modifying a nucleic acid in a subject in need thereof, comprising administering an effective amount of the cell with the composition of any one of claims 152-156, nucleic acid of claim 157, the viral vector of claim 158, or the lipid nanoparticle of claim 159, or the cell of claim 160, or the pharmaceutical composition of claim 161 to the subject.

165. A method of disrupting, correcting, and / or replacing a gene in a cell, comprising contacting the cell with the composition of any one of claims 152-156, nucleic acid of claim 157, the viral vector of claim 158, or the lipid nanoparticle of claim 159, or the cell of claim 160, or the pharmaceutical composition of claim 161.

166. A method of disrupting, correcting, and / or replacing a gene in a subject in need thereof, comprising administering an effective amount of the composition of any one of claims 152- 156, nucleic acid of claim 157, the viral vector of claim 158, or the lipid nanoparticle ofclaim 159, or the cell of claim 160, or the pharmaceutical composition of claim 161 to the subject.

167. A method of treating, ameliorating or preventing a disease or disorder in a subject, comprising:(a) contacting a cell with the composition of any one of claims 152-156, nucleic acid of claim 157, the viral vector of claim 158, or the lipid nanoparticle of claim 159, or the cell of claim 160, or the pharmaceutical composition of claim 161 and(b) administering an effective amount of the cell to the subject.

168. A method of treating, ameliorating or preventing a disease or disorder in a subject, comprising administering an effective amount of the composition of any one of claims 152- 156, nucleic acid of claim 157, the viral vector of claim 158, or the lipid nanoparticle of claim 159, or the cell of claim 160, or the pharmaceutical composition of claim 161 to the subject.

169. Use of the composition of any one of claims 152-156, nucleic acid of claim 157, the viral vector of claim 158, or the lipid nanoparticle of claim 159, or the cell of claim 160, or the pharmaceutical composition of claim 161 in the manufacture of a medicament for the treating, ameliorating or preventing of a disease or disorder.

170. A method of detecting and / or quantifying a nucleic acid in a sample, comprising contacting the sample with a composition of any one of claims 152-156.

171. The composition of any one of claims 152-156, or the trans-splicing system of any one of claims 1-115, comprising a repair RNA (repRNA) sequence, and:(a) one or more exons and / or introns;(b) a splice donor and / or splice acceptor, and wherein the repRNA is suitable for trans-splicing.

172. The composition of claim 171, wherein the trans-splicing system comprises a splice donor, a splice acceptor, and replaces an internal exon.

173. The composition of claim 172, wherein the repRNA is operably linked to the RNA molecule comprising a sequence complementary to one strand of a target nucleic acid molecule or the gRNA.

174. A system for targeting a nucleic acid for trans-splicing, the system comprising:(a) an endonuclease of any one of claims 1-115 and 152-156, and optionally an RNA molecule comprising a sequence complementary to one strand of a target nucleic acid molecule;(b) an RNA-binding polypeptide that associates with the endonuclease; and(c) a repair RNA (repRNA) sequence, comprising:(i) one or more exons and / or introns;(ii) a splice donor and / or splice acceptor.

175. The system of claim 174, wherein the RNA molecule is a gRNA.

176. The system of claim 174 or 175, wherein the endonuclease is not linked, associated, and / or fused with an RNA binding protein.

177. The composition or system of any one of claims 171-176, wherein the repRNA is not operably linked to one or more gRNAs.

178. The composition or system of any one of claims 171-176, wherein the repRNA is provided in trans to one or more gRNAs.

179. The composition or system of any one of claims 171-178, wherein the repRNA further comprises a ribozyme site.

180. The composition or system of claim 179, wherein the ribozyme site is a hairpin, hammerhead, hepatitis delta virus (HDV), Varkud satellite (VS), or glmS ribozyme site, or a variant thereof.

181. The composition or system of any one of claims 174-180, wherein the ribozyme site is a HDV ribozyme site.

182. The composition or system of any one of claims 179-181, wherein the ribozyme site is upstream of the one or more exons and / or introns of the repRNA.

183. A system for targeting a nucleic acid for trans-splicing, the system comprising:(a) an endonuclease of any one of claims 1-115 and 152-156, and an RNA molecule comprising a sequence complementary to one strand of a target nucleic acid molecule; and(b) a repair RNA (repRNA) sequence, comprising:(i) one or more exons and / or introns;(ii) a splice donor and / or splice acceptor.

184. The system of claim 183, wherein the RNA molecule is a gRNA.

185. The system of claim 183 or 184, wherein the endonuclease is not linked, associated, and / or fused with an RNA binding protein.

186. The composition or system of any one of claims 183-185, wherein the repRNA is operably linked to one or more gRNAs.

187. The composition of any one of claims 171-182, wherein the composition comprises a gRNA, repRNA, and a Cas endonuclease operably linked to a single promoter or a bidirectional promoter.

188. The composition of claim 187, wherein the gRNA and repRNA are located on a first side of the bidirectional promoter, and the Cas endonuclease is located on a second side of the bidirectional promoter.

Images