Recombinant oncolytic adenovirus

Abstract

Provided is an oncolytic adenovirus (Ad) of which the basic skeleton is an Ad having a different serotype from that of an adenovirus type-5 (Ad type-5), and which has high virus yield and can exhibit a satisfactory anti-tumor effect. Also provided is a pharmaceutical composition containing the oncolytic Ad as an active ingredient. The oncolytic Ad is a recombinant oncolytic Ad characterized in that a part or the whole of E1 gene of an Ad type-5 is incorporated into an E1 region in the genome of an Ad having a different serotype from that of the Ad type-5 and a part or the whole of E4 gene of the Ad type-5 is incorporated into an E4 region in the genome of the Ad having a different serotype from that of the Ad type-5.

Description

Recombinant oncolytic adenovirus

[0001] The present invention relates to an oncolytic adenovirus that has as its base an adenovirus of a serotype other than adenovirus type 5, and to a pharmaceutical composition containing said virus as an active ingredient.

[0002] This application claims priority from Japanese Patent Application No. 2023-138116, which is incorporated herein by reference.

[0003] Oncolytic viruses, which specifically infect and kill cancer cells, have attracted considerable attention as new anticancer drugs. To date, more than 10 different types of oncolytic viruses have been developed, and oncolytic adenoviruses (Ad) are one of the oncolytic viruses that are currently undergoing clinical development.

[0004] The structure of the Ad genome has been analyzed in detail, and two major approaches have been developed to target cancer cell-specific proliferation. The first approach involves introducing specific mutations or deletions into the Ad early genes, which allows for restricted proliferation based on the biological characteristics of cancer cells. Examples include p53-binding domain-deleted (55 kDa deletion of the E1B gene) mutant Ad. Another approach involves using a tumor-specific promoter to express the E1 gene, essential for Ad replication, leading to tumor-specific viral replication and cell death. The latter approach is currently widely used. The antitumor effect of oncolytic Ad is thought to be due not only to direct cell killing associated with viral replication, but also to stimulation of the immune system by damage-associated molecular patterns (DAMPs) associated with cancer cell death and the induction of antiviral immunity. To efficiently activate antitumor immunity, attempts have been made to incorporate various cytokines and immune-related genes that activate the immune system into oncolytic Ad.

[0005] On the other hand, there are approximately 70 Ad serotypes derived from humans alone, and Ad from various non-human animal species have also been identified. Most oncolytic Ads developed to date are based on Ad type 5, which belongs to subgroup C. However, the infection receptor for Ad type 5 (coxsackievirus-adenovirus receptor; CAR) is poorly expressed in some cancer cells, including highly malignant cancer cells, making it difficult for Ad type 5 to infect CAR-negative cells and resulting in inefficient infection. Furthermore, many adults (over 90%) possess neutralizing antibodies against Ad type 5 due to natural infection, which may reduce the therapeutic effect.

[0006] A new oncolytic Ad type 35, focusing on Ad type 35 belonging to subgroup B, has been disclosed (Patent Document 1, Non-Patent Document 1). Non-Patent Document 1 reports an oncolytic Ad type 35 that incorporates an hTERT (Human Telomerase Reverse Transcriptase) promoter and a mutant E1 fragment of the Ad type 35 genome into the E1-deleted region of the Ad type 35 genome. Since the proportion of people with antibodies to Ad type 35 is low (approximately 20% or less), it is unlikely that these antibodies will diminish the therapeutic effect. Furthermore, CD46, the infection receptor for Ad type 35, is expressed in all human cells except erythrocytes and is known to be highly expressed in highly malignant cancer cells. Ad type 35 is expected to be able to infect a wide range of cancer cells, especially CAR-negative cells, and to avoid the effects of existing antibodies. Oncolytic Ad type 35 can efficiently infect a wide range of cancer types, including highly malignant cancer cells, and is expected to have a high therapeutic effect.

[0007] There is a need to develop an oncolytic Ad that overcomes the problems inherent in oncolytic type 5 Ad and that exhibits sufficient virus yield and antitumor activity.

[0008] WO2020 / 166727 publication

[0009] Molecular Therapy: Oncolytics Vol. 20 March2021, p.399-409

[0010] The present invention aims to provide a recombinant oncolytic Ad that has a basic structure of a serotype Ad other than Ad type 5, that has high virus yield, and is capable of exerting sufficient antitumor activity, and also aims to provide a pharmaceutical composition containing the oncolytic Ad as an active ingredient.

[0011] In order to solve the above problems, the present inventors focused on the regions of the Ad genome necessary for viral proliferation and conducted extensive research. As a result, they discovered that the above problems can be solved by incorporating part or all of the gene encoding the E1 region (E1 gene) and part or all of the gene encoding the E4 region (E4 gene) of Ad type 5 into the E1 and E4 regions of the Ad genome of a serotype other than Ad type 5, and thus completed the present invention.

