Compound, cell membrane permeation promoter, and method for introducing compound into cell membrane

Abstract

The present invention relates to a compound having light emission characteristics. The compound also has a function as a cell membrane permeation promoter for permeating a cell membrane. The compound is characterized by being represented by general formula (1). (In the formula, R1 are the same or different C1-20 straight-chain aliphatic alkyl groups. R2 are the same or different C1-17 straight-chain aliphatic alkyl groups or -NR3 2. R3 are the same or different C1-4 straight-chain aliphatic alkyl groups.)

Description

Compound, cell membrane permeation enhancer, and method for introducing compound into cell membrane

[0001] The present invention relates to a compound, an agent for introducing a compound into a cell, and a method for introducing a compound into a cell using the same.

[0002] Known methods for delivering various compounds into cells include physical methods, chemical methods, and methods using viral vectors. Although each method has its advantages and disadvantages, chemical methods are likely to be applicable to the human body and are an issue that many researchers are working on because they eliminate the risk of using viruses.

[0003] Peptides with cell membrane-penetrating properties, such as oligoarginine, have been extensively studied, and successful covalent binding of various drugs to deliver them into cells has been demonstrated (see, for example, Non-Patent Document 1). However, the following characteristics remain problematic: (1) Because oligoarginines contain multiple positively charged ammonium moieties, they readily interact electrostatically with polyanionic nucleic acid drugs, forming complexes and resulting in aggregation (potential precipitation). (2) Because they penetrate membranes, they may potentially kill cells. (3) Most nucleic acids often remain in endosomes and do not migrate into the cytoplasm. (4) When using nucleic acid drugs, they must first be covalently bound to the nucleic acid drug and then chemically modified.

[0004] Non-Patent Document 2 reports that disulfide-modified nucleic acids penetrate cell membranes and exert their medicinal effects. However, such techniques have challenges, such as a high likelihood of dependence on the amount of disulfides on the cell surface and the need to chemically modify the nucleic acid drug in advance. A known nucleic acid transfer reagent is the lipofection method, in which nucleic acid drugs are encapsulated in liposomes formed by amphiphilic compounds such as ThermoFisher Scientific Invitrogen's Lipofectamine (a molecule composed of a long-chain alkyl group and an oligoamine bonded together), and the cell membrane is then permeated. However, this method often has low transfer efficiency for nucleic acid drugs and is known to be inapplicable to many cell types.

[0005] Recently, Niki, Hirose, Kawaguchi, and others have found that amphipathic α-helical peptides induce transient perturbations in the cell membrane, improving the cell membrane penetration efficiency of functional peptides and proteins (Non-Patent Documents 3 and 4). This method requires that the substances taken up into the cell escape from endosomes or macropinosomes, and new molecular designs and approaches that do not require this escape process are needed.

[0006] W. Tai, et al. Adv Drug Deliv. Rev. 2017, 110, 157D. Abegg, et al. J. Am. Chem. Soc. 2017, 139, 231Y. Kawaguchi, et al. Nat. Chem. 2017, 9, 751S. Futaki, et al. Angew. Chem. Int. Ed. 2017, 56, 7644

[0007] The present invention relates to compounds that are luminescent when aggregated and have restricted molecular motion, but lose their luminescence when dispersed. Such compounds also have the effect of acting as cell membrane permeation enhancers for permeating cell membranes.

[0008] The present invention is a compound represented by the following general formula (1):

[0009] (In the formula, R １ are the same or different and each represents a linear aliphatic alkyl group having 1 to 20 carbon atoms. ２ are the same or different and each represents a linear aliphatic alkyl group having 1 to 17 carbon atoms or -NR ３ ２ .R ３ are the same or different, and are straight-chain aliphatic alkyl groups having 1 to 4 carbon atoms.)

[0010] The present invention also relates to a cell membrane permeation enhancer comprising the compound described above. The present invention also relates to a method for introducing a compound into the cell membrane, comprising the steps of: (1) mixing a cell with the compound described in claim 1; (2) mixing a compound to be introduced; and (3) irradiating the mixture with light.

