Peptide-based coating molecules for stabilizing DNA nanostructures and imparting biological activity

Abstract

Described herein are peptide-based coating molecules for stabilizing DNA nanostructures and imparting biological activity. In one embodiment, a dense coating of peptides along the outside of the DNA nanostructure facilitates endolysosomal escape and improves cell delivery. Also described herein are nanoparticle compositions comprising a DNA nanostructure functionalized with an endolysosomal escape peptide coating or one or more antibodies.

Description

[0001]PEPTIDE-BASED COATING MOLECULES FOR STABILIZING DNA NANOSTRUCTURES AND IMPARTING BIOLOGICAL ACTIVITY CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No.63 / 535,804, filed on August 31, 2023, which is incorporated by reference herein in its entirety. FEDERALLY SPONSORED RESEARCH This invention was made with government support under grant number GM132931 awarded by the National Institutes of Health. The government has certain rights in the invention. REFERENCE TO SEQUENCE LISTING This application was filed with a Sequence Listing XML in ST.26 XML format accordance with 37 C.F.R. § 1.831 and PCT Rule 13ter. The Sequence Listing XML file submitted in the USPTO Patent Center, “208192-0007-WO01_sequence_listing_XML_15-AUG-2024.xml,” was created on August 15, 2024, contains 27 sequences, has a file size of 32.0 kilobytes (32,768 bytes), and is incorporated by reference in its entirety into the specification. BACKGROUND DNA nanostructures (DNs) are programmable and controllable and can be used in a variety of biomedical applications, such as the delivery of therapeutic agents. When exposed to biological liquids, the nanostructures become covered with protein corona that binds spontaneously to the surface of the nanoparticles and can affect their cellular uptake and the biological responses they exhibit. Although DNs are promising biomedical tools, their use is limited by their stability in physiological media. The self-assembly of DNs often necessitates the close packing of DNA helices, resulting in electrostatic repulsion between their negatively charged phosphate backbones. To avoid DN denaturation, high concentrations (e.g., 5–20 mM) of divalent cations, such as Mg2+, are required for structural stability. These concentrations are approximately an order of magnitude higher than what is found in physiological fluids, such as human serum (generally less than 1 mM divalent cation concentration). Additionally, DNs are particularly susceptible to the activity of nucleases and risk degradation in cell media and in vivo. Multiple studies have shown that nuclease activity results in rapid degradation upon DN incubation with 10% fetal bovine serum (FBS). It was determined that the addition of nuclease-inhibitory actin protein and up to 6 mM Mg2+in cell culture media was able to retain DN integrity without any detrimental effects on cell growth and viability. Furthermore, low-Mg2+denaturation occurs in a design-dependent manner. Unfortunately, a key limitation of this approach is that it is only applicable to in vitro cell culture conditions. More experimental studies must be done regarding the in vivo behavior and integrity of DNs if they are to be used for biomedical purposes. What is needed are peptide-based coating molecules for stabilizing DNA nanostructures and imparting biological activity in vitro and in vivo. SUMMARY One embodiment described herein is a nanoparticle composition comprising a DNA nanostructure (DN) functionalized with an endolysosomal escape peptide coating. In one aspect, the DN comprises a 6-helix bundle (6HB) nanostructure. In another aspect, the 6HB nanostructure comprises six different double-stranded DNA helices, each DNA helix comprising a nucleotide sequence having at least 90–99% identity to any one of SEQ ID NO: 1–6. In another aspect, the 6HB nanostructure comprises six different double-stranded DNA helices, each DNA helix comprising a nucleotide sequence selected from any one of SEQ ID NO: 1–6. In another aspect, the 6HB nanostructure is a rigid and monomeric assembly roughly 7 × 6 nm2in size. In another aspect, the endolysosomal escape peptide coating comprises one or more endolysosomal escape peptides having an amino acid sequence comprising at least 90–95% identity to any one of SEQ ID NO: 7–23. In another aspect, the endolysosomal escape peptide coating comprises one or more endolysosomal escape peptides comprising an amino acid sequence of any one of SEQ ID NO: 7–23. In another aspect, the endolysosomal escape peptide comprises a lysine10 (K10) peptide (SEQ ID NO: 7). In another aspect, the endolysosomal escape peptide comprises an aurein 1.2 peptide (SEQ ID NO: 16). In another aspect, the endolysosomal escape peptide comprises a lysine10 (K10) peptide, one or more polyethyleneglycol (PEG) linkers, and an aurein 1.2 peptide. In another aspect, the endolysosomal escape peptide comprises one or more of K10-PEG1K-EE (SEQ ID NO: 21), K10- PEG2K-EE (SEQ ID NO: 22), or K10-PEG5K-EE (SEQ ID NO: 23). In another aspect, the diameter of the functionalized DN is from about 15 nm to about 28 nm. In another aspect, the endolysosomal escape peptide coating binds the DN through electrostatic interactions at a nitrogen / phosphate ratio of about 0.8 to about 1.5. In another aspect, the nitrogen / phosphate ratio is about 1. In another aspect, the composition is stable in intracellular lysosomal compartments for up to 24 hr of incubation. In another aspect, the composition further comprises a therapeutic agent. Another embodiment described herein is a method for improving cellular uptake of a DNA nanostructure (DN) through enhanced endolysosomal escape, the method comprising delivering to a cell a nanoparticle composition comprising a DN functionalized with an endolysosomal escape peptide coating. In one aspect, endolysosomal escape efficiency is determined by a protein corona. In another aspect, cellular uptake efficiency of the functionalized DN is linearly dependent on the cell size. In another aspect, the cell is a hepatoblastoma cell or a hepatocellular carcinoma cell. In another aspect, the endolysosomal escape peptide coating facilitates enhanced endolysosomal escape without concomitant disruption of a cell membrane and without cytotoxicity to the cell. In another aspect, the composition further comprises a therapeutic agent and the method is used to deliver the therapeutic agent to a cell. Another embodiment described herein is a nanoparticle composition comprising a DNA nanostructure (DN) functionalized with one or more antibodies. Another embodiment described herein is a method for enhancing the delivery of a therapeutic agent to a subject, the method comprising administering to the subject a nanoparticle composition comprising a DNA nanostructure (DN) functionalized with an endolysosomal escape peptide and the therapeutic agent. Another embodiment described herein is the use of a nanoparticle composition comprising a DNA nanostructure (DN) functionalized with an endolysosomal escape peptide to enhance the delivery of a therapeutic agent to a subject. DESCRIPTION OF THE DRAWINGS The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. FIG. 1A–E show electrostatic coating strategies for in vivo DNA nanostructure stabilization. FIG. 1A shows a schematic of PEGylated oligolysine coating and subsequent crosslinking by glutaraldehyde. FIG. 1B shows a lock copolymer protection strategy. DNA origami is degraded in the absence of polymer but protected from nucleases after polymer complexation. Decomplexation is made possible via competition with dextran sulfate. FIG.1C shows a schematic view of the two types of peptoid surface coatings of octahedral DNA origami (brush-type and block-type) and their chemical structures. FIG.1D shows lipid micellization of an octahedral DN with lipid-conjugated DNA handles in a solution of surfactant and lipids (liposomes, DOPC, and PEG-PE). FIG. 1E shows a schematic of BSA conjugated to a synthetic binding domain (G2) and its dendritic chemical structure. FIG. 2 shows a schematic depicting the general steps of Fmoc solid-phase peptide synthesis (SPPS). Deprotection, activation, and coupling occur in an iterative fashion until the full-length peptide is synthesized, at which point the peptide is cleaved from the resin. FIG.3A–D show schematics of common bio-orthogonal conjugation techniques. FIG.3A shows a copper-catalyzed strain-promoted azide / alkyne cycloaddition (CuAAC). FIG.3B shows a strain-promoted azide / alkyne cycloaddition (SPAAC). FIG.3C shows a N-hydroxysuccinimide (NHS) ester / amine reaction. FIG.3D shows a maleimide / thiol “click” reaction. FIG.4A–C show the design and coating of a DNA 6-helix bundle (6HB). FIG.4A shows a strand diagram showing the six oligonucleotides that comprise the six-helix bundle (6HB) DN. FIG. 4B shows schematics of two peptides used for coating DNs: a decalysine (“K10”) peptide and K10 flanked by two copies of the aurein 1.2 endolysosomal escape (“aurein” or “EE”) peptide. FIG.4C shows schematics of the DNs coated with either the K10 peptide (top) or an 80:20 mixture of EE / K10 (bottom). FIG.5 shows a schematic of the intracellular fate of coated 6-helix bundles (6HB) coated with K10-EE peptides and the cellular internalization pathways taken under differing cell culture conditions. FIG.6A–D show a general scheme for the coating, design, and synthesis of K10-PEG1K- EE. FIG.6A shows a representative example of an origami structure with an mRNA scaffold and DNA staples. FIG.6B shows two proposed synthetic routes to the production of the K10-PEG1K- EE bioconjugate. FIG.6C–D show chemical structures and graphical illustrations of K10-(PEG1K- EE)2(FIG.6C) and K10-EE (FIG.6D). FIG.7A–G show a summary of bioconjugation reactions. FIG.7A shows a diagram of a SPAAC reaction scheme to produce K10-PEG1K-Mal diblock polymer. FIG.7B shows a schematic depicting two attempted methods of K10-DBCO production: (1) NHS ester-Lys bioconjugation and (2) SPPS attachment of HO2C-DBCO. FIG.7C shows a representative MALDI-TOF MS of the reaction mixture from FIG.7A. Peak regions corresponding to unreacted, degraded K10(1679 Da) and K10-DBCO (~1950 Da) are boxed. Region corresponding to unreacted polydisperse PEG monomer is boxed (~1050 Da). Region in which product peaks are missing (~3000 Da) is boxed. FIG.7D shows a diagram of a CuAAC reaction scheme to produce K10-PEG1K-maleimide diblock polymer. FIG.7E shows a representative MALDI-TOF MS of the reaction mixture from FIG.7D. Regions corresponding to unreacted polydisperse PEG monomer are boxed (~1000 and 2000 Da). Region in which product peaks are missing is boxed (~2650 Da). FIG.7F shows a diagram of a thiol-maleimide click reaction scheme to produce N3-PEG1K-EE. FIG. 7G shows a representative MALDI-TOF MS of the reaction mixture from FIG.7F. Region corresponding to unreacted polydisperse PEG monomer is boxed (~1000 and 2000 Da). Peak corresponding to unreacted EE-Cys peptide is boxed (~1843 Da). Region in which product peaks are missing is boxed (~2800 Da). All MS data were collected using a Bruker Microflex LRF MALDI-TOF mass spectrometer in reflector positive mode, with the exception of FIG.7E, collected in linear positive mode. FIG. 8A–C show SPPS production of K10-PEGNK-EE. FIG. 8A shows the chemical structure of K10-PEGNK-EE synthesized by SPPS. FIG. 8B shows an illustration of the Fmoc- based SPPS route utilized to produce K10-PEG1K-EE. FIG. 8C shows a mass spectrum of successfully synthesized, pure K10-PEG1K-EE and K10-PEG2K-EE. FIG. 9A–E show DNA barrel origami coating and stability. FIG. 9A shows agarose gel electrophoresis (AGE) depicting fully annealed DNA barrel origami before and after purification. FIG. 9B shows a TEM image of an annealed origami structure. Inset shows the design and dimensions of the barrel structure. FIG.9C shows AGE depicting a barrel coated with pure K10- PEG1K-EE at various nitrogen:phosphate (N:P) ratios. FIG. 9D shows AGE of coated barrel origami after 0.5, 1, and 2 h of incubation with DNaseI. FIG.9E shows AGE of a comparison with K10-EE and K10-PEG5Kafter 1 h incubation with DNaseI. FIG.10A–C show mRNA-decorated DNA origami for GFP expression. FIG.10A shows a coated DNA origami-enabled mRNA delivery vehicle diagram. FIG. 10B shows a square block DNA origami (SQB) design GFP-expressing mRNA strand attachment scheme. FIG.10C shows transfection of RAW 264.7 and THP-1 cells by unstructured GFP mRNA linked to DNA-origami leader domain versus lipofectamine control. Bar graphs show percentage of cells exhibiting GFP fluorescence after transfection with SQB-mRNA coated with K10-EE for endosomal escape. This was investigated in various media with different concentrations of serum, which has been shown to inhibit peptide-conferred endosomal escape: DMEM, DMEM + 10% FBS, Opti-MEM reduced serum (5% FBS), Opti-MEM reduced serum with half-dose DNA origami. The right-hand two conditions are with peptide-free controls, instead of complexing with lipofectamine, either SQB- mRNA or else mRNA only. FIG. 11A–G show square block origami (SQB) featuring oligo-EE “patches” and K10- PEG1K-EE coating for mRNA Expression. FIG. 11A shows a conjugation reaction scheme for DNA-DBCO and DNA-peptide. FIG. 11B–E show mass spectra of PLC-purified DNA-EE conjugate variation (N)EE-5′DNA (FIG.11B); (C)EE-5′DNA (FIG.11C); (N)EE-3′DNA (FIG.11D), and (C)EE-3′DNA (FIG. 11E). FIG. 11F shows GFP expression of mRNA-SQB coated using various strategies and FIG.11G shows corresponding confocal microscope images. FIG.12A–E show characterization of K10-(EK)5. FIG.12A shows a diagram of K10-(EK)5, synthesized by SPPS. FIG.12B shows the chemical structure of K10-(EK)5. FIG.12C shows a mass spectrum depicting the correct mass (2699 Da) for K10-(EK)5. FIG.12D shows a TEM image of K10-(EK)5-coated DNA barrel origami (N:P = 1). FIG.12E shows an agarose electrophoresis image of K10-(EK)5-coated DNA barrel origami after 1 h and 20 h under different physiological buffer conditions and incubation at 37 °C. FIG. 13A–D show antibody-oligonucleotide conjugation. FIG. 13A shows the reaction scheme and conditions for antibody-DNA conjugation. Not drawn to scale. FIG.13B shows SDS- PAGE images depicting stain-free protein. FIG. 13C shows TAMRA fluorescence of antibody- DNA conjugates and precursors. FIG.13D shows TEM micrographs of antibody-decorated DNA barrel structures. Insets show a zoomed in view of single barrel-Ab structures. White arrows indicate antibody position. FIG.14A–D show square block origami featuring varying ratios of K10, K10-EE, and K10- PEG1K-EE coatings for mRNA Expression. FIG. 14A shows the protocol for coating a single DNA origami sample with multiple molecules. FIG.14B shows GFP expression of mRNA-SQB coated with various ratios of K10-EE to K10-PEG5K. FIG.14C shows GFP expression of mRNA- SQB coated with various ratios of K10-EE, K10-PEG5K-EE, and K10-PEG5K. FIG.14D shows corresponding confocal microscope images. DETAILED DESCRIPTION Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For example, any nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein are well known and commonly used in the art. In case of conflict, the present disclosure, including definitions, will control. