RNA-based specific deaminase mutant and use thereof

Abstract

An RNA-based specific deaminase mutant and the use thereof. The mutant does not have the deaminase activity for a DNA substrate, has a high deaminase activity for an RNA substrate, and has a redox switch capable of controlling the switching on and off of the deaminase activity thereof. When a system is in an oxidation state, an APOBEC3A mutant does not have the editing activity for an RNA substrate; and when a system is in a reduction state, an APOBEC3A mutant has the editing activity for an RNA substrate.

Description

RNA-specific deaminase mutant and its application

[0001] The present disclosure claims priority to a Chinese patent application filed with the Patent Office of China on August 29, 2023, entitled “A RNA-specific deaminase mutant and its application” and having application number 202311099787.7. The entire contents of the above application are incorporated herein by reference. Technical Field

[0002] The present invention relates to the field of biotechnology, and in particular to an RNA-specific deaminase mutant and applications thereof. Background Art

[0003] DNA editing technologies, such as CRISPR-Cas9, have been widely used in scientific research and disease treatment. This editing technology can directly repair mutation sites at the genomic level (Mali P., et al., Nat. Methods 2013, 10, 957-963; Sander JD, Joung JK. Nat. Biotechnol. 2014, 32, 347-355). However, this system has a large number of off-target effects in both DNA and RNA editing, and the Cas9 protein itself can cause an immune response in the human body, thus limiting its clinical application (Zuo RS, et al., Nat. Methods 2023, 20, 706-713; Chen Y, Ping Y. Acc. Chem. Res. 2023, 56, 2185-2196; Zuo E., et al. Nat. Methods 2020, 17, 600-604). Compared to DNA editing, RNA editing is controllable and reversible, and does not affect genomic stability (Cox DBT, et al., Science 2017, 358, 1019-1027; Merke T., et al. Nat. Biotechnol. 2019, 37, 133-138). More importantly, because the human body has endogenous RNA editing enzymes, editing can be achieved by simply introducing a guide RNA without inducing a severe immune response (Yi Z, et al., Nat. Biotechnol. 2022, 40, 946-955; Song J, et al., Mol. Cell 2022, 83, 139-155).

[0004] Apolioprotein B mRNA-editing enzyme catalytic polypeptides (APOBECs) are a class of endogenous cytidine deaminases in the human body that specifically catalyze the conversion of cytosine to uracil (C-to-U) in the genome. Transcription of APOBEC family editing enzymes can be activated by proinflammatory cytokines and chemokines, playing an important role in the body's innate and adaptive immune mechanisms. Studies have shown that APOBEC-associated mutational signatures are found in more than 70% of tumor types and 50% of tumor genomes. APOBEC3A is a key member of the APOBEC family with highly active cytidine deaminase activity (Huang X, et al., EMBO J. 2021, 40, e108209; Jalili P, et al., Nat. Commun. 2020, 11, 2971). However, APOBEC3A has dual catalytic activity against both DNA and RNA substrates, which leads to serious off-target effects and limits its application in RNA editing (Huang X, et al., EMBO J. 2020, 39, e104741; Kim K, et al., J. Mol. Biol. 2023, 435, 168198).

[0005] Tang Guiyue et al. discovered two integrated mutants of APOBEC3A, Y132G / K30R and Y132G / G188A / R189A / L190A, which retained high RNA substrate editing activity while removing DNA substrate editing activity (Tang G, et al., ACS Synth. Biol. 2021, 10, 1106-1115). This study created a new APOBEC3A variant with RNA-specific cytidine deaminase activity for the first time. However, although the Y132G / K30R and Y132G / G188A / R189A / L190A mutants no longer have DNA substrate editing activity, the in vitro editing efficiency of RNA substrates is only 40% and 28%, and the opening and closing of APOBEC3A editing activity cannot be controlled.

[0006] Summary of the Invention

[0007] Problems to be solved by the invention

[0008] Modifying and obtaining controllable APOBEC3A mutants, eliminating their DNA substrate editing activity, improving their RNA substrate editing activity and making the substrate editing activity controllable has become an urgent need in the field of RNA editing.

[0009] Solutions for solving problems

[0010] The present invention provides a cytidine deaminase comprising one or more of the following sequences:

[0011] I) an amino acid sequence that is 80%-99.5% identical to the amino acid sequence shown in SEQ ID NO: 1, and that retains the deamination activity of the amino acid sequence shown in SEQ ID NO: 1;

[0012] II) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted or inserted into the amino acid sequence shown in SEQ ID NO: 1, and which retains the deamination activity of the amino acid sequence shown in SEQ ID NO: 1; or

[0013] III) A nucleic acid that is partially complementary or completely complementary to any one of I) to II).

[0014] Preferably, the substitution occurs at one or more of the following positions of the amino acid sequence as shown in SEQ ID NO: 1: N24, G27, H29, K30, K60, N61, L62, R128, D131, Y132, G188, R189 and L190.

[0015] Preferably, the substitution occurs at one or more of the following positions of the amino acid sequence as shown in SEQ ID NO: 1: N24C, G27K, H29W, K30R, K60R, N61Q, L62A, R128K, D131C, Y132G, G188A, R189K and L190A.

[0016] Preferably, the substitution is a combination of the following positions in the amino acid sequence as shown in SEQ ID NO: 1:

[0017] (1)G27K, H29W;

[0018] (2)K60R, N61Q, L62A;

[0019] (3)K30R, Y132G;

[0020] (4)Y132G, G188A, R189A, L190A;

[0021] (5)N24C, G27K, H29W, R128K, D131C, R189K;

[0022] (6)N24C, K60R, N61Q, L62A, R128K, D131C, R189K.

[0023] The present invention provides a base editor fusion protein comprising the above-mentioned cytidine deaminase and a nucleic acid programmable nucleotide binding domain.

[0024] Preferably, the nucleic acid programmable nucleotide binding domain is a Cas protein and its variants.

[0025] Preferably, the Cas protein is spCas9 from Saccharomyces cerevisiae, SaCas9 from Staphylococcus aureus, LbCas12a from Lachnospiraceae bacteria, or enAsCas12a from Acidamicoccus bacteria.

[0026] Preferably, the Cas protein variant is VQRspCas9, VRER-spCas9, spRY, spNG, SaCas9-KKH or SaCas9-NG.

