Chemo-sensitive dominant clone for adaptive therapy

Abstract

Disclosed herein is a system that addresses all of the current challenges described above by combining three existing technologies and an improved nuclear RNA delivery system to generate a first-in-class cellular therapy that can secrete a cancer specific suicide gene for the treatment of several cancers. Also disclosed herein is a 'Trojan-Horse' like genetic construct aimed at engineering a chemo-sensitive dominant clone for adaptive therapy in cancers, such as leukemia. In some embodiments, cells, such as cancer cells from a subject, are engineered with suicide genes to promote a bystander effect in neighboring cancer cells once returned to the subject. In some embodiments, these cells are further engineered to be clonally dominant, e.g. by deleting or mutating tumor suppressor genes in the cells, overexpressing oncogenes, or any combination thereof. Once the engineered cells have reached a target clonal dominance, the suicide gene can be induced, thereby promoting the bystander effect.

Description

CHEMO-SENSITIVE DOMINANT CLONE FOR ADAPTIVE THERAPYCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of U.S. Provisional Application No. 63 / 579,518, filed August 30, 2023, which is hereby incorporated herein by reference in its entirety.SEQUENCE LISTING

[0002] This application contains a sequence listing filed in ST.26 format entitled “320805-2160 Sequence Listing” created on August 29, 2024, and having 17,565 bytes. The content of the sequence listing is incorporated herein in its entirety.BACKGROUND OF THE INVENTION

[0003] Genome editing utilizing the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 system holds great therapeutic promise for a broad range of human genetic diseases (Cong L, et al. Science 1231143, 2013; Jinek M, et al. Science 1225829, 2012). Several human clinical trials are already planned that will leverage the CRISPR-Cas9 system to treat hematologic diseases such as sickle cell disease and beta thalassemia in the coming year (Ye L, et al. Proc Natl Acad Sci U S A 113:10661-10665, 2016; Dever DP, et al. Nature 539:384, 2016). These monogenetic disorders are ideally suited for genome editing because they have easy access to the target cell (i.e. blood cells), have a clear genetic target, and only require a subset of target cells to be corrected for clinically relevant responses to occur (Pawliuk R, et al. Science 294:2368-2371 , 2001). However, although cancer is collectively the most common genetic disorder of man, several barriers exist that prevent this genome editing strategy from achieving clinical relevance. For example, even if comparable genome editing approaches focused on leukemia, where target cell acquisition is similarly straightforward, this cancer would not be amenable to genome editing because it is a multi-gene disorder with ambiguous genetic targets and its development and propagation are governed by evolutionary principles (Merlo LM, et al. Nat Rev Cancer 6:924-35, 2006). The former requires that 100% of target cells be corrected because otherwise native, uncorrected target cells would be rapidly selected leading to treatment failure. Because a 100% editing rate is not possible with current or near-future technologies, novel approaches are needed to implement CRISPR-Cas9 based therapies in leukemia and other cancers.

[0004] Suicide gene therapy refers to a therapeutic strategy whereby a modified genetic construct is introduced into cancer or immune cells designed to induce cell death (Bonini, C. et al. Mol Ther 2007 15:1248-1252; Duarte, S., et al. Cancer Lett 2012 324:160-170). When inserted directly in cancer cells, this strategy has conventionally aimed to leverage a local and, in some cases, distant ‘bystander effect’ (Rainov, N. G. Human gene therapy 2000 11 :2389-2401 ; Freeman, S. M., et al. The Lancet 1997 349:2-3). This is because gene-delivery systems generally introduce the suicide construct in only a small fraction of the tumor bulk and therefore death of non-modified cancer cells is required for clinically meaningful efficacy. This reliance on a clinically unpredictable degree of ‘bystander effect’ has led to modest results in human trials (Rainov, N. G. Human gene therapy 2000 11 :2389-2401). Further, suicide genes have generally been non-specific making in vivo clinically translatable strategies limited.

[0005] When inserted in immune cells, this strategy has been leveraged to minimize toxicity associated with genetically modified T-cells to include CAR-T therapy (Di Stasi, A. et al. New England Journal of Medicine 2011 365:1673-1683). Several delivery systems have been developed to introduce suicide gene therapy to include non-replicating and replicating viral vectors and the CRISPR / Cas9 system (Duarte, S., et al. Cancer Lett 2012 324:160-170; Di Stasi, A. et al. New England Journal of Medicine 2011 365:1673-1683). However, all of these strategies are limited by the relatively low efficiency of suicide gene delivery. Therefore, there exists a critical need for the development of novel therapeutic strategies that either improve the bystander effect or leverage other biologic mechanisms to maximize this approach.SUMMARY OF THE INVENTION

[0006] Disclosed herein is a system that addresses all of the current challenges described above by combining three existing technologies and an improved nuclear RNA delivery system to generate a first-in-class cellular therapy that can secrete a cancer specific suicide gene for the treatment of several cancers.

[0007] Disclosed herein is a secreted RNA therapeutic system that involves (a) a first polynucleotide encoding retroviral elements that preferentially binds and facilitates formation and secretion of vesicles carrying its own RNA messenger operably linked to a first expression control sequence; (b) a second polynucleotide encoding an RNA therapeutic having a nuclear retention sequence that is flanked by packaging signals for the retroviral elements operably linked to a second expression control sequence; and (c) a third polynucleotide encoding a membrane fusion protein operably linked to a third expression control sequence.

[0008] In some embodiments, the first, second and third polynucleotides are present in separate vectors. In some embodiments, the first, second and third polynucleotides are present in a single vector. In some embodiments, the delivery vesicle is a virus-like particle.

[0009] In some embodiments, the retroviral elements for forming a delivery vesicle comprises two or more of a retroviral gag protein, a retroviral envelope protein, a retroviral reverse transcriptase or a combination thereof. For example, the retroviral gag protein can be a gag-homology protein, such as paternally expressed gene 10 (PEG10). Therefore, in some embodiments, the packaging signals for the retroviral elements is the 5’ UTR and 3’ UTR for PEG 10.

[0010] In some embodiments, the nuclear retention sequence is a portion of a long non-coding RNA (IncRNA) enriched in Alu repeats and / or a SIRLOIN motif

[0011] In some embodiments, the RNA therapeutic has a synthetic intron that can be spliced by a mutant spliceosome. For example, the RNA therapeutic can encode a herpes simplex virus thymidine kinase (HSV-TK) when the synthetic intron is spliced by a mutant spliceosome.

[0012] In some embodiments, the membrane fusion protein is the G envelope protein of vesicular stomatitis virus (VSV-G).

[0013] Also disclosed herein is a ‘Trojan-Horse’ like therapeutic strategy aimed at engineering a chemo-sensitive dominant clone for adaptive therapy in cancers, such as leukemia. In some embodiments, cells, such as cancer cells from a subject, are engineered with suicide genes to promote a bystander effect in neighboring cancer cells once returned to the subject. In some embodiments, these cells are further engineered to be clonally dominant, e.g. by deleting or mutating tumor suppressor genes in the cells, overexpressing oncogenes, or any combination thereof. Human cell lines, which inherently rapidly proliferate and have the capacity to be clonally dominant, can also be used. Once the engineered cells have reached a target clonal dominance, the suicide gene can be induced, thereby promoting the bystander effect.

[0014] Therefore, disclosed herein is a chimeric cell for treating cancer. The cell can be genetically engineered to express an inducible suicide gene to promote a bystander effect at the cancer site. The cell can also be genetically engineered with at least one tumor suppressor gene knocked out, one oncogene overexpressed, or a combination thereof, to make the cell clonally dominant at the cancer site. In some embodiments, the at least one tumor suppressor gene is knocked out by insertion of the suicide gene in the tumor suppressor gene locus. This would guarantee that the only cells with deleted tumor suppressor genes also have a suicide gene. In someembodiments, the suicide gene further comprises one or more insulator sequences to prevent epigenetic silencing. In other embodiments, the subject’s cancer cells can be engineered such that the tumor suppressor and suicide gene are inserted in parallel. Human cell lines could also be engineered to express the suicide gene.

[0015] In some embodiments, the chimeric cell is further engineered to secrete an RNA therapeutic as described herein to kill cells prior to suicide being induced.

[0016] There are a variety of suitable suicide genes known in the art. As used herein, the term “suicide gene” refers either 1) a gene encoding a protein that when activated by an inducer can cause cell death, including apoptosis, pyroptosis, or necroptosis; or 2) a gene encoding an enzyme that can convert a non-lethal prodrug into a lethal drug.

[0017] In some embodiments, the suicide gene encodes a chimeric version of a pro-apoptotic protein, such as a caspase, that has been modified to only dimerize in the presence of a small molecule inducer. A notable example is iCasp-9, which can be induced by AP1903.

[0018] In some embodiments, the suicide gene encodes an enzyme that converts a prodrug into a lethal drug. For example, herpes simplex virus thymidine kinase (HSV-tk) converts the prodrug ganciclovir (GCV) into GCV-triphosphate resulting in cell death by incorporation into replicating DNA.

[0019] In some embodiments, a combination of suicide genes are used for better safety and control.

[0020] Any tumor suppressor gene or oncogene can be used in the disclosed cells so long as their deletion or overexpression, alone or in combination with other gene modifications, can increase the clonal dominance of the cell. In some embodiments, the tumor suppressor gene comprises c-Cbl, PTEN, or any combination thereof.

[0021] Any cell capable of homing to or selectively associating with cancer cells can be used in the disclosed methods. In some embodiments, the cell is a cancer cell, such as a cancer cell from the subject. In some embodiments, the cell is any harvestable cancer cell. For example, for a subject with a leukemia, myeloid cells can be collected and modified according to the disclosed methods. In some embodiments, CD34+ cells are used for subjects with a leukemia, such as a myeloid leukemia. The disclosed scheme can also be used for solid tumors by implanting the modified cell into the solid tumor. The cell can therefore be autologous or allogeneic. In some embodiments, the cell is from a cell line.

[0022] In some embodiments, the method involves an adaptive treatment schedule (Figure 24). Adaptive therapy is a therapeutic approach that directly applies evolutionary principles in cancer cell populations. The adaptive approach requires that therapy be intermittently deployed to a cancer such that chemo-sensitive clones maximize their dominance and resistant clones remain subclonal. The kinetics of the dominant clone are monitored and therapy withdrawal is informed by predictive mathematical models, using kinetic parameters to maximize the fitness advantage of the sensitive clone. This approach is able to delay or prevent competitive release and expansion of resistant populations.

[0023] In some embodiments, the cell expresses a chimeric antigen receptor (CAR) polypeptide that targets a tumor antigen. However, in some embodiments, the cell is not CAR-T cell. The cell can also be engineered to express a chemokine receptor suitable to provide homing cues to the bone marrow, such as CXCR-4.

[0024] In some embodiments, the cell is further modified to express or encapsulate a diagnostic or therapeutic agent.

[0025] Therefore, also disclosed herein is a method for treating a cancer in a subject that involves isolating a cancer cell from the subject; genetically engineering the cancer cell to express a suicide gene; genetically engineering the cancer cell to knock out at least one tumor suppressor gene, over express at least one oncogene, or a combination thereof; administering the engineered cell back to the cancer of the subject; allowing the engineered cell to clonally expand; and administering to the subject an inducer of the suicide gene (or prodrug for the suicide gene) in an amount effective to promote cell death and a bystander effect in the cancer.

[0026] The disclosed method can be used in any cancer subject to the bystander effect. The bystander effect is mediated by dsDNA, and leukemic cells are particularly sensitive to the TLR / DAMP pathway. Therefore, in some embodiments, the cancer is a leukemia, such as a myeloid leukemia. In some embodiments the cancer is chronic myelomonocytic leukemia (CMML).

[0027] In some embodiments, the cancer is a sarcoma, lymphoma, leukemia, carcinoma, blastoma, or germ cell tumor. A representative but non-limiting list of cancers that the disclosed cells can be used to treat include lymphoma, B cell lymphoma, T cell lymphoma, mycosis fungoides, Hodgkin’s Disease, myeloid leukemia, bladder cancer, brain cancer, nervous system cancer, head and neck cancer, squamous cell carcinoma of head and neck, kidney cancer, lung cancers such as small cell lung cancer and non-small cell lung cancer, neuroblastoma / glioblastoma, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer, liver cancer, melanoma, squamous cell carcinomas of the mouth, throat,larynx, and lung, colon cancer, cervical cancer, cervical carcinoma, breast cancer, epithelial cancer, renal cancer, genitourinary cancer, pulmonary cancer, esophageal carcinoma, head and neck carcinoma, large bowel cancer, hematopoietic cancers; testicular cancer; colon and rectal cancers, prostatic cancer, and pancreatic cancer.

[0028] The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.BRIEF DESCRIPTION OF FIGURES

[0029] FIG. 1 illustrates a system integrating a synthetic intron and PEG10 packaging.

[0030] FIG. 2 illustrates an embodiment of the disclosed system with a nuclear retention sequence as disclosed herein.

[0031] FIGs. 3A to 3C illustrates an embodiment of a Genomic Safe Harbor approach. FIG. 3A shows a trojan horse construct directed to the AWS1 loci utilizing a Cas9 RNP with an sgRNA targeting AAVS1. FIG. 3B shows a second sgRNA arising from the same construct as the first sgRNA that targets a tumor suppressor for depletion leading to increased leukemic fitness. FIG. 3C shows an option where the sgRNA targeting the tumor suppressor is transcribed only when the amplicon is integrated ensuring suicide gene expression in those cells with increased fitness.

[0032] FIG. 4 is an illustration of an embodiment of a disclosed strategy for cell based therapy for CMML.

[0033] FIG. 5 is a bar graph showing proliferation of 2 single cell clones stably carrying and expressing the suicide cassette treated with AP1903 (0.05, 0.1 , 0.2, 0.4 and 0.8 uM) and non treated (NT). Proliferation was measured by the CCK8 assay, Clone number 1 was picked for future experiments. Note the drug was able to kill almost all cells at 24 and 48 hrs as low as with 50nM.

[0034] FIG. 6A shows by-standard effect of clonel cells over GFP stably expressing cells. The effect was measured by the CCK8 assay. Data were normalized vs. non treated cells to estimate the percentage of living cells. Co-culture were settled at the different ratio as shown, keeping the killer (clonel) constant while increasing the number of the victim (GFP positive cells). FIG. 6B is a drug control for GFP positive cells, which are not carrying the suicide gene.

[0035] FIGs. 7A and 7B show by-standard effect of clonel cells (killer) over GFP stably expressing cells (victim). Co-culture were settled at the different ratio as shown, keeping the killer (clonel) constant while increasing the number of the victim (GFP positive cells). Measure living GFP positive cells at the FLOW facility.

[0036] FIGs. 8A to 8D show by-standard effect of clonel (killer) cells over GFP stably expressing cells (victim). The by-standard effect was measured using transwells. The number of living cells in both compartments were counted. Note cells were in separated compartments: Killer (on the top), Victim (on the bottom). Membrane pore size does not allow the transfer of cells but allow the move of small molecules. cGAS inhibitor partially blocks the by-standard effect, suggesting that such effect is partially mediated by the cGAS pathway (FIG. 8D).

[0037] FIGs. 9A to 9C show by-standard effect of THP1 / CRISPR clone (killer) cells over GFP stably expressing cells (victim). The by-standard effect was measured using transwells. The number of living cells was count in both comparments. cGAS inhibitor partially blocks the by-standard effect, suggesting that such effect is partially mediated by the cGAS pathway (FIG. 9C).

[0038] FIG. 10 shows cloning strategy of suicide cassette into the Addgene vector carrying the insulator and the AAVS1 flanking regions needed to generated the THP1 / CRISPR clone (killer).

[0039] FIG. 11 shows CRIPSR based knock-out strategy against Cbl gene. KO clones must have a better fitness (e.i faster growth, apoptosis resistance, etc.).

[0040] FIG. 12 shows Western-blot of Cbl KO clones. Note that D4 and G6 clones seems to be KO.

[0041] FIG. 13A and 13B show proliferation data of WT, Non-Targeted (NT) and Cbl-KO clones (D4 and G6). Note that only D4 clones seems to be a really true KO, since it growths faster than WT, which support the expected better fitness reported for Cbl-KO. Sequence analysis of Cbl locus confirmed this and the previous protein data. G6 clones seems to be a fake clone.

[0042] FIG. 14 shows CRIPSR based knock-in strategy to insert the suicide cassette into the AAVS1 locus.