[0011] The compound of the present invention has the ability to become luminescent when aggregated and to lose its luminescence when dispersed. Furthermore, it also has the ability to attach to the cell membrane surface. Furthermore, when attached to the cell surface, it also has the ability to promote cell membrane permeation of the compound.

[0012] NMR chart of compound 1 (top row) １ H-NMR, bottom row １３ C-NMR). NMR chart of compound 3b (upper row) １ H-NMR, bottom row １３ C-NMR). NMR chart of TPE-C-N (upper row) １ H-NMR, bottom row １３ C-NMR). NMR chart of TPE-C (upper row) １ H-NMR, bottom row １３ C-NMR). NMR chart of TPE-N (upper row) １ H-NMR, bottom row １３C-NMR). Figure showing the HRMS (ESI) spectrum of TPE-C-N. (a) Absorption spectrum and (b) emission spectrum (10 μM) were measured for TPE-C, TPE-N, and TPE-C-N, respectively, in a mixed solution of acetonitrile (MeCN) and water (volume ratio 1:1). (a) Absorption spectrum and (b) emission spectrum (10 μM) were measured for TPE-C and TPE-C-N, respectively, in a mixed solution of N,N-dimethylformamide (DMF) and water (volume ratio 1:200). (a) Absorption spectrum and (b) emission spectrum (10 μM) of TPE-C-N in a solvent with varying ratios (volume ratio) of acetonitrile (MeCN) and water. Cell viability of A549 cells exposed to TPE-C-N (10 μM). (a) Confocal microscope image of A549 cells treated with TPE-C-N and then treated with Cy5-4S under light irradiation. (b) Graph of luminescence intensity evaluation. Cell luminescence intensity was evaluated using a flow cytometer (FACS Attune) after TPE-C-N was treated with A549 cells for 5 minutes at 37°C, followed by Cy5-4S treatment for 10 minutes under light irradiation at room temperature. (a) X-mean value, (b) R2 gate%. Fluorescence microscope image of A549 cells treated with TPE-C-N for 5 minutes at 37°C, followed by Cy5-4S treatment for 5 minutes under light irradiation at room temperature. Photograph of the aqueous solution containing (a) PI and (b) Cy5-4S after adding a hexane solution containing TPE-C-N (right side of the figure; left side does not contain TPE-C-N). Confocal microscope images of A549 cells treated with TPE-C-N and treated with PI immediately (0 minutes) or 15 minutes after light irradiation. Confocal microscope images of HeLa cells treated with TPE-C-N and treated with Cy5-4S under light irradiation. OVK-18, SUIT-2, HUVEC, A549, A431, and HeLa cells were treated with Cy5-4S in the presence of TPE-C-N under light irradiation, and the luminescence intensity from the cells was measured using a flow cytometer (FACS Attune), and this graph summarizes the gate%. Confocal microscope images of A549 cells treated with TPE-C-N and treated with FITC-R8 under light irradiation. Evaluation of luminescence intensity when A549 cells treated with TPE-C-N and treated with FITC-R8 under light irradiation.Cytotoxicity (WST-8 assay) evaluation of TPE-CN-treated A549 cells treated with R8-PAD under light irradiation. Evaluation of the RNA expression suppression effect of TPE-CN-treated A549 cells treated with ASO under light irradiation. Results show the residual rate of TPE-CN in A549 cells. A549 cells treated with TPE-C4-N (Figure 23a), TPE-CN (Figure 23b), or TPE-C16-N (Figure 23c) were treated with Cy-5, and the distribution of Cy-5 fluorescent signals within the cells was observed. The luminescence intensity of these cells was measured using a flow cytometer (BD Accuri C6 Plus), and the gate percentage was summarized (Figure 23e). The distribution of these cells is summarized (Figure 23f), with luminescence intensity on the horizontal axis and cell number on the vertical axis.

[0013] The compound of the present invention is represented by the general formula described above. Such a compound of the present invention exhibits optical properties, such that it becomes luminescent when aggregated and loses its luminescence when dispersed. Furthermore, it also has the ability to attach to the surface of cell membranes.