[0027] The present invention provides a polynucleotide encoding the cytidine deaminase as described above or encoding the base editor fusion protein as described above.

[0028] The present invention provides a vector comprising the polynucleotide described above.

[0029] The present invention provides a cell comprising one or more of the cytidine deaminase as described above, the base editor fusion protein as described above, the polynucleotide as described above, and the vector as described above.

[0030] The present invention provides a base editor system, characterized by comprising the cytidine deaminase as described above, a nucleic acid programmable nucleotide binding domain, and a guide polynucleotide;

[0031] Alternatively, it comprises a base editor fusion protein as described above, and a guide polynucleotide.

[0032] The present invention provides a pharmaceutical composition, characterized in that it comprises one or more of the cytidine deaminase as described above, the base editor fusion protein as described above, the polynucleotide as described above, the vector as described above, the cell as described above, and the base editor system as described above, and a pharmaceutically acceptable carrier.

[0033] The present invention provides the use of the cytidine deaminase as described above, the base editor fusion protein as described above, the polynucleotide as described above, the vector as described above, the cell as described above, the base editor system as described above, or the composition as described above in the preparation of base editing drugs or gene therapy drugs.

[0034] Effects of the Invention

[0035] The novel cytidine deaminase provided by the present invention lacks deaminase activity on DNA substrates, but possesses high deaminase activity on RNA substrates. It also features a redox switch that can control the on and off of its deaminase activity. When the system is in an oxidized state, the APOBEC3A mutant lacks RNA substrate editing activity, but when the system is in a reduced state, the APOBEC3A mutant possesses RNA substrate editing activity.

[0036] The new cytidine deaminase provided by the present invention has excellent editing efficiency and an extremely narrow editing window when constituting a base editor and being used in a base editor system, thereby promoting the targeted treatment of diseases and the application of base editors in precision medicine. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 is a schematic diagram of the RNA substrate editing efficiency of wild-type APOBEC3A (WT) and mutants (E72A, G27K / H29W, K60R / N61Q / L62A, K30R / Y132G, Y132G / G188A / R189A / L190A).

[0038] FIG2 is a schematic diagram of the RNA substrate editing efficiency of wild-type APOBEC3A (WT), oxidized APOBEC3A mutants, and reduced APOBEC3A mutants. DETAILED DESCRIPTION

[0039] To make the technical solutions and beneficial effects of the present invention more clearly understood, the following detailed description is given by way of specific embodiments. The accompanying drawings are not necessarily drawn to scale, and local features may be enlarged or reduced to more clearly illustrate the details of the local features. Unless otherwise defined, the technical and scientific terms used herein have the same meanings as those in the technical field to which this application belongs.

[0040] The present invention provides a cytidine deaminase comprising one or more of the following sequences:

[0041] I) an amino acid sequence that is 80%-99.5% identical to the amino acid sequence shown in SEQ ID NO: 1, and that retains the deamination activity of the amino acid sequence shown in SEQ ID NO: 1;

[0042] In certain embodiments, an amino acid sequence that is 80%, 80.5%, 81%, 80.5%, 81.5%, 82%, 82.5%, 83%, 83.5%, 84%, 84.5%, 85%, 85.5%, 86%, 86.5%, 87%, 87.5%, 88%, 88.5%, 89%, 89.5%, 90%, 90.5%, 91%, 91.5%, 92%, 92.5%, 93%, 93.5%, 94%, 94.5%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, or 99.5% identical to the amino acid sequence set forth in SEQ ID NO: 1, and which retains the deamination activity of the amino acid sequence set forth in SEQ ID NO: 1;

[0043] II) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted or inserted into the amino acid sequence shown in SEQ ID NO: 1, and which retains the deamination activity of the amino acid sequence shown in SEQ ID NO: 1; or

[0044] III) A nucleic acid that is partially complementary or completely complementary to any one of I) to II).

[0045] In the present invention, the expression "retains deamination activity," for example, "retains the deamination activity of the amino acid sequence shown in SEQ ID NO: 1," can refer to an adenosine deaminase that completely retains the deamination activity of the original sequence, or can refer to an adenosine deaminase that partially retains the deamination activity of the original sequence, for example, retaining 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the deamination activity. In other embodiments, an adenosine deaminase with a modified sequence, for example, an adenosine deaminase with a sequence having amino acid substitutions, may also have a deamination activity higher than that of an adenosine deaminase with the original sequence.

[0046] In certain embodiments, the substitution occurs at one or more of the following positions of the amino acid sequence as shown in SEQ ID NO: 1: N24, G27, H29, K30, K60, N61, L62, R128, D131, Y132, G188, R189 and L190.

[0047] In certain embodiments, the substitution occurs at one or more of the following positions of the amino acid sequence as shown in SEQ ID NO: 1: N24C, G27K, H29W, K30R, K60R, N61Q, L62A, R128K, D131C, Y132G, G188A, R189K and L190A.

[0048] In certain embodiments, the substitution is a combination of the following positions in the amino acid sequence as shown in SEQ ID NO: 1:

[0049] (1) G27K, H29W (SEQ ID NO: 2);

[0050] (2) K60R, N61Q, L62A (SEQ ID NO: 3);

[0051] (3) K30R, Y132G (SEQ ID NO: 5);

[0052] (4) Y132G, G188A, R189A, L190A (SEQ ID NO: 6);

[0053] (5) N24C, G27K, H29W, R128K, D131C, R189K (SEQ ID NO: 26);

[0054] (6) N24C, K60R, N61Q, L62A, R128K, D131C, R189K (SEQ ID NO: 27).

[0055] In certain embodiments, the cytidine deaminase provided herein lacks deaminase activity on DNA substrates, possesses high deaminase activity on RNA substrates, and has a redox switch that can control the on and off of its deaminase activity. When the system is in an oxidized state, APOBEC3A lacks RNA substrate editing activity, but when the system is in a reduced state, APOBEC3A possesses RNA substrate editing activity.

[0056] In certain embodiments, the redox switch is a lysine-cysteine ​​redox switch. When the system is in an oxidized state, lysine and cysteine ​​are connected through reactive oxygen species and the RNA substrate editing activity of APOBEC3A is turned off. When the system is in a reduced state, the connection between lysine and cysteine ​​is disconnected and the RNA substrate editing activity of APOBEC3A is turned on.