[0012] That is, the present invention comprises the following: 1. A recombinant oncolytic Ad having a serotype other than Ad type 5 as a backbone, wherein a portion or all of the E1 gene of Ad type 5 is integrated into the E1 region of the genome of the Ad serotype other than Ad type 5, and a portion or all of the E4 gene of Ad type 5 is integrated into the E4 region of the genome of the Ad serotype other than Ad type 5. 2. The recombinant oncolytic Ad according to the preceding item 1, wherein a portion or all of the E1 gene of Ad type 5 comprises at least a gene encoding the E1B 55kD protein of Ad type 5. 3. The recombinant oncolytic Ad according to the preceding item 1 or 2, wherein a portion or all of the E4 gene of Ad type 5 comprises one or more genes selected from the group consisting of a gene encoding ORF (open reading frame) 4, a gene encoding ORF6, and a gene encoding ORF6 / 7 of the E4 protein of Ad type 5. 4. The recombinant oncolytic Ad according to any one of the preceding items 1 to 3, wherein a tumor-specific promoter is further integrated into the recombinant oncolytic Ad. 5. The recombinant oncolytic Ad according to the preceding item 4, wherein the tumor-specific promoter is any one selected from the group consisting of an hTERT promoter, a Survivin promoter, an α-fetoprotein promoter, a carcinoembryonic antigen (CEA) promoter, a prostate-specific antigen promoter, a midkine promoter, and a cyclooxygenase-2 (COX-2) promoter. 6. The recombinant oncolytic Ad according to any one of the preceding items 1 to 5, further comprising a gene encoding a cell death induction-related protein or an immunostimulation-related protein. 7. The oncolytic Ad according to any one of the preceding items 1 to 6, wherein the serotype of Ad other than Ad type 5 is Ad type 35. 8. A pharmaceutical composition for cancer treatment, comprising as an active ingredient the recombinant oncolytic Ad according to any one of the preceding items 1 to 7. 9. A reagent for cancer treatment research, comprising the recombinant oncolytic Ad according to any one of the preceding items 1 to 7. 10. A method for producing the recombinant oncolytic Ad according to any one of the preceding items 1 to 6.11. A method for improving the yield of a recombinant oncolytic Ad that has a non-type 5 Ad serotype as its basic backbone, characterized by incorporating part or all of the E1 gene of type 5 Ad into the E1 region of the genome of the non-type 5 Ad serotype, and incorporating part or all of the E4 gene of type 5 Ad into the E4 region of the genome of the non-type 5 Ad serotype.

[0013] The recombinant oncolytic Ad of the present invention exhibited higher physical and biological titers than, for example, conventional type 35 Ad, and high virus yields were confirmed. Furthermore, the high biological titer ensured a highly active viral load. Since Ad serotypes other than type 5 Ad, such as type 35 Ad, have an extremely low rate of anti-Ad antibody retention in humans compared to type 5 Ad, the effects of existing antibodies can be eliminated. Furthermore, CD46, the receptor for type 35 Ad, is expressed in almost all human cells, but its expression is particularly elevated in cancer cells, potentially enhancing infection of cancer cells. The recombinant oncolytic Ad of the present invention can fully exert the antitumor effects of oncolytic Ad.

[0014] 1 is a diagram showing oncolytic type 35 Ad (OAd35) and a recombinant oncolytic type 35 Ad (OAd35-E1 / E4) in which a portion of the E1 region genome and a portion of the E4 region genome of Ad are replaced with a portion of the E1 region genome and a portion of the E4 region genome of Ad5. (Example 1) A diagram showing a plasmid for producing OAd35-E1 / E4. (Example 1) A photograph showing the results of the cytotoxic activity of OAd35 and OAd35-E1 / E4 against HCT116 (human colon cancer) cells, BxPC-3 (human pancreatic cancer) cells, H1299 (human non-small cell lung cancer) cells, and HEK293A (human embryonic kidney) cells, as determined by the crystal violet method. (Experimental Example 2) This figure shows the results of confirming the viability of OAd35 and OAd35-E1 / E4 by WST-8 assay when each virus was added to HCT116 cells, BxPC-3 cells, H1299 cells, and HEK293A cells and cultured. (Experimental Example 3) This figure shows the results of confirming the viral infection and proliferation ability of OAd35 and OAd35-E1 / E4 by measuring the viral genome copy number when each virus was added to H1299 cells, HCT116 cells, HEK293A cells, and BxPC-3 cells and cultured. (Experimental Example 4) This figure shows the results of evaluating the viral infectivity of OAd35 and OAd35-E1 / E4 as the ratio of physical titer (VP / mL) to biological titer (PFU / mL). (Experimental Example 5) This figure shows the results of confirming the tumor growth inhibitory effect of OAd35 and OAd35-E1 / E4. Figure 7(A) shows the experimental protocol, and Figure 7(B) shows the results. (Experimental Example 6) The results of confirming the viral proliferation activity in tumors for OAd35 and OAd35-E1 / E4 are shown. Figure 8(A) shows the experimental protocol, and Figure 8(B) shows the results. (Experimental Example 7)