[0014] The compounds of the present invention emit strong light when irradiated with ultraviolet to blue light when molecular motion is restricted. When optical absorption and emission spectra are measured in a mixed solvent of water and an organic solvent such as MeCN or DMF, when the ratio of organic solvent to water is high, the compounds of the present invention are dispersed, and the excitation energy is deactivated by the rotation and bending / extension motion of the molecules, resulting in almost no light emission even when irradiated with light. On the other hand, when the ratio of organic solvent is reduced, aggregation of the lipid-soluble TPE skeletons is induced, inhibiting molecular motion, and making it easier to emit light (aggregation-induced emission (AIE)).

[0015] Furthermore, when the compound of the present invention is attached to the cell membrane surface and irradiated with light, it induces molecular motion, thereby improving cell membrane permeability, and therefore can be used as a cell permeation enhancer.

[0016] The compound of the present invention is a compound represented by the above-mentioned general formula (1). In the general formula, R １are the same or different and are linear aliphatic alkyl groups having 1 to 20 carbon atoms. More preferably, they have 3 or more carbon atoms. Most preferably, R １ All of them are C ８ H １７ This is an embodiment.

[0017] R ２ are the same or different and each represents a linear aliphatic alkyl group having 1 to 17 carbon atoms or -NR ３ ２ Among these, -NR ３ ２ More preferably, all are -NR ３ ２ It is more preferable that:

[0018] R ３ are the same or different and each is a linear aliphatic alkyl group having 1 to 4 carbon atoms, and more preferably has 2 or less carbon atoms.

[0019] The compound represented by the general formula (1) above can be obtained by any synthesis method, for example, as shown in the following reaction scheme, although the synthesis method is not particularly limited.

[0020]

[0021] The reactions in each step of the above synthesis method will be briefly described below.

[0022]

[0023] This step is an etherification reaction of 4,4'-dihydroxybenzophenone. The etherification can be carried out by a known general method. Specifically, for example, １ Examples of such a reaction include a reaction with an alkyl halide represented by -X (X: halogen). The reaction can be carried out in the presence of a base such as potassium carbonate. Although not particularly limited, the reaction can be carried out, for example, in a polar organic solvent such as DMF, by stirring at 80°C or higher for 12 hours or more.

[0024]

[0025] This reaction is known as the McMurry coupling reaction. The low-valent titanium used as the reactant can be generated under known conditions, for example, by mixing titanium trichloride or titanium tetrachloride with zinc, an alkali metal, or lithium aluminum hydride. Similar reactants used in McMurry coupling reactions can also be used, and the reaction can be carried out under known conditions, such as reaction temperature and concentration.

[0026]

[0027] This reaction introduces a formyl group into a specific position of an aromatic ring. Specific examples of the method include a method in which a formylating agent is reacted under acidic conditions. While not particularly limited, examples include a method in which hexamethylenetetramine is reacted as a formylating agent in trifluoroacetic acid. The conditions for this reaction may be known.

[0028] (Step 4) The compound of the present invention can be obtained by reacting the compound represented by general formula 3 obtained in the above step 3 with an amine compound. This step is a combination of a dehydration reaction and a reduction reaction, and the dehydration reaction and the reduction reaction can be carried out stepwise or in one step. In this case, when a monoamine compound is used as the amine compound, R ２ The resulting compound is a linear aliphatic alkyl group having 1 to 17 carbon atoms (Step 4-1). While known dehydrating agents such as molecular sieves can be used in the dehydration reaction, a dehydration method using heating under reflux, such as a Dean-Stark apparatus, can also be used. Metal hydrides, such as sodium borohydride (NaBH4), can be used as reducing agents.

[0029]

[0030] When a diamine compound is used as the amine compound, R ２ But, -NR ３ ２ A compound represented by the formula (Step 4-2) is obtained.

[0031]

[0032] (Aggregation-Induced Luminescence) The compound of the present invention is characterized by exhibiting optical properties in which it becomes luminescent when aggregated and loses its luminescence when dispersed. More specifically, it exhibits aggregation-induced luminescence. This property can be utilized to identify the intracellular environment in which the compound partially aggregates. For example, it can be suitably used in staining cell membranes, etc.