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the embodiments and aspects described herein. As used herein, the terms “amino acid,” “nucleotide,” “nucleic acid,” “ribonucleic acid,” “deoxyribonucleic acid,” “polynucleotide,” “vector,” “polypeptide,” and “protein” have their common meanings as would be understood by a biochemist of ordinary skill in the art. Standard single letter nucleotides (A, C, G, T, U) and standard single letter amino acids (A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, or Y) are used herein. Nucleic acids may be single stranded or double stranded or may contain portions of both double stranded and single stranded sequence. The nucleic acid may be DNA, both genomic and cDNA, RNA, or a hybrid thereof, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine. Nucleic acids may be obtained by chemical synthesis methods or by recombinant methods. As used herein, “variants” can include, but are not limited to, those that include conservative amino acid (AA) substitutions, SNP variants, degenerate variants, and biologically active portions of a gene or nucleotide. A “degenerate variant” as used herein refers to a variant that has a mutated nucleotide sequence, but still encodes the same polypeptide due to the redundancy of the genetic code. There are 20 naturally occurring amino acids; however, some of these share similar characteristics. For example, leucine and isoleucine are both aliphatic, branched, and hydrophobic. Similarly, aspartic acid and glutamic acid are both small and negatively charged. Conservative substitutions in proteins often have a smaller effect on function than non-conservative mutations. Although there are many ways to classify amino acids, they are often sorted into six main groups on the basis of their structure and the general chemical characteristics of their R groups. A mutation among the same class of amino acids is considered a conservative amino acid substitution. The term “functional” when used in conjunction with “variant” or “fragment” refers to an entity or molecule which possess a biological activity that is substantially similar to a biological activity of the entity or molecule of which it is a variant or fragment thereof. In accordance with the present disclosure, a nucleotide or peptide described herein may be modified, for example, to facilitate or improve identification, activity, expression, isolation, storage and / or administration, so long as such modifications do not reduce the function of the nucleotide or peptide to an unacceptable level. As used herein, “substantial identity” of polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 25% sequence identity compared to a reference sequence as determined using programs known in the art (e.g., Basic Local Alignment Search Tool (BLAST)). In preferred embodiments, percent identity can be any integer from 25% to 100%. More preferred embodiments include polynucleotide sequences that have at least about: 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to a reference sequence. These values can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning, and the like. Accordingly, polynucleotides of the present disclosure encoding a protein or polypeptide of the present disclosure include nucleic acid sequences that have substantial identity to the nucleic acid sequences that encode the proteins or polypeptides of the present disclosure. Polynucleotides encoding a polypeptide comprising an amino acid sequence that has at least about: 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to a reference polypeptide sequence are also preferred. As used herein, “substantial identity” of amino acid sequences (and of peptides or polypeptides having these amino acid sequences) means that an amino acid sequence comprises a sequence that has at least 25% sequence identity compared to a reference sequence as determined using programs known in the art (e.g., BLAST). In preferred embodiments, percent identity can be any integer from 25% to 100%. More preferred embodiments include amino acid or polypeptide sequences that have at least about: 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity compared to a reference sequence. Polypeptides that are “substantially identical” share amino acid sequences except that residue positions which are not identical may differ by one or more conservative amino acid changes. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine. Exemplary conservative amino acid substitution groups include valine-leucine-isoleucine, phenylalanine-tyrosine, lysine- arginine, alanine-valine, aspartic acid-glutamic acid, and asparagine-glutamine. Accordingly, peptides, polypeptides, or proteins, encoded by the polynucleotides of the present disclosure, include amino acid sequences that have substantial identity to the amino acid sequences of the reference polypeptide sequences. As used herein, the terms such as “include,” “including,” “contain,” “containing,” “having,” and the like mean “comprising.” The present disclosure also contemplates other embodiments “comprising,” “consisting of,” and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not. As used herein, the term “a,” “an,” “the” and similar terms used in the context of the disclosure (especially in the context of the claims) are to be construed to cover both the singular and plural unless otherwise indicated herein or clearly contradicted by the context. In addition, “a,” “an,” or “the” means “one or more” unless otherwise specified. As used herein, the term “or” can be conjunctive or disjunctive. As used herein, the term “and / or” refers to both the conjunctive and disjunctive. As used herein, the term “substantially” means to a great or significant extent, but not completely. As used herein, the term “about” or “approximately” as applied to one or more values of interest, refers to a value that is similar to a stated reference value, or within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, such as the limitations of the measurement system. In one aspect, the term “about” refers to any values, including both integers and fractional components that are within a variation of up to ± 10% of the value modified by the term “about.” Alternatively, “about” can mean within 3 or more standard deviations, per the practice in the art. Alternatively, such as with respect to biological systems or processes, the term “about” can mean within an order of magnitude, in some embodiments within 5-fold, and in some embodiments within 2-fold, of a value. As used herein, the symbol “~” means “about” or “approximately.” All ranges disclosed herein include both end points as discrete values as well as all integers and fractions specified within the range. For example, a range of 0.1–2.0 includes 0.1, 0.2, 0.3, 0.4 . . . 2.0. If the end points are modified by the term “about,” the range specified is expanded by a variation of up to ±10% of any value within the range or within 3 or more standard deviations, including the end points. As used herein, the terms “active ingredient” or “active pharmaceutical ingredient” refer to a pharmaceutical agent, active ingredient, compound, or substance, compositions, or mixtures thereof, that provide a pharmacological, often beneficial, effect. As used herein, the terms “control,” or “reference” are used herein interchangeably. A “reference” or “control” level may be a predetermined value or range, which is employed as a baseline or benchmark against which to assess a measured result. “Control” also refers to control experiments or control cells. As used herein, the term “dose” denotes any form of an active ingredient formulation or composition, including cells, that contains an amount sufficient to initiate or produce a therapeutic effect with at least one or more administrations. “Formulation” and “composition” are used interchangeably herein. As used herein, the term “prophylaxis” refers to preventing or reducing the progression of a disorder, either to a statistically significant degree or to a degree detectable by a person of ordinary skill in the art. As used herein, the terms “effective amount” or “therapeutically effective amount,” refers to a substantially non-toxic, but sufficient amount of an action, agent, composition, or cell(s) being administered to a subject that will prevent, treat, or ameliorate to some extent one or more of the symptoms of the disease or condition being experienced or that the subject is susceptible to contracting. The result can be the reduction or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. An effective amount may be based on factors individual to each subject, including, but not limited to, the subject’s age, size, type or extent of disease, stage of the disease, route of administration, the type or extent of supplemental therapy used, ongoing disease process, and type of treatment desired. As used herein, the term “subject” refers to an animal. Typically, the subject is a mammal. A subject also refers to primates (e.g., humans, male or female; infant, adolescent, or adult), non- human primates, rats, mice, rabbits, pigs, cows, sheep, goats, horses, dogs, cats, fish, birds, and the like. In one embodiment, the subject is a primate. In one embodiment, the subject is a human. As used herein, a subject is “in need of treatment” if such subject would benefit biologically, medically, or in quality of life from such treatment. A subject in need of treatment does not necessarily present symptoms, particular in the case of preventative or prophylaxis treatments. As used herein, the terms “inhibit,” “inhibition,” or “inhibiting” refer to the reduction or suppression of a given biological process, condition, symptom, disorder, or disease, or a significant decrease in the baseline activity of a biological activity or process. As used herein, “treatment” or “treating” refers to prophylaxis of, preventing, suppressing, repressing, reversing, alleviating, ameliorating, or inhibiting the progress of biological process including a disorder or disease, or completely eliminating a disease. A treatment may be either performed in an acute or chronic way. The term “treatment” also refers to reducing the severity of a disease or symptoms associated with such disease prior to affliction with the disease. “Repressing” or “ameliorating” a disease, disorder, or the symptoms thereof involves administering a cell, composition, or compound described herein to a subject after clinical appearance of such disease, disorder, or its symptoms. “Prophylaxis of” or “preventing” a disease, disorder, or the symptoms thereof involves administering a cell, composition, or compound described herein to a subject prior to onset of the disease, disorder, or the symptoms thereof. “Suppressing” a disease or disorder involves administering a cell, composition, or compound described herein to a subject after induction of the disease or disorder thereof but before its clinical appearance or symptoms thereof have manifest. As used herein, “administration” or “administering” refers to providing, contacting, and / or delivery of an action, agent, composition, or cell(s) by any appropriate route to achieve a desired effect. In some embodiments, the term “administering” may also refer to the placement of a compound or a composition as disclosed herein into a subject by a method or route that results in at least partial localization of the compound or composition at a desired site in the subject. Administration may include, but is not limited to, oral, sublingual, parenteral (e.g., intravenous, intracardiac, infusion (e.g., cardiac catheter infusion), subcutaneous, intracutaneous, intramuscular, intraarticular, intraarterial, intrasynovial, intrasternal, intrathecal, intralesional or intracranial