[0043] FIG. 15 shows proliferation of 3 single cell clones stably carrying and expressing the suicide cassette compared to 2 negative clones treated with AP1903 (0.05, 0.1 , and 0.5 uM) and non treated (NT). Proliferation was measured by the CCK8 assay, Clone number 3 was picked for future experiments. Note the drug was able to kill almost all cells at 24 hrs as low as with 50nM.

[0044] FIG. 16A shows by-standard effect of clone 3 cells over GFP stably expressing cells. The effect was measured by the CCK8 assay. Data were normalized vs. non treated cells to estimate the percentage of living cells. Co-culture were settled at the different ratio as shown, keeping the killer (clone3) constant while increasing the number of the victim (GFP positive cells). FIG. 16B is a drug control for GFP positive cells, which are not carrying the suicide gene.

[0045] FIGs. 17A and 17B shows by-standard effect of clones cells (killer) over GFP stably expressing cells (victim). Co-culture were settled at the different ratio as shown, keeping the killer (clone3) constant while increasing the number of the victim (GFP positive cells). Measure living GFP positive cells at the FLOW facility.

[0046] FIGs. 18A to 18C show by-standard effect of clonel cells (killer) over Firefly luciferase stably expressing cells (victim). Mice were injected with both cells at ratio 1 :1. After 18 days upon previous control of cell engraftment, mice were treated with the drug at 0.1 and 0.5 mpk. FIG. 18A is a representative luminescence picture of a drug treated mouse. FIG. 18B shows the spleen weight of vehicle and the treated mice. FIG. 18C shows the statistical analysis of the luminescence from the bone marrows: left (BML) and right (BML).

[0047] FIG. 19 shows clinical workflow for cell-therapies based strategy.

[0048] FIGs. 20A to 20C show genomic Safe Harbor approach. FIG. 20A shows a Trojan horse construct directed to the AWS1 loci utilizing a Cas9 RNP with an sgRNA targeting AAVS1 as previously described 1. FIG. 20B shows a second sgRNA arising from the same construct as the first sgRNA will target a tumor suppressor for depletion leading to increased leukemic fitness. FIG. 20C shows, in this option, the sgRNA targeting the tumor suppressor is transcribed only when the amplicon is integrated ensuring suicide gene expression in those cells with increased fitness.

[0049] FIG. 21 shows AAVS1 methylation status in human leukemia. Methylation specific (MSP) and unmethylated specific primers were designed to the AAVS1 loci and amplified in two myelomonocytic cell lines in duplicate (1&2).

[0050] FIGs. 22A to 22C show a direct gene disruption approach. FIG. 22A shows a Trojan horse construct with targeting sequences to exon 1 of candidate tumor suppressors, insulators to minimize long term methylation, the suicide gene of interest, and the sgRNA targeting Cas9. FIG. 22B shows sgRNA will directly target exonl of candidate tumor suppressor simultaneously ‘knocking-out’ the candidate gene and expressing the suicide gene. FIG. 22C shows strategy to generate this construct by cloning the iCASP9 amplicon in the AAVS1 targeting plasmid. PCR confirmation seven representative colonies identified the expected band at 22 kB and sequencing (not shown) demonstrates successful cloning.

[0051] FIGs. 23A to 23C show generation of a targeted CRISPR / Cas9 CMML patient screen. FIG. 23A shows use of genetically distinct myelomonocytic cell lines to perform genome wide lentiviral CRISPR screens (i.e. GeKO). FIG. 20B shows sgRNA targets validated in CMML patient sample PDX to ensure increase in leukemic fitness as measured by sgRNA enrichment at time of necropsy. The panelis iteratively optimized to ensure that at least 50% of CMML patient samples can be engineered to increase leukemic fitness. FIG. 23C shows CBL targeted by CRISPR in primary human umbilical cord blood cells demonstrating capacity to track INDELs and edit primary human cells. UL panel enumerates the number of WT reads, LL panel enumerates the number INDEL reads. Relative proliferation of edited cells (RFP+) in 2% SCF (UR panel) and 0.2% (LL panel).

[0052] FIGs. 24A shows computational modeling strategy to inform adaptive therapy treatment schedule. FIG. 24B shows an example of an adaptive treatment schedule. FIG. 24C shows predictive mathematical and statistical model exploration based on in vitro and in vivo studies leads to treatment outcome predictions.DETAILED DESCRIPTION

[0053] Before the present disclosure is described in greater detail, it is to be understood that this disclosure is not limited to particular embodiments described, and as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended claims.

[0054] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.

[0055] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, the preferred methods and materials are now described.

[0056] All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission thatthe present disclosure is not entitled to antedate such publication by virtue of prior disclosure. Further, the dates of publication provided could be different from the actual publication dates that may need to be independently confirmed.

[0057] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present disclosure. Any recited method can be carried out in the order of events recited or in any other order that is logically possible.

[0058] Embodiments of the present disclosure will employ, unless otherwise indicated, techniques of chemistry, biology, and the like, which are within the skill of the art.

[0059] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to perform the methods and use the probes disclosed and claimed herein. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C, and pressure is at or near atmospheric. Standard temperature and pressure are defined as 20 °C and 1 atmosphere.

[0060] Before the embodiments of the present disclosure are described in detail, it is to be understood that, unless otherwise indicated, the present disclosure is not limited to particular materials, reagents, reaction materials, manufacturing processes, or the like, as such can vary. It is also to be understood that the terminology used herein is for purposes of describing particular embodiments only, and is not intended to be limiting. It is also possible in the present disclosure that steps can be executed in different sequence where this is logically possible.Definitions

[0061] It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise.

[0062] The term “subject” refers to any individual who is the target of administration or treatment. The subject can be a vertebrate, for example, a mammal. Thus, the subject can be a human or veterinary patient. The term “patient” refers to a subject under the treatment of a clinician, e.g., physician.

[0063] The term “therapeutically effective” refers to the amount of the composition used is of sufficient quantity to ameliorate one or more causes orsymptoms of a disease or disorder. Such amelioration only requires a reduction or alteration, not necessarily elimination.

[0064] The term “treatment” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder.

[0065] The terms “polynucleotide” and “nucleic acid,” used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single-, double-, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. “Oligonucleotide” generally refers to polynucleotides of between about 5 and about 100 nucleotides of single- or double-stranded DNA. However, for the purposes of this disclosure, there is no upper limit to the length of an oligonucleotide. Oligonucleotides are also known as “oligomers” or “oligos” and may be isolated from genes, or chemically synthesized by methods known in the art. The terms “polynucleotide” and “nucleic acid” should be understood to include, as applicable to the embodiments being described, single-stranded (such as sense or antisense) and double-stranded polynucleotides.

[0066] The term “vector” or “construct” refers to a nucleic acid sequence capable of transporting into a cell another nucleic acid to which the vector sequence has been linked. The term “expression vector” includes any vector, (e.g., a plasmid, cosmid or phage chromosome) containing a gene construct in a form suitable for expression by a cell (e.g., linked to a transcriptional control element). “Plasmid” and “vector” are used interchangeably, as a plasmid is a commonly used form of vector. Moreover, the invention is intended to include other vectors which serve equivalent functions.

[0067] The term “operably linked to” refers to the functional relationship of a nucleic acid with another nucleic acid sequence. Promoters, enhancers, transcriptional and translational stop sites, and other signal sequences are examples of nucleic acid sequences operably linked to other sequences. For example, operable linkage of DNAto a transcriptional control element refers to the physical and functional relationship between the DNA and promoter such that the transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to and transcribes the DNA.

[0068] The term “tumor suppressor gene” refers to any gene whose loss of function can result in uncontrolled cellular proliferation.Chemo-sensitive Dominant Clone for Adaptive Therapy

[0069] Disclosed herein is a ‘Trojan-Horse’ like therapeutic strategy aimed at engineering a chemo-sensitive dominant clone for adaptive therapy in cancers, such as leukemia. In some embodiments, cells, such as cancer cells from a subject, are engineered with suicide genes to promote a bystander effect in neighboring cancer cells once returned to the subject. In some embodiments, these cells are further engineered to be clonally dominant, e g. by deleting or mutating tumor suppressor genes in the cells, overexpressing oncogenes, or any combination thereof. Human cell lines, which inherently rapidly proliferate and have the capacity to be clonally dominant, can also be used. Once the engineered cells have reached a target clonal dominance, the suicide gene can be induced, thereby promoting the bystander effect.

[0070] Therefore, disclosed herein is a chimeric cell for treating cancer. The cell can be genetically engineered to express an inducible suicide gene to promote a bystander effect at the cancer site. The cell can also be genetically engineered with at least one tumor suppressor gene knocked out, one oncogene overexpressed, or a combination thereof, to make the cell clonally dominant at the cancer site. In some embodiments, the at least one tumor suppressor gene is knocked out by insertion of the suicide gene in the tumor suppressor gene locus. This would guarantee that the only cells with deleted tumor suppressor genes also have a suicide gene. In some embodiments, the suicide gene further comprises one or more insulator sequences to prevent epigenetic silencing. In other embodiments, the subject’s cancer cells can be engineered such that the tumor suppressor and suicide gene are inserted in parallel. Human cell lines could also be engineered to express the suicide gene.

[0071] Tumor suppressor genes are important genes that act within the genome to regulate several cellular functions. These genes can be broadly classified based on their role in cell growth / cell cycle progression, cell proliferation, DNA repairmechanisms, and other crucial cellular signaling functions such as the apoptosis induction.

[0072] The retinoblastoma (RB) gene, also called ‘Governor of the Cell Cycle,’ encodes the RB protein that, when hypophosphorylated, binds and inhibits E2F transcriptions factors. A variety of mechanisms like loss-of-function mutations affecting RB, CDK4, and cyclin D gene amplification, cyclin-dependent kinase inhibitors loss (p16 / INK4a), and inhibition of RB by the binding of viral oncoproteins (E7 protein of HPV) can revoke the antiproliferative effect of RB in cancers.

[0073] The TP53 tumor suppressor gene encodes for the p53 protein, which controls the expression of proteins and their activity in cell cycle arrest, cellular senescence, DNA repair, and apoptosis. Loss of p53 can cause continued cell replication despite DNA damage and failure to activate programmed cell death. Similar to RB, p53 can be inactivated by viral oncoproteins like the E6 protein of HPV, thus revoking the antiproliferative and other important cellular effects. Most of the cancers demonstrate a biallelic loss-of-function mutation in TP53.

[0074] The Phosphatase and Tensin Homolog (PTEN) gene encodes a lipid phosphatase that negatively regulates the phosphoinositide-3-kinase (PI3K)-AKT and the target of mTOR signaling pathways. A biallelic loss-of-function is common in diverse cancers.

[0075] The CDH1 (E-cadherin): regulates contact inhibition by binding to a key component of the WNT signaling pathway, p-catenin. This binding prevents E- cadherin from translocating to the nucleus of the cell, stopping it from activating transcription of pro-growth target genes. Overall, this interaction regulates the morphology and organization of epithelial cell linings. Autosomal dominant familial gastric carcinoma is associated with a germline loss-of-function in this gene.

[0076] The NF1 gene encodes for neurofibromin 1 , which is a GTPase that functions as a negative regulator of RAS. A germline loss of function mutation of this gene causes Neurofibromatosis type 1 , an autosomal dominant disorder associated with the formation of neurofibromas, brain tumors like optic gliomas, and malignant nerve sheath tumors peripherally. The NF2 gene encodes neurofibromin 2 (also known as merlin), which is a cytoskeletal protein associated with contact inhibition. Loss of function mutations of this gene leads to neurofibromatosis type 2, which is also an autosomal dominant disorder associated with an increased risk of bilateral schwannomas among other tumors.

[0077] BRCA1 and BRCA2 are tumor suppressor genes that encode proteins involved in the repair of DNA double-strand breaks through the homologous recombination repair pathway. PARP-1 encodes a protein that assists with the repairof single-stranded breaks in the DNA. Without functional proteins that repair DNA, the cell cycle continues to pass along defective and mutated genetic material that leads to aberrant daughter cells.

[0078] The APC gene encodes a tumor suppressor protein that negatively regulates the WNT signaling pathway. This regulation leads to enhancement of the formation of a complex that degrades p-catenin that is involved in the regulation and co-ordination of cell-cell adhesion and gene transcription. The APC mutation is present in familial adenomatous polyposis, an autosomal dominant disorder where thousands of colonic polyps develop with early onset of colon carcinoma. The tumor development is associated with a loss of a single normal APC allele.

[0079] The CDKN2A complex encodes two tumor suppressor proteins, p16 / INK4a, and ARF, which augments RB function and stabilizes p53, respectively. Loss-of-function germline mutations in this gene occur in autosomal dominant familial melanoma. A biallelic loss-of-function presents in multiple cancers including melanomas, leukemias, and carcinomas.

[0080] WT1 gene encodes for transcription factors required for normal genitourinary tissue development. Wilms tumor, pediatric kidney cancer, is associated with a germline loss-of-function mutation in this gene. Sporadic Wilms tumor also correlates with similar WT 1 mutations.

[0081] PTCH1 tumor suppressor gene encodes protein patched homolog 1 that negatively regulated the hedgehog signaling pathway. Gorlin syndrome is an autosomal dominant disorder that correlates with a germline loss-of-function mutation in this gene and has a high risk of developing basal cell carcinoma and medulloblastoma. Sporadic cases of basal cell carcinoma and medulloblastomas are frequently associated with acquired biallelic loss-of-function PTCH1 mutations.

[0082] VHL gene encodes a component of a ubiquitin ligase, which is involved in the degradation of hypoxia-induced factors (HIFs). These are transcription factors that alter the expression of genes in response to hypoxia. Von Hippel-Lindau syndrome, an autosomal dominant disorder, is associated with loss-of-function germline mutations of this gene and poses a high risk of developing renal cell carcinoma and pheochromocytoma.

[0083] There are a variety of suitable suicide genes known in the art. As used herein, the term “suicide gene” refers either 1) a gene encoding a protein that when activated by an inducer can cause cell death, including apoptosis, pyroptosis, or necroptosis; or 2) a gene encoding an enzyme that can convert a non-lethal prodrug into a lethal drug.

[0084] In some embodiments, the suicide gene encodes a chimeric version of a pro-apoptotic protein, such as a caspase, that has been modified to only dimerize in the presence of a small molecule inducer. A notable example is iCasp-9, which can be induced by AP1903.

[0085] In some embodiments, the suicide gene encodes an enzyme that converts a prodrug into a lethal drug. For example, herpes simplex virus thymidine kinase (HSV-tk) converts the prodrug ganciclovir (GCV) into GCV-triphosphate resulting in cell death by incorporation into replicating DNA.

[0086] In some embodiments, a combination of suicide genes are used for better safety and control.

[0087] Any tumor suppressor gene or oncogene can be used in the disclosed cells so long as their deletion or overexpression, alone or in combination with other gene modifications, can increase the clonal dominance of the cell. In some embodiments, the tumor suppressor gene comprises c-Cbl, PTEN, or any combination thereof.

[0088] Any cell capable of homing to or selectively associating with cancer cells can be used in the disclosed methods. In some embodiments, the cell is a cancer cell, such as a cancer cell from the subject. In some embodiments, the cell is any harvestable cancer cell. For example, for a subject with a leukemia, myeloid cells can be collected and modified according to the disclosed methods. In some embodiments, CD34+ cells are used for subjects with a leukemia, such as a myeloid leukemia. The disclosed scheme can also be used for solid tumors by implanting the modified cell into the solid tumor. The cell can therefore be autologous or allogeneic. In some embodiments, the cell is from a cell line.

[0089] In some embodiments, the method involves an adaptive treatment schedule (Figure 21 B). Adaptive therapy is a therapeutic approach that directly applies evolutionary principles in cancer cell populations. The adaptive approach requires that therapy be intermittently deployed to a cancer such that chemosensitive clones maximize their dominance and resistant clones remain subclonal. The kinetics of the dominant clone are monitored and therapy withdrawal is informed by predictive mathematical models, using kinetic parameters to maximize the fitness advantage of the sensitive clone. This approach is able to delay or prevent competitive release and expansion of resistant populations.

[0090] In some embodiments, the cell expresses a chimeric antigen receptor (CAR) polypeptide that targets a tumor antigen. However, in some embodiments, the cell is not CAR-T cell. The cell can also be engineered to express a chemokine receptor suitable to provide homing cues to the bone marrow, such as CXCR-4.