[0033] (Cell Membrane Permeation Enhancer) The compound of the present invention can also be used as a cell membrane permeation enhancer. The compound of the present invention has the ability to adhere to the cell membrane surface. In particular, the compound having R in the side chain １ When the alkyl has 3 or more carbon atoms (e.g., C ８ H １７ ) and R ２ NR ３ ２ (R ３ In the case where n is 1 or more alkyl groups (e.g., NMe ２ ), and adhere more strongly to the cell surface. When the compound of the present invention adheres to the cell membrane surface, irradiation with ultraviolet to blue light causes excited molecules to lose their excitation energy through molecular rotation and bending / extension. During this deactivation, the rotation and bending / extension of the molecules is presumed to cause disturbances on the cell membrane surface. Such disturbances then facilitate the permeation of various compounds through the cell membrane. It is presumed that this effect allows the compound of the present invention to exhibit its effect as a cell membrane permeation enhancer.

[0034] Such cell membrane permeation enhancers are preferable because they can introduce a wide variety of compounds, from low-molecular-weight compounds such as cyanine dyes to relatively large molecules such as oligopeptides with molecular weights of approximately 1,000 to 3,000 and nucleic acid drugs with molecular weights of approximately 5,000. Furthermore, because they contain anionic phosphate moieties, they are highly likely to be applicable to nucleic acid drugs, etc., which are difficult to permeate through membranes due to electrostatic repulsion with phospholipids in the cell membrane. In other words, these cell membrane permeation enhancers have excellent effects in that they can enable nucleic acid drugs, etc., which have an extremely low probability of reaching the interior of the cell membrane upon simple contact with cells, to reach the interior of the cell membrane. Furthermore, the compounds of the present invention are excellent in that they permeate the cell membrane by causing temporary disruption in the cell membrane upon irradiation with light, and therefore, after this temporary disruption subsides, the cell membrane returns to its original state, preventing cell death.

[0035] Such use as a cell membrane permeation enhancer can be applied to in vitro experiments, and is also expected to be used in vivo or ex vivo.

[0036] (Molecules permeated by cell membrane permeation enhancer) As described above, the cell membrane permeation enhancer of the present invention acts on molecules with relatively large molecular weights, such as nucleic acid drugs, and can be applied to not only nucleic acid drugs but also compounds used as pharmaceuticals with a molecular weight of 5000 or less. Furthermore, even a small amount exerts a useful effect on low-molecular-weight compounds, and can be applied to those with a molecular weight of 500 to 2000, for example.

[0037] (Method for Promoting Cell Membrane Permeation) The present invention also relates to a method for introducing a compound into a cell membrane using the cell membrane permeation agent of the present invention. Specifically, this method comprises the steps of: (1) mixing a cell with the compound of the present invention; (2) mixing a compound to be introduced; and (3) irradiating with light.

[0038] In the above method, cells are first mixed with the compound of the present invention. This allows the compound of the present invention to adhere to the cell membrane surface. This step is preferably carried out in the presence of a liquid medium. For example, the compound of the present invention can be dissolved or dispersed in a liquid medium such as water or a mixture of water and a polar solvent such as DMF or dimethyl sulfoxide at a concentration of 5% or less, preferably 2% or less, and then contacted with cells. The contact conditions are not particularly limited, and the compound can be mixed at room temperature while shaking.

[0039] In order to allow the compound of the present invention to adhere to the cell membrane, it is preferable to leave it for a certain period of time. More specifically, after mixing the cells and the compound of the present invention, it is preferable to leave it for 5 to 20 minutes. By leaving it for such a period of time, the compound of the present invention will be sufficiently attached to the cell membrane surface.