[0015] The present invention is described in detail below. The scope of the present invention is not limited by these descriptions, and modifications other than those exemplified below can be made as appropriate within the scope of the present invention. The present invention relates to a recombinant oncolytic Ad that produces a high virus yield and exhibits sufficient antitumor activity. Numerous Ad serotypes exist, including approximately 70 human-derived Ads alone, and Ads derived from various non-human animal species have also been identified. Most oncolytic Ads developed to date have a backbone based on Ad type 5, which belongs to subgroup C. However, as used herein, "Ads of a non-Ad type 5 serotype" literally refers to Ads of a non-Ad type 5 serotype, and is not limited to human-derived Ads, but may also be Ads derived from other species, such as monkeys. Non-Ad type 5 serotypes are preferably Ads of a non-Ad type 5 serotype, more preferably Ads of a subgroup B serotype, and particularly preferably Ad type 35. "Recombinant Ads based on a non-Ad type 5 serotype" refers to Ads primarily composed of the Ad genome of a non-Ad type 5 serotype as defined above, in which the Ad genome of the non-Ad type 5 serotype has been partially modified. Specifically, it refers to a recombinant Ad characterized in that part or all of the E1 gene of Ad type 5 is integrated into the E1 region of the Ad genome, and part or all of the E4 gene of Ad type 5 is integrated into the E4 region of the Ad genome of a serotype other than Ad type 5.

[0016] The Ad genome consists of a single double-stranded linear DNA fragment encoding early genes (E1A, E1B, E2A, E2B, E3, and E4) and late genes (L1-L5). The Ad E1 gene contains the E1A and E1B genes. The E1A protein encoded by the E1A gene activates the transcription of genes required for infectious virus production (e.g., E1B, E2, and E4). The E1B protein encoded by the E1B gene promotes the accumulation of late gene (L gene) mRNA in the cytoplasm of infected host cells, promoting viral replication. It has been reported that Ad E1B55K protein and the ORF (open reading frame) 6 protein of the Ad E4 protein cooperate to transport Ad late gene mRNA (Silke Weigel et al., Journal of Virology, January 2000, p. 764-772). For example, when non-replicating type 5 Ad propagates in HEK293 cells, the Ad5 E1B55K protein and the Ad5 E4 ORF6 protein expressed in HEK293 cells form a complex to promote viral gene transport and replication. The complex of the E1B55K protein and the E4 ORF6 protein must each be derived from the same type of Ad.

[0017] As used herein, the incorporation of "part or all of the E1 gene of Ad type 5" into the E1 region of a non-Ad type 5 serotype Ad genome literally means that part or all of the E1 gene of Ad type 5 is incorporated into the E1 region of a non-Ad type 5 serotype Ad genome, particularly as long as the region of the Ad type 5 E1 gene necessary for transcriptional activation of the genes required for Ad production is included. Specifically, the incorporation of at least part or all of the E1A gene and / or part or all of the E1B gene of Ad type 5 into the E1 region of a non-Ad type 5 serotype Ad genome is sufficient. More specifically, it is desirable that at least the gene encoding the Ad type 5 E1B55kD protein (E1B55kD gene) is included. Furthermore, in the present invention, mutations may be introduced into the E1 gene, which is essential for viral replication. For example, mutations can be introduced into the sequence to avoid activation of innate immunity. This allows for the optimization of tumor-specific promoters (using the hTERT or Survivin promoter) and the incorporation of the ADP (adenovirus death protein) gene, thereby providing superior oncolytic Ad.

[0018] As used herein, "integration of a part or all of the E4 gene of Ad type 5" into the E4 region of the Ad genome of a serotype other than Ad type 5 literally means integration of a part or all of the E4 gene of Ad type 5 into the E4 region of the Ad genome of a serotype other than Ad type 5, as long as the E4 gene of Ad type 5 required for transcriptional activation of the genes necessary for Ad production is included. More specifically, it is desirable that at least one or more genes selected from the group consisting of the gene encoding ORF4, the gene encoding ORF6, and the gene encoding ORF6 / 7 of the E4 proteins of Ad type 5 are included. Furthermore, in the present invention, the E4 gene of Ad type 5 to be integrated may be mutated.

[0019] The recombinant oncolytic type 35 Ad of the present invention can be produced by the following method: first, a plasmid containing the entire genome of an Ad serotype other than Ad type 5 is prepared, and then the E1 gene containing part or all of the E1 gene of Ad type 5 is inserted into the genome of an Ad serotype other than Ad type 5 by recombination of the plasmid, thereby producing the recombinant Ad of the present invention.

[0020] The recombinant Ad of the present invention can be designed to replicate specifically in cancer cells by placing the E1 genes (E1A and E1B genes), which are essential for Ad replication, downstream of a tumor-specific promoter. The tumor-specific promoter is not particularly limited as long as it functions in the corresponding tumor. For example, the hTERT (human telomerase reverse transcriptase) promoter, which is highly active in many human cancer cells, can be used. Other tumor-specific promoters that can be used include the Survivin promoter, the AFP (alpha-fetoprotein) promoter, the CEA (carcinoembryonic antigen) promoter, the PSA (prostate-specific antigen) promoter, the DF3 / MUC1 promoter, the MK (midkine) promoter, and the cyclooxygenase-2 (COX-2) promoter.