[0091] In some embodiments, the cell is further modified to express or encapsulate a diagnostic or therapeutic agent.

[0092] Therefore, also disclosed herein is a method for treating a cancer in a subject that involves isolating a cancer cell from the subject; genetically engineering the cancer cell to express a suicide gene; genetically engineering the cancer cell to knock out at least one tumor suppressor gene, over express at least one oncogene, or a combination thereof; administering the engineered cell back to the cancer of the subject; allowing the engineered cell to clonally expand; and administering to the subject an inducer of the suicide gene (or prodrug for the suicide gene) in an amount effective to promote cell death and a bystander effect in the cancer.

[0093] The disclosed method can be used in any cancer subject to the bystander effect. The bystander effect is mediated by dsDNA, and leukemic cells are particularly sensitive to the TLR / DAMP pathway. Therefore, in some embodiments, the cancer is a leukemia, such as a myeloid leukemia. In some embodiments the cancer is chronic myelomonocytic leukemia (CMML).

[0094] In some embodiments, the cancer is a sarcoma, lymphoma, leukemia, carcinoma, blastoma, or germ cell tumor. A representative but non-limiting list of cancers that the disclosed cells can be used to treat include lymphoma, B cell lymphoma, T cell lymphoma, mycosis fungoides, Hodgkin’s Disease, myeloid leukemia, bladder cancer, brain cancer, nervous system cancer, head and neck cancer, squamous cell carcinoma of head and neck, kidney cancer, lung cancers such as small cell lung cancer and non-small cell lung cancer, neuroblastoma / glioblastoma, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer, liver cancer, melanoma, squamous cell carcinomas of the mouth, throat, larynx, and lung, colon cancer, cervical cancer, cervical carcinoma, breast cancer, epithelial cancer, renal cancer, genitourinary cancer, pulmonary cancer, esophageal carcinoma, head and neck carcinoma, large bowel cancer, hematopoietic cancers; testicular cancer; colon and rectal cancers, prostatic cancer, and pancreatic cancer.Systems for Delivering Cargo

[0095] Compositions, systems, and methods for delivering cargo to a target cell are described for example in WO2021055855A1 , which is incorporated by reference in its entirety for these compositions, systems, and methods. These cargo delivering moieties are referred to herein as a “fusogen.”

[0096] In some embodiments, the compositions, systems, and methods for delivering cargo comprise one or more polynucleotides encoding one or more endogenous retroviral elements for forming a delivery vesicle and one or more capture moieties for packaging a cargo within the delivery vesicle. The one or moreendogenous retroviral elements for forming a delivery vesicle may comprise two or more of a retroviral gag protein, a retroviral envelope protein, a retroviral reverse transcriptase or a combination thereof. The retroviral gag protein alone, the retroviral envelope protein alone, or both the retroviral gag protein and retroviral envelope protein may be endogenous.

[0097] In some embodiments, the envelope protein comprises a cargobinding domain. In some embodiments, the cargo-binding domain is a hairpin loopbinding element. In some embodiments, the hairpin loop-binding element is an MS2 aptamer.

[0098] In some embodiments, the cargo comprises nucleic acids, proteins, a complex thereof, or a combination thereof. In some embodiments, the cargo is linked to one or more envelope proteins by a linker. In some embodiments, the linker is a glycine-serine linker. In some embodiments, the glycine-serine linker is (GGS)3(SEQ ID NO:7).

[0099] In some embodiments, the system further comprised a reverse transcriptase. In some embodiments, the one or more capture moieties comprise DNA-binding moieties, RNA-binding moieties, protein-binding moieties, or a combination thereof.

[0100] In some embodiments, the delivery vesicle is a virus-like particle (VLP). As used herein, the term “virus-like particle” (VLP) refers to a structure that in at least one attribute resembles a virus, but which has not been demonstrated to be infectious. A VLP may be a nonreplicating, noninfectious viral shell that contains a viral capsid but lacks all or part of the viral genome, in particular, the replicative components of the viral genome. VLPs are generally composed of one or more viral proteins, such as, but not limited to those proteins referred to as capsid, coat, shell, surface, and structural proteins (e.g., VPI, VP2). A VLP may also resemble the structure of a bacteriophage, being non-replicative and noninfectious, and lacking at least the gene or genes coding for the replication machinery of the bacteriophage, and also lacking the gene or genes encoding the protein or proteins responsible for viral attachment to or entry into the host.

[0101] In some embodiments, the system further comprises a targeting moiety, wherein the targeting moiety is capable of specifically binding to a target cell. In some embodiments, the targeting moiety comprises a membrane fusion protein. In some embodiments, the membrane fusion protein is the G envelope protein of vesicular stomatitis virus (VSV-G).

[0102] In some embodiments, the target cell is a mammalian cell. In some embodiments, the mammalian cell is a cancer cell. In some embodiments, themammalian cell is infected with a pathogen. In some embodiments, the pathogen is a virus.Retroviral Gag Protein

[0103] Group-specific antigen (gag) proteins are the core structural proteins or the major components of the retroviral capsid. The HIV pl7 matrix protein (MA) is a 17 kDa protein, of 132 amino acids, which comprises the N-terminus of the Gag polyprotein. It is responsible for targeting Gag polyprotein to the plasma membrane but also makes contacts with the HIV trans membrane glycoprotein gp41 in the assembled virus and may play a critical role in recruiting Env glycoproteins to viral budding sites.

[0104] Several studies have shown that expression of the gag gene alone in a number of systems results in the efficient assembly and release of membrane enveloped virions (Craven, R. C., et al. (1996). Dynamic interactions of the Gag polyprotein. Current Topics in Microbiology and Immunology 214, pp.65-94; Delchambre, M., et al. (1989). The Gag precursors of simian immunodeficiency virus assemble into virus-like particles. EMBO 8, pp.2653-60; Dickson, C., et al. (1984). “Protein biosynthesis and assembly,” RNA tumor viruses (R. Weiss, N. Teich, H. Varmus, and J. Coffin, Eds.), Vol. 1 , pp. 513-648. 2 vols. Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y.; Gheysen, H. P., et al. (1989), “Assembly and release of HIV-1 precursor Pr55gag virus-like particles from recombinant baculovirus- infected insect cells,” Cell 59, pp.103-12; Haffar, O., et al. (1990), “Human immunodeficiency virus-like, non-replication, Gag-Env particles assemble in a recombinant vaccinia virus expression system,” J. Virol. 64, pp.2653-59; Hunter, E. (1994), “Macromolecular interactions in the assembly of HIV and other retroviruses,” Sem. in Virology 5, pp.71-83; Krausslich, H - G., et al. (1996), “Intracellular transport of retroviral capsid components,” Current Topics in Microbiology and Immunology 214, pp.25-64; Madisen, L., et al. (1987), “Expression of the human immunodeficiency virus gag gene in insect cells,” Virology 158, pp.248-250; Smith, A. J., et al. (1990), “Human immunodeficiency virus type 1 Pr55gag and Prl60gag-pol expressed from a simian virus 40 late-replacement vector are efficiently processed and assembled into virus-like particles,” J. Virol. 64, pp.2743-50; Sommerfelt, M. A., et al. (1992), “Importance of the pl2 protein in Mason-Pfizer monkey virus assembly and infectivity,” J. Virol. 66, pp.7005-11 ; Wills, J. W., et al. (1989), “Creation and expression of myristylated forms of Rous sarcoma virus Gag protein in mammalian cells,” J. Virol. 63, pp.4331-43). Thus, the product of this gene has the necessary structural information to mediate intracellular transport, to direct assembly into the capsid shell, and to catalyze the process of membrane extrusion known as budding.

[0105] Once Gag is translated, Gag polyproteins are myristoylated at their N- terminal glycine residues by N-myristoyltransf erase 1 , a modification that is critical for plasma membrane targeting. In the membrane-unbound form, the MA myristoyl fatty acid tail is sequestered in a hydrophobic pocket in the core of the MA protein. Recognition of plasma membrane proteins by MA activates a "myristoyl switch", wherein the myristoyl group is extruded from its hydrophobic pocket in MA and embedded in the plasma membrane.

[0106] The HIV nucleocapsid protein (NC) is a 7 kDa zinc finger protein in the Gag polyprotein and which, after viral maturation, forms the viral nucleocapsid. NC recruits full- length viral genomic RNA to nascent virions.

[0107] The neuronal gene Arc bears homology to the Gag component of Ty3 / gypsy retrotransposons and exhibits biochemical properties that are reminiscent of retroviral Gag proteins. The Arc protein assembles into virus-like capsids both in cells and when recombinantly expressed in bacteria. Arc capsids are able to encapsulate their own mRNA, mediating their intercellular transfer in extracellular vesicles. Purified Arc proteins may be used to reconstitute capsids with different DNA or RNA or proteins or some mixture thereof and can be packaged into the capsid for delivery into cells. In some embodiments, capsids may be assembled using lipids to aid uptake by cells. Various embodiments may utilize different Arc orthologs.

[0108] In some embodiments, the polynucleotides described herein may comprise a Gag- homology protein or functional domain thereof. The term “functional domain” refers to a polypeptide sequence that has an activity other than binding to the nucleic acid sequence recognized by the nucleic acid-binding domain. By combining a nucleic acid-binding domain with one or more effector domains, the polypeptides of the invention may be used to target the one or more functions or activities mediated by the effector domain to a particular target DNA sequence to which the nucleic acid-binding domain specifically binds.

[0109] Molecular and genetic determinants of Gag-mediated intercellular communication may be determined by characterizing the mechanisms of capsid- mediated intercellular mRNA transfer, with particular focus on features that could enable use of this system for programmable delivery of cargo. Different Gag proteins evolved diverse RNA-binding domains for mediating specific encapsidation of their RNA genomes. The RNA-binding sequence specificity of the human Gag homology proteins can be tested through protein pull down and sequencing of associated RNA and / or through sequencing of the extracellular vesicle fraction from HEK293 cells that over-express each protein. The nucleic-acid-binding domains can be swapped between proteins, or additional RNA-binding domains with known specificity can befused to test the extent to which binding specificity can be reprogrammed. Accordingly, the Gag-homology protein or functional domain thereof can comprise both the export compartment domain and nucleic acid-binding complain.

[0110] The Gag-homology protein can be selected from Arc, ASPRV1 , a Sushi-Class protein, a SCAN protein, or a PNMA protein. In particular instances, the Gag-homology protein is a PNMA protein, for example, ZCC18, ZCH12, PNM8B, PNM6A, PNMA6EJ2, PMA6F, PMAGE, PNMAI, PNMA2, PNM8A, PNMA3, PNMA4, PNMA5, PNMA6, PNMA7, PNMAI, MOAPI, or CCD8. In embodiments, the Gaghomology protein is an Arc protein, in certain embodiments, hARC or dARCI. The Gag-homology protein can comprise ASPRV1. In other instances, the Gag-homology protein is PEG 10, RTL3, RTL10, or RTL1. In certain embodiments, the Gag Homology protein is a SCAN protein, for example, PGBD1. In instances, the PEG 10 Gag homology protein is PEG10J6 or PEG10J2.

[0111] In some embodiments, the Gag-homology protein or functional domain thereof may comprise both the export compartment domain and the nucleic acid-binding domain. In specific embodiments, the nucleic acid binding-domain may be modified relative to the native nucleic acid-binding domain of the Gag-homology protein. In specific embodiments, the nucleic acid binding domain may be a nonnative nucleic acid-binding domain relative to the Gag- homology protein. In some embodiments, the Gag-homology protein may be Arc or a paraneoplastic Ma antigen (PNMA) protein.

[0112] In some embodiments, the recombinant GAG-like proteins may be expressed and purified from bacteria, yeast, insect cells, or mammalian cells. The recombinant GAG-like proteins may be purified under denaturing conditions and transferred to non-denaturing conditions by buffer exchange.

[0113] In some embodiments, the retroviral gag protein is endogenous. In some embodiments, the retroviral gag protein may contain the NC and MA domains. In some embodiments, the retroviral gag protein may be a gag-homology protein, as described herein.

[0114] In some embodiments, the gag-homology protein may include, but is not necessarily limited to, Arcl, Asprvl, PNMA1 , PNMA3, PNMA4, PNMA5, PNMA6, PNMA7, PEG10, RTL1 , MOAPI, or ZCCHC12. In specific embodiments, the gaghomology protein is Arcl, PNMA6a, or PNMA3. In specific embodiments, the gaghomology protein is PEG10.

[0184] In some embodiments, the gag-homology protein may contain a DNA-binding motif. As a specific example, and as discussed in Example 4, PEG10 comprises a DNA binding motif that allows for packaging of DNA of specific sequences.

[0115] As any person of skill in the art would appreciate, any of the systems described herein can be further engineered to a minimal set of components and be applied to any suitable endogenous element. As described in Examples 3 and 4 and Figures 56-70, use of PEG 10 is just an example approach that can be followed with any other endogenous element.Retroviral Env Protein

[0116] Env is a retroviral gene that encodes the protein that forms the viral envelope. The expression of the env gene allows retroviruses to target and attach to specific cell types, and to infiltrate the target cell membrane. The structure and sequence of several different env genes suggests that Env proteins are type 1 fusion machines. Type 1 fusion machines initially bind a receptor on the target cell surface, which triggers a conformational change, allowing for binding of the fusion protein. The fusion peptide inserts itself in the host cell membrane and brings the host cell membrane very close to the viral membrane, allowing for membrane fusion. The sequence of the env gene may differ significantly between retroviruses, however, the gene is always located downstream of gag, pro, and pol. The env mRNA has to be spliced to be expressed.

[0117] Env not only mediates virus entry into cells, but is also a major target for both cellular and antibody responses. It is synthesized as a precursor molecule, gpl60, which is subsequently processed into the surface subunit (SU) gpl20 and the transmembrane subunit (TM) gp41 by a cellular protease, and exists as a trimer of gpl20-gp41 heterodimers on viral or cell membranes. The SU protein domain determines the tropism of the virus because it is responsible for the receptor-binding function of the virus. The SU domain therefore determines the specificity of the virus for a single receptor molecule. gpl20 interacts with receptor and coreceptor molecules for HIV and mediates virus attachment to the cell, while gp41 causes subsequent fusion between viral and cell membranes for releasing viral core components into the cell during the initial infection process. The TM protein consists of three distinct domains: the extracellular domain, the transmembrane domain, and the cytoplasmic domain.

[0118] In some embodiments, the retroviral envelope protein is endogenous. In some embodiments, the envelope protein may be from a Gammaretrovirus. In some embodiments, the envelope protein may be from a Deltaretrovirus. In some embodiments, the envelope protein may be selected from, but is not necessarily limited to, envHI, envH2, envH3, envKI, envK2_l, envK2_2, envK3, envK4, envK5, envK6, envT, envW, envWI, envfrd, envR(b), envR, envF(c)2, or envF(c)l.

[0119] In some embodiments, the envelope protein may comprise a cargobinding domain. In some embodiments, the cargo-binding domain is a hairpin loopbinding element. In some embodiments, the hairpin loop-binding element is an MS2 aptamer.

[0120] In some embodiments, the retroviral gag protein and the retroviral envelope protein are both endogenous. In some embodiments, the gag protein is endogenous and the envelope protein is of viral origin. In some embodiments, the envelope protein is endogenous and the gag protein is of viral origin.Capture Moieties

[0121] In some embodiments, the vesicles comprise one or more capture moieties, e.g., for packaging a cargo and / or recruiting specific cargo(s) into the vesicle. The term “nucleic acid capture moiety” or simply “capture moiety”, as used herein, refers to a moiety which binds selectively to a target molecule. Optionally, the moiety can be immobilized on an insoluble support, as in a microarray or to microparticles, such as beads. When used as a primer, a probe of the invention would likely not be anchored to a solid support. A capture moiety can “capture” a target molecule by hybridizing to the target and thereby immobilizing the target. In cases wherein the moiety itself is immobilized, the target too becomes immobilized. Such binding to a solid support may be through a linking moiety, which is bound to either the capture moiety or to the solid support.