[0040] Next, the compound to be introduced is added and mixed. Step (2) of adding the compound to be introduced is preferably carried out immediately before step (3) of irradiating with light, which will be described later, but may also be carried out during or within a certain time after light irradiation. The compound of the present invention is brought into contact with cells in a liquid medium, so that it adheres to the cell membrane. In this state, the compound to be introduced is coexistent and light irradiation is carried out. Light irradiation is carried out to convert the compound of the present invention from the ground state to an excited state. To cause such a transition, it is preferable to irradiate with light having a wavelength of 300 to 450 nm. The light intensity is not particularly limited, and may be, for example, 10 mW / cm 2 The light source is not particularly limited, and examples thereof include a xenon lamp light source and an LED light source. The light irradiation time can be 5 to 20 minutes.

[0041] It is believed that light irradiation causes disturbances on the cell membrane surface, which in turn creates pores in the cell membrane, allowing the target compound to be introduced into the cell through the pores.

[0042] When the step (2) of adding the compound to be introduced is performed after the light irradiation step (3), it is preferable to perform the step within 10 minutes after the light irradiation, although this depends on the type of cell. That is, when the light irradiation is stopped, the rotation and bending / extension movement of the molecular structure of the compound of the present invention stops. Therefore, the compound to be introduced cannot be sufficiently introduced into the cell membrane.

[0043] Furthermore, by carrying out the light irradiation (3) while carrying out the step (2), the compound is quickly re-excited to the excited state even if it is de-excited to the ground state, and molecular motion continues repeatedly. In this state, the compound to be introduced can be continuously introduced into the cell membrane.

[0044] (Cytotoxicity) It has also been revealed that the compounds of the present invention have low cytotoxicity. In the following examples, the present inventors have also confirmed whether cell death occurs when the compounds of the present invention are used as cell membrane permeabilizing agents. As a result, it has been revealed that even after tests using the compounds of the present invention, the rate of cell death is low. From this perspective, the compounds of the present invention are preferable.

[0045] The present invention will be described in detail below with reference to examples, but the present invention is not limited thereto. In the following examples, among the compounds represented by general formula (1), R １ is C ８ H １７ The compound represented by the formula R is referred to as TPE-C-N. １ is C ４ H ９ The compound of TPE-C4-N, R １ is C １６ H ３３ The compound is referred to as TPE-C16-N.

[0046] (Synthesis of Compounds) (Example 1) (1-1) Synthesis of Compound 1

[0047]

[0048] Under a nitrogen atmosphere, 4,4'-dihydroxybenzophenone (1.1 g, 5.0 mmol), bromooctane (3.9 g, 20 mmol), K2CO3 (6.9 g, 50 mmol), and DMF (80 mL) were stirred at 80 °C for 12 h. The reaction solution was allowed to cool, and chilled Milli-Q water (80 mL) was added and stirred for 2 h. The reaction solution was extracted with dichloromethane (50 mL), and the organic layer was washed with saturated brine (2 × 30 mL). The washed organic layer was dried over magnesium sulfate, the magnesium sulfate was removed by filtration, and the organic solvent was evaporated under reduced pressure. The residue was recrystallized from hexane to give 1 (2.3 g, 97%) as a white solid. 1 H NMR (400 MHz, CDCl3, 25 °C): δ = 0.89 (t, J = 6.9 Hz, 6H), 1.30-1.38 (m, 16H), 1.44-1.51 (m, 4H), 1.78-1.85 (m, 4H), 4.03 (t, J = 6.7 Hz, 4H), 6.94 (d, J = 8.7 Hz, 4H), 7.77 (d, J = 4.6 Hz, 4H). 13 C NMR (100 MHz, CDCl3, 25 °C): δ = 14.5, 23.1, 26.4, 29.5, 29.6, 29.7, 32.2, 68.6, 114.3, 130.9, 132.6, 162.8, 194.8. HRMS (ESI) calcd for C 29 H 42 O3 ([M+Na] + ): 461.3026, found: 461.3024.