injection), enteral, transdermal, topical, buccal, rectal, vaginal, nasal, ophthalmic, via inhalation, and implants. Via the parenteral route, the compound or composition may be in the form of solutions or suspensions for infusion or injection, or as lyophilized powders. Via the enteral route, the compound or composition may be in the form of capsules, gel capsules, tablets, sugar-coated tablets, syrups, suspensions, solutions, powders, granules, emulsions, or microspheres, nanospheres, lipid vesicles, or polymer vesicles allowing for controlled release. Via the topical route, the compound or composition may be in the form of an aerosol, spray, powder, lotion, cream, paste, gel, ointment, oil, suspensions, solutions, or emulsions. Physiological Stability of DNA Nanostructures Some structures, such as the DNA tetrahedro, have been shown to be stable under cell culture conditions without any stabilizers, making them a favorable and often-implemented design for intracellular studies with DNs. This stability may be due to the lower-density packing of DNA helices, in concert with the relatively short length of the tetrahedral edges, which limits the available space for nuclease binding. The simple geometry and small size of DNA tetrahedrons, however, limit their capacity for multi-functionalization and internal cargo loading, necessitating methods to be developed for structural stabilization of alternative DN architectures. Recent reports further demonstrate that more complex wireframe structures can also be stable at physiological salt concentrations, although the enzymatic stability of these structures was not probed. Notably, it has been reported that an origami nanostructure made solely of a single strand of RNA is resistant to RNase I digestion and remains stable after overnight incubation in mouse serum, which was attributed to the compact nature of the structure as well as the lack of internal nick positions that are characteristic of traditional DNA origami fabrication methods. Methods for DNA Nanostructure Protection The protection of nucleic acids in biological contexts is not a challenge unique to DNA nanotechnology. In fact, the biomedical field has long been developing methods of the intracellular delivery of nucleic acids. The administration of nucleic acid vaccines and gene therapies utilize both physical methods and particulate formulations to overcome the challenges associated with their cellular delivery. Physical methods, including direct injection, gas decompression, sonoporation, and electroporation, are nonspecific procedures that generate mostly localized effects. Conversely, particle-based systems, such as viral vectors, virus-like particles, conjugation to metal nanoparticles, micellization in polymers and lipids, and cell penetrating peptide (CPP) modification, offer a more targeted approach. Many methods for DN protection and delivery take inspiration from these established approaches designed for unstructured nucleic acids (i.e., nucleic acids whose structures are not user-defined). Cationic Polymers Therapeutically oriented DN research has developed several approaches to address the challenge of DN stability in denaturing or enzymatic hydrolyzing environments. Cationic block copolymers were synthesized to electrostatically adhere to and encase DNA origami structures. These polymer-coated DNs exhibited very limited cell toxicity after nine hours of incubation with A549 human epithelial cells. Furthermore, luciferase proteins encapsulated by DNs demonstrated limited enzyme activity when coated compared to their bare counterparts due to the restriction of substrate accessibility. The extent of substrate inaccessibility was dependent upon polymer structure, suggesting that these coatings may serve future applications in tuning enzymatic reaction rates in addition to providing physiological stability. Notably, previous studies have demonstrated that electrostatic coating of DNs with a PEGylated oligolysine decamer (K10-PEG5K) affords an approximate 400-fold increase in DN half- life (~36 h) in 10% FBS and retains DN structural integrity in as low as 0.6 mM Mg2+. The positively charged K10effectively replaced magnesium to stabilize the structures, and the PEG polymers blocked nuclease accessibility to the surface, reducing degradation rates. Additionally, it was demonstrated that the K10-PEG5Kcoating did not hinder accessibility to single-stranded (ss)DNA handles on the DN, suggesting that these structures can still be decorated with surface features if needed. The coated structures also showed a 5-fold greater half-life in vivo in murine models compared to the uncoated structures, likely due to their increased resistance to nuclease degradation and denaturation. Even greater stability (>48 h of incubation with DNase I) was achieved in a follow-up investigation in which oligolysine amines were covalently cross-linked with glutaraldehyde after adherence to DNs, which was hypothesized to decrease mobility and / or dissociation of the coating (FIG.1A). It was also shown that this crosslinked coating is internalized into cells more readily than its non-crosslinked counterpart. A comparable cationic PEG- polylysine polymeric coating molecule was shown to have similar protective benefits when incubated with 10% FBS, DNase I, or in low salt concentrations (namely, 20 mM NaCl and an absence of Mg2+). Importantly, this study illustrated that the coating can be removed from DNs via competitive complexation of polyanionic dextran sulfate (FIG.1B). Molecular dynamics simulations of a non-PEGylated oligolysine decamer (K10) interacting with a DNA origami rectangle showed that the peptide binds nonspecifically and reversibly to the structure, stabilizing it by binding across adjacent helices with its flexible cationic side chains. One additional finding to consider in future electrostatic coating studies is that K10binding also causes a slight decrease in aspect ratio and change in DN conformation— albeit to a lesser extent than common DNA-stabilizing cations Mg2+and Na+. An investigation using cryo-electron microscopy (cryo-EM) demonstrated a similar phenomenon in which coating with either K10or K10-PEG5Keach induced DN structural deformations such as twisting and bending. Moreover, cryo-EM showed that coated structures under physiological ionic strength shrunk in the helical direction and expanded in the direction perpendicular to the helical axis. In sum, the results of this investigation largely validated oligolysine as a powerful tool for the stabilization of DNA nanostructures, but also revealed several coating artifacts to consider when working with these molecules. Although a highly promising method, the nonspecific binding mechanism of oligolysine also hampers the ability to modulate site-specificity or density of the coating. Additionally, this peptide-based coating may be susceptible to protease activity, a concern that was not addressed in these investigations. Employing polycationic peptoid molecules for DN protection may offer a solution to the issue of protease degradation for peptide-based coatings. Peptoids are peptidomimetic N- substituted glycine oligomers that offer many of the same benefits as peptides, including biocompatibility, low-cost synthesis, and high chemical addressability, but without susceptibility to proteases. A series of PEGylated peptoid molecules were designed and tested for their ability to protect octahedral DNs from biological adversaries. In this work, peptoids with two different binding modes were designed: brush-type and block-type. Brush-type peptoids exhibited alternating amine (Nae) and PEG (Nte) side chains and bound to DNs with the full backbone against the DN structure. The block-type peptoids were designed with Nae and Nte clustered into blocks of repeating units that resulted in binding of the Nae end of the chain to the DNs while the Nte end protruded out and away from the structure (FIG.1C). It was determined that brush-type peptoids exhibited the greatest DN protection against physiological conditions, including 1.25 mM MgCl2or the presence of DNase I or 10% FBS over 24 hours. Furthermore, peptoid-coated DNs conferred a 26% increase in protection of their encapsulated protein cargo when incubated with trypsin compared to uncoated DN encapsulation, demonstrating that these modifications can serve purposes beyond protection of the scaffold alone. The chemical versatility of the peptoid coating was also demonstrated by functionalizing them with various moieties, including peptides and antibodies, via click chemistry. This study showed that peptoid-coated DNs may serve as a multifunctional platform for biological applications. Lipid and Protein-Based Coatings Although cationic polymers present a promising solution to the issue of DN stability, other methods have shown similar potential. Previous studies, for example, have developed a method of lipid micellization of DNA nanostructures by utilizing lipid-DNA conjugates that anneal to external DNA handles on the structure in a surfactant solution (FIG. 1E). The virus-inspired encapsulation strategy resulted in up to 85% of the encapsulated DNs being protected from DNase I digestion over 24 hours. Furthermore, immune activation against the micellized DNs was decreased by two orders of magnitude compared with controls, as measured by inflammatory cytokine secretion and uptake into splenocytes. Additionally, lipid micellization was shown to significantly increase the biodistribution and pharmacokinetic half-life of DNs in murine models. Though this encapsulation strategy was not explicitly tested for efficacy of DN protection in low- salt conditions, their behavior in murine models suggests that the nanostructures were not denatured at physiological salt concentrations. Another concern regarding the use of DNA nanostructures as intracellular delivery vehicles is their transfection efficiency. A protein-based coating was designed to enhance DN transfection and biological stability by chemically modifying bovine serum albumin (BSA) with a cationic dendrimer to enable nonspecific DNA binding (FIG.1D). This coating not only yielded a 2.5-fold enhancement of transfection into human embryonic kidney (HEK293) cells, but it notably reduced the levels of inflammatory cytokine secretion by primary mouse splenocytes. Another interesting observation is that the BSA-coated structures seemed to exhibit enhanced endosome escape capabilities compared to the uncoated structures, a useful attribute if cytosolic delivery of DN therapeutic cargo is required. Hybrid Biomaterials for Drug Delivery Hybrid biomaterials take inspiration from nature, often composed of synthetic materials coupled to bioactive motifs or composed of different types of biomolecules synthetically linked together. The hybrid design of these materials permits considerable chemical versatility and enhanced biofunction that could not be achieved by one type of material alone. In addition, the flexibility of their design allows for tuning physical, mechanical, and biological properties. Due to their versatility and biological compatibility and functionality, hybrid biomaterials are powerful tools for the design of drug delivery platforms. Many variations of these materials have been constructed to facilitate self-assembly, mitigate toxicity and off-target effects, and to enhance water solubility, specificity, cargo protection, and pharmacokinetics of delivery platforms. Peptides are a common and easily synthesized component of hybrid biomaterials. The 20 canonical amino acid monomers that make up these biological polymers offer excellent chemical and structural variety of the material. Peptides also play a large role in many biological processes which are determined by their amino acid sequence and composition. Examples of the widespread biological functions of peptides include cell penetration, innate immune modulation, tissue targeting, antimicrobial, antioxidative, antihypertension, mineral binding, and more. Because of this, they are useful tools for imparting function to many kinds of therapeutics. Additionally, the facile incorporation of noncanonical amino acids confers additional chemical motifs for conjugation with other materials, such as DNA, proteins, or other synthetic biostable polymers, that can help modulate the function, pharmacokinetics, or safety of a therapeutic. Bioactive Peptides and Their Synthesis Another benefit of peptide components in hybrid biomaterials is their facile production. Many methods exist for the manufacture of peptides composed of both canonical and nonconical amino acids, and in both linear and cyclical forms. In some embodiments described herein, peptides are manufactured via solid-phase peptide synthesis (SPPS), as depicted in FIG.2. In SPPS, the peptide backbone is anchored onto an insoluble polymeric support resin to facilitate the C- to N-terminal stepwise addition of amino acids. The resin enables a physical separation of the product from the reaction mixture without the need for cumbersome purifications after each synthetic step. Synthesis begins with the piperidine deprotection of base-labile 9- fluorenylmethoxycarbonyl (Fmoc) protected rink amide resin, resulting in a reactive amide group for carbodiimide-mediated coupling with the first amino acid in the sequence. Amino acid coupling refers to the formation of a peptide bond between the amine group of the growing peptide chain to the carboxy group of the next amino acid in the sequence. The coupling reagent employed for