[0057] The present invention provides a base editor fusion protein comprising the above-mentioned cytidine deaminase and a nucleic acid programmable nucleotide binding domain.

[0058] In the present invention, the nucleic acid programmable nucleotide binding domain, when bound to a bound guide polynucleotide (e.g., gRNA), can specifically bind to a target polynucleotide sequence (i.e., by a complementary base pairing sequence between the bases of the bound guide nucleic acid and the bases of the target polynucleotide), thereby positioning the base editor to the target nucleic acid sequence that needs to be edited. In some embodiments, the target polynucleotide sequence comprises single-stranded DNA or double-stranded DNA. In some embodiments, the target polynucleotide sequence comprises RNA. In some embodiments, the target polynucleotide sequence comprises a DNA-RNA hybrid. It should be understood that the nucleic acid programmable nucleotide binding domain can also include a nucleic acid programmable protein that binds to RNA.

[0059] In certain embodiments, the nucleic acid programmable nucleotide binding domain is a Cas protein and its variants.

[0060] In certain embodiments, the Cas protein is spCas9 from Saccharomyces cerevisiae, SaCas9 from Staphylococcus aureus, LbCas12a from Lachnospiraceae bacteria, or enAsCas12a from Acidamicoccus bacteria.

[0061] In certain embodiments, the Cas protein variant is VQRspCas9, VRER-spCas9, spRY, spNG, SaCas9-KKH or SaCas9-NG.

[0062] The present invention provides a polynucleotide encoding the cytidine deaminase as described above or encoding the base editor fusion protein as described above.

[0063] The present invention provides a vector comprising the polynucleotide described above.

[0064] In certain embodiments, the vector is a mammalian expression vector. In some embodiments, the expression vector is selected from one or more of an adeno-associated virus, a retroviral vector, an adenoviral vector, a lentiviral vector, a Sendai virus vector, and a herpes virus vector. In some embodiments, the vector comprises a promoter.

[0065] The present invention provides a cell comprising one or more of the cytidine deaminase as described above, the base editor fusion protein as described above, the polynucleotide as described above, and the vector as described above.

[0066] In certain embodiments, the cell is a prokaryotic cell or a eukaryotic cell.

[0067] In certain embodiments, the cell is a bacterial cell, a plant cell, an insect cell, a human cell, or a mammalian cell.

[0068] The present invention provides a base editor system, characterized by comprising the cytidine deaminase as described above, a nucleic acid programmable nucleotide binding domain, and a guide polynucleotide;

[0069] Alternatively, it comprises a base editor fusion protein as described above, and a guide polynucleotide.

[0070] In certain embodiments, the guide polynucleotide is a guide RNA (gRNA), which is a short synthetic RNA consisting of a backbone sequence required for Cas binding and a user-defined spacer sequence of about 20 nucleotides that defines the genomic target to be modified. Thus, a technician can alter the genomic target specificity of the Cas protein depending in part on the specificity of the gRNA targeting sequence for the genomic target compared to the rest of the genome.

[0071] The present invention provides a pharmaceutical composition, characterized in that it comprises one or more of the cytidine deaminase as described above, the base editor fusion protein as described above, the polynucleotide as described above, the vector as described above, the cell as described above, and the base editor system as described above, and a pharmaceutically acceptable carrier.

[0072] The present invention provides the use of the cytidine deaminase as described above, the base editor fusion protein as described above, the polynucleotide as described above, the vector as described above, the cell as described above, the base editor system as described above, or the composition as described above in the preparation of base editing drugs or gene therapy drugs.

[0073] The terms and laboratory procedures used in the present invention in connection with protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology are those widely used in the respective fields. For example, standard recombinant DNA and molecular cloning techniques used in the present invention are well known to those skilled in the art and are fully described in Sambrook et al., Molecular Cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, 1989.

[0074] In this specification, a numerical range expressed using "a numerical value A - a numerical value B" means a range including the endpoints A and B.

[0075] The terms "nucleic acid" and "nucleic acid molecule" refer to compounds comprising a core base and an acidic moiety, such as a polymer of nucleosides, nucleotides or nucleotides. Typically, polymeric nucleic acids, such as nucleic acid molecules comprising three or more nucleotides, are linear molecules in which adjacent nucleotides are interconnected by phosphodiester bonds. In some embodiments, "nucleic acid" refers to a single nucleic acid residue (such as a nucleotide and / or nucleoside). In some embodiments, "nucleic acid" refers to an oligonucleotide chain comprising three or more individual nucleotide residues. As used herein, the terms "oligonucleotide" and "polynucleotide" are used interchangeably to refer to a polymer of nucleotides (such as a string of at least three nucleotides). In some embodiments, "nucleic acid" includes RNA and single-stranded and / or double-stranded DNA. Nucleic acid can be naturally occurring, such as in the context of a genome, transcript, mRNA, tRNA, rRNA, siRNA, snRNA, plasmid, cosmid, chromosome, chromatid or other naturally occurring nucleic acid molecules. On the other hand, nucleic acid molecules can be non-naturally occurring molecules, such as recombinant DNA or RNA, artificial chromosomes, engineered genomes or fragments thereof, or synthetic DNA, RNA, DNA / RNA hybrids or include non-naturally occurring nucleotides or nucleosides. In addition, the terms "nucleic acid," "DNA," "RNA," and / or similar terms include nucleic acid analogs, e.g., analogs having backbones other than phosphodiester backbones. Nucleic acids can be purified from natural sources, produced and optionally purified using recombinant expression systems, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, nucleic acids can include nucleoside analogs, e.g., analogs having chemically modified bases or sugar and backbone modifications.

[0076] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein and refer to amino acid polymers of any length. The polymer may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).

[0077] The term "fusion protein" refers to a hybrid polypeptide comprising protein domains from at least two different proteins. A protein can be located at the amino-terminal (N-terminal, N-terminal) portion or carboxyl-terminal (C-terminal, C-terminal) protein of the fusion protein, thereby forming an "amino-terminal fusion protein" or a "carboxyl-terminal fusion protein" respectively. Any protein provided herein can be produced by any method known in the art. For example, provided herein is a protein that can be produced via recombinant protein expression and purification, which is particularly suitable for fusion proteins comprising peptide linkers. Methods for recombinant protein expression and purification are well known, and include those described in: Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2012)), the entire contents of which are incorporated herein by reference.