[0049] (1-2) Synthesis of Compound 2

[0050]

[0051] Under a nitrogen atmosphere, powdered zinc (1.4 g, 21 mmol) was added to a solution of 1 (1.9 g, 4.1 mmol) in THF (40 mL) at 0 °C and stirred for 20 min. TiCl4 (3.9 g, 21 mmol) was added dropwise to this solution at 0 °C. The reaction solution was refluxed and allowed to react overnight. After cooling to room temperature, saturated aqueous potassium carbonate (40 mL) was added and stirred for 30 min. The mixture was filtered through Celite, and the THF contained in the filtrate was evaporated under reduced pressure. The residue was dissolved in ethyl acetate (20 mL) and washed with saturated brine (2 × 30 mL). The washed organic layer was dried over magnesium sulfate. The magnesium sulfate was removed by filtration, and the organic solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (hexane / AcOEt, v:v = 20:1-10:1) to give 2 as a white solid (1.3 g, 76%). 1 H NMR (400 MHz, CDCl3, 25 °C): δ = 0.88 (t, J = 6.4 Hz, 12H), 1.28-1.34 (m, 32H), 1.38-1.46 (m, 8H), 1.70-1.77 (m, 8H), 3.87 (t, J = 6.4 Hz, 8H), 6.62 (d, J = 8.2 Hz, 8H), 6.90 (d, J = 8.2 Hz, 8H). 13 C NMR (100 MHz, CDCl3, 25 °C): δ = 14.3, 22.8, 26.2, 29.4, 29.5, 29.6, 32.0, 67.9, 113.6, 132.7, 136.9, 138.4, 157.4. HRMS (ESI) calcd for C 58 H 84 O4 ([M+Na] + ): 867.6262, found: 867.6252.

[0052] (1-3-a) Synthesis of Compound 3a

[0053] Compound 3a was synthesized by a known method (Reference: J. Xiong, Y. Yuan, L. Wang, J. Sun, W. Qiao, H. Zhang, M. Duan, H. Han, S. Zhang, Y. Zheng, Org. Lett. 2018, 20, 373-376).

[0054] (1-3-b) Synthesis of Compound 3b

[0055] Under a nitrogen atmosphere, 2b (0.46 g, 0.54 mmol) and hexamethylenetetramine (6.0 g, 43 mmol) were dissolved in trifluoroacetic acid (50 mL) and reacted under reflux for 18 hours. The reaction solution was allowed to cool, and chilled Milli-Q water (80 mL) was added and stirred for 1 hour. The reaction solution was extracted with dichloromethane (50 mL), and the organic layer was washed with saturated brine (2 × 30 mL). The washed organic solvent was evaporated under reduced pressure, and the residue was purified by silica gel column chromatography (hexane / AcOEt, v:v = 20:1-10:1) to give 3b as a pale yellow solid (0.40 g, 77%). 1 H NMR (400 MHz, CDCl3, 25 °C): δ = 0.89 (dd, J = 6.9, 5.0 Hz, 12H), 0.90-0.88 (m, 32H), 1.42-1.50 (m, 8H), 1.77-1.84 (m, 8H), 4.00 (t, J = 6.0 Hz, 8H), 6.71 (dd, J = 8.7, 1,8 Hz, 4H), 7.15 (dt, J = 8.7, 2.3 Hz, 4H), 7.43 (t, J = 2.3 Hz, 4H), 10.35 (d, J = 2.3 Hz, 4H). 13 C NMR (100 MHz, CDCl3, 25 °C): δ = 13.8, 22.4, 25.8, 28.8, 28.9, 29.0, 31.5, 68.3, 111.9, 124.2, 130.5, 134.9, 138.1, 138.6, 160.1, 189.2. HRMS (ESI) calcd for C 62 H84 O8 ([M+Na] + ): 979.6058, found: 979.6058.