[0021] An E1 gene incorporating part or all of the E1 gene of Ad type 5 can be inserted downstream of a tumor-specific promoter, and an E1 gene expression cassette designed to express the E1B gene from the virus's native promoter can be inserted into the E1-deficient region of the Ad genome of a serotype other than Ad type 5. The plasmid encoding the Ad genome with the inserted E1 gene expression cassette is linearized by restriction enzyme treatment, and then transfected into packaging cells to recover the recombinant Ad of the present invention. Packaging cells that can be used include HEK293 cells, as well as H1299 cells, HeLa cells, A549 cells, and the like.

[0022] Because the recombinant Ad of the present invention proliferates in a tumor-specific manner, it may further contain a gene encoding a cell death-inducing protein or an immunostimulatory protein, such as a protein that can induce apoptosis in target cells or a protein that can enhance the function of immune cells such as cytotoxic T lymphocytes (CTLs) and natural killer cells.

[0023] The activity of the recombinant oncolytic Ad of the present invention can be evaluated by measuring the physical titer and biological titer. For the physical titer, for example, the 260 nm (UV) absorbance can be measured according to the method of Maizel et al. (Virology, 36:115-125 (1968)), and the Ad particle concentration, including non-infectious virus particles, can be determined. This method provides the Ad particle concentration in terms of VP (vector particle) and PT (particle titer). The virus particles per mL can be expressed as VP / mL or PT / mL. For the biological titer, PFU (plaque-forming unit), IFU (infectious unit), and TCID 50 (tissue culture infectious dose 50, 50% cytopathic end point) can be measured. The ratio of the physical titer to the biological titer can be expressed as a ratio. The more infectious the virus, the lower the ratio value. MOI (multiplicity of infection) indicates the number of viruses per cell, and can be expressed specifically as MOI = PFU / cell.

[0024] When the physical and biological titers of type 5 Ad, which lacks the E1 region, and type 35 Ad, a non-type 5 serotype Ad in which part of the E4 gene of the type 35 Ad genome was modified with part of the E4 gene of the Ad5 genome, were measured, the Ad with the modified E4 region of the type 35 Ad genome showed physical and biological titers comparable to those of type 5 Ad, whereas the unmodified type 35 Ad had lower physical and biological titers. Furthermore, the ratio of the physical titer to the biological titer for the unmodified type 35 Ad was very high, confirming that type 35 Ad produced very low levels of infectious virus. On the other hand, the recombinant Ad type 35 of the present invention, in which part or all of the E1 gene of Ad type 5 is integrated into the E1 region of the Ad type 35 genome and part or all of the E4 gene of Ad type 5 is integrated into the E4 region of the Ad type 35 genome, exhibits physical titers, biological titers, and a ratio of physical titer to biological titer (ratio) comparable to those of Ad type 5, demonstrating high production of infectious virus. For example, Ad type 35, as mentioned above, is advantageous in that it can enhance infection of cancer cells by using CD46, which is upregulated in cancer cells, as a receptor. Furthermore, the high innate immune induction capacity of Ad antibodies leads to enhanced antitumor immunity as an oncolytic virus for cancer therapy, providing a significant advantage.

[0025] The present invention also encompasses pharmaceutical compositions containing the recombinant oncolytic Ad of the present invention as an active ingredient. The pharmaceutical compositions of the present invention can be used for cancer treatment. Furthermore, the present invention also encompasses methods for treating cancer, comprising administering the recombinant oncolytic Ad or the pharmaceutical composition to a cancer patient. The type of tumor (cancer) to be treated is not particularly limited, as long as it is a cancer in which the recombinant oncolytic Ad of the present invention can grow. Examples of tumors (cancers) to be treated include brain tumors, head and neck cancer, gastric cancer, colon cancer, lung cancer, liver cancer, prostate cancer, pancreatic cancer, esophageal cancer, bladder cancer, gallbladder cancer, bile duct cancer, breast cancer, uterine cancer, thyroid cancer, ovarian cancer, leukemia, lymphoma, sarcoma, mesenchymal tumors, and breast cancer.

[0026] The recombinant oncolytic Ad as an active ingredient of the present invention may be used as is, since it proliferates specifically in cancer cells, or may be mixed with known pharmaceutically acceptable carriers such as excipients, bulking agents, binders, and lubricants, and known additives (including buffers, isotonicity agents, chelating agents, colorants, preservatives, fragrances, flavoring agents, sweeteners, etc.).

[0027] The pharmaceutical composition of the present invention can be applied to the affected area as it is, or can be introduced into a living body (target cells or organs) by any known method, such as intratumoral, intravenous, intramuscular, intraperitoneal, or subcutaneous injection, or by inhalation through the nasal cavity, oral cavity, or lungs, oral administration, or intravascular administration using a catheter, etc.

[0028] The pharmaceutical composition of the present invention can be administered orally or parenterally depending on its form, such as oral preparations such as tablets, capsules, powders, granules, pills, liquids, and syrups, or parenteral preparations such as injections, topical preparations, suppositories, and eye drops. Preferred examples include local injections into tumors, muscles, the abdominal cavity, and the like, and intravenous injections.