peptide synthesis in this research, N,N′-diisopropylcarbodiimide (DIC), is used in conjunction with the additive ethyl cyanohydroxyiminoacetate (oxyma), which suppresses product racemization and accelerates coupling. After coupling with an amino acid that is Fmoc- and side chain- protected, the resultant N-terminal Fmoc on the elongating chain is again deprotected to allow the addition of the next amino acid. Once the full-length sequence has been synthesized, a 95% solution of trifluoroacetic acid is used to simultaneously cleave the peptide from the resin and remove acid-labile protecting groups on amino acid residues. Peptides are then precipitated in cold diethyl ether, resuspended, and purified by reverse-phase (RP)-HPLC. Bioconjugation Techniques Covalent linkage of two or more biomolecules, or bioconjugation, is a widely used technique in biomedicine. Methods for the site-specific alteration of proteins, DNA, RNA, and carbohydrates have been developed for applications in therapeutics, diagnostics, and high- throughput screening, to name a few. The development of these chemoselective conjugations under mild conditions has enabled their use in physiological buffers and temperatures— a critical advancement towards their widespread use. A variety of techniques have been employed to both directly functionalize DNs and to create new electrostatic coating molecules to enable their physiological protection. Copper-Catalyzed Azide / Alkyne Cycloaddition (CuAAC) Copper-catalyzed azide / alkyne cycloaddition (CuAAC), also known as “copper click” chemistry, has the ability to react two molecular building blocks together quickly, efficiently, and selectively under a variety of solvent conditions. In CuAAC, Cu(I) is used as a catalyst to perform a Diels-Alder cycloaddition between an azide and terminal alkyne that selectively produces a stable 1,4-disubstituted triazole (FIG. 3A). The solvent for this reaction can, remarkably, be aqueous or organic, making this a suitable method for both biochemical conjugation and organic synthesis. Cupric salts, such as Cu2SO4, are often used as the source of copper, but must be reduced to form the Cu(I) species; one commonly used reducing agent for this purpose is sodium ascorbate. Additionally, ligands are often used to accelerate the reaction rate. Water soluble tris- hydroxypropyltriazolylmethylamine (THPTA) in varying ratios is a popular accelerating ligand which protects biomolecules from hydrolysis by Cu(II) byproducts and intercepts oxidants formed by O2 / Cu / ascorbate that react with amino acid residues such as histidine. In cases when side reactions between dehydroascorbate and protein side chains (primarily arginine) must be avoided, aminoguanidine is also added to the CuAAC reactions. Although these reactions are selective and produce a high product yield, the complexity incurred by the use of the copper catalyst inspired alternative routes to producing triazole-linked “click” conjugates. Strain-Promoted Azide / Alkyne Cycloaddition (SPAAC) Strain-promoted azide / alkyne cycloaddition (SPAAC), also known as “copper-free click” chemistry is a Diels-Alder reaction that relies on the use of strained cyclooctynes to mitigate the need for a copper catalyst (FIG.3B). SPAAC can be a preferential to CuAAC for bioconjugation because it does not involve biologically toxic Cu(I) species and does not require additives to prevent unwanted byproducts. SPAAC is an especially attractive route due to its simplicity, selectivity, and ability to be carried out under the aqueous physiological conditions required by most biomolecules. In addition, the triazole-linked product between organic azide and cyclooctyne-functionalized biomolecules is highly stable. Amine-Reactive Crosslinkers: NHS Esters N-hydroxysuccinimide (NHS) esters are popular amine-specific functional groups used for bioconjugation reactions with proteins (FIG.3C). These protein-modifying reagents are typically used to conjugate biomolecules or labelling dyes to lysine residues on protein surfaces. NHS ester-activated crosslinkers (and the more water-soluble sulfonated derivatives) are convenient for a variety of bioconjugation schemes due to their optimal reactivity at a physiological pH range and the ubiquitous commercial availability of NHS ester reagents. Thiol-Maleimide “Click” The thiol-maleimide click reaction, also known as the thiol-Michael addition, has similar attributes to traditional azide / alkyne click chemistry, including fast reaction rates, near-neutral pH requirements, minimal reactivity with other functional groups, and the potential for achieving near- quantitative yields. This simple, rapid reaction between a thiol and maleimide functional group produces a thiosuccinimide product and serves as the most popular method for site-selective modification of cysteines on proteins of interest (FIG.3D). However, it should be noted that the imido groups of maleimides are susceptible to spontaneous hydrolysis, resulting in undesirable heterogeneity. Oligolysine-Based Polymers for DN Protection and Endosomal Escape A goal was to modify oligolysine to impart both stability and an additional functionality: cytosolic delivery. Unmodified DNs become trapped in endolysosomal compartments when taken up by cells in vitro, greatly limiting their use as delivery vehicles, since many therapeutics require delivery to the cytosol to be effective. One way to circumvent this issue is by using cell penetrating peptides (CPPs). Typically derived from viruses, bacteria, insects, or computational algorithms, CPPs generally contain less than 20 amino acids and carry a net positive charge to mediate direct internalization across cell membranes. They have become widely used for the delivery of therapeutics and in the formulation of transfection agents. CPP examples include TAT, gp41, SP, penetratin, and Aurein 1.2, to name a few. Aurein 1.2 is a 13-amino acid alpha helical, antimicrobial peptide known to be a potent facilitator of cytosolic delivery by disintegrating the endosomal membrane in a detergent-like manner, termed the “carpet mechanism.” To enhance cytosolic delivery of DNs, a small six-helix bundle was designed (“6HB-DN,” FIG.4A) and coated with a K10peptide that featured the Aurein 1.2 (“EE,” for endosomal escape) sequence on both its N- and C-termini (FIG.4B–C). It was demonstrated that 6HB-DNs coated with K10-EE peptides successfully exit endosomal compartments in hepatic cell lines when administered under serum-free conditions. However, under serum-containing conditions, endosomal escape was inhibited due to the formation of a protein corona that obstructs EE peptide function (FIG.5). The formation of a protein corona, or protein adsorption layer, around nanomaterials when suspended in biological fluids is known. Because coronae can alter the biological effects of nanoparticles, their existence provides a complex challenge for nanoparticle therapeutics. To further complicate the issue, the biological effects, size, and composition of a protein corona can vary depending on factors such as host disease state, genetics, and environment, as well as nanoparticle tissue location, cellular trafficking mechanisms, circulation time, and other conditions. To mitigate the formation of a protein corona onto coated DNs, an alternative oligolysine-based coating for endosomal escape, termed K10-PEG-EE, was designed and synthesized in serum-containing cell media. As described herein, the modification to previous K10-EE designs is the poly(ethylene glycol) (PEG) moiety incorporated between the oligolysine and EE sequences (refer to FIG.6 for an overview of the coating process and proposed molecular design). PEGylation is a widely used strategy in nanoparticle and therapeutic formulations. PEG can be utilized for its ability to increase water solubility, decrease nonspecific protein binding (e.g., protein corona formation), reduce immunogenicity and toxicity, shield cargo from enzymatic degradation, and modify the pharmacodynamics of therapeutics. PEGylated K10has demonstrated DN protection from nuclease degradation, a feature not observed when using K10alone. It is hypothesized that the smaller, more compact nature of the 6-helix bundle nanostructure is already less prone to enzymatic degradation than more large, open structures, contributing to their apparent stability even without the PEG moiety in the coating. Additionally, the brush-like EE portion of the coating molecule may further decrease nuclease accessibility to the DNA helices. Furthermore, additional work with larger DNA origami structures coated with K10or K10-EE shows that they have limited solubility and enhanced aggregation compared to those coated with K10-PEG5K. The inclusion of PEG between the K10and EE sequences, therefore, was hypothesized to further protect DNs from nuclease degradation, enhance the water solubility of the coated structures, and discourage protein corona formation, all while evading confinement to endolysosomal compartments. Synthesis and Characterization of K10-PEG1K-EE The premise of the original decalysine design and the process by which it adheres to DNs remains unchanged. FIG.6A illustrates the workflow for nanostructure coating. First, the nucleic acid structure is assembled in its native annealing buffer. Then, it is mixed with an oligolysine variant at a defined ratio of positive charges (nitrogen (N) from the amines on lysine residues) and negative charges (phosphates (P) on DNA backbones), deemed the N:P ratio. A non-limiting exemplary structure analogous to a PEG-modified version of K10-EE would include two copies of each PEG and EE, as depicted in FIG.6C–D. Due to the large size of these molecules, the first attempt at creating this peptide-PEG-peptide polymer includes only one copy of PEG-EE on the C-terminus of the K10sequence. A one kilodalton PEG unit was chosen in part due to its more manageable size for synthesis compared to a five kilodalton PEG, but also because there is precedent for a K10-PEG1Ksufficiently protecting DNA origami in cellular experiments and even promoting greater internalization than K10-PEG5K. Two general synthetic routes were developed for producing K10-PEG1K-EE. The first method was to generate the entire molecule on-resin using Fmoc-based SPPS, in which Fmoc- PEG1K-COOH would be used to couple PEG to the growing amino acid chain in the same manner as normal amino acid coupling. Initial attempts to produce the product with this method failed but were later revisited. The second proposed route was to conjugate the individual components together (K10, PEG, and EE) using heterobifunctional linkers for site-specific attachment (FIG. 6B). The synthesis strategies for generating the disclosed K10-PEG-EE molecules via the bioconjugation routes are described herein. Table 1. Sequences of the DNA strands that make up the 6-helix bundle DN. Name DNA Sequence (5′→3′) SEQ ID NO 6HB-BlueAGCGAACGTGGATTTTGTCCGACATCGGCAAGCTCCCTTTTTCGACTATT 16HB-GreenCCGATGTCGGACTTTTACACGATCTTCGCCTGCTGGGTTTTGGGAGCTTG 26HB-YellowCGAAGATCGTGTTTTTCCACAGTTGATTGCCCTTCACTTTTCCCAGCAGG 3 6HB-OrangeAATCAACTGTGGTTTTTCTCACTGGTGATTAGAATGCTTTTGTGAAGGGC 4 6HB-RedTCACCAGTGAGATTTTTGTCGTACCAGGTGCATGGATTTTTGCATTCTAA 56HB-PurpleCCTGGTACGACATTTTTCCACGTTCGCTAATAGTCGATTTTATCCATGCA-Alexa Fluor 488 6Abbreviations: Alexa Fluor 488 – Alexa Fluor™ 488 dye Table 2. Peptides with their expected masses. Name Amino Acid SequenceExpectedSEQ MassID NOK10KKKKKKKKKKK10-Pr(A)KKKKKKKKKKGSG-Pr(A) K10-DBCO (NHS)KKKKKKKKKKGSG-K-DBCO2266 9K10-DBCO (SPPS)KKKKKKKKKKGSG-DBCO1808 10EE-CysCGGGLFDIIKKIAESF1784 11K10-FITCFluorescein-GSGKKKKKKKKKK1858 12K10-K(Mtt)KKKKKKKKKKGSG-K(Mtt)1628 13K10-EEGLFDIIKKIAESFGGKKKKKKKKKKGGFSEAIKKIIDFLG4452 14K10-EE scrambleIKAFKGFDESILIGGKKKKKKKKKKGGILISEDFGKFAKI4452 15Aurein 1.2 Endosomal EscapeGLFDIIKKIAESF1480 16Peptide (EE)(N)-(Az)K-EEAz(K)-GGGLFDIIKKIAESF1746 17(C)-(Az)K-EEGLFDIIKKIAESFGG-Az(K)1746 18EE-Az(K)-EEIKAFKGFDESILIGG-Az(K)-GGILISEDFGKFAKI3326 19K10-(EK)5KKKKKKKKKKEKEKEKEKEK2699 20K10-PEG1K-EEKKKKKKKKKKGSG-(PEG12) -GSGFSEAIKKIIDFLG4398 21K10-PEG2K-EEKKKKKKKKKKGSG-(PEG12) -GSGFSEAIKKIIDFLG5634 22K10-PEG5K-EEKKKKKKKKKKGSG-(PEG12) -GSGFSEAIKKIIDFLG7900 23Abbreviations: Pr(A) – propargylalanine; DBCO – dibenzocyclooctyne; (Mtt) – 4-methyltrityl protected lysine; Az – azidolysine modification; PEG – polyethyleneglycol Table 3. DNA conjugates with their expected masses. Name DNA Sequence (5′→3′)ExpectedMass SEQ ID NO5′ antiMars DNA-DBCO / DBCO / AGTGATGTGAGACCATGTGAG7034 243′ antiMars DNA-DBCOAGTGATGTGAGACCATGTGAG / DBCO / 7066 25(N)EE-5′ DNA(C)FSEAIKKIIDFLGGG(N)–(5′)AGTGATGTGAGACCATGTGAG(3′) 8800 –(C)EE-5′ DNA (N)GLFDIIKKIAESFGG(C)–(5′)AGTGATGTGAGACCATGTGAG(3′)8800 –(N)EE-3′ DNA(5′)AGTGATGTGAGACCATGTGAG(3′)–(N)GLFDIIKKIAESFGG(C) 8832 –(C)EE-3′ DNA(5′)AGTGATGTGAGACCATGTGAG(3′)–(C)FSEAIKKIIDFLGGG(N) 8832 –Ab DNA-DBCO / DBCO / AGTTTCGTCCAACGCTCAAGAAC7476 26TAMRA Ab DNA-DBCO / DBCO / AGTTTCGTCCAACGCTCAAGAAC / 6-TAMSp / 8485 27Abbreviations: DBCO – dibenzocyclooctyne; EE – Aurein 1.2 Endosomal Escape Peptide; 6-TAM – 6- carboxytetramethylrhodamine One embodiment described herein is a nanoparticle composition comprising a DNA nanostructure (DN) functionalized with an endolysosomal escape peptide coating. In one aspect, the DN comprises a 6-helix bundle (6HB) nanostructure. In another aspect, the 6HB nanostructure comprises six different double-stranded DNA helices, each DNA helix comprising a nucleotide sequence having at least 90–99% identity to any one of SEQ ID NO: 1–6. In another