[0056] (1-4) Synthesis of TPE-N

[0057]

[0058] Under a nitrogen atmosphere, 3a (0.11 g, 0.19 mmol), N,N-dimethyl-1,3-propanediamine (80 mg, 0.78 mmol), and 4Å molecular sieves were added to anhydrous methanol (20 mL) and reacted under reflux for 24 hours. The molecular sieves were removed by filtration, and the resulting solution was treated with NaBH4 (29 mg, 0.78 mmol) at 0°C. The reaction solution was stirred overnight at room temperature. Water (5 mL) was added to the reaction solution, followed by the addition of 10% hydrochloric acid to neutralize it. Potassium carbonate was added to adjust the pH of the aqueous solution to approximately 9. The methanol contained in the solution was evaporated under reduced pressure, and the water was removed by lyophilization. The residue was dissolved in methylene chloride and filtered through Celite to remove insoluble material. The organic solvent was evaporated under reduced pressure to yield TPE-N (78 mg, 44%). 1 H NMR (400 MHz, CD3OD, 25 °C): δ = 1.62-1.67 (m, 8H), 2.25 (s, 24H), 2.37 (t, J = 7.3 Hz, 8H), 2.52 (t, J = 6.9 Hz, 8H), 3.67 (s, 8H), 3.82 (s, 12H), 6.79 (d, J = 8.2 Hz, 4H), 6.94-7.00 (m, 8H). 13 C NMR (100 MHz, CDCl3, 25 °C): δ = 25.9, 45.2, 47.2, 48.1, 55.1, 58.1, 109.4, 124.5, 131.8, 133.5, 136.2, 138.3, 155.7. HRMS (ESI) calcd for C 54 H 84 N8O4 ([M+H] + ): 909.6688, found: 909.6699.

[0059] (1-5) Synthesis of TPE-C—N

[0060]

[0061] Under a nitrogen atmosphere, 3b (0.11 g, 0.12 mmol), N,N-dimethyl-1,3-propanediamine (47 mg, 0.46 mmol), and 4Å molecular sieves were added to anhydrous methanol (15 mL) and reacted under reflux for 24 hours. The molecular sieves were removed by filtration, and the resulting solution was treated with NaBH4 (18 mg, 0.47 mmol) at 0°C. The reaction solution was stirred overnight at room temperature. Water (5 mL) was added to the reaction solution, followed by the addition of 10% hydrochloric acid to neutralize it. Potassium carbonate was added to adjust the pH of the aqueous solution to approximately 9. The methanol contained in the solution was evaporated under reduced pressure, and the water was removed by lyophilization. The residue was dissolved in methylene chloride and filtered through Celite to remove insoluble material. The organic solvent was evaporated under reduced pressure to yield TPE-C-N (78 mg, 52%). 1 H NMR (400 MHz, CD3OD, 25 °C): δ = 0.91 (t, J = 6.8 Hz, 12H), 1.29-1.39 (m, 32H), 1.45-1.51 (m, 8H), 1.56-1.64 (m, 8H), 1.75-1.82 (m, 8H), 2.21 (s, 24H), 2.28 (t, J = 7.3 Hz, 8H), 2.38 (t, J = 6.9 Hz, 8H), 3.56 (s, 8H), 3.96 (t, J = 6.4 Hz, 8H), 6.71 (d, J = 8.2 Hz, 4H), 6.90 (d, J = 7.3 Hz, 8H). 13 C NMR (100 MHz, CDCl3, 25 °C): δ = 14.2, 22.8, 26.4, 28.2, 29.4, 29.5, 31.9, 45.7, 47.2, 49.4, 58.2, 67.9, 110.2, 127.3, 131.3, 133.2, 136.5, 138.6, 155.5. HRMS (ESI) calcd for C 82 H 140O4N8 ([M+H] + ): 1302.1070, found: 1302.1081.

[0062] (1-6) Synthesis of TPE-C

[0063]