[0122] The capture moiety may comprise one or more genes endogenous to the polynucleotide or plasmid, for example genes capable of recruiting the plasmid into the vesicle. The capture moiety may comprise exogenous genes or may comprise molecules capable of recruiting or capturing cargo molecules for the vesicles. In some examples, the capture moieties may interact with the cargo. The capture moieties may be nucleic acid-binding molecules, e.g., DNA, RNA, DNA- binding proteins, RNA-binding proteins, or a combination thereof. In some embodiments, the capture moieties may be protein-binding molecules, e.g., DNA, RNA, antibodies, nanobodies, antigens, receptors, ligands, fragments thereof, or a combination thereof. The capture moieties can be fused to endogenous genes or exogenous genes.

[0123] In some embodiments, the one or more capture moieties comprise DNA-binding moieties, RNA-binding moieties, protein-binding moieties, or a combination thereof.

[0124] In certain embodiments, the capture moiety may be labelled, as with, e.g., a fluorescent moiety, a radioisotope (e.g., 32P), an antibody, an antigen, a lectin, an enzyme (e.g., alkaline phosphatase or horseradish peroxidase, which canbe used in calorimetric methods), chemiluminescence, bioluminescence or other labels well known in the art. In certain embodiments, binding of a target strand to a capture moiety can be detected by chromatographic or electrophoretic methods. In embodiments in which the capture moiety does not contain a detectable label, the target nucleic acid sequence may be so labelled, or, alternatively, labelled secondary probes may be employed. A “secondary probe” includes a nucleic acid sequence which is complementary to either a region of the target nucleic acid sequence or to a region of the capture moiety. Region G of a probe (which will most often not be complementary to the target), might be useful in capturing a secondary labelled nucleic acid probe.

[0125] In some embodiments, the capture moiety is a nucleic acid hairpin. The terms "nucleic acid hairpin", "hairpin capture moiety", or simply "hairpin", as used herein, refer to a unimolecular nucleic acid-containing structure which comprises at least two mutually complementary nucleic acid regions such that at least one intramolecular duplex can form. Hairpins are described in, for example, Cantor and Schimmel, "Biophysical Chemistry", Part III, p. 1183 (1980). In certain embodiments, the mutually complementary nucleic acid regions are connected through a nucleic acid strand; in these embodiments, the hairpin comprises a single strand of nucleic acid. A region of the capture moiety which connects regions of mutual complementarity is referred to herein as a "loop" or "linker". In some embodiments, a loop comprises a strand of nucleic acid or modified nucleic acid. In some embodiments, the linker is not a hydrogen bond. In other embodiments, the loop comprises a linker region which is not nucleic-acid-based; however, capture moieties in which the loop region is not a nucleic acid sequence are referred to herein as hairpins. Examples of non-nucleic-acid linkers suitable for use in the loop region are known in the art and include, for example, alkyl chains (see, e.g., Doktycz et al. (1993) Biopolymers 33:1765). While it will be understood that a loop can be a singlestranded region of a hairpin, for the purposes of the discussion below, a "singlestranded region" of a hairpin refers to a non-loop region of a hairpin. In embodiments in which the loop is a nucleic acid strand, the loop preferably comprises 2-20 nucleotides, more preferably 3-8 nucleotides. The size or configuration of the loop or linker is selected to allow the regions of mutual complementarity to form an intramolecular duplex. In preferred embodiments, hairpins useful in the present invention will form at least one intramolecular duplex having at least 2 base-pairs, more preferably at least 4 base-pairs, and still more preferably at least 8 base-pairs. The number of base-pairs in the duplex region, and the base composition thereof can be chosen to assure any desired relative stability of duplex formation. For example,to prevent hybridization of non-target nucleic acids with the intramolecular duplex - forming regions of the hairpin, the number of base-pairs in the intramolecular duplex region will generally be greater than about 4 base-pairs. The intramolecular duplex will generally not have more than about 40 base-pairs. In preferred embodiments, the intramolecular duplex is less than 30 base-pairs, more preferably less than 20 basepairs in length.

[0126] A hairpin may be capable of forming more than one loop. For example, a hairpin capable of forming two intramolecular duplexes and two loops is referred to herein as a "double hairpin". In preferred embodiments, a hairpin will have at least one single-stranded region which is substantially complementary to a target nucleic acid sequence. "Substantially complementary" means capable of hybridizing to a target nucleic acid sequence under the conditions employed. In preferred embodiments, a "substantially complementary" single- stranded region is exactly complementary to a target nucleic acid sequence. In preferred embodiments, hairpins useful in the present invention have a target-complementary single- stranded region having at least 5 bases, more preferably at least 8 bases. In preferred embodiments, the hairpin has a target-complementary single-stranded region having fewer than 30 bases, more preferably fewer than 25 bases. The target- complementary region will be selected to ensure that target strands form stable duplexes with the capture moiety. In embodiments in which the capture moiety is used to detect target strands from a large number of non-target sequences (e.g., when screening genomic DNA), the target-complementary region should be sufficiently long to prevent binding of non-target sequences. A target-specific singlestranded region may be at either the 3' or the 5' end of the capture moiety strand, or it may be situated between two intramolecular duplex regions (for example, between two duplexes in a double hairpin).

[0127] Also disclosed is a delivery vesicle comprising one or more components encoded in the one or more polynucleotides in the engineered delivery system described herein. In some embodiments, the one or more components of the delivery vesicle comprise two or more of a retroviral gag protein, a retroviral envelope protein, a retroviral reverse transcriptase, or a combination thereof.

[0128] In some embodiments, the Gag-homology protein or functional domain thereof may comprise both the export compartment domain and the nucleic acid-binding domain. In specific embodiments, the nucleic acid binding-domain may be modified relative to the native nucleic acid-binding domain of the Gag-homology protein. In specific embodiments, the nucleic acid binding domain may be a nonnative nucleic acid-binding domain relative to the Gag- homology protein. In someembodiments, the Gag-homology protein may be Arc or a paraneoplastic Ma antigen (PNMA) protein.

[0129] In some embodiments, the vesicle comprises a cell-specific targeting moiety. In some embodiments, the cell-specific targeting moiety targets a mammalian cell. In some embodiments, the cell-specific targeting moiety comprises a membrane fusion protein. In some embodiments, the membrane fusion protein is VSV-G.

[0130] In some embodiments, the mammalian cell is a cancer cell. In some embodiments, the mammalian cell is infected with a pathogen. In some embodiments, the pathogen is a virus.Synthetic Introns

[0131] In some embodiments, the RNA therapeutic is a synthetic intron. For example, artificial nucleic acid introns configured for selective splicing in cells with aberrant RNA splicing activity, e.g., neoplastic cells, are disclosed in WO2022087427A1 , which is incorporated by reference in its entirety for these introns and methods of use thereof.

[0132] In some embodiments, the artificial intron can comprise a 5' splice site, a canonical 3' splice site, at least one cryptic 3' splice site, a pyrimidine-rich domain, and at least one branchpoint. Also provided are constructs integrating the artificial introns with exons in a configuration that, when the artificial intron is spliced out by the aberrant RNA splicing factors, encode a functional protein.

[0133] In some embodiments, the disclosure provides an artificial nucleic acid construct comprising an intron. The intron comprises: a 5' splice site; a canonical 3' splice site; at least one cryptic 3' splice site, that is within about 100 nucleotides upstream of the canonical 3' splice site or within about 50 nucleotides downstream of the canonical 3' splice site; a pyrimidine-rich domain comprising at least 6 consecutive nucleotides, wherein the sequence of the pyrimidine-rich domain is at least 60% pyrimidine nucleotides, and wherein the pyrimidine-rich domain is within at least 50 nucleotides of a cryptic 3' splice site; and at least one branchpoint at least 15 nucleotides upstream of the canonical 3' splice site.

[0134] In some embodiments, the intron is at least about 50 nucleotides to about 1000 nucleotides in length.

[0135] In some embodiments, the intron is derived from a human wildtype intron selected from intron 1 of MTERFD3, intron 4 of MY015B, intron 10 of SYTL1 , intron 11 of SYTL1 , intron 4 of MAP3K7, intron 1 of ORAI2, and intron 1 of TMEM14C. In some embodiments, the intron is derived from a human wildtype intron 1 of MTERFD3, and wherein the intron further comprises one, two, three, or more of the following features: a 5' splice site comprising a GT dinucleotide immediatelyfollowed by a consensus 5' splice site context, optionally wherein the consensus 5' splice site context includes one of AAG, GAG, GTG, and the like; a canonical 3' splice site comprising an AG dinucleotide immediately preceded by a C or T; at least one cryptic 3' splice site, located at least 5 nucleotides upstream of the canonical 3' splice site, with an AG dinucleotide and comprising a sequence that is a weaker 3 splice site than is the canonical 3 splice site, where splice site strength is estimated with the MaxEntScan algorithm or similar methods; a pyrimidine-rich domain comprising at least 15 consecutive nucleotides, wherein the sequence of the pyrimidine-rich domain is at least 60% pyrimidine nucleotides and at least 40% thymine nucleotides, and wherein the pyrimidine-rich domain is within at least 30 nucleotides of a cryptic 3' splice site; and at least one branchpoint at least 20 nucleotides upstream of the canonical 3' splice site. In some embodiments, the intron has a 5' end domain with about 10 to about 150 nucleotides having at least 50% sequence identity to a sequence of the 5'-most 10 to about 150 nucleotides of the wildtype intron. In some embodiments, the intron has a 3' end domain with about 50 to about 350 nucleotides having at least 50% sequence identity to a sequence of the 3'-most 50 to about 350 nucleotides of the wildtype intron.

[0136] In some embodiments, the 5' splice site comprises a sequence selected from GTGAG, GTAAG, GTGCG, GTACG, GTGGG, GTAGG, GTGTG, GTATG, and GTATC. In some embodiments, the canonical 3' splice site comprises a sequence selected from AAG, CAG, and TAG. In some embodiments, the at least one cryptic 3' splice site comprises a sequence selected from AAG, CAG, GAG, TAG, ATG, CTG, GTG, and TTG. In some embodiments, the intron comprises a plurality of cryptic 3' splice sites within about 100 nucleotides upstream of the canonical 3' splice site or within about 100 nucleotides downstream of the canonical 3' splice site, and wherein each of the plurality of the cryptic 3' splice sites comprises a sequence independently selected from AAG, CAG, GAG, TAG, ATG, CTG, GTG, and TTG.

[0137] In some embodiments, the at least one branchpoint is at least 20 nucleotides upstream of the canonical 3' splice site, and wherein the branchpoint nucleotide is an adenine. In some embodiments, the branchpoint and surrounding sequence context has sequence identity of at least 60% to the sequence tactaAca, where the uppercase A is the branchpoint nucleotide.

[0138] In some embodiments, the intron is configured to be spliced differently in a cancer cell comprising a change-of- function or loss-of-function mutation in a recurrently mutated RNA splicing factor gene relative to the splicing pattern of the intron in a cell lacking a change-of-function or loss-of-function mutation in arecurrently mutated RNA splicing factor gene. In some embodiments, the RNA splicing factor gene is SF3B1. In some embodiments, the recurrent change-of- function mutation in SF3B1 results in an amino acid substitution selected from E592K, E622D, E622Q, E622V, Y623C, R625C, R625G, R625H, R625L, N626D, N626S, N626Y, A633V, H662Q, H662R, T663P, K666E, K666M, K666N, K666Q, K666R, K666T, K700E, V701 F, R702Q, I704F, G740E, G742D, A762V, Y765C, D781E, D781G, M784I, E802Q, M971T, M971V, and combinations thereof, with reference to the wild-type amino acid sequence.

[0139] In some embodiments, the nucleic acid construct further comprises a first exon domain and a second exon domain, wherein the intron is disposed between the first exon domain and the second exon domain. In some embodiments, the combination of the first exon domain and the second exon domain without the intron encodes part or all of a protein of interest. In some embodiments, the nucleic acid intron construct comprises an expression cassette comprising the first exon domain, the intron, the second exon domain, and a promoter sequence operatively linked thereto.

[0140] In some embodiments, the disclosure provides a method of generating an artificial nucleic acid construct with an intron, e.g., an artificial intron. The method comprises:

[0141] (1) ligating a 5' end domain of a human wildtype intron to a 3' end domain of the human wildtype intron to provide an abbreviated intron that lacks an interior sequence, wherein the 5' end domain comprises about 10 to about 150 nucleotides of the 5' end sequence of the human wildtype intron, and wherein the 3' end domain comprises about 50 to about 350 nucleotides of the 3' end sequence of the human wildtype intron;

[0142] (2) implementing one or more sequence modifications to the abbreviated intron sequence to provide a first plurality of artificial introns derived from the abbreviated intron sequence;

[0143] (3) selecting artificial introns from the first plurality of artificial introns that conform to at least three of the following parameters: a 5 splice site; a canonical 3' splice site; at least one cryptic 3' splice site, that is within about 100 nt nucleotides upstream of the canonical 3' splice site or within about 50 nt nucleotides downstream of the canonical 3' splice site; a pyrimidine-rich domain comprising at least 6 consecutive nucleotides, wherein the sequence of the pyrimidine-rich domain is at least 60% pyrimidine nucleotides, and wherein the pyrimidine-rich domain is within at least 50 nucleotides of a cryptic 3' splice site; and at least one branchpoint at least 15 nucleotides upstream of the canonical 3' splice site.

[0144] In some embodiments, the one or more sequence modifications comprises one or more of the following in any combination or order: (a) mutating a single nucleotide; (b) mutating any pair of nucleotides within 10 nucleotides of the 5' end of the abbreviated intron sequence or 30 nucleotides of the 3' end of the abbreviated intron sequence; (c) deleting any consecutive stretch of 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 125, 150, 200, or 250 nucleotides; (d) mutating any pair of nucleotides within the 5 nt nucleotides upstream of and 2 nucleotides downstream of each branchpoint; (e) mutating any combination of branchpoints to guanine; (f) mutating any combination of multiple adenines to guanines; (g) mutating any combination of branchpoint contexts to strong branchpoint contexts, optionally wherein the strong branchpoint context comprises a sequence with a sequence identity of at least 50% to the sequence tactaAca, where A is a branchpoint nucleotide and tacta_ca is a context sequence; (h) mutating any four consecutive nucleotides to cAGg; (i) inserting a polypynmidine tract immediately followed by a 3 splice site at any position; (j) mutating any consecutive stretch of nucleotides to one or more thymines; (k) mutating all pyrimidines within any six or more consecutive positions to guanines; (1) inserting a strong branchpoint and flanking sequence context at any position; (m) inserting one or more intronic splicing enhancers at any position; and (n) inserting one or more intronic splicing silencers at any position.

[0145] In some embodiments, the polypyrimidine tract immediately followed by a 3' splice site comprises at least 6 consecutive nucleotides containing at least 4 pyrimidines, immediately followed by a sequence selected from AAG, CAG, GAG, TAG, ATG, CTG, GTG, or TTG, and the like. In some embodiments, the strong branchpoint and flanking sequence context comprises a sequence with a sequence identity of at least 50% to the sequence tactaAca, where uppercase indicates the branchpoint, and the like. In some embodiments, the one or more intronic splicing enhancers are selected from GGGTTT, GGTGGT, TTTGGG, GAGGGG, GGTATT, GTAACG, and the like. In some embodiments, the one or more intronic splicing silencers are selected from CACACCA, CTCCTC, TACAGCT, CTTCAG, GAACAG, CAAAGGA, AGATATT, ACATGA, AATTTA, AGTAGG, and the like.

[0146] In some embodiments, the method further comprises introducing the modified target nucleic acid molecule to a cancer cell with a mutation in an RNA splicing factor gene and permitting expression, or alternately selective lack of expression, of the protein of interest.

[0147] In some embodiments, the target nucleic acid molecule is a gene in the chromosome of a cell, wherein the gene encodes a protein of interest, and the modified target nucleic acid molecule is configured for selective expression, oralternately selective lack of expression, in a cell characterized by a mutation in an RNA splicing factor gene. In some embodiments, the cell is a cancer cell and the mutation in an RNA splicing factor gene is a change-of-function or loss-of-function mutation in a recurrently mutated RNA splicing factor gene; wherein the artificial intron sequence is configured to be spliced differently in a cancer cell comprising the change-of-function or loss-of-function mutation in the recurrently mutated RNA splicing factor gene, relative to the splicing pattern of the intron in a cell lacking the change-of-function or loss-of-function mutation in the recurrently mutated RNA splicing factor gene; wherein the different splicing pattern of the artificial intron sequence results in production of different mature transcripts of the modified target nucleic acid molecule in a cancer cell comprising the change-of-function or loss-of- function mutation in the recurrently mutated RNA splicing factor gene, relative to the splicing pattern of the intron in a cell lacking the change-of-function or loss-of- function mutation in the recurrently mutated RNA splicing factor gene; and wherein the production of different mature transcripts of the modified nucleic acid molecule permits either selective expression, or alternately selective lack of expression, of a desired protein from the target nucleic acid molecule in the cancer cell, and the opposite pattern in a cell lacking the change-of-function or loss-of-function mutation in the recurrently mutated RNA splicing factor gene. In some embodiments, the RNA splicing factor gene is SF3B1 .