aspect, the 6HB nanostructure comprises six different double-stranded DNA helices, each DNA helix comprising a nucleotide sequence selected from any one of SEQ ID NO: 1–6. In another aspect, the 6HB nanostructure is a rigid and monomeric assembly roughly 7 × 6 nm2in size. In another aspect, the endolysosomal escape peptide coating comprises one or more endolysosomal escape peptides having an amino acid sequence comprising at least 90–95% identity to any one of SEQ ID NO: 7–23. In another aspect, the endolysosomal escape peptide coating comprises one or more endolysosomal escape peptides comprising an amino acid sequence of any one of SEQ ID NO: 7–23. In another aspect, the endolysosomal escape peptide comprises a lysine10 (K10) peptide (SEQ ID NO: 7). In another aspect, the endolysosomal escape peptide comprises an aurein 1.2 peptide (SEQ ID NO: 16). In another aspect, the endolysosomal escape peptide comprises a lysine10 (K10) peptide, one or more polyethyleneglycol (PEG) linkers, and an aurein 1.2 peptide. In another aspect, the endolysosomal escape peptide comprises one or more of K10-PEG1K-EE (SEQ ID NO: 21), K10- PEG2K-EE (SEQ ID NO: 22), or K10-PEG5K-EE (SEQ ID NO: 23). In another aspect, the diameter of the functionalized DN is from about 15 nm to about 28 nm. In another aspect, the endolysosomal escape peptide coating binds the DN through electrostatic interactions at a nitrogen / phosphate ratio of about 0.8 to about 1.5. In another aspect, the nitrogen / phosphate ratio is about 1. In another aspect, the composition is stable in intracellular lysosomal compartments for up to 24 hr of incubation. In another aspect, the composition further comprises a therapeutic agent. Another embodiment described herein is a method for improving cellular uptake of a DNA nanostructure (DN) through enhanced endolysosomal escape, the method comprising delivering to a cell a nanoparticle composition comprising a DN functionalized with an endolysosomal escape peptide coating. In one aspect, endolysosomal escape efficiency is determined by a protein corona. In another aspect, cellular uptake efficiency of the functionalized DN is linearly dependent on the cell size. In another aspect, the cell is a hepatoblastoma cell or a hepatocellular carcinoma cell. In another aspect, the endolysosomal escape peptide coating facilitates enhanced endolysosomal escape without concomitant disruption of a cell membrane and without cytotoxicity to the cell. In another aspect, the composition further comprises a therapeutic agent and the method is used to deliver the therapeutic agent to a cell. Another embodiment described herein is a nanoparticle composition comprising a DNA nanostructure (DN) functionalized with one or more antibodies. Another embodiment described herein is a method for enhancing the delivery of a therapeutic agent to a subject, the method comprising administering to the subject a nanoparticle composition comprising a DNA nanostructure (DN) functionalized with an endolysosomal escape peptide and the therapeutic agent. Another embodiment described herein is the use of a nanoparticle composition comprising a DNA nanostructure (DN) functionalized with an endolysosomal escape peptide to enhance the delivery of a therapeutic agent to a subject. It will be apparent to one of ordinary skill in the relevant art that suitable modifications and adaptations to the compositions, formulations, methods, processes, apparata, assemblies, and applications described herein can be made without departing from the scope of any embodiments or aspects thereof. The compositions, apparata, assemblies, and methods provided are exemplary and are not intended to limit the scope of any of the disclosed embodiments. All the various embodiments, aspects, and options disclosed herein can be combined in any variations or iterations. The scope of the compositions, formulations, methods, apparata, assemblies, and processes described herein include all actual or potential combinations of embodiments, aspects, options, examples, and preferences described herein. The compositions, formulations, apparata, assemblies, or methods described herein may omit any component or step, substitute any component or step disclosed herein, or include any component or step disclosed elsewhere herein. The ratios of the mass of any component of any of the compositions or formulations disclosed herein to the mass of any other component in the formulation or to the total mass of the other components in the formulation are hereby disclosed as if they were expressly disclosed. Should the meaning of any terms in any of the patents or publications incorporated by reference conflict with the meaning of the terms used in this disclosure, the meanings of the terms or phrases in this disclosure are controlling. All patents and publications cited herein are incorporated by reference herein for the specific teachings thereof. Various embodiments and aspects of the inventions described herein are summarized by the following clauses: Clause 1. A nanoparticle composition comprising a DNA nanostructure (DN) functionalized with an endolysosomal escape peptide coating. Clause 2. The composition of clause 1, wherein the DN comprises a 6-helix bundle (6HB) nanostructure. Clause 3. The composition of clause 1 or 2, wherein the 6HB nanostructure comprises six different double-stranded DNA helices, each DNA helix having a nucleotide sequence having at least 90–99% identity to any one of SEQ ID NO: 1–6. Clause 4. The composition of any one of clauses 1–3, wherein the 6HB nanostructure comprises six different double-stranded DNA helices, each DNA helix having a nucleotide sequence selected from any one of SEQ ID NO: 1–6. Clause 5. The composition of any one of clauses 1–4, wherein the 6HB nanostructure is a rigid and monomeric assembly roughly 7 × 6 nm2in size. Clause 6. The composition of any one of clauses 1–5, wherein the endolysosomal escape peptide coating comprises one or more endolysosomal escape peptides having an amino acid sequence having at least 90–95% identity to any one of SEQ ID NO: 7–23. Clause 7. The composition of any one of clauses 1–6, wherein the endolysosomal escape peptide coating comprises one or more endolysosomal escape peptides having an amino acid sequence of any one of SEQ ID NO: 7–23. Clause 8. The composition of any one of clauses 1–7, wherein the endolysosomal escape peptide comprises a lysine10 (K10) peptide (SEQ ID NO: 7). Clause 9. The composition of any one of clauses 1–8, wherein the endolysosomal escape peptide comprises an aurein 1.2 peptide (SEQ ID NO: 16). Clause 10. The composition of any one of clauses 1–9, wherein the endolysosomal escape peptide comprises a lysine10 (K10) peptide, one or more polyethyleneglycol (PEG) linkers, and an aurein 1.2 peptide. Clause 11. The composition of any one of clauses 1–10, wherein the endolysosomal escape peptide comprises one or more of K10-PEG1K-EE (SEQ ID NO: 21), K10-PEG2K-EE (SEQ ID NO: 22), or K10-PEG5K-EE (SEQ ID NO: 23). Clause 12. The composition of any one of clauses 1–11, wherein the diameter of the functionalized DN is from about 15 nm to about 28 nm. Clause 13. The composition of any one of clauses 1–12, wherein the endolysosomal escape peptide coating binds the DN through electrostatic interactions at a nitrogen / phosphate ratio of about 0.8 to about 1.5. Clause 14. The composition of any one of clauses 1–13, wherein the nitrogen / phosphate ratio is about 1. Clause 15. The composition of any one of clauses 1–14, wherein the composition is stable in intracellular lysosomal compartments for up to 24 hr of incubation. Clause 16. The composition of any one of clauses 1–15, further comprising a therapeutic agent. Clause 17. A method of improving cellular uptake of a DNA nanostructure (DN) through enhanced endolysosomal escape, the method comprising delivering to a cell a nanoparticle composition comprising a DN functionalized with an endolysosomal escape peptide coating. Clause 18. The method of clause 17, wherein endolysosomal escape efficiency is determined by a protein corona. Clause 19. The method of clause 17 or 18, wherein cellular uptake efficiency of the functionalized DN is linearly dependent on the cell size. Clause 20. The method of any one of clauses 17–19, wherein the cell is a hepatoblastoma cell or a hepatocellular carcinoma cell. Clause 21. The method of any one of clauses 17–20, wherein the endolysosomal escape peptide coating facilitates enhanced endolysosomal escape without concomitant disruption of a cell membrane and without cytotoxicity to the cell. Clause 22. The method of any one of clauses 17–21, wherein the composition further comprises a therapeutic agent and the method is used to deliver the therapeutic agent to a cell. Clause 23. A nanoparticle composition comprising a DNA nanostructure (DN) functionalized with one or more antibodies. Clause 24. A method for enhancing the delivery of a therapeutic agent to a subject, the method comprising administering to the subject a nanoparticle composition comprising a DNA nanostructure (DN) functionalized with an endolysosomal escape peptide and the therapeutic agent. Clause 25. Use of a nanoparticle composition comprising a DNA nanostructure (DN) functionalized with an endolysosomal escape peptide to enhance the delivery of a therapeutic agent to a subject. EXAMPLES Example 1 Peptide Synthesis All peptides were synthesized on a CEM Liberty Blue using a Rink amide resin via standard Fmoc-based solid phase peptide synthesis (SPPS) and purified using reverse phase HPLC. The Fmoc-PEG12-COOH monomer used to synthesize K10-PEGNK-EE conjugates was purchased from PurePEG (San Diego, CA) and prepared in a 0.1 M solution of N,N- dimethylformamide for SPPS. Mass Spectrometry All molecules were measured on a Bruker LRF MALDI-TOF mass spectrometer and spotted using the sandwich method. α-Cyano-4-hydroxycinnamic acid (CHCA) was used as the matrix for peptides and peptide-PEG conjugates, 3-hydroxypicolinic acid (HPA) for DNA and DNA-peptide conjugates, and {(2E)-2-Methyl-3-[4-(2-methyl-2-propanyl)phenyl]-2-propen-1- ylidene}malononitrile (DCTB) for polydisperse PEG polymers. Samples were measured in linear positive mode unless containing a polydisperse PEG moiety, which were measured instead using reflector positive mode. Fabrication of DNs DNA barrel origami structures were annealed and purified either by 100 kDa MWCO filtration or 25–30% ethanol precipitation. Six-helix bundle nanostructures were annealed and used without further purification. DN Coating and Characterization DNs were coated as described previously. All coated DNs run on agarose gels utilized a fluorescein labeled K10at 20 mol % of the total K10concentration. Fluorescein was employed for fluorescent imaging. Barrel origami structures were electrophoresed in 2% agarose gels at 60 V for 3.5 h at 4 °C. 6-helix bundle nanostructures were electrophoresed in 1.5% agarose gels at 65 V for 60 min. DN Stability Analysis Bare or coated DNs were diluted in either a solution of DNase I in nuclease reaction buffer (100 mM Tris, 25 mM MgCl2, 1 mM CaCl2) or RPMI-1640 medium (Gibco) containing 10% freshly thawed FBS (Gibco; heat-inactivated at 56^°C by the vendor) such that the final Mg2+ concentration is 0.6^mM. The samples were incubated at 37^°C for 0–24^h on a thermal cycler (Bio-Rad) and analyzed using AGE and TEM imaging. Peptide-DNA Conjugation Amine modified oligonucleotides from IDT (Coralville, IA), 1 µmol, were dissolved in 1× PBS buffer (pH 7.5) and reacted with five equivalents of NHS ester-sulfo-DBCO at RT for 4 h. Another five equivalents of NHS-sulfo-DBCO was added and the mixture was incubated at RT overnight. The DBCO-modified DNA was purified using reverse phase HPLC (Agilent 1220), using a Zorbax Eclipse C18 column with 50 mM triethylammonium acetate and methanol buffers. A gradient of 0–70% methanol was applied over 45 min while monitoring the absorbance at both 260 and 309 nm, the peak absorbance wavelengths of the DNA and DBCO, respectively. The peak displaying an absorbance at both wavelengths was collected and exchanged into water using a 3 kDa molecular weight cut off (MWCO) filter. The DBCO-modified DNA was then mixed with the azidolysine-modified peptide in a 1:4 ratio (DNA:peptide) in 1× PBS buffer (pH 7.5), and incubated at RT overnight. The DNA-peptide conjugate was purified using the same HPLC method. Conjugates were characterized by MALDI-TOF MS. Antibody-DNA Conjugation Briefly, 1 µmol of amine-modified oligonucleotide from IDT (Coralville, IA) was reacted with NHS-PEG4-N3(4-fold excess) in 1× PBS (pH 7.5) at RT for 2 h. The product was purified using a 3 kDa MWCO filter. Separately, antibodies (Ab) were reacted at 1 mg / mL in 1× PBS (pH 6.5) with NHS-sulfo-DBCO at 50 μM for 60 min at RT. The product was purified and concentrated using a 30 kDa MWCO filter and the number of DBCO molecules per antibody were estimated with a UV / Vis spectrometer, as described previously. Then, azido-DNA and DBCO-Ab were reacted in 1× PBS (pH 7.2) in a 3:1 mol ratio (DNA:Ab) for 10 h at 37 °C. Excess DNA was removed using a 30 kDa MWCO filter and ratio of DNA:Ab in the final product was estimated by UV / Vis spectrometry. Ab-DNA conjugates were visualized by stain-free FastCast PAGE (BioRad) at 150 V for 1 h under either denaturing (1× Tris / glycine / SDS, at RT) and nondenaturing PAGE (1× TAE with 12.5 mM Mg2+, at 4 °C) conditions. TAMRA-labelled DNA-N3conjugates were used for Typhoon gel scanner fluorescent identification of Ab-DNA