[0029] The dosage of the recombinant oncolytic Ad as the active ingredient of the present invention is appropriately selected depending on the route of administration, the recipient, the age, weight, sex, symptoms, and other conditions of the patient. 6 ~10 11 About PFU, preferably 10 9 ~10 11 The recombinant oncolytic Ad of the present invention may be administered in a single dose or in divided doses per day. The recombinant oncolytic Ad of the present invention may be used in combination with known anticancer drugs or radiation therapy.

[0030] EXAMPLES The present invention will be described in detail below with reference to examples and experimental examples to deepen understanding of the present invention, but it goes without saying that the present invention is not limited to these examples.

[0031] Example 1: Preparation of Oncolytic Ad with E1 and E4 Regions Replaced with Ad5. An oncolytic Ad was designed to replicate specifically in cancer cells by incorporating the E1 gene (E1A gene, E1B gene), essential for self-replication, downstream of the tumor-specific hTERT promoter. In this example, a portion of the E1 region of Ad type 35 was replaced with a portion of the E1 region of Ad type 5, and an oncolytic Ad (hereinafter referred to as "OAd35-E1 / E4") was prepared by replacing a portion of the E4 region of Ad type 35 with genes encoding ORFs 4, 6, and 6 / 7 of the E4 protein of Ad type 5. As a comparative example, the oncolytic Ad (hereinafter referred to as "OAd35") described in Patent Document 1 (WO2020 / 166727) was used (Figure 1). The complete sequence of the human Ad type 5 genome was referenced in GenBank Accession Number M73260.1.

[0032] 1. Construction of OAd35-E1 / E4 The plasmid for constructing OAd35-E1 / E4 (pAdMS4-67-hmE1) was constructed as follows. First, a portion of the type 35 E4 gene was replaced with the gene encoding ORFs 4, 6, and 6 / 7 of the E4 protein of type 5 Ad (32914-34342 bp of type 5 Ad; SEQ ID NO: 1) to construct pAdMS4-67. pHM5-hmE1, a plasmid carrying a modified Ad type 5 E1 gene (560-3509 bp; SEQ ID NO: 2) downstream of the 5' ITR and hTERT promoter of type 35 Ad, was digested with I-CeuI and PI-SceI to obtain a fragment. This fragment was then ligated with pAdMS4-67 digested with I-CeuI and PI-SceI to obtain pAdMS4-67-hmE1 (Figure 2). The base sequence of the modified portion (823-837 bp) of the E1 gene of type 5 Ad before modification is shown in SEQ ID NO: 3, and the base sequence after modification is shown in SEQ ID NO: 4.

[0033] (Accession No. 1) Gene encoding ORF4, 6, 6 / 7 of E4 protein of type 5 Ad (32914 - 34342 bp) tcacaga accctagtat tcaacctgcc acctccctcc caacacacag agtacacagt cctttctccccggctggcct taaaaagcat catatcatgg gtaacagaca tattcttagg tgttatattc cacacggtttcctgtcgagc caaacgctca tcagtgatat taataaactc cccgggcagc tcacttaagt tcatgtcgct gtccagctgc tgagccacag gctgctgtcc aacttgcggt tgcttaacgg gcggcgaaggagaagtccac gcctacatgg gggtagagtc ataatcgtgc atcaggatag ggcggtggtg ctgcagcagcgcgcgaataa actgctgccg ccgccgctcc gtcctgcagg aatacaacat ggcagtggtc tcctcagcgatgattcgcac cgcccgcagc ataaggcgcc ttgtcctccg ggcacagcag cgcaccctga tctcacttaaatcagcacag taactgcagc acagcaccac aatattgttc aaaatcccac agtgcaaggc gctgtatccaaagctcatgg cggggaccac agaacccacg tggccatcat accacaagcg caggtagatt aagtggcgacccctcataaa cacgctggac ataaacatta cctcttttgg catgttgtaa ttcaccacct cccggtaccatataaacctc tgattaaaca tggcgccatc caccaccatc ctaaaccagc tggccaaaac ctgcccgccggctatacact gcagggaacc gggactggaa caatgacagt ggagagccca ggactcgtaa ccatggatcatcatgctcgt catgatatca atgttggcacaacacaggca cacgtgcata cacttcctca ggattacaagctctcccgc gttagaacca tatcccaggg aacaacccat tcctgaatca gcgtaaatcc cacactgcagggaagacctc gcacgtaact cacgttgtgc attgtcaaag tgttacattc gggcagcagc ggatgatcctccagtatggt agcgcgggtt tctgtctcaa aaagggtag acgatccctactgtacggag tgcgccgaga caaccgagat cgtgttggtc gtagtgtcat gccaaatgga acgccggacgtagtcatatt tcctgaagca aaaccaggtg cgggcgtgac aaacagatct gcgtctccgg tctcgccgcttagatcgctc tgtgtagtag ttgtagtata tccactctct caaagcatcc aggcgcccccc tggcttcgggttctatgtaa actccttcat gcgccgctgc cctgataaca tccaccaccg cagaataagc cacacccagccaacctac attcgttctg cgagtcacac acgggaggag cgggaagagc tggagaagaacc at