[0148] In some embodiments, upon splicing of the at least one artificial nucleic acid intron from the gene transcript in a cancer cell the CDS encodes a functional therapeutic protein. In some embodiments, the functional therapeutic protein is a suicide gene, toxin, chemokine, cytokine, growth factor, targetable cellsurface protein, targetable antigen, druggable enzyme, detectable marker, and the like.

[0149] In some embodiments, the functional therapeutic protein is a chemokine, cytokine, or growth factor, and wherein the chemokine, cytokine, or growth factor stimulates an increased immune response against the cancer cell.

[0150] In some embodiments, the functional therapeutic protein is a druggable enzyme. A druggable enzyme is an enzyme that is ideally not substantially prevalent in healthy cells, but when expressed presents a target for a known therapeutic, which can be additionally administered to the specific detriment of the cancer cell expressing the druggable enzyme target. Various druggable enzymes and their associated therapeutics are known and are encompassed by this disclosure. Non-limiting examples are provided below.

[0151] In one embodiment, the druggable enzyme is herpes simplex virus thymidine kinase and the method further comprises administering to the subject an effective amount of ganciclovir. For example, a CDS for herpes simplex virus thymidine kinase (HSV-TK) can be divided by the disclosed artificial introns in an expression cassette. When transcribed and properly spliced in leukemic and melanoma cells with a change of function mutation in the RNA splicing factor gene SF3B1 , the exons are combined in the mRNA leading to proper expression of the HSV-TK protein in the cells. Upon treatment with ganciclovir, the cells are selectively killed compared to cells not properly expressing the HSV-TK (i.e., cell not receiving the expression cassette or cells with receiving the expression cassette but having wild-type SF3B1).

[0152] In one embodiment, the druggable enzyme is cytosine deaminase and the method further comprises administering to the subject an effective amount of 5- fluorocytosine. In one embodiment, the druggable enzyme is nitroreductase and the method further comprises administering to the subject an effective amount of CB1954 or analogs thereof. In one embodiment, the druggable enzyme is carboxypeptidase G2 and the method further comprises administering to the subject an effective amount of CMDA, ZD-2767P, and the like. In one embodiment, the druggable enzyme is purine nucleoside phosphorylase and the method further comprises administering to the subject an effective amount of 6- methylpurine deoxyriboside, and the like. In one embodiment, the druggable enzyme is cytochrome P450 and the method further comprises administering to the subject an effective amount of cyclophosphamide, ifosfamide, and the like. In one embodiment, the druggable enzyme is horseradish peroxidase and the method further comprises administering to the subject an effective amount of indole- 3 -acetic acid, and the like. In one embodiment, the druggable enzyme is carboxylesterase and the method further comprises administering to the subject an effective amount of irinotecan, and the like.RNA therapeutics

[0153] In some embodiments, the RNA therapeutic is a mRNA, sgRNA, siRNA, shRNA, miRNA, tRNA, rRNA, snRNA, or IncRNA. The polynucleotides may include natural nucleotides, modified nucleotides, analogs of natural nucleotides, such as labeled nucleotides, or any combination thereof.

[0154] In some embodiments, the RNA therapeutic is a genetic modulating agent. In some embodiments, the genetic modulating agent comprises one or more components of a gene editing system and / or polynucleotides encoding thereof. In some embodiments, the gene editing system is a CRISPR-Cas system. In someembodiments, the CRISPR-Cas system is a Type II, Type V, or Type VI CRISPR- Cas system. In some embodiments, the Type II CRISPR-Cas system comprises CRISPR-Cas9. In some embodiments, the Type V CRISPR-Cas system comprises CRISPR- Casl2. In some embodiments, the Type VI CRISPR-Cas system comprises CRISPR-Casl3. In some embodiments, a Cas protein of the CRISPR-Cas system may be modified to bind to a binding domain of the envelope protein. In some embodiments, a guide molecule of the CRISPR-Cas system is modified to bind to a binding domain of the envelope protein. In some embodiments, the modification comprises incorporation of a hairpin loop that binds to a hairpin-binding element on the envelope protein. In some embodiments, the hairpin loop may be recognized by the MS2 aptamer.Nuclear Targeting Sequences

[0155] In some embodiments, the disclosed RNA therapeutics further comprise a nuclear retention RNA sequence, such as a nuclear retention sequence derived from naturally occurring RNAs that are exclusively found in the nucleus. Examples of nuclear retention sequences are described for example in Lubelsky, Y. & Ulitsky, I. Nature 2018 555:107-111 and Trenkmann, M, et al. Nature Reviews Genetics 2018 19:188-189, which are incorporated by reference in its entirety for the teaching of these sequences.

[0156] In some embodiments, the nuclear retention sequence is a long noncoding RNA (IncRNA) enriched in Alu repeats and / or SIRLOIN motif. For example, in some embodiments, the nuclear retention sequence is metastasis-associated lung adenocarcinoma transcript 1 (MALAT1). In some embodiments, the nuclear retention sequence is

[0157] In some embodiments, the retention sequence is present on the 3’ end of the RNA therapeutic.Specific Embodiments

[0158] Embodiment 1 . A chimeric cell for treating cancer, comprising a cell genetically engineered to express an inducible suicide gene and genetically engineered with at least one tumor suppressor gene knocked out.

[0159] Embodiment 2. The chimeric cell of embodiment 1 , wherein the at least one tumor suppressor gene is knocked out by insertion of the suicide gene in the tumor suppressor gene locus.

[0160] Embodiment 3. The chimeric cell of embodiment 1 or 2, wherein the tumor suppressor gene comprises c-Cbl, PTEN, or any combination thereof.

[0161] Embodiment 4. The chimeric cell of any one of embodiments 1 to 3, wherein the inducible suicide gene comprises inducible caspase 9 (iCasp9).

[0162] Embodiment 5. The chimeric cell of any one of embodiments 1 to 4, wherein the cell is a myeloid cell.

[0163] Embodiment 6. The chimeric cell of any one of embodiments 1 to 5, wherein the cell expresses a chimeric antigen receptor (CAR) polypeptide that targets a tumor antigen.

[0164] Embodiment 7. The chimeric cell of any one of embodiments 1 to 6, wherein the cell is a cancer cell.

[0165] Embodiment 8. The chimeric cell of any one of embodiments 1 to 7, wherein the cell is autologous.

[0166] Embodiment 9. The chimeric cell of any one of embodiments 1 to 7, wherein the cell is allogeneic.

[0167] Embodiment 10. The chimeric cell of any one of embodiments 1 to 7, wherein the cell is a cell line.

[0168] Embodiment 11. The chimeric cell of any one of embodiments 1 to 10, wherein the cell is further genetically engineered to overexpress a chemokine receptor.

[0169] Embodiment 12. The chimeric cell of embodiment 11 , wherein the chemokine receptor is CXCR-4.

[0170] Embodiment 13. The chimeric cell of any one of embodiments 1 to 12, wherein the cell is further engineered to express or encapsulate one or more diagnostic or therapeutic agents.

[0171] Embodiment 14. The chimeric cell of any one of embodiments 1 to 12, wherein the cell is further engineered to secrete an RNA therapeutic.

[0172] Embodiment 15. The chimeric cell of embodiment 14, wherein the cell comprise(a) a first polynucleotide encoding retroviral elements that preferentially binds and facilitates formation and secretion of vesicles carrying its own RNA messenger operably linked to a first expression control sequence;(b) a second polynucleotide encoding the RNA therapeutic having a nuclear retention sequence that is flanked by packaging signals for the retroviral elements operably linked to a second expression control sequence; and(c) a third polynucleotide encoding a membrane fusion protein operably linked to a third expression control sequence.

[0173] Embodiment 16. The chimeric cell of embodiment 15, wherein the retroviral elements for forming a delivery vesicle comprises two or more of a retroviral gag protein, a retroviral envelope protein, a retroviral reverse transcriptase or a combination thereof.

[0174] Embodiment 17. The chimeric cell of embodiment 16, wherein the retroviral gag protein is a gag-homology protein.

[0175] Embodiment 18. The chimeric cell of embodiment 17, wherein the gag-homology protein is Paternally expressed gene 10 (PEG10).

[0176] Embodiment 19. The chimeric cell of any one of embodiments 15 to 18, wherein the nuclear retention sequence is a portion of a long non-coding RNA (IncRNA) enriched in Alu repeats and / or a SIRLOIN motif.

[0177] Embodiment 20. The chimeric cell of embodiment 19, wherein the nuclear retention sequence has the nucleic acid sequence SEQ ID NO:5.

[0178] Embodiment 21. The chimeric cell of any one of embodiments 15 to 20, wherein the RNA therapeutic comprises a synthetic intron.

[0179] Embodiment 22. The chimeric cell of embodiment 21 , wherein the RNA therapeutic encodes a herpes simplex virus thymidine kinase (HSV-TK) when the synthetic intron is spliced by a mutant spliceosome.

[0180] Embodiment 23. The chimeric cell of embodiment 22, wherein the RNA therapeutic comprises the nucleic acid sequence SEQ ID NO:4.

[0181] Embodiment 24. The chimeric cell of any one of embodiments 15 to23, wherein the packaging signals for the retroviral elements comprises 5’ UTR and 3’ UTR for PEG 10.

[0182] Embodiment 25. The chimeric cell of any one of embodiments 15 to24, wherein the membrane fusion protein is the G envelope protein of vesicular stomatitis virus (VSV-G).

[0183] Embodiment 26. The chimeric cell of any one of embodiments 15 to25, wherein the first, second and third polynucleotides are present in separate vectors.

[0184] Embodiment 27. The chimeric cell of any one of embodiments 15 to26, wherein the first, second and third polynucleotides are present in a single vector.

[0185] Embodiment 28. The chimeric cell of embodiment 27, having the nucleic acid sequence SEQ ID NO:6.

[0186] Embodiment 29. The chimeric cell of any of embodiments 15 to 28, wherein the delivery vesicle is a virus-like particle.

[0187] Embodiment 30. A method for treating a cancer in a subject, comprising isolating a cancer cell from the subject, genetically engineering the cancer cell to express an inducible suicide gene, genetically engineering the cancer cell to knock out at least one tumor suppressor gene, administering the engineered cell back to the cancer of the subject, allowing the engineered cell to clonally expand,and administering to the subject an inducer of the suicide gene in an amount effective to promote a bystander effect in the cancer.

[0188] Embodiment 31. The method of embodiment 30, wherein the cancer is a myeloid cancer.

[0189] Embodiment 32. The method of embodiment 31 , wherein the myeloid cancer comprises Chronic myelomonocytic leukemia (CMML).

[0190] Embodiment 33. The method of any one of embodiments 30 to 32, wherein the tumor suppressor gene comprises c-Cbl, PTEN, or any combination thereof.

[0191] Embodiment 34. The method of any one of embodiments 30 to 33, wherein the inducible suicide gene comprises inducible caspase 9 (iCasp9).

[0192] Embodiment 35. The method of any one of embodiments 30 to 34, wherein the at least one tumor suppressor gene is knocked out by insertion of the suicide gene in the tumor suppressor gene locus.

[0193] Embodiment 36. The method of any one embodiments claims 30 to 35, wherein the inducer of the suicide gene is AP1903.

[0194] Embodiment 37. The method of any one of embodiments 30 to 36, wherein the engineered cell and / or inducer of the suicide gene are administered intermittently on an adaptive treatment schedule.

[0195] Embodiment 38. The method of embodiment 37, further comprising monitoring kinetics of the engineered cell and adjusting the adaptive treatment schedule to maximize fitness of the engineered cell.

[0196] In some embodiments, the packaging signals for the retroviral elements comprises 5’ UTR and 3’ UTR for PEG 10. In some embodiments, the 5’UTR comprises the nucleic acid sequence tcctcggtgcaacctatataaggctcacagtctgcgctcctggtacacgcgcttcaacttcggttggtgtgtgtcgaagaa acctgactgcgccctgaggagaacagcggagaaggtccaccgagcctggcgaaaggtccgctgagcgggctgtc gtccggagccactccgggctgcggagcacccagtggagaccgcgcctggctcaggtgtgggaccccatccttcctgt cttcgcagaggagtcctcgcgtgaaataagcgggttttgaaaacaaaaaaaagaaggagtggaagagggggcca ggatccaggcctccatccccacagaagtgaagctacagctgggaggtctcctcccaccccaaccgtcaccctgggtc ccgactgcccacctcctcctcctccccctccccccaacaacaacaacaacaacaactccaagcacaccggccata agagtgcgtgtgtccccaac (SEQ ID NO:1). In some embodiments, the 3’UTR comprises the nucleic acid sequence atacctgtcatgtccttcaggatctctgccctcaaaatttattcctgttcagcttctcaatcagtgactgtgtgctaaattttagg ctactgtatcttcaggccacctgaggcacatcctctctgaaacggctatggaaggttagggccactctggactggcaca catcctaaagcaccaaaagaccttcaacattttctgagagcaacagagtatttgccaataaatgatctctcatttttccac cttgactgccaatctaactaaaataattaataagtttactttccagccagtcctggaagtctgggttttacctgccaaaacctccatcaccatctaaattataggctgccaaatttgctgtttaacatttacagagaagctgatacaaacgcaggaaatgct gatttctttatggagggggagacgaggaggaggaggacatgacttttcttgcggtttcggtaccctctttttaaatcactgg aggactgaggccttattaaggaagc (SEQ ID N0:2).

[0197] In some embodiments, the RNA therapeutic encodes a herpes simplex virus thymidine kinase (HSV-TK) when the synthetic intron is spliced by a mutant spliceosome. In some embodiments, the spliced HSV-TK gene has the nucleic acid sequence gcttcgtacccctgccatcaacacgcgtctgcgttcgaccaggctgcgcgttctcgcggccatagcaaccgacgtacg gcgttgcgccctcgccggcagcaagaagccacggaagtccgcctggagcagaaaatgcccacgctactgcgggtt tatatagacggtcctcacgggatggggaaaaccaccaccacgcaactgctggtggccctgggttcgcgcgacgatat cgtctacgtacccgagccgatgacttactggcaggtgctgggggcttccgagacaatcgcgaacatctacaccacac aacaccgcctcgaccagggtgagatatcggccggggacgcggcggtggtaatgacaagcgcccagataacaatg ggcatgccttatgccgtgaccgacgccgttctggctcctcatatcgggggggaggctgggagctcacatgccccgccc ccggccctcaccctcatcttcgaccgccatcccatcgccgccctcctgtgctacccggccgcgcgataccttatgggca gcatgaccccccaggccgtgctggcgttcgtggccctcatcccgccgaccttgcccggcacaaacatcgtgttgggg gcccttccggaggacagacacatcgaccgcctggccaaacgccagcgccccggcgagcggcttgacctggctatg ctggccgcgattcgccgcgtttacgggctgcttgccaatacggtgcggtatctgcagggcggcgggtcgtggcgggag gattggggacagctttcggggacggccgtgccgccccagggtgccgagccccagagcaacgcgggcccacgacc ccatatcggggacacgttatttaccctgtttcgggcccccgagttgctggcccccaacggcgacctgtacaacgtgtttg cctgggccttggacg (SEQ ID NO:3).