conjugates. Transmission Electron Microscopy Micrographs were taken on a Phillips CM12 transmission electron microscope from the Eyring Materials Center at Arizona State University. Samples were prepared on Formvar / Carbon 400 mesh copper grids from Ted Pella Inc. (Redding, CA) and stained with 2% uranyl acetate. Example 2 Bioconjugation Synthesis The synthesis of K10-PEG1K-EE via bioconjugation of peptide and PEG units proved a difficult task. As depicted in FIG.6B, the multistep process would begin by conjugating either a K10-DBCO or a K10-propargylalanine to the azido group on heterobifunctional N3-PEG1K- maleimide. Subsequently, this newly formed product would be reacted with the EE peptide (Aurein 1.2 sequence) outfitted with a cysteine on its C-terminus for later conjugation with the maleimide group of K10-PEG1K-maleimide, forming K10-PEG1K-EE. Initially, SPAAC was the preferred method to react the PEG and K10units due to its presumed simplicity (FIG. 7A). However, due to the instability of DBCO in the strongly acidic TFA solution used to cleave the peptide from resin after SPPS, K10-DBCO must be reacted with PEG on-resin before cleavage. Moreover, this scheme was further complicated by the synthesis of the K10-DBCO reactant itself. As demonstrated in FIG. 7B, two methods were tested to create K10-DBCO. Method 1 involved SPPS of Boc-protected K10with an additional Mtt-protected lysine at its C-terminus. Mtt (4-methyltrityl) can be selectively deprotected from lysine in a weaker acidic solution (5% TFA, rather than the 95% required for removing Boc protecting groups) for site-selective amine coupling with an NHS ester group on DBCO. Method 2 involved reacting a DBCO-CO2H with the K10N- terminus in the same fashion as an amino acid addition. The final product for both methods would differ only by the composition of the chemical linker between the peptide and DBCO. Both methods successfully produced K10-DBCO as measured by mass spectrometry, but neither yielded any product when reacted on-resin with N3-PEG1K-maleimide. MS data collection involved microcleavage of the product and resulted in a distribution of peaks around the expected product size due to the degradation of the DBCO moiety (similar to what is shown in FIG. 7C). A representative example of a mass spectrum from reaction mixture is shown in FIG.7C, where all reactant peaks can be identified (boxed region), but no product peak (boxed region) is present. In addition to MS, HPLC analysis also demonstrated no apparent product peaks. After many attempts at optimizing the reaction in 1× PBS, including adjustments to buffer pH (7.0, 7.2, 7.5, 8.0), reaction time (1, 4, 12, 24 h), reagent concentration (micromolar to millimolar), molar excess of PEG (1×, 2×, 5×, 10×, 100×), and temperature (25, 37, 50 °C), it was hypothesized that the reaction failure may be due to K10-DBCO being on solid phase and the SPAAC approach was abandoned. Given the complications that arose when conducting the SPAAC reaction, a CuAAC approach was pursued in which the K10-propargylalanine is coupled to the PEG unit (FIG. 7D). K10-propargylalanine was easily generated via SPPS, cleaved, and purified, but its reaction with N3-PEG1K-maleimide saw no improvements over the SPAAC approach (FIG. 7E). The same optimization attempts were made, with the addition of altering the Cu(I):THPTA ligand ratio (1:5, 1:10) and concentrations (micromolar to millimolar). One hypothesis for the failure of this reaction is that the highly positively charged oligolysine was somehow interfering with efficient conjugation. To test this, reactions between EE-Cys and N3-PEG1K-maleimide were carried out while these CuAAC optimization attempts were ongoing. The click reaction between EE-Cys and N3-PEG1K-maleimide was also fraught with difficulties. Again, many attempts at optimizing the reaction were carried out, including trying multiple solvents (1× PBS, DMSO, EtOH, and DMF), reaction times (1, 4, 12, 24 h), reagent concentrations (micromolar to millimolar), molar excesses of PEG (1×, 2×, 5×, 10×), reducing agents (DTT or TCEP in excess), and temperatures (25, 37, 50 °C). 1× PBS was tested at the various pH values. DMSO was later recognized as an oxidant competing with the reduction of the thiol by DTT or TCEP. The EE peptide was not soluble in ethanol, even at lower concentrations of ethanol or peptide. DMF reactions were carried out ± 10mM triethylamine acetate (TEAA) to provide a base for the reaction. Notably, the reducing agents used in these reactions can perform side reactions that sabotage the conjugation moieties involved. For example, both dithiothreitol (DTT) and tris(2-carboxyethyl)phosphine (TCEP) can reduce azides to primary amines, and TCEP can form an adduct with maleimides. These side reactions necessitate the removal of these molecules after reduction of the thiolated EE peptide—a cumbersome task when the peptide molecular weight is too small to be isolated by simple molecular weight cutoff filtration. However, MS analysis demonstrated no peak corresponding to a disulfide-linked EE peptide dimer even after two months frozen in solution, indicating little danger of EE-Cys oxidation. Thus, additional reactions were subsequently carried out in the absence of reducing agent. Even so, the many attempts to react EE-Cys with N3-PEG1K- maleimide yielded no product. It was hypothesized that the highly flexible PEG unit might be folding in on itself, obstructing its termini from participating in conjugations. However, even in solvents with a high dielectric constant, such as DMF, no product was formed. Example 3 Solid-Phase Peptide Synthesis After many fruitless attempts to produce K10-PEG1K-EE (FIG.8A) through bioconjugation, the SPPS route was reconsidered (FIG. 8B). Previously, the expensive cost of Fmoc-PEG1K- COOH monomer discouraged multiple synthetic attempts. However, evidence for iterative additions of a shorter and more economical PEG monomer of 12 PEG units (Fmoc-PEG12-CO2H), was developed. Two successive additions of Fmoc-PEG12-CO2H would contribute ~1200 Da of PEG mass to the final product, very near the original target mass of 1000 Da. Furthermore, this PEG unit is of monodisperse length, facilitating product identification with mass spectrometry. The inaugural attempt to synthesize K10-PEG1K-EE using Fmoc-PEG12-CO2H monomers resulted in a high yield of product, as revealed by mass spectrometry (FIG.8C). Furthermore, it was easily purified using RP-HPLC. The suddenly unproblematic synthesis of this complex peptide-PEG polymer encouraged the synthesis of additional variations, including K10-PEG2K-EE (PEG2Kincludes four additions of PEG12, or 42 total PEG units, for an ~2.4 kDa PEG) and (PEG1K-EE)-K10-(PEG1K-EE), with one copy of PEG-EE on both the C- and N-terminus of the oligolysine core sequence. K10-PEG2K-EE was designed to enhance the protection and water solubility of DNs compared to K10-PEG1K-EE, given that longer PEG lengths have been associated with these traits. Notably, Fang et al. have recently shown in vivo tissue targeting of a polyelectrolyte complex micelle gene carrier that features a very similar design: K30-PEG2K-peptide (where the epitope targets either VCAM-1 or fibrin). The success of this two-kilodalton PEG and peptide-based targeting to protect and deliver microRNA inhibitors to target cells supports the notion that K10-PEG2K-EE holds similar potential for success. (PEG1K-EE)-K10-(PEG1K-EE) was designed to serve as a direct comparison with previously studied K10-EE (which had EE peptides on both termini of decalysine block) and to facilitate even greater water solubility and endosome escape efficiency, as it has been established that an increase in CPP copy number augments their efficacy. Both K10-PEG1K-EE and K10- PEG2K-EE molecules were synthesized successfully, as evidenced by the traces in the mass spectrum of FIG.8C. Example 4 Coated DNA Barrel Origami Stability A barrel-shaped DNA origami nanostructure was implemented as the delivery vehicle of choice for this study. A benefit of this barrel nanostructure design is the existence of both outer and inner parallel helices with defined positions to enable the complex 3D arrangement of molecules within and on the surface of the barrel. Furthermore, the barrel architecture holds the capacity for multimerization, allowing individual barrels to be coaxially stacked end-to-end in specific orientation with the addition of connector strands. The DNA barrel has dimensions of 30 nm in diameter and 60 nm in height, much larger than the 6-helix bundle (6HB) nanostructure implemented in studies with K10-EE. Successful coating strategies using the large DNA barrel vs. the small 6HB will demonstrate the universality of this method. FIG.9 shows the characterization of DNA barrel formation by agarose gel electrophoresis and negative-stain transmission electron microscopy (TEM). Samples were annealed and a 100 kDa molecular weight cut-off (MWCO) spin filter was used to successfully remove the excess staple strands in the Pure Barrel sample of FIG.9A, as can be seen by the absence of the staples band in the Pure Barrel lane compared to the Impure Barrel lane. The mobility of the DNA barrel bands relative to the 1 kbp ladder, scaffold, and staple strand bands. Encouraged by these results, the purified structure was analyzed by negative-stain TEM, shown in FIG.9B. The circular shapes are indicative of barrels standing upright on the grid, whereas the striated rectangular shapes indicate barrels lying lengthwise. The striations indicate the individual helices that compose the barrel shape. The diameter of the barrel measures an approximate 30 nm with a height of approximately 60 nm, in agreement with the expected dimensions of the structure. From these results, it is evident that the DNA barrel has been produced as designed. FIG. 9C demonstrates K10-PEG1K-EE / Barrel coating to varying degrees. The degree of coating is determined by the ratio of positively charged oligolysine residue amines (N) to negatively charged DNA backbone phosphates (P), also known as the N:P ratio. Therefore, a higher N:P ratio designates a greater degree of coating. Previous studies on polycationic polymers for nucleic acid delivery have found that the level of coating necessary for full protection is dependent on the cargo and design of the polymer. Coated structures exhibit reduced electrophoretic mobility on an agarose gel compared to their bare counterparts due to the negative charge screening by the coating molecule. Additionally, the coating tends to exclude DNA dye molecules from staining the nanostructures, necessitating the addition of 20 mol% fluorescein labelled K10, such that UV excitation can allow visualization both the uncoated DNA barrels via SYBR Safe and coated DNA barrels using fluorescence. FIG. 9C shows that increasing the coating ratio actually reverses the direction of electrophoresis for ratios greater than N:P = 0.5. Example 5 Peptide Conjugates for Cytosolic Delivery of mRNA-Loaded DNA Nanostructures One consideration for facilitating cytosolic delivery of nucleic acid nanostructures using the Aurein 1.2 peptide is whether electrostatic adherence (i.e., an oligolysine-based approach), direction covalent linkage (via chemical conjugation of the peptide to an oligonucleotide hybridized to the structure) or a combination of the two, would result in more efficient endosomal escape. This SQB as a “leader” domain tethered to “follower” domains consisting of unstructured mRNA encoding GFP (FIG. 11A). Poly-dT DNA handles extrude from the surface of the SQB for hybridization of mRNAs via their 3′ poly-A tails (FIG.11B). These mRNA-SQB complexes have the ability to transfect cells such as RAW 264.7 macrophages and THP-1 monocytes, with a comparable efficiency to lipofectamine-complexed mRNA (FIG.10C). Interestingly, unstructured mRNA complexed with K10-EE also had limited ability to transfect cells, although at a twenty-fold lower efficiency compared to tethering it to a DNA-origami leader domain (data not shown). However, coating mRNA-SQB with this “first-generation” endosome escape peptide (K10-EE) led to significant aggregation of the particles. The design parameters can be adjusted to minimize unwanted multimerization / aggregation, enabling improved transfection performance. The versatility of the SQB’s multifaceted architecture was utilized when redesigning the mRNA delivery vehicle. On one face of the SQB, mRNA was hybridized to the structure. On another face, EE peptides were covalently linked to the SQB, forming an additional, spatially distinct functional peptide “patch” on the structure. Four variations of DNA-EE conjugates, differing in the directionality of their linkage, were synthesized for testing with the mRNA-SQB: The EE peptide N-terminus conjugated to the (1) 5′ or (2) 3′ end of DNA, or the C-terminus linked to (3) 5′ or (4) 3′ end of DNA. The conjugation strategy (FIG.11A) involved NHS ester attachment of an amine-modified oligonucleotide to NHS-sulfo-DBCO and subsequent SPAAC conjugation of this oligo-DBCO to an azide-modified Aurein 1.2 (synthesized by SPPS). RP-HPLC purification of the conjugates followed, with pure product peaks determined by MALDI-TOF mass spectrometry (FIG. 11B-E). Experimental results demonstrated that the most efficient GFP expression was exhibited with a patch of C-terminally linked EE to the 3′ end of DNA (data not shown). Thus, all subsequent samples that include an EE patch are constructed with this EE- DNA variant and denoted