[0034] (Accession No. 2) Gene encoding E1 of type 5 Ad (560 - 3509 bp) atgagacatat tatctgccac ggaggtgtta ttaccgaaga aatggccgccagtcttttgg accagctgat cgaagaggta ctggctgata atcttccacc tcctagccattttgaaccac ctacccttca cgaactgtat gatttagacg tgacggcccc cgaagatcccaacgaggagg cggtttcgca gatttttccc gactctgtaa tgttggcggt gcaggaagggattgacttac tcacttttcc gccggcgccc ggttctccgg agccgcctca cctttcccgg cagcccgagcagccggagca gagagccttg ggtccggttt ctatgccaaa ccttgtaccggaggtgatcg atcttacctg ccacgaggct ggctttccac ccagtgacga cgaggatgaa gagggtgaggagtttgtgtt agattatgtg gagcaccccg ggcacggttg caggtcttgt cattatcacc ggaggaatacgggggaccca gatattatgt gttcgctttg ctatatgagg acctgtggca tgtttgtcta cagtaagtgaaaattatggg cagtgggtga tagagtggtg ggtttggtgt ggtaattttt tttttaattt ttacagttttgtggtttaaa gaattttgta ttgtgatttt tttaaaaggt cctgtgtctg aacctgagcc tgagcccgagccagaaccgg agcctgcaag acctacccgc cgtcctaaaa tggcgcctgc tatcctgaga cgcccgacat cacctgtgtc tagagaatgc aatagtagta cggatagctg tgactccggtccttctaaca cacctcctga gatacacccg gtggtcccgc tgtgccccat taaaccagttgccgtgagagttggtgggcg tcgccaggct gtggaatgta tcgaggactt gcttaacgag cctgggcaac ctttggacttgagctgtaaa cgcccaggc cataaggtgt aaacctgtga tgcgtgtgt ggttaacgcc tttgtagttgttgt atgacttgct gagataatgt ttaacttgca tggcgtgtta aatggggggggcttaagg gtataatg cgccgtgggc taatctggt tacatctgac ctcatggagg cttgggagtttggagat ttttctgctg tgcgtactt gctggaacagt gccttaggtgtgttcagt gctcatccca ggcaagtta gtctgcagaa ttaaggaggattacaagtgg gatttgaag agcttgaa atcctgtggt gagctgttg attcttgaa tctggtcaccaggcgctt tccagagaa ggtcagttcaag actttggatt ttccacattctt gggttgcgcg aaggataaat ggagcgaaga aacccactg agcggggggt acctgattttctctggcc atgcatctgt ggagagcggt tgtgagacac aagaatcgcc tgctgtt gtctccgtccgcccggcga taataccgac ggaggagcag cagggacggagccagc agagcccatg gaacccgaga gccggcctggaccctcggga atgaatgttg tacaggtggc tgaactgtat ccagaactga gacgcatttt vakaattacagaggatggc aggggtaa gggggtaag agggagcggg gggcttgtga ggctacagaggaggctaggaatctagcttt tagcttaatg accagacacc gtcctgagtg tattactttt caacagatca aggataattgcctaatgag cttgatctgc tggcgcagaa gtattccata gagcagctga ccacttactg gctgcagccaggggatgatt ttgaggaggc aagtacaagatcagcaaact tgtaaattc aggaattgtt gctacatttc tgggaacggg gccgaggtgg agatagatacggaggatagg gtggccttta gatgtagcat gataaattg tggccgggg tgcttggcat ggacggggtg gttattatga atgtaaggtt taggccctcttacggttcggttc accaacctta tcctacacgg tgtaagcttc tatgggttta acaatacctgtgtggaagcc tggaccgatg taagggttcg gggctgtgcc ttttactgct gctggaaggg ggtggtgtgtcgccccaaaa gcagggcttc aattaagaaa tgcctctttg aaaggtgtc cgtggctc ggtgcgccac aatgtggcct ccgactgtgg ttgcttcatg ctagtgaaaaa gcgtggctgtgattaagcat aacatggtat gtggcaactg cgaggacagg gcctctcaga tgctgacctg ctcggacggcaactgtcacc tgctgaagac cattcacgcct gccagctgcgc tttgagcata acatactgac ccgctgttcc ttgcatttgg gtaacaggag gggggtgttcctaccttacc aatgcaattt gagtcacact aagatattgc ttgagcccgagagcatgtcc aaggtgaacctgaacggggt gtttgacatg accatgaaga tctggaaggt gctgaggtac gatgagaccc gcaccaggtgcagaccctgc gagtgtggcg gtaaacatat taggaaccag cctgtgatgc tggatgtgac cgaggagctgaggcccgatc acttggtgct ggcctgcacc cgcgctgagt ttggctctag cgatgaagat acagattga

[0035] (SEQ ID NO: 3) Part of the E1 gene of Ad type 5 (823-837 bp) cttacctg ccacgag (SEQ ID NO: 4) Modified part of the E1 gene of Ad type 5 (823-837 bp) gttacctc ccacgat

[0036] The plasmid DNA of pAdMS4-67-hmE1 was linearized by treating it with the restriction enzyme AsiSI (NEB). TM OAd35-E1 / E4 was obtained by transfecting HEK293 cells using Invitrogen 2000. Subsequently, large-scale preparations were made by infecting HEK293 cells with OAd35-E1 / E4 three or four times. Each Ad was purified by cesium chloride density gradient centrifugation and dialyzed against a solution consisting of 10 mM Tris (pH 7.5), 1 mM MgCl2, and 10% glycerol.