[0078] The term "Cas protein" refers to CRISPR-associated proteins. Cas proteins and CRISPR sequences together constitute the CRISPR / Cas system. Cas proteins have functional domains related to nucleases and cut target sequences at specific locations by recognizing PAM (protospacer adjacent motif).

[0079] The term "deaminase" or "deaminase domain" refers to a protein or enzyme that catalyzes a deamination reaction. In some embodiments, the deaminase is an adenosine deaminase, which catalyzes the hydrolytic deamination of adenine to hypoxanthine. In some embodiments, the deaminase is an adenosine deaminase, which catalyzes the hydrolytic deamination of adenosine or adenine (A) to inosine (I). In some embodiments, the deaminase or deaminase domain is an adenosine deaminase that catalyzes the hydrolytic deamination of adenosine or deoxyadenosine to inosine or deoxyinosine, respectively. In some embodiments, adenosine deaminase catalyzes the hydrolytic deamination of adenosine in deoxyribonucleic acid (DNA).

[0080] The terms "nucleic acid programmable nucleotide binding domain" and "nucleic acid programmable DNA-binding protein (napDNAbp)" refer to proteins that bind to nucleic acids (e.g., DNA or RNA), such as guide polynucleotides (e.g., gRNA), which guide napDNAbp to a specific nucleic acid sequence, for example, by hybridizing with a target nucleic acid sequence. For example, the Cas9 protein can be bound to a guide RNA that guides the Cas9 protein to a specific DNA sequence that is complementary to the guide RNA. In some embodiments, napDNAbp is a Cas9 domain, e.g., a nuclease-active Cas9, a Cas9 nickase (nCas9), or a nuclease-free Cas9 (dCas9). Examples of nucleic acid programmable DNA-binding proteins include, but are not limited to, Cas9 (e.g., dCas9 and nCas9), CasX, CasY, Cpf1, C2c1, C2c2, C2c3, and Argonaute protein (AGO). However, it should be understood that nucleic acid programmable DNA-binding proteins also include nucleic acid programmable proteins that bind RNA. For example, the napDNAbp can be bound to a nucleic acid that guides the napDNAbp to the RNA.Other nucleic acid programmable DNA binding proteins are also within the scope of the present disclosure, although they may not be specifically described in this disclosure.

[0081] The term "base editor (BE)" or "nucleobase editor" refers to a reagent that binds to a polynucleotide and has a nuclear base modification activity. In various embodiments, the base editor comprises a nuclear base modification polypeptide (e.g., a deaminase) and a nucleic acid programmable nucleotide binding domain (e.g., a nucleic acid programmable DNA binding protein) bound to a guide polynucleotide (e.g., a guide RNA). In various embodiments, the reagent is a biomolecule complex comprising a protein domain with base editing activity, i.e., capable of modifying bases (e.g., A, T, C, G, or U) in a nucleic acid molecule (e.g., DNA, RNA). In some embodiments, the polynucleotide programmable DNA binding domain is fused or connected to a deaminase domain. In one embodiment, the reagent is a fusion protein comprising a domain with base editing activity. In some embodiments, the domain with base editing activity can deaminize bases in a nucleic acid molecule. In some embodiments, the base editor can deaminize one or more bases in a DNA molecule. In some embodiments, the base editor is an adenosine base editor (ABE).

[0082] The term "base editing activity" refers to the activity used to chemically change a base within a polynucleotide. In one embodiment, a first base is converted to a second base. In one embodiment, the base editing activity is adenosine or adenine deaminase activity, for example, converting target A·T to C·G. In some embodiments, base editing activity is assessed by editing efficiency. Base editing efficiency can be measured in any suitable manner, for example, by Sanger sequencing or second-generation sequencing. In some embodiments, base editing efficiency is measured by the percentage of total sequencing reads with nuclear base conversions affected by the base editor, for example, the percentage of total sequencing reads with target C·G base pairs converted to A·T base pairs. In some embodiments, when base editing is performed in a cell population, base editing efficiency is measured by the percentage of total cells with nuclear base conversions affected by the base editor.

[0083] The term "base editor system" refers to a system for editing a nucleobase of a target nucleotide sequence. In various embodiments, the base editor system comprises (1) a nucleic acid programmable nucleotide binding domain (e.g., Cas9); (2) a deaminase domain (e.g., adenosine deaminase) for deaminating the nucleobase; and (3) one or more guide polynucleotides (e.g., guide RNA).

[0084] The term "guide polynucleotide," "guide RNA," or "gRNA" refers to a polynucleotide that can specifically target a target sequence and can form a complex with a nucleic acid-programmable nucleotide binding domain protein (e.g., Cas9). In one embodiment, the guide polynucleotide is a guide RNA (gRNA). The gRNA can exist as a complex of two or more RNAs or as a single RNA molecule. A gRNA that exists as a single RNA molecule may be referred to as a single guide RNA (sgRNA), but "gRNA" is used interchangeably to refer to a guide RNA that exists as a single molecule or a complex of two or more molecules. Typically, a gRNA that exists as a single RNA species includes two domains: (1) a domain that has homology to the target nucleic acid (e.g., guides the binding of the Cas9 complex to the target nucleic acid); and (2) a domain that binds to the Cas9 protein. In some embodiments, domain (2) corresponds to a sequence called tracrRNA and includes a stem-loop structure. For example, in some embodiments, domain (2) is identical to or homologous to the tracrRNA provided in Jinek et al., Science 337:816-821 (2012). Other examples of gRNAs may be those disclosed in U.S. Provisional Patent Application USSN 61 / 874,682, filed on September 6, 2013, entitled “Switchable Cas9 Nucleases and Uses Thereof” and U.S. Provisional Patent Application USSN 61 / 874,746, filed on September 6, 2013, entitled “Delivery System For Functional Nucleases.” In some embodiments, the gRNA includes two or more of domains (1) and (2) and may be referred to as an “extended gRNA.” The extended gRNA will bind to two or more Cas9 proteins and bind to the target nucleic acid at two or more different regions. The gRNA includes a nucleotide sequence complementary to the target site that mediates binding of the nuclease / RNA complex to the target site, providing sequence specificity for the nuclease:RNA complex.