[0198] In some embodiments, the HSV-TK gene containing the synthetic intron has the nucleic acid sequence gcttcgtacccctgccatcaacacgcgtctgcgttcgaccaggctgcgcgttctcgcggccatagcaaccgacgtacg gcgttgcgccctcgccggcagcaagaagccacggaagtccgcctggagcagaaaatgcccacgctactgcgggtt tatatagacggtcctcacgggatggggaaaaccaccaccacgcaactgctggtggccctgggttcgcgcgacgatat cgtctacgtacccgagccgatgacttactggcaggtgctgggggcttccgagacaatcgcgaacatctacaccacac aacaccgcctcgaccagggtgagatatcggccggGTGAGTCGCCCCCTTCCTCTGCTCCGAGA GGGAAATGGGAATTAGGGTGGTGGCAGAGCCCAAAGAGGCCTTGTAGGCCATG GTAAGGCATTTCTATGTTTTATTTTACTTTGTCTTTATCCTAAAATGCCATTGGCA AGTTTATTGCAGggacgcggcggtggtaatgacaagcgcccagataacaatgggcatgccttatgccgtga ccgacgccgttctggctcctcatatcgggggggaggctgggagctcacatgccccgcccccggccctcaccctcatct tcgaccgccatcccatcgccgccctcctgtgctacccggccgcgcgataccttatgggcagcatgaccccccaggcc gtgctggcgttcgtggccctcatcccgccgaccttgcccggcacaaacatcgtgttgggggcccttccggaggacaga cacatcgaccgcctggccaaacgccagcgccccggcgagcggcttgacctggctatgctggccgcgattcgccgcg tttacgggctgcttgccaatacggtgcggtatctgcagggcggcgggtcgtggcgggaggattggggacagctttcgg ggacggccgtgccgccccagggtgccgagccccagagcaacgcgggcccacgaccccatatcggggacacgttatttaccctgtttcgggcccccgagttgctggcccccaacggcgacctgtacaacgtgtttgcctgggccttggacg (SEQ ID N0:4).

[0199] In some embodiments, the nuclear retention sequence has the nucleic acid sequence tacccatacgatgttccagattacgct (SEQ ID NO:5).

[0200] Therefore, in some embodiments, the secreted RNA therapeutic system has the nucleic acid sequence gacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtat ctgctccctgcttgtgtgttggaggtcgctgagtagtgcgcgagcaaaatttaagctacaacaaggcaaggcttgaccg acaattgcatgaagaatctgcttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacatt gattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataactta cggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaa cgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtat catatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttat gggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatggg cgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaat caacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggt ctatataagcagagctctctggctaactagagaacccactgcttactggcttatcgaaattaatacgactcactataggg agataatacgactcactatagcccaagctggctagcgtttaaaacctcctcggtgcaacctatataaggctcacag tctgcgctcctggtacacgcgcttcaacttcggttggtgtgtgtcgaagaaacctgactgcgccctgaggag aacagcggagaaggtccaccgagcctggcgaaaggtccgctgagcgggctgtcgtccggagccactcc gggctgcggagcacccagtggagaccgcgcctggctcaggtgtgggaccccatccttcctgtcttcgcag aggagtcctcgcgtgaaataagcgggttttgaaaacaaaaaaaagaaggagtggaagagggggccagga tccaggcctccatccccacagaagtgaagctacagctgggaggtctcctcccaccccaaccgtcaccctg ggtcccgactgcccacctcctcctcctccccctccccccaacaacaacaacaacaacaactccaagcaca ccggccataagagtgcgtgtgtccccaacgccaccatgtacccatacgatgtccagattacgcttcgfaccca facgafgffccagaffacgcfgaagcgtccGCTTCGTACCCCTGCCATCAACACGCGTCTGCG TTCGACCAGGCTGCGCGTTCTCGCGGCCATAGCAACCGACGTACGGCGTTGC GCCCTCGCCGGCAGCAAGAAGCCACGGAAGTCCGCCTGGAGCAGAAAATGC CCACGCTACTGCGGGTTTATATAGACGGTCCTCACGGGATGGGGAAAACCAC CACCACGCAACTGCTGGTGGCCCTGGGTTCGCGCGACGATATCGTCTACGTA CCCGAGCCGATGACTTACTGGCAGGTGCTGGGGGCTTCCGAGACAATCGCGA ACATCTACACCACACAACACCGCCTCGACCAGGGTGAGATATCGGCCGGGTG AGTCGCCCCCTTCCTCTGCTCCGAGAGGGAAATGGGAATTAGGGTGGTGGCAG AGCCCAAAGAGGCCTTGTAGGCCATGGTAAGGCATTTCTATGTTTTATTTTACTT TGTCTTTATCCTAAAATGCCATTGGCAAGTTTATTGCAGGGACGCGGCGGTGGT AATGACAAGCGCCCAGATAACAATGGGCATGCCTTATGCCGTGACCGACGCC GTTCTGGCTCCTCATATCGGGGGGGAGGCTGGGAGCTCACATGCCCCGCCCCCGGCCCTCACCCTCATCTTCGACCGCCATCCCATCGCCGCCCTCCTGTGCTAC CCGGCCGCGCGATACCTTATGGGCAGCATGACCCCCCAGGCCGTGCTGGCGT TCGTGGCCCTCATCCCGCCGACCTTGCCCGGCACAAACATCGTGTTGGGGGC CCTTCCGGAGGACAGACACATCGACCGCCTGGCCAAACGCCAGCGCCCCGG CGAGCGGCTTGACCTGGCTATGCTGGCCGCGATTCGCCGCGTTTACGGGCTG CTTGCCAATACGGTGCGGTATCTGCAGGGCGGCGGGTCGTGGCGGGAGGATT GGGGACAGCTTTCGGGGACGGCCGTGCCGCCCCAGGGTGCCGAGCCCCAGA GCAACGCGGGCCCACGACCCCATATCGGGGACACGTTATTTACCCTGTTTCG GGCCCCCGAGTTGCTGGCCCCCAACGGCGACCTGTACAACGTGTTTGCCTGG GCCTTGGACGagccccaagaagaagagaaaggtggaggccagctaaatacctgtcatgtccttcagg atctctgccctcaaaatttattcctgttcagcttctcaatcagtgactgtgtgctaaattttaggctactgtatcttca ggccacctgaggcacatcctctctgaaacggctatggaaggttagggccactctggactggcacacatcct aaagcaccaaaagaccttcaacattttctgagagcaacagagtatttgccaataaatgatctctcatttttccac cttgactgccaatctaactaaaataattaataagtttactttccagccagtcctggaagtctgggttttacctgcc aaaacctccatcaccatctaaattataggctgccaaatttgctgtttaacatttacagagaagctgatacaaac gcaggaaatgctgatttctttatggagggggagacgaggaggaggaggacatgacttttcttgcggtttcggt accctcttttaaatcactggaggactgaggccttattaaggaagccttaagcttggtaccgagctcggatccacta gtccagtgtggtggaattctgcagatatccagcacagtggcggccgctcgagtctagagggcccgtttaaacccgctg atcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgcca ctcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtg gggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggcttct gaggcggaaagaaccagctggggctctagggggtatccccacgcgccctgtagcggcgcattaagcgcggcgggt gtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgc cacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgac cccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggag tccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataaggg attttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaattctgtggaatgtgtgtc agttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaac caggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccata gtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttt tttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggc ttttgcaaaaagctcccgggagcttgtatatccattttcggatctgatcaagagacaggatgaggatcgtttcgcatgatt gaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagac aatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccg gtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtg ctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcac cttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctg gacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgagg atctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtg gccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaat g g g ctg accg cttcctcgtg ctttacg gtatcg ccg ctcccg attcg cag eg catcg ccttctatcg ccttcttg acg agtt cttctgagcgggactctggggttcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccacc gccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatcctccagcgcggggatctcat gctggagttcttcgcccaccccaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcac aaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgacct ctagctagagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacg agccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcc cgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtat tgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaa aggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaa ggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatc gacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgt gcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagct cacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgac cgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactg gtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacacta gaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaa caaaccaccgctggtagcggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctt tgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaagg atcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttac caatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagat aactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctcca gatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatcca gtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggc atcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatccccc atgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatg gttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtc attctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcag aactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttc gatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaa ggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattg aagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcg cacatttccccgaaaagtgccacctgacgtc (SEQ ID N0:6), with PEG 10 sequences inlowercase BOLD, the HSV-TK gene in uppercase BOLD, the synthetic intron in uppercase, an SV40 NLS in lowercase italics, and an HA sequence in lowercase italics and bold.Methods of Use

[0201] Also disclosed are methods of targeting an RNA therapeutic to the nucleus of a cell using the disclosed systems. In particular, the disclosed system packages the RNA therapeutic into a vesicle (e.g. VLP) for delivery to a cell. The disclosed nuclear retention signal targets the RNA therapeutic to the cell nucleus. In some embodiments, the RNA therapeutic is a suicide gene or druggable enzyme having a synthetic intron, such that the suicide gene or druggable enzyme is not functional unless the spliced by a mutant spliceosome, e.g. in a cancer cell.

[0202] Therefore, also disclosed is a method of treating cancer in a subject that involves administering to the subject a therapeutically effective amount of a system disclosed herein the RNA therapeutic is a suicide gene or druggable enzyme having a synthetic intron, such that the suicide gene or druggable enzyme is not functional unless the spliced by a mutant spliceosome in the cancer cells.

[0203] In some embodiments, the cancer is a myelodysplastic syndrome (MDS), chronic myelomonocytic leukemia (CMML), chronic lymphocytic leukemia (CLL), acute myeloid leukemia (AML), uveal melanoma, mucosal melanoma, skin melanoma, breast cancer, pancreatic cancer, endometrial cancer, liver cancer, lung cancer, mesothelioma, or other neoplasm with recurrent SF3B1 mutations. In some embodiments, upon splicing of the at least one artificial nucleic acid intron from the gene transcript, the gene of interest encodes a functional therapeutic protein. In some embodiments, the functional therapeutic protein is a toxin, chemokine, cytokine, growth factor, targetable cell-surface protein, targetable antigen, druggable enzyme, detectable marker, and the like.

[0204] In another aspect, the disclosure provides a method of treating in a subject with cancer, wherein the cancer is characterized by a change-of-function or loss-of-function mutation in a recurrently mutated RNA splicing factor gene. The method comprises administering to the subject an effective amount of a therapeutic composition comprising an expression cassette comprising a coding sequence (CDS) interrupted by at least one artificial nucleic acid intron as described herein, wherein the expression cassette further comprises a promoter operatively linked to the CDS.

[0205] A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made withoutdeparting from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.EXAMPLESExample 1:

[0206] Several suicide gene constructs have been generated each with distinct advantages. These include systems that convert prodrugs to active cytotoxic agents (i.e. Tsk / GSV system) (Fillat, C., et al. Current gene therapy 2003 3:13-26), systems that render cells sensitive to a monoclonal antibody with minimal toxicity (i.e. rituximab system) (Serafini, M. et al. Human gene therapy 2004 15:63-76), and systems that render cells sensitive to otherwise biologically inert compounds (i.e. iCasp9 system) (Di Stasi, A. et al. New England Journal of Medicine 2011 365:1673- 1683). Disclosed herein is a system that addresses all of the current challenges described above by combining three existing technologies and an improved nuclear RNA delivery system to generate a first-in-class cellular therapy that can secrete a cancer specific suicide gene for the treatment of several cancers. Each technology is now integrated into a proof-of-concept cellular product.Engineering a cellular factory for the secretion of a suicide gene:

[0207] Using the recently described PEG 10 system, CAR-T cells were previously generated with the capacity to secrete RNA-containing virus like particles with the capacity to efficiently enter target cells (Segel, M. et al. Science 2021 373:882-889). This system has now been engineered to instead secrete the below, cancer specific suicide gene construct.A splicing mutation specific suicide gene for the treatment of blood cancers:

[0208] Mutations in the splicing machinery occur very frequently in myeloid and lymphoid cancer. The consequence of this is a slightly altered consensus sequencing for spliceosome binding and redefined intron / exon boundaries. To therapeutically exploit these ‘change of function’ mutations present only in cancer cells, a ‘synthetic intron’ was developed that is only spliced by mutant spliceosome components (North, K. et al. Nature biotechnology 202240:1103-1113). This synthetic intron has been inserted in a suicide gene such that only spliceosome mutant cells have the capacity to fully translate this to a functional protein and succumb to this therapy. Using a state-of-the-art secretion system, the disclosed proof-of-concept cellular product has now integrated a SF3B1 specific suicide gene that is secreted to its microenvironment.A nuclear targeting signal derived from naturally occurring RNA sequences:

[0209] The splicing machinery is only present in the nucleus and current RNA medicines and delivery systems, including the synthetic intron approach and PEG10system utilized here, lack the capacity for nuclear translocation. While extremely innovative, this limitation prevents clear clinical translation of this technology for patients. To address this known nuclear retention RNA sequences derived from naturally occurring RNAs that are exclusively found in the nucleus, such as MALAT1 , were investigated (Lubelsky, Y. & Ulitsky, I. Nature 2018 555:107-111). The optimal location for the nuclear targeting sequence on the RNA medicine was identified, demonstrating that a synthetic intron containing GFP construct could only be translated if the sequence was present on the 3’ position. The disclosed proof-of- concept cellular product contains this synthetic intron with the so-called SIRLOIN sequence at the 3’ position (Lubelsky, Y. & Ulitsky, I. Nature 2018 555:107-111). However, other retention signals are being optimized. Therefore, disclosed herein is the repurposing a nuclear retention sequence for nuclear targeting of RNA medicines.A second safe harbor suicide gene for the generation of a bv-standard effect in cancers:

[0210] Last, a second suicide gene was inserted that is transcribed but only activated with the addition of systemic therapy. While this approach can be applied to CAR-T cells, the current proof-of-concept cellular product is a genetically engineered human leukemia myeloid cell line. This has two specific advantages: (1) there a redundant evolutionarily conserved homing mechanisms present that may result in better bone marrow to CAR-T cells; and (2) if myeloid penetration relative cellular product is induced towards programmed cell death, a therapeutically relevant bystandard effect may be achieved. To potentially leverage this a construct that renders cells universally sensitive to AP1903 was have inserted, an otherwise biologically inert compound, already tested and deemed safe without adverse effects in humans (Di Stasi, A. et al. New England Journal of Medicine 2011 365:1673-1683). A similar construct is also generated using rituximab (Serafini, M. et al. Human gene therapy 2004 15:63-76), instead of AP1903, as adaptive therapy (Budde, L. E. et al. PloS one 2013 8:e82742). Rituximab has been infused in thousands of lymphoma and rheumatoid arthritis patients with a favorable side effect profile (Coiffier, B. et al. New England Journal of Medicine 2002 346, 235-242; Lopez-Olivo, M. A., et al. Rituximab for rheumatoid arthritis. The Cochrane Library 2015). Of note, this construct has been inserted in the AAVS1 safe harbor site (Ordovas, L. et al. Stem cell reports 2015 5:918-931), to prevent undesirable off target genomic events (Figure 1A) and has been flanked with insulator sequences to prevent epigenetic silencing as previously described (Fu, H. et al. Nature biotechnology 2006 24:572-576). Alternatively, thesuicide gene could be inserted using CRISPR targeting approaches within a tumor suppressor gene to increase replicative fitness of our target in vivo (Figure 1B-1C).Example 2:

[0211] Adaptive therapy is a therapeutic approach informed by evolutionary principles recently demonstrated to improve the time to progression for patients with metastatic prostate cancer (Zhang J, et al. Nat Commun 8:1816, 2017). This approach requires that a therapy be intermittently deployed to a cancer harboring a chemo-sensitive, dominant clone. The kinetics of the dominant clone are monitored and therapy withdrawal is informed by mathematical models that use these kinetic parameters to maximize the fitness advantage of the dominant clone delaying or preventing competitive release of a resistant population. Prostate cancer is the archetypal neoplasm to test this approach because of the universal presence of testosterone-dependent dominant clones and widely available anti-testosterone therapies (Ryan CJ, et al. N Engl J Med 368:138-148, 2013). However, this is not the case for the vast majority of malignancies. To address this, we have generated a ‘Trojan-Horse’ like genetic construct aimed at engineering a chemo-sensitive dominant clone for adaptive therapy in human leukemia. Inspired by technology initially developed for chimeric antigen receptor (CAR)-T therapy (Di Stasi A, et al. N Engl J Med 365:1673-1683, 2011 ; Budde LE, et al. PloS one 8:e82742, 2013) and CRISPR-Cas9 (Heckl D, et al. Nature Biotechnol 32:941 , 2014) based genome editing, our preliminary data demonstrates the feasibility of a strategy that would harvest leukemic stem cells (LSCs) from patients via leukopheresis, genetically engineer LSCs with a novel construct ex vivo, and reinfuse engineered LSCs back to patients priming them for adaptive therapy. Once the engineered clone exerts clonal dominance, adaptive therapy commences.