[0037] 2. Preparation of OAd35 as a Comparative Example OAd35 was prepared by the method described in Patent Document 1 (WO2020 / 166727).

[0038] (Experimental Example 1) Virus titer (HEK293 cells, H1299 cells) In this experimental example, cells were collected from a total of 10 150mm diameter dishes on which CPE (cytopathic effect) had occurred after the action of each Ad for OAd35-E1 / E4 and OAd35 prepared in Example 1, and 500 μL of virus solution was obtained for OAd35, and 300 μL of virus solution was obtained for OAd35-E1 / E4. The physical titer (virus particle; VP) of each virus solution was measured by the method of Maizel et al. (Virology, 36:115-125 (1968)), and the biological titer (plaque forming unit; PFU) was measured using HEK293 cells or H1299 (human non-small cell lung cancer) cells by the method of Kanegae et al. (Jpn J Med Sci Biol, 47,157-166, 1994). The results are shown in Table 1.

[0039]

[0040] The results showed that OAd35-E1 / E4 produced higher physical titers (VP / mL) and biological titers (PFU / mL) than the other oncolytic Ads cultured in either cell line. Furthermore, the physical titer (VP) to biological titer (PFU) ratio (ratio) was lower in OAd35-E1 / E4. Specifically, when cultured in HEK293 cells, the OAd35 ratio was 103-fold higher than that of OAd35-E1 / E4, and when cultured in H1299 cells, the OAd35 ratio was 87.5-fold higher than that of OAd35-E1 / E4. These results confirmed that OAd35-E1 / E4 produced significantly higher levels of infectious virus.

[0041] (Experimental Example 2) Cytocidal effect 1 In this experimental example, the cytocidal effects of OAd35-E1 / E4 and OAd35 prepared in Example 1 on HCT116 (human colon cancer) cells, BxPC-3 (human pancreatic cancer) cells, H1299 (human non-small cell lung cancer) cells, and HEK293A (human embryonic kidney) cells were confirmed using the crystal violet method.

[0042] As in Experimental Example 1, virus solutions of various concentrations were prepared for OAd35-E1 / E4 and OAd35 and added to the cultured cells. After 5 days of incubation at 37°C, surviving adherent cells were fixed with 0.5% glutaraldehyde in PBS, and live cells were stained with 0.1% crystal violet. The results confirmed that OAd35-E1 / E4 had a stronger cell-killing effect on each cell type (Figure 3).

[0043] Experimental Example 3: Cytocidal Effect 2 In this experiment, virus solutions of OAd35-E1 / E4 and OAd35 prepared in Example 1, respectively, at 300 VP / cell and 30 VP / cell, were added to HCT116 cells, BxPC-3 cells, H1299 cells, and HEK293A cells, and the viability after 1, 3, and 5 days was determined using the WST-8 assay (Cell Counting Kit-8, Dojindo Laboratories). The results confirmed that the cell viability of each cell was reduced when OAd35-E1 / E4 was applied (Figure 4).

[0044] (Experimental Example 4) Viral Infectivity and Growth Ability In this experiment, the OAd35-E1 / E4 and OAd35 prepared in Example 1 were added to H1299 cells and HCT116 cells at 30 VP / cell, and to HEK293A cells and BxPC-3 cells at 3 VP / cell, and cultured for up to 72 hours. The viral infectivity and growth ability of each virus was confirmed by measuring the viral genome copy number. After 1, 24, 48, and 72 hours of culture, each cell was collected, and total DNA was extracted using DNeasy Blood & Tissue Kit (QIAGEN). The Ad genome copy number was then measured by quantitative PCR using THUDERBIRD SYBR qPCR Mix (TOYOBO) (Figure 5). Measurements were performed using StepOnePlus TM A real-time PCR system (Applied Biosystems) was used.

[0045] The viral infection and proliferation ability when OAd35-E1 / E4 and OAd35 were cultured in each cell line for 1 hour, 48 hours, and 72 hours is shown in Table 2. As a result, OAd35-E1 / E4 showed a larger increase in the viral genome copy number than OAd35, confirming its higher viral proliferation ability.

[0046]

[0047] (Experimental Example 5) Viral Infectivity In this experiment, the viral infectivity of OAd35-E1 / E4 and OAd35 prepared in Example 1 was evaluated from the ratio (ratio) of the physical titer (VP / mL) to the biological titer (PFU / mL). The higher the infectious virus content, the lower the ratio value.