[0085] According to the present invention, the three-letter and one-letter codes for amino acids are as described in J. biol. chem, 243, p3558 (1968).

[0086] According to the present invention, amino acid "addition" refers to the addition of amino acids to the C-terminus or N-terminus of an amino acid sequence. According to the present invention, amino acid "deletion" refers to the deletion of one, two, or three or more amino acids from an amino acid sequence. According to the present invention, amino acid "insertion" refers to the insertion of amino acid residues at appropriate positions in an amino acid sequence. The inserted amino acid residues may be all or partly adjacent to each other, or none of the inserted amino acids may be adjacent to each other.

[0087] According to the present invention, amino acid "substitution" refers to the replacement of a certain amino acid residue at a certain position in the amino acid sequence by another amino acid residue; wherein, the "substitution" can be a conservative amino acid substitution.

[0088] According to the present invention, "conservative modification", "conservative substitution" or "conservative replacement" refers to the replacement of an amino acid in a protein with another amino acid having similar characteristics (e.g., charge, side chain size, hydrophobicity / hydrophilicity, main chain conformation and rigidity, etc.), so that changes can be made frequently without changing the biological activity of the protein. It is known to those skilled in the art that, in general, single amino acid replacements in non-essential regions of a polypeptide do not substantially change the biological activity (see Watson et al. (1987), Molecular Biology of the Gene, The Benjamin / Cummings Pub. Co., p. 224, (4th edition)). In addition, replacements of amino acids with similar structure or function are unlikely to destroy biological activity. Exemplary conservative replacements are set forth in the table below, "Exemplary amino acid conservative replacements".

[0089] As used interchangeably herein, the terms "coding sequence" or "protein coding sequence" refer to a polynucleotide segment that encodes a protein. This region or sequence has a start codon near the 5' end and a stop codon near the 3' end. A coding sequence may also be referred to as an open reading frame.

[0090] The terms "complementary" or "hybridize" are used to refer to "polynucleotides" and "oligonucleotides" (which are interchangeable terms referring to nucleotide sequences) with respect to the base pairing rules. For example, the sequence "CAGT" is complementary to the sequence "GTCA". Complementarity can be "partial" or "complete". "Partial" complementarity refers to a mismatch between one or more nucleic acid bases according to the base pairing rules, and "complete" or "complete" complementarity between nucleic acids refers to a match between each nucleic acid base and another base under the base pairing rules. The degree of complementarity between nucleic acid chains has an important influence on the efficiency and strength of hybridization between nucleic acid chains. This is particularly important in amplification reactions and detection methods that rely on binding between nucleic acids.

[0091] The terms "nucleic acid sequence" and "nucleotide sequence" refer to oligonucleotides or polynucleotides and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin that can be single-stranded or double-stranded, and represent the sense or antisense strand.

[0092] The terms "sequence identity" and "percentage identity" refer to the percentage of nucleotides or amino acids that are identical (i.e., identical) between two or more polynucleotides or polypeptides. The sequence identity between two or more polynucleotides or polypeptides can be determined by aligning the nucleotide or amino acid sequences of the polynucleotides or polypeptides and scoring the number of positions containing the same nucleotide or amino acid residue in the aligned polynucleotides or polypeptides, and comparing it with the number of positions containing different nucleotides or amino acid residues in the aligned polynucleotides or polypeptides. A polynucleotide may differ at one position, for example, by containing different nucleotides (i.e., substitutions or mutations) or missing nucleotides (i.e., nucleotide insertions or nucleotide deletions in one or two polynucleotides). A polypeptide may differ at one position, for example, by containing different amino acids (i.e., substitutions or mutations) or missing amino acids (i.e., amino acid insertions or amino acid deletions in one or two polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of nucleotide or amino acid residues in the polynucleotide or polypeptide and multiplying by 100. Exemplary, two or more sequences or subsequences have at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% nucleotide "sequence identity" or "percent identity" when compared and aligned for maximum correspondence using a sequence comparison algorithm or as measured by visual inspection. In certain embodiments, the sequences are substantially identical over the entire length of either or both compared biopolymers (e.g., polynucleotides).

[0093] The term "vector" refers to a means for introducing a nucleic acid sequence into a cell to produce a transformed cell. Vectors include plasmids, transposons, phages, viruses, liposomes, and episomes. An "expression vector" is a nucleic acid sequence that contains a nucleotide sequence to be expressed in a recipient cell. An expression vector may include additional nucleic acid sequences to facilitate and / or promote expression of the introduced sequence, such as initiation, termination, enhancer, promoter, and secretion sequences.

[0094] As used herein, the terms "individual" and "subject" are used interchangeably and refer to mammals. Mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In particular, the individual is a human.

[0095] The methods disclosed herein can be performed in vitro, ex vivo, or in vivo, or the products can exist in an in vitro, ex vivo, or in vivo form. The term "in vitro" refers to experiments using materials, biological substances, cells and / or tissues under laboratory conditions or in culture medium; while the term "in vivo" refers to experiments and procedures using intact multicellular organisms. In some embodiments, the methods performed in vivo can be performed on non-human animals. "Ex vivo" refers to an event that exists or occurs outside an organism, such as outside a human or animal, such as an event that can exist or occur on a tissue (e.g., a whole organ) or cell taken from an organism.

[0096] The term "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., a lubricant, talc, magnesium, calcium or zinc stearate, or stearic acid), or solvent encapsulating material, involved in delivering or transporting a compound from one part of the body (e.g., a delivery site) to another part (e.g., an organ, tissue, or part of the body). A pharmaceutically acceptable carrier is "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the tissues of the subject (e.g., physiologically compatible, sterile, physiological pH, etc.). Some examples of materials that can serve as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose, and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose and its derivatives, such as sodium carboxymethylcellulose, methylcellulose, ethylcellulose, microcrystalline cellulose, and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricants, such as magnesium stearate, sodium lauryl sulfate, and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, and treacle oil. oil, olive oil, corn oil, and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerol, sorbitol, mannitol, and polyethylene glycol (PEG); (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffers, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethanol; (20) pH buffered solutions; (21) polyesters, polycarbonates, and / or polyanhydrides; (22) bulking agents, such as peptides and amino acids; (23) serum components, such as serum albumin, high-density lipoprotein (HDL), and low-density lipoprotein (LDL); (22) C2-C12 alcohols, such as ethanol; and (23) other non-toxic compatible substances used in pharmaceutical formulations. Wetting agents, coloring agents, release agents, coating agents, sweeteners, flavoring agents, fragrances, preservatives, and antioxidants may also be present in the formulation.Terms such as "excipient," "pharmaceutically acceptable carrier," and the like are used interchangeably herein.