[0212] The genetic construct utilized is a derivation of the iCasp9 ‘suicide gene’ used to extinguish infused CAR-T cells post therapy. This construct renders cells universally sensitive to AP1903, an otherwise biologically inert compound, already tested and deemed safe without adverse effects in humans (Di Stasi A, et al. N Engl J Med 365:1673-1683, 2011). In the disclosed approach, a guide RNA (gRNA) insertion site was integrated that targets a gene whose depletion increases leukemic fitness resulting in a chemo-sensitive, dominant clone. A similar construct was generated utilizing rituximab, instead of AP1903, as adaptive therapy (Budde LE, et al. PloS one 8:e82742, 2013). Rituximab has been infused to tens of thousands of lymphoma and rheumatoid arthritis patients with a favorable side effect profile (Coiffier B, et al. N Engl J Med 346:235-242, 2002; Lopez-Olivo MA, et al. Cochrane Database Syst Rev. 1 :CD007356, 2015). Last, preliminary datademonstrates that the overall therapeutic strategy can be preclinically modeled utilizing cell line and patient-derived leukemia xenografts. Therefore, as disclosed herein, LSCs can be genetically engineered and primed for adaptive therapy and that this approach can lead to long, durable remissions in leukemia patients.Example 3: Evolutionarily-informed cell-based therapy for chronic myelomonocytic leukemiaOverview

[0213] Chronic myelomonocytic leukemia (CMML) is a lethal myeloid neoplasm with a median survival of 34 months and no approved therapies that augment this natural history (Padron, E. et al. Blood cancer journal, (2015)). Although precision medicine and immunotherapies have led to promising clinical advances across many cancers, preliminary clinical studies in most myeloid neoplasms have reported only modest efficacy. Next Generation sequencing studies have annotated the complete mutatome of many cancers, to include CMML3 and other myeloid neoplasms (Welch, J. S. et al. Cell, (2012)), and emerging genome editing technologies hold great therapeutic promise to correct many of these genetic aberrancies (Mali, P. et al. Science, (2013); Cong, L. et al. Science, (2013); Jinek, M. et al. Science, (2012)). However, current and future editing technologies are necessarily characterized by an editing efficiency of less than 100% and therefore the pervasive evolutionary principles that govern malignant initiation and disease progression presents a clinical challenge for the therapeutic implementation of genome editing across cancer.

[0214] To address this, genome editing is used to generate a ‘Trojan-Horse’ genetic construct aimed at engineering chemosensitive, clonally-dominant leukemic cells that would then be utilized for evolutionarily informed therapy in human clinical trials. These studies establish the preclinical evidence required to translate a strategy that would harvest leukemic CD34+ cells (HSPCs) from patients via leukopheresis, genetically engineer HSPCs with a novel construct ex vivo, and reinfuse engineered HSPCs back to patients, priming them for therapy (Figure 19). Once the engineered cells exert clonal dominance, evolutionarily informed therapy commences. To achieve clonal dominance, a guide RNA (gRNA) insertion site is integrate within existing ‘suicide gene’ constructs that targets a gene whose depletion increases leukemic fitness, resulting in a chemosensitive, dominant clone. This approach is inspired by emerging technology developed for chimeric antigen receptor (CAR)-T therapy (Di Stasi, A. et al. New England Journal of Medicine, (2011); Budde, L. E. et al. PloS one, (2013)) and CRISPR-Cas9 (Heckl, D. et al. Nature biotechnology, (2014)) based genome editing and has several advantages. First, it addressesrelatively low genome editing efficiency by enabling genetically directed in vitro and in vivo expansion of engineered leukemia cells. Second, this approach can enhance the known ‘bystander effect’ documented with ‘suicide gene’ therapy in cancer while minimizing the reliance on this unpredictable phenomenon for clinical efficacy. Third, rather than restricted by evolutionary dynamics, this approach leverages these dynamics for both the creation of an engineered chemosensitive dominant clone and its maintenance in vivo. Ultimately, a therapeutic strategy is established that implements genome editing technology which can convert these lethal leukemias to chronic diseases controlled through genetically engineered tumor cells.Background

[0215] The need to improve the clinical implementation of CRISPR / Cas9 technology across cancer. Genome editing utilizing the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 system holds great therapeutic promise for a broad range of human genetic diseases (Jinek, M. et al. Science, (2012); Cong, L. et al. Science, (2013)). Several human clinical trials are already planned that will leverage the CRISPR-Cas9 system to treat hematologic diseases such as sickle cell disease and beta thalassemia in the coming years (Ye, L. et al. Proceedings of the National Academy of Sciences, (2016); Dever, D. P. et al. Nature, (2016)). These monogenetic disorders are ideally suited for genome editing because they have easy access to the target cell (i.e. blood cells), have a clear genetic target, and only require a subset of target cells to be corrected for clinically relevant responses to occur (Pawliuk, R. et al. Science, (2001)). However, although cancer is collectively the most common genetic disorder of man, multiple barriers exist that prevent this genome editing strategy from achieving clinical relevance. In leukemia, where target cell acquisition is similarly straightforward, direct genome editing would remain intractable because it is a multi-gene disorder with ambiguous genetic targets driven by evolutionary principles (Merlo, L. M. et al. Nature reviews. Cancer, (2006)). The latter importantly obligates that 100% of target cells be corrected. Otherwise native, uncorrected target cells would be rapidly selected, leading to treatment failure. Because a 100% editing rate is not possible with current or near-future technologies, novel approaches are critically needed to implement CRISPR-Cas9 based therapies in leukemia and other cancers.

[0216] Chronic Myelomonocytic Leukemia (CMML) as a model to improve therapeutic approaches across adult leukemia. CMML is a lethal myeloid leukemia with no therapies that improve its dismal natural history. CMML is a clonal disorder characterized by increased monocytes in the peripheral blood (PB) and morphologically abnormal cells (termed "dysplastic" cells) within the bone marrow(BM). CMML was previously classified as a subtype of the Myelodysplastic Syndromes (MDS) until 2001 when the World Health Organization (WHO) consolidated a group of diseases, including CMML, into a new category of myeloid neoplasms known as Myelodysplastic / Myeloproliferative Neoplasms (MDS / MPNs) (Vardiman, J. W. et al. Blood, (2009); Arber, D. A. et al. Blood, (2016)). These diseases have features of both MDS, characterized by ineffective hematopoiesis and Myeloproliferative Neoplasms (MPNs), characterized by myeloproliferation. Its mutational landscape has been well-annotated and is comprised of relatively few somatic exonic mutations (10-15 / exome) (Merlevede, J. et al. Nat Commun, (2016)). Like many adult leukemias, the overall survival of CMML has not appreciably changed over the last three decades and its median overall survival is approximately 34 months (Padron, E. et al. Blood cancer journal, (2015)). This is, in part, because no preclinical models of CMML had existed to adequately credential preclinical therapeutic approaches.

[0217] To address this, 2 recent advances were exploited to generate the first human CMML xenografts: (1) the discovery of GMCSF dependence of CMML18, and (2) the development of NSG mice with transgenic expression of human GM-CSF, IL- 3, and SCF (so-called NSGS mice) (Wunderlich, M. et al. Leukemia, (2010)). Surprisingly, xenotransplantation of human CMML cells into sublethally irradiated NSGS hosts results in a fatal leukemic disorder, which bears resemblance to human CMML based on morphology, immunophenotype, and somatic genetic alterations with a 100% ‘take-rate’ (Yoshimi, A. et al. Blood, (2017)). This was achieved by transplantation of cryopreserved CD34+ cells (which represent human hematopoietic stem / progenitor cells (HSPCs)) or cryopreserved unfractionated PB or BM mononuclear cells (MNCs) from CMML patients. In the former method, when >200,000 CD34+ cells are injected directly into the femur of NSGS recipients, there is a 100% rate of engraftment (defined as >10% hCD45+ cells in the BM of recipient mice; 15 patients tested). The median survival in these models is 43-71 days and death in the animals is heralded by the development of macrocytic anemia, thrombocytopenia, and splenomegaly remarkably similar to the human disease. Moreover, sequencing analysis of leukemia-associated genes of primary patient BM MNCs and corresponding human hematopoietic cells (marked by human CD45 (hCD45)) purified from primary xenografted mice revealed identical somatic mutations with similar allelic ratios.

[0218] Given the paucity of active therapies, the well-known relatively homogenous genetic landscape, and our murine PDX model now available, CMML may serve as the ideal preclinical model system to explore the therapeutic candidacyof our approach. Further, the future clinical translation of this approach is also ideally suited in CMML because patients often present to their oncologist in a clinically asymptomatic state (-70% of all patients in the Moffitt Cancer Center CMML cohort (n=456)) for weeks to months prior to disease progression (Ball, M. et al. Blood, (2016)). This will allow sufficient time to generate the genetically modified leukemia required for our therapeutic approach.

[0219] Adaptive therapeutic strategies for cancer. The development of chemo-resistance in cancer is governed by Darwinian evolutionary principles (Enriquez-Navas, P. M. et al. Cancer research, (2015)). In cancers with chemosensitive disease at the start of treatment, conventional therapeutic strategies often expose the cancer to therapy until a resistant subset of cells emerge and establish clonal dominance. This strategy is not consistent with maximizing evolutionary dynamics in favor of chemo-sensitive clones because the resultant “competitive release” favors the rapid proliferation of resistant cancer cell populations. Adaptive therapy is a therapeutic approach that directly applies evolutionary principles in cancer cell populations (Gatenby, R. A. et al. Cancer research, (2009)). The adaptive approach requires that therapy be intermittently deployed to a cancer such that chemo-sensitive clones maximize their dominance and resistant clones remain subclonal. The kinetics of the dominant clone are monitored and therapy withdrawal is informed by predictive mathematical models, using kinetic parameters to maximize the fitness advantage of the sensitive clone. This approach is able to delay or prevent competitive release and expansion of resistant populations. Prostate cancer is the archetypal neoplasm to test this approach because of the universal presence of testosterone-dependent dominant clones and widely available anti-testosterone therapies (Ryan, C. J. et al. New England Journal of Medicine, (2013)). Adaptive therapy has been recently demonstrated to improve the time to progression for patients with metastatic prostate cancer25 in a clinical trial. In this study, patients with castrate-resistant metastatic prostate cancer were intermittently treated with abiraterone. The treatment schedule was informed by evolutionary game theory models that attempted to maximize chemo-sensitive disease. This approach led to a time to progression of 27 months which is longer than conventionally treated patients (Zhang, J. et al. Nat Commun, (2017)). Although promising in prostate cancer, the degree of oncogene addiction to testosterone in prostate cancer is not present in the vast majority of other malignancies. Therefore, novel approaches are required to translate adaptive therapy across cancer.

[0220] Suicide-gene therapy for cancer. Suicide gene therapy refers to a therapeutic strategy whereby a modified genetic construct is introduced into canceror immune cells designed to induce cell death (Bonini, C. et al. Mol Ther, (2007); Duarte, S. et al. Cancer Lett, (2012)). When inserted directly in cancer cells, this strategy has conventionally aimed to leverage a local and, in some cases, distant ‘bystander effect’ (Rainov, N. G. Human gene therapy, (2000); Freeman, S. M. et al. The Lancet, (1997)). This is because gene-delivery systems generally introduce the suicide construct in only a small fraction of the tumor bulk and therefore death of nonmodified cancer cells is required for clinically meaningful efficacy. This reliance on a clinically unpredictable degree of ‘bystander effect’ has led to modest results in human trials (Rainov, N. G. Human gene therapy, (2000)). When inserted in immune cells, this strategy has been leveraged to minimize toxicity associated with genetically modified T-cells to include CAR-T therapy (Di Stasi, A. et al. New England Journal of Medicine, (2011)). Several delivery systems have been developed to introduce suicide gene therapy to include non-replicating and replicating viral vectors and the CRISPR / Cas9 system (Di Stasi, A. et al. New England Journal of Medicine, (2011); Duarte, S. et al. Cancer Lett, (2012)). However, all of these strategies are limited by the relatively low efficiency of suicide gene delivery. Therefore, there exists a critical need for the development of novel therapeutic strategies that either improve the bystander effect or leverage other biologic mechanisms to maximize this approach.

[0221] Several suicide gene constructs have been generated each with distinct advantages. These include systems that convert prodrugs to active cytotoxic agents (i.e. Tsk / GSV system) (Fillat, C. et al. Current gene therapy, (2003)), systems that render cells sensitive to a monoclonal antibody with minimal toxicity (i.e. rituximab system) (Serafini, M. et al. Human gene therapy, (2004)), and systems that render cells sensitive to otherwise biologically inert compounds (i.e. iCasp9 system) (Di Stasi, A. et al. New England Journal of Medicine, (2011)). The disclosed concept primarily employs a derivation of the iCasp9 suicide gene. This construct renders cells universally sensitive to AP1903, an otherwise biologically inert compound, already tested and deemed safe without adverse effects in humans (Di Stasi, A. et al. New England Journal of Medicine, (2011)). A similar construct is also generated using rituximab (Serafini, M. et al. Human gene therapy, (2004)), instead of AP1903, as adaptive therapy (Budde, L. E. et al. PloS one, (2013)). Rituximab has been infused in thousands of lymphoma and rheumatoid arthritis patients with a favorable side effect profile (Coiffier, B. et al. New England Journal of Medicine, (2002); Lopez- Olivo, M. A. et al. The Cochrane Library, (2015)).Research StrategyOverall Hypothesis and Long-term Goal

[0222] It is hypothesized that leukemic stem and progenitor cells (HSPCs) can be genetically engineered and primed for adaptive therapy, and that this approach can lead to long, durable remissions in leukemia patients. It is further hypothesized that these genetically engineered HSPCs may serve to induce a more robust ‘bystander effect’ that may serve as an adjuvant for future immunotherapeutic strategies. The goal of this Example is to establish all experimental, computational, and modeling approaches required to translate this therapeutic strategy to human trials.Approach

[0223] Optimize a ‘trojan-horse’ genetic construct for human clinical trials. Several studies are conduct to generate and validate a ‘clinical grade’ genetic construct capable of both effectively targeting a tumor suppressor to increase leukemic fitness and inserting a suicide gene within the same cell. Recognizing that it is critical to ensure efficient editing that results in both a durably functional suicide gene in leukemic cells and an engineered fitness advantage, the following approaches are tested.

[0224] 1) Genomic Safe Harbor (Papapetrou, E. P. et al. Mol Ther, (2016)). An amplicon is generated that includes flanking regions that target the AAVS1 loci via CRISPR1 , insulator sequences to minimize potential methylation and silencing (Fu, H. et al. Nature biotechnology, (2006)), the suicide gene of interest, and a separate construct with 2 sgRNAs that target both the AAVS1 loci and a tumor suppressor to increase fitness (Figure 19). The advantage of this approach is that the suicide gene will be inserted into a genomic region (AAVS1) that has been previously tested in gene therapy studies and primates in vitro and in vivo, respectively (Hong, S. G. et al. Mol Ther, (2017)). In addition, this region has been demonstrated, both in our preliminary data (Figure 20) and in the literature, to remain in an open chromatin state with minimal methylation. This ensures maximum suicide gene expression across a variety of evolutionary landscapes potentially encountered by engineered leukemic cells. The disadvantage of this approach is that, despite ensuring all genetic elements enter a target cell by generating a single amplicon, Cas9 editing efficiency limitations and minuscule impurities after selection could result in a cell in which a fitness advantage is introduced without insertion and integration of our suicide gene. To address this, an alternative strategy is proposed by which the sgRNA targeting the tumor suppressor is more likely to be expressed only upon integration of the suicide gene amplicon as shown in Figure 20C.

[0225] 2) Direct Tumor Suppressor Disruption. A second strategy is tested in which a suicide gene is directly inserted within the early exonic regions of a tumorsuppressor increasing leukemic fitness. This is accomplished with the same single amplicon approach described above modified to directly insert our suicide gene construct within early exons of a targeted tumor suppressor simultaneously increasing leukemic fitness and genomically integrating our suicide gene within engineered primary cells (Figure 21). The advantage of this approach is that it guarantees that leukemic fitness and suicide gene dependence necessarily occur in each engineered cell. The disadvantage, tested below, is that there is likely a variable potential for the long-term epigenetic silencing of the suicide gene, depending on the tumor suppressor targeted, in any given patient sample. To test this, several candidate tumor suppressor genomic regions are placed under ‘epigenetic stress’ (see below) and evaluated for their capacity to remain epigenetically active.