as “SQB-C-EE-mRNA.” The GFP expression of mRNA-SQB, with or without the EE patch, was measured with different coating strategies (FIG. 11F–G): K10-PEG5K, a 1:1 ratio of K10-EE / K10-PEG5K, and K10- PEG1K-EE. A 3:1 ratio of K10-EE / K10-PEG5Kwas also tested, but in absence of an EE patch on the SQB. K10-PEG5Kwas used in conjunction with K10-EE to mitigate SQB aggregation caused by coating with this peptide. Notably, it was found that K10-PEG1K-EE exhibits less aggregation than K10-EE, obviating the need for supplementary K10-PEG5Kin the coating mixture. K10-PEG1K- EE also enhances GFP expression compared to K10-PEG5Kalmost 2-fold and demonstrates similar expression levels to lipofectamine alone. K10-PEG2K-EE has yet to be tested, but the longer PEG moiety is likely to provide even more protection and further mitigate aggregation- related problems. It is also hypothesized that a denser coating of the EE, such as with a (PEG2K- EE)-K10-(PEG2K-EE) that features two copies of EE per molecule, could further enhance GFP expression. An interesting phenomenon, seen in FIG.11G, is that SQB-mediated mRNA expression seems more punctate compared to lipofectamine-mediated expression, which appears dispersed throughout the cell. The SQB may be processed through a different cellular internalization pathway compared to lipofectamine, or a distinct mode of cytosolic delivery. Future experiments will incorporate a nuclear stain to better visualize this differential mode of GFP expression. Endolysosomal staining would also shed a better light on the trafficking of these particles into the cytosol from these compartments. Although more studies are required before hard conclusions about the mRNA-SQB design can be formed, these preliminary results illustrate the beneficial properties of the newly designed K10-PEG1K-EE polymer. However, the contribution of the EE patch should not be understated. It is not yet known what the cytosolic delivery capacity of the K10-PEG1K-EE coating alone is. Thus far, the EE patch on the SQB improves GFP expression in all samples tested, which can be attributed to either greater cellular uptake or enhanced liberation from endosomal compartments. Thus far, these studies have also garnered insights into the way that differential peptide- DNA conjugation schemes can affect biological function. For example, there may be a preferred EE sequence orientation (e.g., the N-terminus facing outward and thus more accessible for interaction with endolysosomal membranes) for optimal performance. Aside from peptide and DNA orientation, a notable difference between the EE-DNA conjugates is that the 5′-modified DNA has an additional 6-carbon alkyl chain linking the DNA to the amine functional group. This may have conferred an additional level of flexibility to the linker that became moderately detrimental to EE function. Nevertheless, these experiments have proven the vast potential that peptide conjugates hold for the functionalization of nucleic acid nanostructures for biomedicine. Example 6 Zwitterionic Peptide-Oligolysine Block Copolymer for DN Protection Though PEGylation has long served as the most widely used biocompatible polymer for modulating the pharmacokinetics of clinically approved drugs, its use presents some challenges. For example, PEG is susceptible to oxidation in the presence of oxygen and transition metals, which causes it to lose its antifouling properties. More importantly, there is an increasing amount of research demonstrating the generation of anti-PEG IgM antibodies in patients after their second dose of PEG-containing drugs, inducing quick clearance of these drugs by the immune system and limiting their efficacy. Thus, PEG alternatives have been developed to mitigate these issues. Zwitterionic polymers, which exhibit both cationic and anionic groups while maintaining a net neutral charge, have shown much potential for this purpose. Zwitterionic polymers typically demonstrate inherently low immunogenicity in addition to abating issues with nanoparticle aggregation, precipitation, and in vivo clearance. These properties are attributed to the way that these materials form a strongly associated hydration layer via electrostatic interactions, which suppresses nonspecific protein adsorption. The benefits of utilizing a peptide-based zwitterion-oligolysine polymer in lieu of a PEG- based oligolysine copolymer include lower immunogenicity and cytotoxicity, as well as facile and cost-efficient synthesis owing to the fact that they can be fabricated via SPPS using canonical amino acid monomers. Thus, an oligolysine-based peptide with a zwitterionic region was generated using five repeats of alternating glutamine-lysine residues, termed K10-(EK)5(FIG. 12A–B). This molecule was expected to serve as an attractive alternative to K10-PEG polymers for DN protection. K10-(EK)5was successfully synthesized on-resin, yielding a molecular weight of 2699 Da (expected 2700 Da, FIG.12C). Coating of DNA barrel origami with K10-(EK)5was verified with AGE (not shown) and TEM (FIG. 12D). Notably, TEM imaging revealed that K10-(EK)5-coated barrels (N:P=1) were more monodisperse compared to uncoated barrels (data not shown). Encouraged by these results, these coated structures were incubated in either 1× PBS, DMEM, or DMEM supplemented with 10% FBS at 37 °C and analyzed after 1 and 20 hours for stability. Unfortunately, AGE analysis showed that nanostructures were partially degraded at a comparable level to uncoated structures after just 1 hour in FBS-containing media, and even more so after 20 hours. This suggested that K10-(EK)5did not protect DNs in serum conditions. Since low-salt denaturation of the origami would result in a higher scaffold band and lower staple band rather than one disperse band located between these two regions, these results suggest that K10-(EK)5is insufficient in discouraging nuclease activity rather than insufficient at charge screening (though the absence of bands for all other buffer conditions may imply denaturation as well, or simply an inadequate sample concentration for visualization). Although the gel shown in FIG.12E exhibited poor band intensity for most lanes and would ideally be repeated for better clarity, the serum- containing results were discouraging enough to abandon further investigation. Future studies implementing the oligolysine-zwitterion peptide would focus on modifications to the peptide sequence. Five repeats of alternating glutamine-lysine residues were originally chosen for the initial design because (EK)5has a comparable molecular weight to the (PEG12)2moiety in K10-PEG1K-EE (1303 Da vs. 1235 Da, respectively). The zwitterionic region may be extended in future designs, as chain length of these polymers is an important factor impacting their antifouling efficacy. Additionally, it may be the case that the cationic oligolysine sequence is somehow interfering with the zwitterionic region’s ability to fend off protein adsorption. Though, given that K10-(EK)5coated DNA barrels in a predictable manner, this does not seem likely, as the oligolysine block should be preoccupied with electrostatic interactions with the DNA nanostructure. Nevertheless, it would be pertinent to test this theory by introducing neutrally charged residues, such as glycine or alanine, as a linker between the K10and (EK)5regions of the peptide that may disrupt oligolysine interference by providing better physical separation between the two blocks. Example 7 Antibody-Oligonucleotide Conjugates for DN Tissue Targeting A number of investigations with DN-based delivery vehicles have incorporated cell surface receptor ligands, aptamers, and peptides in order to enhance the specificity of cellular uptake into target tissues and mitigate off-target effects of their bioactive cargoes. However, there are limitations to consider when implementing these targeting moieties. For example, the development of aptamers requires extensive and costly library screening and are susceptible to nuclease degradation in vivo, and both aptamers and peptides often demonstrate limited specificity. Alternatively, antibodies have had significant clinical success as targeting moieties when conjugated to drugs (termed antibody-drug conjugates, or ADCs). Advances in antibody engineering have allowed the generation of safe antibodies that can be theoretically raised against any target — including internalizing cell surface receptors that enhance ADC uptake as well as specificity. Furthermore, conjugation of monoclonal antibodies (mAbs) to other bioactive components enhances their therapeutic efficacy compared to their administration as single agents. The clinical success of ADCs has prompted an abundance of research to develop mAb conjugation strategies, including those for the attachment of oligonucleotides. Conjugation of an oligonucleotide to a mAb serves as a simple method for the attachment of mAbs to DNs by hybridization. Not only would this approach enable facile attachment to virtually any DNA nanostructure, but also the attachment of multiple antibodies (or multiple types of antibodies) on the same structure site-specifically. Many protocols have been developed for the covalent attachment of mAbs to DNA, and there are even kits commercially available for this purpose (i.e., SoluLink Antibody-Oligonucleotide All-in-One Conjugation kit, Innova Thunder-Link kit, etc.). However, these protocols are often either labor-intensive or costly. Thus, a method was chosen to create three mAb-DNA conjugates for their subsequent attachment to a DNA barrel origami. This method utilized SPAAC to achieve the desired conjugate (FIG.13A), featuring an azide-modified oligonucleotide and DBCO-modified mAb. These conjugates were optimized for a single oligonucleotide conjugation per antibody and verified to not inhibit antibody binding affinity, despite the nonselective modification strategy. This preservation of binding affinity was attributed to the finding that the majority of conjugations were found on the constant (Fc) fragment of the antibodies, rather than the variable (Fv) region responsible for affinity. Preparation of a TAMRA-labelled azido-DNA was verified by mass spectrometry and Ab- DBCO preparation was verified by UV / Vis spectroscopy. The molar concentrations of DBCO and antibody were determined using their extinction coefficients at A309and A280, respectively, and the number of DBCO molecules per antibody were calculated by dividing the molar concentration of DBCO by the molar concentration of antibody after MWCO filtration of excess DBCO was performed. An average number of four DBCO groups per antibody were attached when 0.29 mg mAb was reacted with 50 uM NHS-sulfo-DBCO. Three different antibodies were tested with this method: human α-EGFR, human α-HER2, and IgG2a isotype control. SDS-PAGE analysis demonstrated an upward shift in mobility for Ab species successfully conjugated to DNA (FIG. 13B). Fluorescent imaging revealed the presence of a TAMRA-labelled DNA band, which aligns with the shifted Ab-DNA band seen in the Stain-Free image, suggesting that the mobility shift is a result of successful DNA conjugation to the antibodies (FIG.13C). However, the presence of multiple laddered bands, especially for the α-HER2-DNA and IgG2a isotype control-DNA, suggests some antibody species were attached to multiple oligonucleotides, though the major product for each is that of a single conjugation. Reagent stoichiometry in future Ab-DNA reactions should be optimized to minimize this phenomenon. It should also be noted that for all antibodies tested, some degree of conjugation occurred on the Fv-containing light chain (lower band) in addition to the Fc-containing heavy chain. Future experiments will focus on determining whether the affinity of free Ab-DNA is affected by the conjugation strategy. Once preservation of affinity has been established, naked DNA origami and DNA origami hybridized to antibodies should be tested for cellular uptake in cell lines positive and negative for their target receptors to determine the efficiency and specificity of uptake conferred by Ab attachment. Furthermore, comparison of this method with previously established DN-targeting moieties, such as an α-HER2 aptamer, for targeting and internalization will help prove whether antibodies serve as a superior targeting moiety for DNs. Described herein are a variety of ways in which nucleic acid nanostructures can be decorated and modified to suit a myriad of biological purposes. Over the years, the field of DNA nanotechnology has drawn inspiration from a vast pool of well-established methodologies developed for intracellular nucleic acid delivery. Because these nanostructures have the same chemical composition of unstructured DNA or RNA used for vaccines and gene therapies, they face very similar challenges when administered to cells, including the need for protection, tissue targeting, and intracellular trafficking. However, the benefit of DNA nanostructures lies in their capability as multifunctional devices along with their addressability at the nanoscale. One can envision for the future a universal delivery platform with a DNA nanostructure serving as the foundation, able to be readily decorated with the drug, targeting moiety, and protection method of choice for deployment under an assortment of biomedical contexts. The countless ways in which these structures can be configured to suit different purposes necessitate the development of an assortment of quick and easy tools for their modification.