[0097] The terms "treatment", "processing" refer to a clinical intervention intended to reverse, alleviate a disease or disorder or one or more symptoms thereof, delay the onset of a disease or disorder or one or more symptoms thereof, or suppress the progression of a disease or disorder or one or more symptoms thereof as described herein. As used herein, the terms "treatment", "processing" refer to a clinical intervention intended to reverse, alleviate a disease or disorder or one or more symptoms thereof, delay the onset of a disease or disorder or one or more symptoms thereof, or suppress the progression of a disease or disorder or one or more symptoms thereof as described herein. In some embodiments, treatment can be administered after one or more symptoms have been formed and / or after the disease has been diagnosed. In other embodiments, treatment can be administered in the absence of symptoms, for example, for preventing or delaying the onset of symptoms or suppressing the onset or progression of a disease. For example, treatment can be administered to susceptible individuals before the onset of symptoms (for example, in view of the history of symptoms and / or in view of genetic or other susceptibility factors). Treatment can also be continued after the symptoms subside, for example to prevent or delay their recurrence.

[0098] Example 1 Construction of APOBEC3A mutants

[0099] In this example, the wild-type APOBEC3A is human APOBEC3A (Uniprot accession: P31941), and its amino acid sequence is shown in SEQ ID No: 1. In this example, the APOBEC3A mutants G27K / H29W, K60R / N61Q / L62A, E72A, K30R / Y132G, and Y132G / G188A / R189A / L190A have amino acid sequences shown in Table 1.

[0100] Table 1

[0101] The gene fragments of wild-type APOBEC3A or its mutants (G27K / H29W, K60R / N61Q / L62A, E72A, K30R / Y132G, Y132G / G188A / R189A / L190A) (as shown in Table 2) were inserted into the Ncol-Notl site of the pET28a plasmid (the primers used are shown in Table 3) to obtain plasmid pET28a-APOBEC3A. The plasmid was then transformed into Escherichia coli BL21 (DE3) strains. The cells were cultured at 37°C in a medium containing 50 μg / mL kanamycin to an OD value of 0.6-0.8, and then induced with 0.4 mM isopropylthiogalactoside for 24 h. The cells were harvested and lysed with lysis buffer A (0.2 mM KH2PO4, 10 mM Na2HPO4, 500 mM NaCl, 5% glycerol, 0.1 mM The cells were resuspended in 1% TCEP (1000x PMSF), lysed at 4°C, and purified using a nickel column after high-speed centrifugation to obtain proteins of wild-type APOBEC3A and its mutants (G27K / H29W, K60R / N61Q / L62A, E72A, K30R / Y132G, Y132G / G188A / R189A / L190A).

[0102] Table 2

[0103] Table 3

[0104] Example 2 Detection of DNA substrate deamination activity of wild-type APOBEC3A and its mutants

[0105] The DNA deamination activity of the wild-type APOBEC3A and its mutants (G27K / H29W, K60R / N61Q / L62A, E72A, K30R / Y132G, Y132G / G188A / R189A / L190A) was determined using a uracil DNA glycosylase-based assay. The specific steps are as follows:

[0106] The fluorescently labeled ssDNA substrate (whose nucleotide sequence is shown in SEQ ID No: 25) was diluted to 50 μM with buffer B (20 mM KH2PO4, pH 7.5, 50 mM NaCl, 0.1 mM TCEP). 3 μg of purified wild-type APOBEC3A or its mutant protein was mixed with 1 μL of the above substrate dilution and diluted to 20 μL with buffer C (20 mM KH2PO4, pH 6.0, 50 mM NaCl, 0.1 mM TCEP, 0.1% Triton X-100). The mixture was reacted at 37°C for 1 hour and then heated to 95°C to terminate the reaction. 5 units of uracil DNA glycosylase were added and the reaction was incubated at 37°C for 1 hour. The reaction was then terminated by adding 0.25 M NaOH. The reaction was neutralized by adding 1 M Tris-HCl solution, and then an equal volume of buffer D (4 M urea, 4 mM EDTA, 0.005% bromophenol blue) and heated to 95°C for 10 minutes. 10 μL of the above treatment solution was loaded onto the gel and subjected to fluorescence scanning (excitation wavelength: 494 nm; emission wavelength: 522 nm). The DNA deamination rate was calculated as follows:

[0107] DNA deamination rate = deaminated cytidine / (deaminated cytidine + non-deaminated cytidine)*100%

[0108] Nucleotide sequence of ssDNA substrate:

[0109] SEQ ID No:25:TAAGAAAGAAATCAGAAGAGGAA

[0110] The results are shown in Table 4. Wild-type APOBEC3A and its E72A mutant served as positive and negative controls, respectively. The four APOBEC3A mutants (G27K / H29W, K60R / N61Q / L62A, K30R / Y132G, and Y132G / G188A / R189A / L190A) exhibited zero DNA deamination rates, indicating no deaminated ssDNA substrates were detected. These results demonstrate that the DNA substrate deamination activities of the G27K / H29W, K60R / N61Q / L62A, K30R / Y132G, and Y132G / G188A / R189A / L190A mutants were completely abolished.