[0048] For OAd35-E1 / E4 and OAd35, each virus was scaled up to 30 150φ dishes, and each virus was purified by the same method as in Example 1. For physical titers, viral particles per mL (VP / mL) were measured by measuring absorbance at 260 nm (UV) according to the method of Maizel et al., Virology, 36:115-125 (1968). VP / mL was nearly equivalent for OAd35-E1 / E4 and OAd35. For biological titers, TCID in 293A cells was used. 50 The PFU / mL was measured by

[0049] As a result, we confirmed that OAd35-E1 / 4 had approximately 80-fold higher viral infectivity than OAd35 (Fig. 6). Based on these results, we succeeded in recovering highly infectious OAd35 by replacing E1 and E4 with those derived from type 5 Ad.

[0050] (Experimental Example 6) Tumor Growth Inhibitory Effect In this experiment, the tumor growth inhibitory effect of OAd35-E1 / E4 and OAd35 prepared in Example 1 was confirmed in vivo using nude mice.

[0051] H1299 cells (human lung cancer cell line) 3 x 10 6The cells were subcutaneously transplanted into nude mice, and 2 × 10 OAd35-E1 / E4 or OAd35 cells were added according to the protocol shown in Figure 7A. 9 VP was administered intratumorally on Day 0 and Day 3. Tumor volume was measured every 3 days.

[0052] As a result, OAd35-E1 / 4 exhibited a tumor growth inhibitory effect comparable to that of OAd35 (FIG. 7B).

[0053] (Experimental Example 7) Intratumoral viral proliferation activity In this experimental example, the intratumoral viral proliferation activity of OAd35-E1 / E4 and OAd35 prepared in Example 1 was confirmed using nude mice.

[0054] Using the same method as in Experimental Example 6 and the protocol shown in Figure 8A, human lung cancer cell lines were subcutaneously implanted into nude mice, and OAd35-E1 / E4 or OAd35 was administered intratumorally. Subcutaneous tumors were harvested on day 19, and the viral genome loads in the tumors were measured. The viral genome loads were analyzed by quantitative PCR.

[0055] Although the results were not statistically significant, OAd35-E1 / 4 showed a higher viral genome copy number than OAd35, suggesting that OAd35-E1 / 4 exhibits high viral replication within tumors (Fig. 8B).

[0056] As described above, the recombinant oncolytic Ad of the present invention exhibited higher physical and biological titers than, for example, conventional type 35 Ad, and high virus yields were confirmed. Furthermore, the high biological titer ensured a highly active viral load. Non-type 5 Ad, such as type 35 Ad, has an extremely low anti-Ad antibody retention rate in humans compared to type 5 Ad, eliminating the influence of existing antibodies. Furthermore, CD46, the receptor for type 35 Ad, is expressed in almost all human cells, but its expression is particularly elevated in cancer cells, potentially enhancing infection of cancer cells. The recombinant oncolytic Ad of the present invention can fully exert the antitumor effects of oncolytic Ad.

Claims

1. A recombinant oncolytic adenovirus having as its basic structure an adenovirus of a serotype other than adenovirus type 5, characterized in that a portion or all of the E1 gene of adenovirus type 5 is incorporated into the E1 region of the genome of said adenovirus of a serotype other than adenovirus type 5, and a portion or all of the E4 gene of adenovirus type 5 is incorporated into the E4 region of the genome of said adenovirus of a serotype other than adenovirus type 5.

2. The recombinant oncolytic adenovirus according to claim 1, wherein part or all of the E1 gene of adenovirus type 5 includes at least the gene encoding the E1B55kD protein of adenovirus type 5.

3. The recombinant oncolytic adenovirus described in claim 1, wherein a portion or all of the E4 gene of type 5 adenovirus includes one or more genes selected from a gene encoding ORF (open reading frame) 4, a gene encoding ORF6, and a gene encoding ORF6 / 7 of the E4 protein of type 5 adenovirus.

4. The recombinant oncolytic adenovirus according to claim 1, further comprising a tumor-specific promoter incorporated therein.

5. The recombinant oncolytic adenovirus described in claim 4, wherein the tumor-specific promoter is any one selected from the group consisting of an hTERT promoter, a Survivin promoter, an alpha-fetoprotein promoter, a carcinoembryonic antigen (CEA) promoter, a prostate-specific antigen promoter, a midkine promoter, and a cyclooxygenase-2 (COX-2) promoter.

6. The recombinant oncolytic adenovirus of claim 1, further comprising a gene encoding a cell death induction-related protein or an immunostimulatory protein.

7. An oncolytic adenovirus according to any one of claims 1 to 6, wherein the adenovirus of a serotype other than adenovirus type 5 is adenovirus type 35.

8. A pharmaceutical composition for cancer treatment comprising the recombinant oncolytic adenovirus according to claim 1 as an active ingredient.

9. A reagent for cancer treatment research, comprising the recombinant oncolytic adenovirus according to claim 1.

10. A method for producing the recombinant oncolytic adenovirus described in claim 1.

Images