Claims

CLAIMS What is claimed:

1. A nanoparticle composition comprising a DNA nanostructure (DN) functionalized with an endolysosomal escape peptide coating.

2. The composition of claim 1, wherein the DN comprises a 6-helix bundle (6HB) nanostructure.

3. The composition of claim 2, wherein the 6HB nanostructure comprises six different double- stranded DNA helices, each DNA helix comprising a nucleotide sequence having at least 90–99% identity to any one of SEQ ID NO: 1–6.

4. The composition of claim 2, wherein the 6HB nanostructure comprises six different double- stranded DNA helices, each DNA helix comprising a nucleotide sequence selected from any one of SEQ ID NO: 1–6.

5. The composition of claim 2, wherein the 6HB nanostructure is a rigid and monomeric assembly roughly 7 × 6 nm2in size.

6. The composition of claim 1, wherein the endolysosomal escape peptide coating comprises one or more endolysosomal escape peptides comprising an amino acid sequence having at least 90–95% identity to any one of SEQ ID NO: 7–23.

7. The composition of claim 1, wherein the endolysosomal escape peptide coating comprises one or more endolysosomal escape peptides comprising an amino acid sequence of any one of SEQ ID NO: 7–23.

8. The composition of claim 7, wherein the endolysosomal escape peptide comprises a lysine10 (K10) peptide (SEQ ID NO: 7).

9. The composition of claim 7, wherein the endolysosomal escape peptide comprises an aurein 1.2 peptide (SEQ ID NO: 16).

10. The composition of claim 7, wherein the endolysosomal escape peptide comprises a lysine10 (K10) peptide, one or more polyethyleneglycol (PEG) linkers, and an aurein 1.2 peptide.

11. The composition of claim 7, wherein the endolysosomal escape peptide comprises one or more of K10-PEG1K-EE (SEQ ID NO: 21), K10-PEG2K-EE (SEQ ID NO: 22), or K10- PEG5K-EE (SEQ ID NO: 23).

12. The composition of claim 1, wherein the diameter of the functionalized DN is from about 15 nm to about 28 nm.

13. The composition of claim 1, wherein the endolysosomal escape peptide coating binds the DN through electrostatic interactions at a nitrogen / phosphate ratio of about 0.8 to about 1.

5.

14. The composition of claim 13, wherein the nitrogen / phosphate ratio is about 1.

15. The composition of claim 1, wherein the composition is stable in intracellular lysosomal compartments for up to 24 hr of incubation.

16. The composition of claim 1, further comprising a therapeutic agent.

17. A method of improving cellular uptake of a DNA nanostructure (DN) through enhanced endolysosomal escape, the method comprising delivering to a cell a nanoparticle composition comprising a DN functionalized with an endolysosomal escape peptide coating.

18. The method of claim 17, wherein endolysosomal escape efficiency is determined by a protein corona.

19. The method of claim 17, wherein cellular uptake efficiency of the functionalized DN is linearly dependent on the cell size.

20. The method of claim 17, wherein the cell is a hepatoblastoma cell or a hepatocellular carcinoma cell.

21. The method of claim 17, wherein the endolysosomal escape peptide coating facilitates enhanced endolysosomal escape without concomitant disruption of a cell membrane and without cytotoxicity to the cell.

22. The method of claim 17, wherein the composition further comprises a therapeutic agent and the method is used to deliver the therapeutic agent to a cell.

23. A nanoparticle composition comprising a DNA nanostructure (DN) functionalized with one or more antibodies.

24. A method for enhancing the delivery of a therapeutic agent to a subject, the method comprising administering to the subject a nanoparticle composition comprising a DNA nanostructure (DN) functionalized with an endolysosomal escape peptide and the therapeutic agent.

25. Use of a nanoparticle composition comprising a DNA nanostructure (DN) functionalized with an endolysosomal escape peptide to enhance the delivery of a therapeutic agent to a subject.

Images