[0111] Table 4

[0112] Example 3 Detection of RNA substrate editing activity of wild-type APOBEC3A and its mutants

[0113] The mCherry-SDHB-eGFP fusion gene was inserted into the Ncol-Notl site of the pET28a plasmid to obtain the pET28a-mCherry-SDHB-eGFP recombinant plasmid. Then, the gene fragments of wild-type APOBEC3A or its mutants (G27K / H29W, K60R / N61Q / L62A, E72A, K30R / Y132G, Y132G / G188A / R189A / L190A) were inserted into the Ncol-Notl site of the pET28a-mCherry-SDHB-eGFP recombinant plasmid to obtain the single plasmid pET28a-mCherry-SDHB-eGFP-APOBEC3A and transformed into the Escherichia coli BL21 (DE3) strain in the presence of 50 μg / mL HCl. Kanamycin culture medium was cultured at 37°C to an OD value of 0.6-0.8, and then 0.4 mM isopropylthiogalactoside was added for induction for 24 hours. The cells were harvested with lysis buffer A (0.2 mM KH2PO4, 10 mM Na2HPO4, 500 mM NaCl, 5% glycerol, 0.1 mM TCEP, 1000xPMSF), and the fluorescence intensity was measured using a microplate reader. The excitation wavelengths of red fluorescence and green fluorescence were set to 580 nm and 485 nm, and the emission wavelengths were set to 610 nm and 520 nm. Equal volumes of bacterial culture were collected, RNA was extracted, and the editing efficiency was determined by RT-PCR.

[0114] The RNA editing efficiency is calculated as follows:

[0115] RNA editing efficiency = uracil peak height / (cytosine peak height + uracil peak height) * 100%

[0116] The results are shown in Figure 1. As positive and negative controls, the RNA editing efficiencies of wild-type APOBEC3A and its E72A mutant were 23% and 0%, respectively. The Y132G / G188A / R189A / L190A mutant of APOBEC3A had similar RNA editing efficiency to that of wild-type APOBEC3A, while the RNA editing efficiencies of the G27K / H29W, K60R / N61Q / L62A, and K30R / Y132G mutants of APOBEC3A were significantly higher than that of wild-type APOBEC3A. Among them, the editing efficiencies of the G27K / H29W and K60R / N61Q / L62A mutants of APOBEC3A were significantly higher than those of the other mutants.

[0117] Example 4 Construction of APOBEC3A mutants with redox switches

[0118] According to the aforementioned method, the N24C, D131C, R128K, and R189K mutations were constructed on the G27K / H29W and K60R / N61Q / L62A mutants of APOBEC3A, thereby forming the N24C / G27K / H29W / R128K / D131C / R189K and N24C / K60R / N61Q / L62A / R128K / D131C / R189K mutants, whose amino acid sequences are shown in SEQ ID No: 26 and SEQ ID No: 27. Under oxidative conditions, Cys24-Lys128 and Cys131-Lys189 form crosslinks, forming the oxidized mutants; under reduced conditions, the Cys24-Lys128 and Cys131-Lys189 crosslinks are broken, forming the reduced mutants.

[0119] The amino acid sequences of the G27K / H29W mutants of oxidized and reduced APOBEC3A are as follows:

[0120] The amino acid sequences of the K60R / N61Q / L62A mutants of oxidized and reduced APOBEC3A are as follows:

[0121] The gene fragments of the APOBEC3A N24C / G27K / H29W / R128K / D131C / R189K and N24C / K60R / N61Q / L62A / R128K / D131C / R189K mutants (the nucleotide sequences of which are shown in SEQ ID No: 28 and SEQ ID No: 29) were inserted into the Ncol-Notl site of the pET28a plasmid to obtain plasmid pET28a-APOBEC3A. The plasmid was then transformed into Escherichia coli BL21 (DE3) strain, cultured in a medium containing 50 μg / mL kanamycin at 37°C to an OD value of 0.6-0.8, and then induced with 0.4 mM isopropylthiogalactoside for 24 hours. The cells were harvested and lysed with lysis buffer A (0.2 mM KH2PO4, 10 mM Na2HPO4, 500 mM NaCl, 5% glycerol, 0.1 mM The cells were resuspended in 1% TCEP (1000x PMSF) and lysed at 4°C. After high-speed centrifugation, two aliquots of the centrifuge were added with the oxidizing agents hydrogen peroxide and dithiothreitol (DTT), respectively, and reacted for 1 hour. Proteins containing oxidized and reduced APOBEC3A mutants were purified using a nickel column.

[0122] The nucleotide sequence of the N24C / G27K / H29W / R128K / D131C / R189K mutant of APOBEC3A is as follows:

[0123] The nucleotide sequence of the APOBEC3A N24C / K60R / N61Q / L62A / R128K / D131C / R189K mutant is as follows:

[0124] Example 5 Detection of DNA and RNA substrate deamination activity of APOBEC3A mutants with redox switches

[0125] DNA substrate deamination activity was determined using the uracil DNA glycosylase method described above: a fluorescently labeled ssDNA substrate (whose nucleotide sequence is shown in SEQ ID No: 25) was diluted to 50 μM with buffer B (20 mM KH2PO4, pH 7.5, 50 mM NaCl, 0.1 mM TCEP). 2 μg of purified oxidized and reduced APOBEC3A mutant proteins were mixed with 1 μL of the substrate dilution and diluted to 20 μL with buffer C (20 mM KH2PO4, pH 6.0, 50 mM NaCl, 0.1 mM TCEP, 0.1% Triton X-100). The reaction was incubated at 37°C for 1 hour and then terminated by heating to 95°C. 5 units of uracil DNA glycosylase were added and the reaction was incubated at 37°C for 1 hour. The reaction was then terminated by adding 0.25 M NaOH and 1 M After neutralization with Tris-HCl solution, add an equal volume of buffer D (4 M urea, 4 mM EDTA, 0.005% bromophenol blue) and heat to 95°C for 10 minutes. Load 10 μL of the treated solution onto a gel and perform fluorescence scanning (excitation wavelength: 494 nm; emission wavelength: 522 nm). Calculate the DNA deamination rate using the following formula:

[0126] DNA deamination rate = deaminated cytidine / (deaminated cytidine + non-deaminated cytidine)*100%

[0127] The editing activity of RNA substrates was determined using the dual fluorescence system described above: the mCherry-SDHB-eGFP fusion gene was inserted into the Ncol-Notl site of the pET28a plasmid to obtain the pET28a-mCherry-SDHB-eGFP recombinant plasmid. The gene fragments of the oxidized and reduced APOBEC3A mutants were then inserted into the Ncol-Notl site of the pET28a-mCherry-SDHB-eGFP recombinant plasmid to obtain the single plasmid pET28a-mCherry-SDHB-eGFP-APOBEC3A and transformed into the Escherichia coli BL21 (DE3) strain. The cells were cultured at 37°C in a medium containing 50 μg / mL kanamycin to an OD value of 0.6-0.8, and then induced with 0.4 mM isopropylthiogalactoside for 24 h. The cells were washed with lysis buffer A (0.2 mM KH2PO4, 10 mM Na2HPO4, 500 mM NaCl, 5% glycerol, 0.1 mM The cells were harvested with 1000×PMSF (TCEP), and the fluorescence intensity was measured using a microplate reader. The excitation wavelengths of red and green fluorescence were set to 580 nm and 485 nm, and the emission wavelengths were set to 610 nm and 520 nm. Equal volumes of bacterial culture were collected, RNA was extracted, and the editing efficiency was determined by RT-PCR.