[0226] Delivery Strategies: Based on a series of studies demonstrating superior efficacy and reduced off target effects of HiFi and other Cas9 ribonuclear particles (RNPs), all of the delivery strategies utilize this approach (Vakulskas, C. A. et al. Nature medicine, (2018)). The concomitant amplicon demonstrated above is delivered as naked DNA via electroporation, adenoassociated viral vectors, or lentiviral vectors in collaboration with the Ebert laboratory at the Dana Farber Cancer Institute. Primary cells are selected based on either presence of a suicide gene- related cell surface protein (i.e. CD19 for iCasp9 system) or antibiotic selection dependent on the suicide gene of interest. Transfection / infection efficiencies will be calculated and utilized to determine the optimal delivery strategy.

[0227] Suicide Genes: The approach focuses on the aforementioned iCasp9 and rituximab-based suicide genes, respectively. The primary advantage of these systems is that they have very low immunogenicity because they are of human origin and their corresponding drug(s) have been extensively tested in human trials. The potency of each drug / suicide gene to induce cell death in engineered human leukemia cells is tested in vitro and in vivo in a panel of human myelomonocytic cell lines and primary cells. Further, the relationship between drug dose and cell death is measured and the combination that optimally models a linear relationship is selected for evolutionary based therapeutic approaches.

[0228] Experimental readouts to assess optimal strategy: The following assays are performed: (1) Both Reduced representation bisulfite DNA sequencing (Meissner, A. et al. Nucleic acids research, (2005)) and Assay for Transposase- Accessible Chromatin using sequencing (ATAC-seq) (Buenrostro, J. D. et al. Nature methods, (2013)) is performed in the above iterations of the genetic construct to determine both methylation status and chromatin accessibility, respectively. To mimicepigenetic stresses, these assays are performed in long term in vitro culture of myeloid leukemia cell lines and longitudinal in vivo measurements of both cell line and patient derived xenografts in the presence of the suicide gene drug. TET2 deletions are additionally introduced in these cells and resultant methylation of the suicide construct measured as previously described (Tothova, Z. et al. Cell stem cell, (2017)). (2) The percent of cells that are both positive and negative for the selection marker (i.e. CD19 for iCasp9) is measured to determine the true frequency of cells transfected / infected as well as the number of cells edited for the target tumor suppressor cell that did not integrate the suicide gene in each method is measured by DNA sequencing. (3) Proliferation and colony formation assays are used to determine the efficacy of each suicide gene in vitro, respectively. Xenografts, as discussed below, are utilized to measure the relationship between drug dose and percent engrafted cells aiming for the most linear association.

[0229] Generate a library ofsgRNAs that increase fitness in human leukemia. Given known leukemia heterogeneity, a precision medicine approach is employed to maximally increase leukemic fitness in a patient specific manner. In collaboration with the Ebert laboratory, results from an unbiased CRISPR screen are used to generate a primary patient-specific targeted screen of candidate genes (20-30) each targeted by 4-6 sgRNAs enabling primary patient sample screening. This is accomplished by first performing a lentiviral genome wide CRISPR screen (GeKo library) utilizing a panel of genetically distinct human myelomonocytic leukemia cell lines (n=10) in vitro. As shown in Figure 23, proliferation is used as a surrogate for cell-intrinsic fitness by flow sorting highly proliferative cells measured by carboxyfluorescein succinimidyl ester (CFSE) staining. sgRNA enrichment is identified utilizing PinAPL- Py41 comparing each sorted population to their cell line specific control. Those genes associated with sgRNAs that are enriched in more than 3 of 10 cell lines are nominated for the final targeted screen via lentiviral gene delivery. Each gene sgRNA is optimized in myelomonocytic cell lines to ensure efficient on-target editing with minimal off-target effects utilizing NGS sequencing approaches. A final screen is then tested both in vitro and in vivo below. Figure 23C demonstrates one such candidate (CBL) identified and targeted in primary human cells.

[0230] Optimize the experimental methods required to personalize sgRNAs that increase fitness for an individual leukemia patient. Once a targeted screen is generated, the following optimization and validation steps are undertaken for translation to human clinical trial. Each sgRNA is designed to be compatible with both the genomic safe harbor and direct tumor suppressor disruption approaches. With respect to the later, flanking regions and sgRNAs for each candidate gene aredesigned to ensure that direct tumor disruption is feasible. It is verified that direct tumor disruption leads to reductions in target protein expression for each sgRNA. Off target effects of pooled sgRNAs are evaluated utilizing CIRCLE-seq as previously described (Tsai, S. Q. et al. Nature methods, (2017)). Next, fresh bone marrow mononuclear samples are prospectively collected and CD34+ cells from at least 20 CMML patients enriched. These CD34+ cells are tested using the final construct and delivery method identified above and the following optimization steps are performed: (1) Determine the optimal condition for CRISPR RNP-targeted screen in human CMML CD34+ cells. This includes optimizing electroporation conditions for maximal transfection efficiency (as measured by CD19 expression for iCasp9 for example) and minimal cell death as measured by flow-based viability assays. Cas9 RNP dosage is additionally optimized using suicide gene marker expression as a readout for successful editing. (2) Annotate the frequency in which a gene is identified that increases leukemic fitness. sgRNA enrichment is measured by sampling DNA just after transfection and selection and then after 4 weeks of xenotransplantation in NSGS mice or 14-day colony formation assays as previously described (Heckl, D. et al. Nature biotechnology, (2014)). The capacity of the targeted screen to identify a gene whose depletion improves leukemic fitness is deemed optimal if leukemic fitness can be increase in at least 50% of CMML cases tested. If the goal of 50% is not achieved, an iterative strategy is used in which candidate genes not included in version 1 of the screen identified above are added-in and those genes included in version 1 but not found to impact leukemic fitness in primary cells are added-out. Finally, single gene sgRNAs or their pools from the targeted screen are validated in vitro (and in vivo (CMML PDX)) to confirm the capacity to optimize leukemic fitness.

[0231] Parameterize models that predicts the required trojan-horse construct- induced D fitness and timing of adaptive therapy. Otka-Volterra equations (Gatenby, R. A. et al. Mol Cancer Ther, (2003)) are used to model population dynamics of the interactions between native and engineered primary leukemia both in vitro and in vivo (Figure 24). This will enable determination of the following: (1) The optimal increase in engineered leukemic cell proliferative capacity compared to native cells in vitro. These predictions are validated in our CMML PDX models. (2) The optimal carrying capacity and ratio of engineered to wildtype cells that should be transplanted in our CMML PDX model to enable rapid clonal dominance of engineered leukemic cells and the most clinically realistic murine modeling of the therapeutic approach. This is accomplished by parameterizing the mathematical model using global optimization, minimizing the loss between the model and data obtained from in vitro experiments. Then in silico simulations are used to validated the model compared against in vivocompetitive transplant experiments. These insights and mathematical models enable estimation of the optimal period between re-infusion of engineered cells and pharmacologic activation of the suicide gene in human trials. Predictions from this model are validated in CMML PDX models by monitoring suicide gene in vivo expansion (i.e. % CD19 / CD33+ engineered cells versus CD19- / CD33+ wild type cells for iCasp9) both before suicide gene activation and after. (3) Determine the optimal adaptive therapy strategy for human clinical trials (Stankova, K. et al. JAMA Oncol, (2018)). The above mathematical models as previously described are used to inform drug and dose interruptions that maximize clonal dominance of engineered cells. These predictions will be tested in our CMML PDX models and compared to random dose interruptions. Duration of engineered leukemic cells will be measured by serial peripheral blood analysis of CD33+ / CD19+ V CD33+ / CD19- cells. Further model parameter refinement may be needed to account for patient heterogeneity and are addressed as adaptive therapy schedules are designed for individual CMML PDX models.

[0232] Model the in vitro and in vivo therapeutic consequence of our trojanhorse construct in human leukemia. After identification of sgRNAs that increase leukemic fitness in a subset of CD34+ CMML primary samples and myelomonocytic cell lines, two novel therapeutic strategies are explored as discussed above. First, adaptive therapy approach is tested in vivo by performing a CMML PDX study utilizing 10 distinct patient samples from which 3 PDXs per group are generated as previously published (Yoshimi, A. et al. Blood, (2017)). PDXs are generated with an admixture of engineered cells and wild type primary samples that will expand such that the engineered cells exert clonal dominance as measured by peripheral blood flow cytometry (i.e. CD19) prior to initiation of pharmacologic therapy. Next, groups are treated with either a pharmacologic agent that will activate the suicide gene or vehicle at increasing doses to identify the optimal dose of drug that induce the degree of engineered cell death required and predicted by the mathematical model of adaptive therapy. Second, whether a maximally tolerated dose (MTD) of suicide gene activating drug can induce a ‘bystander effect,’ is explored, hypothesizing that infusing cells that exert clonal dominance yield a more clinical meaningful response. The ‘bystander effect’ is defined to be the percentage of CD33+ / CD19- cell death relative to the vehicle control as measured by flow cytometry. The bystander effect has been observed both precl in ically and clinically and is thought to be secondary to local inflammation. Alternatively, several lines of evidence suggest that a distant bystander effect may be a result of an enhanced tumor immune response. Although the CMML PDX models have observable human T-cells, these models may not fullyrecapitulate the immune system. Therefore, the bystander effect is alternatively measured in immunocompetent murine CMML models using the wildtype (TET2 floxed) and (TET2 floxed crossed with NRAS G12D as previously described (Kunimoto, H. et al. Cancer cell, (2018)). The TET2- / -NRASG12D / WT cells (which are induced utilizing the Mx1 ere driver) are transfected with the suicide gene and serve to model the engineered cells. These are then re-infused in TET2- / - / Mx1-Cre in similar fashion to the proposed human trial. Both the bystander effect and the adaptive approach are explored as above in this murine model.

[0233] Perform a preclinical ‘phase 3-like study’ testing the overall therapeutic concept utilizing primary CMML patient samples in vivo. To determine if the therapeutic strategy is viable, a 3-arm preclinical “phase 3-like” CMML PDX study is performed. Approximately 20 CMML unique patient samples are utilized, each contributing 3 PDX models per arm. Arm 1 consists of CMML PDXs derived from wildtype patient samples treated with vehicle control. Arm 2 consists of CMML PDXs derived from wildtype and engineered cells as described above and then treated with the suicide gene activator to elicit the optimal ‘bystander effect’. Arm 3 consists of CMML PDXs derived from wildtype and engineered cells as described above and then treated with the suicide gene activator in an adaptive therapeutic manner. The primary endpoint of this study is overall survival. Secondary endpoints include: (1) reduction in splenomegaly (as measured by spleen weight at necropsy), (2) improvement in hematologic parameters (to include monocyte count, anemia, and thrombocytopenia), (3) improvement in BM pathology to include decreases in bone marrow myeloblasts (CD34+) and resolution of dysplasia, and (4) the percentage of hCD45+ cells across tissue compartments (PB, BM, spleen, liver, and lung). The arm with statistically superior survival is the therapeutic strategy nominated for human clinical trial in CMML. With a total of 60 PDX per arm (20 pts, each with 3 PDX), a relative hazard ratio 0.6 between groups can be detected with a two-sided p-value of 0.05 and power of 80%.

[0234] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of skill in the art to which the disclosed invention belongs. Publications cited herein and the materials for which they are cited are specifically incorporated by reference.

[0235] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

WHAT IS CLAIMED IS:

1. A chimeric cell for treating cancer, comprising a cell genetically engineered to express an inducible suicide gene and genetically engineered with at least one tumor suppressor gene knocked out.

2. The chimeric cell of claim 1 , wherein the at least one tumor suppressor gene is knocked out by insertion of the suicide gene in the tumor suppressor gene locus.

3. The chimeric cell of claim 1 , wherein the tumor suppressor gene comprises c- Cbl, PTEN, or any combination thereof.

4. The chimeric cell of claim 1 , wherein the inducible suicide gene comprises inducible caspase 9 (iCasp9).

5. The chimeric cell of claim 1 , wherein the cell is a myeloid cell.

6. The chimeric cell of claim 1, wherein the cell expresses a chimeric antigen receptor (CAR) polypeptide that targets a tumor antigen.

7. The chimeric cell of claim 1 , wherein the cell is a cancer cell.

8. The chimeric cell of claim 1 , wherein the cell is autologous.

9. The chimeric cell of claim 1 , wherein the cell is allogeneic.

10. The chimeric cell of claim 1 , wherein the cell is a cell line.

11. The chimeric cell of claim 1 , wherein the cell is further genetically engineered to overexpress a chemokine receptor.

12. The chimeric cell of claim 11 , wherein the chemokine receptor is CXCR-4.

13. The chimeric cell of claim 1 , wherein the cell is further engineered to express or encapsulate one or more diagnostic or therapeutic agents.

14. The chimeric cell of claim 1 , wherein the cell is further engineered to secrete an RNA therapeutic.

15. The chimeric cell of claim 14, wherein the cell comprise(a) a first polynucleotide encoding retroviral elements that preferentially binds and facilitates formation and secretion of vesicles carrying its own RNA messenger operably linked to a first expression control sequence;(b) a second polynucleotide encoding the RNA therapeutic having a nuclear retention sequence that is flanked by packaging signals for the retroviral elements operably linked to a second expression control sequence; and(c) a third polynucleotide encoding a membrane fusion protein operably linked to a third expression control sequence.

16. The chimeric cell of claim 15, wherein the retroviral elements for forming a delivery vesicle comprises two or more of a retroviral gag protein, a retroviral envelope protein, a retroviral reverse transcriptase or a combination thereof.

17. The chimeric cell of claim 16, wherein the retroviral gag protein is a gaghomology protein.

18. The chimeric cell of claim 17, wherein the gag-homology protein is Paternally expressed gene 10 (PEG10).

19. The chimeric cell of any one of claims 15 to 18, wherein the nuclear retention sequence is a portion of a long non-coding RNA (IncRNA) enriched in Alu repeats and / or a SIRLOIN motif.

20. The chimeric cell of claim 19, wherein the nuclear retention sequence has the nucleic acid sequence SEQ ID NO:5.

21. The chimeric cell of claim 15, wherein the RNA therapeutic comprises a synthetic intron.

22. The chimeric cell of claim 21 , wherein the RNA therapeutic encodes a herpes simplex virus thymidine kinase (HSV-TK) when the synthetic intron is spliced by a mutant spliceosome.

23. The chimeric cell of claim 22, wherein the RNA therapeutic comprises the nucleic acid sequence SEQ ID NO:4.

24. The chimeric cell of claim 15, wherein the packaging signals for the retroviral elements comprises 5’ UTR and 3’ UTR for PEG10.

25. The chimeric cell of claim 15, wherein the membrane fusion protein is the G envelope protein of vesicular stomatitis virus (VSV-G).

26. The chimeric cell of claim 15, wherein the first, second and third polynucleotides are present in separate vectors.

27. The chimeric cell of claim 15, wherein the first, second and third polynucleotides are present in a single vector.

28. The chimeric cell of claim 27, having the nucleic acid sequence SEQ ID NO:6.

29. The chimeric cell of claim 15, wherein the delivery vesicle is a virus-like particle.

30. A method for treating a cancer in a subject, comprising isolating a cancer cell from the subject, genetically engineering the cancer cell to express an inducible suicide gene, genetically engineering the cancer cell to knock out at least one tumor suppressor gene, administering the engineered cell back to the cancer of the subject, allowing theengineered cell to clonally expand, and administering to the subject an inducer of the suicide gene in an amount effective to promote a bystander effect in the cancer.

31. The method of claim 30, wherein the cancer is a myeloid cancer.

32. The method of claim 31 , wherein the myeloid cancer comprises Chronic myelomonocytic leukemia (CMML).

33. The method of claim 30, wherein the tumor suppressor gene comprises c-Cbl, PTEN, or any combination thereof.

34. The method of claim 30, wherein the inducible suicide gene comprises inducible caspase 9 (iCasp9).

35. The method of claim 30, wherein the at least one tumor suppressor gene is knocked out by insertion of the suicide gene in the tumor suppressor gene locus.

36. The method of claim 30, wherein the inducer of the suicide gene is AP1903.

37. The method of claim 30, wherein the engineered cell and / or inducer of the suicide gene are administered intermittently on an adaptive treatment schedule.

38. The method of claim 37, further comprising monitoring kinetics of the engineered cell and adjusting the adaptive treatment schedule to maximize fitness of the engineered cell.

Images