[0128] The RNA editing efficiency is calculated as follows:

[0129] RNA editing efficiency = uracil peak height / (cytosine peak height + uracil peak height) * 100%

[0130] Table 5

[0131] The DNA substrate deamination activities of the G27K / H29W and K60R / N61Q / L62A mutants of APOBEC3A with redox switches are shown in Table 5. The deamination rates of the G27K / H29W and K60R / N61Q / L62A mutants of the oxidized and reduced APOBEC3A for DNA substrates were both 0, indicating that the deamination activities of the G27K / H29W and K60R / N61Q / L62A mutants of the oxidized and reduced APOBEC3A for DNA substrates have been completely abolished.

[0132] The RNA substrate editing activities of the redox-switch APOBEC3A G27K / H29W and K60R / N61Q / L62A mutants are shown in Figure 2. The RNA substrate editing efficiencies of the reduced APOBEC3A G27K / H29W and K60R / N61Q / L62A mutants were 76%-80%, similar to the RNA substrate editing activities of the non-redox-switch APOBEC3A G27K / H29W and K60R / N61Q / L62A mutants described above. In contrast, the RNA substrate editing efficiencies of the oxidized APOBEC3A G27K / H29W and K60R / N61Q / L62A mutants were zero, indicating that the oxidized mutants lack RNA substrate editing activity. However, the RNA substrate editing activity of these mutants can be restored by the addition of the reducing agent DTT.

[0133] It should be understood that the above embodiments are exemplary and are not intended to encompass all possible implementations of the claims. Various modifications and variations may be made to the above embodiments without departing from the scope of this disclosure. Similarly, the various technical features of the above embodiments may be arbitrarily combined to form additional embodiments of the present invention that may not be explicitly described. Therefore, the above embodiments merely illustrate several implementations of the present invention and do not limit the scope of protection of the patent of this invention.

Claims

1. A cytidine deaminase, characterized in that Contains one or more of the following sequences: I) an amino acid sequence that has 80% to 99.5% identity to the amino acid sequence shown in SEQ ID NO: 1, and which retains the deamination activity of the amino acid sequence shown in SEQ ID NO: 1; II) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted or inserted into the amino acid sequence shown in SEQ ID NO: 1, and which retains the deamination activity of the amino acid sequence shown in SEQ ID NO: 1; or, III) A nucleic acid that is partially complementary or completely complementary to any one of I) to II).

2. The cytidine deaminase according to claim 1, characterized in that Substitutions occur at one or more of the following positions of the amino acid sequence shown in SEQ ID NO: 1: N24, G27, H29, K30, K60, N61, L62, R128, D131, Y132, G188, R189 and L190.

3. The cytidine deaminase according to claim 2, characterized in that The substitution is a substitution occurring at one or more of the following positions of the amino acid sequence as shown in SEQ ID NO: 1: N24C, G27K, H29W, K30R, K60R, N61Q, L62A, R128K, D131C, Y132G, G188A, R189K and L190A; Preferably, the substitution is a combination of the following positions in the amino acid sequence as shown in SEQ ID NO: 1: (1) G27K, H29W; (2) K60R, N61Q, L62A; (3) K30R, Y132G; (4)Y132G, G188A, R189A, L190A; (5)N24C, G27K, H29W, R128K, D131C, R189K; (6)N24C, K60R, N61Q, L62A, R128K, D131C, R189K.

4. A base editor fusion protein, characterized in that A method comprising the cytidine deaminase according to any one of claims 1 to 3, and a nucleic acid programmable nucleotide binding domain; Preferably, the nucleic acid programmable nucleotide binding domain is a Cas protein and its variants; Preferably, the Cas protein is spCas9 from Saccharomyces cerevisiae, SaCas9 from Staphylococcus aureus, LbCas12a from Lachnospiraceae bacteria, or enAsCas12a from Acidamicin bacteria; Preferably, the Cas protein variant is VQRspCas9, VRER-spCas9, spRY, spNG, SaCas9-KKH or SaCas9-NG.

5. A polynucleotide, characterized in that Encoding the cytidine deaminase according to any one of claims 1 to 3 or encoding the base editor fusion protein according to claim 4.

6. A carrier, characterized in that Comprising the polynucleotide as claimed in claim 5.

7. A cell, characterized in that Comprising one or more of the cytidine deaminase according to any one of claims 1 to 3, the base editor fusion protein according to claim 4, the polynucleotide according to claim 5, and the vector according to claim 6.

8. A base editor system, characterized in that: Comprising a cytidine deaminase according to any one of claims 1 to 3, a nucleic acid programmable nucleotide binding domain, and a guide polynucleotide; Alternatively, it comprises the base editor fusion protein as described in claim 4, and a guide polynucleotide.

9. A pharmaceutical composition, characterized in that Comprising one or more of the cytidine deaminase according to any one of claims 1 to 3, the base editor fusion protein according to claim 4, the polynucleotide according to claim 5, the vector according to claim 6, the cell according to claim 7, and the base editor system according to claim 8, and a pharmaceutically acceptable carrier.

10. Use of the cytidine deaminase according to any one of claims 1 to 3, the base editor fusion protein according to claim 4, the polynucleotide according to claim 5, the vector according to claim 6, the cell according to claim 7, the base editor system according to claim 8, or the composition according to claim 9 in the preparation of base editing drugs or gene therapy drugs.

Images