[0064] Under a nitrogen atmosphere, 3b (0.15 g, 0.16 mmol), n-butylamine (47 mg, 0.46 mmol), and 4Å molecular sieves were added to anhydrous methanol (20 mL) and reacted under reflux for 24 hours. The molecular sieves were removed by filtration, and the resulting solution was treated with NaBH4 (48 mg, 1.3 mmol) at 0°C. The reaction solution was stirred overnight at room temperature. Water (5 mL) was added to the reaction solution, followed by the addition of 10% hydrochloric acid to neutralize it. Potassium carbonate was added to adjust the pH of the aqueous solution to approximately 9. The methanol contained in the solution was evaporated under reduced pressure, and the residue was dissolved in chloroform (20 mL). The organic layer was washed with saturated brine (2 × 30 mL) and dried over magnesium sulfate. The magnesium sulfate was removed by filtration, and the organic solvent was evaporated under reduced pressure to yield TPE-C (94 mg, 51%). 1 H NMR (400 MHz, CD3OD, 25 °C): δ = 0.89-0.92 (m, 24H), 1.25-1.9 (m, 56H), 1.74-1.79 (m, 8H), 2.31 (t, J = 6.9 Hz, 8H), 3.55 (s, 8H), 3.95 (t, J = 6.4 Hz, 8H), 6.71 (d, J = 8.2 Hz, 4H), 6.89 (d, J = 8.7 Hz, 8H). 13 C NMR (100 MHz, CDCl3, 25 °C): δ = 13.8, 13.9, 20.3, 22.5, 26.1, 29.1, 29.2, 31.6, 32.0, 48.1, 49.2, 67.5, 109.9, 127.1, 130.9, 133.0 136.2, 138.3, 155.2. HRMS (ESI) calcd for C 78 H 128 N4O4 ([M+H]+ ): 1186.0008, found: 1185.9995.

[0065] (Optical Properties of Each Compound) The absorption and emission spectra of TPE-C, TPE-N, and TPE-C-N obtained by the above-described manufacturing method were measured using MeCN / Milli-Q water (v / v = 1 / 1) as the solvent, and are shown in FIG. 7. In FIG. 7, (a) is the absorption spectrum, and (b) is the emission spectrum. The emission spectrum has a wavelength of λ ｅｘ Measurements were made at λ = 330 nm. The absorption and emission spectra of TPE-C and TPE-C-N obtained by the above-mentioned manufacturing method were measured using DMF / Milli-Q water (v / v = 1 / 200) as the solvent, and are shown in Figure 8. In Figure 8, (a) is the absorption spectrum and (b) is the emission spectrum. The emission spectrum is measured at λ ｅｘ Measurements were taken at 330 nm. The emission intensity in Figure 7b is about 1 / 100 of that in Figure 8b, indicating that there is almost no emission in the MeCN / Milli-Q water (v / v = 1 / 1) solvent. This suggests that there is no emission when the organic solvent ratio is high and the molecules are dispersed, but that there is emission in a medium with little organic solvent and where the molecules tend to aggregate.

[0066] For TPE-C-N, (a) absorption and (b) emission spectra were measured in solvents with varying mixture ratios of water and MeCN. The results are shown in Figure 9. From these results, it can be seen that when the ratio of MeCN is high, there is almost no emission. On the other hand, when the ratio of organic solvent is reduced, emission becomes more likely. This is presumably due to the aggregation of the lipophilic TPE skeletons, which inhibits molecular motion.

[0067] (Experiments on the Function of the Compound of the Present Invention as a Cell Permeation Enhancer) Before describing in detail the contents of the experiments on the compound of the present invention described above, various experimental methods will first be explained.

[0068] (Reagents) Reagents were purchased from domestic reagent manufacturers and used as is without any special treatment. Celite® 535 was purchased from Sigma-Aldrich. Silica gel for column chromatography (SiO2, 230-400 mesh) was purchased from Silicycle.

[0069] (Apparatus) UV-visible absorption spectra of compounds were measured using a UV-visible absorption spectrometer UH5300 (Hitachi High-Technologies Co., Japan). Emission spectra of compounds were measured using an emission spectrometer RF-6000 (Shimadzu Co., Japan). Mass spectrometry of compounds was measured using EXACTICVE (ESI, Thermo Fisher Scientific Inc., USA). Emission images were observed using a fluorescence microscope BZ-X810 (Keyence Co. Ltd., Japan). Confocal laser scanning microscope images of live cells were observed using an LSM 710 (Carl Zeiss Co. Ltd., Germany). Flow cytometer analysis was performed using a FACS Attune (Thermo Fisher Scientific Inc., USA) and a BD Accuri C6 Plus (Becton, Dickinson and Company, USA). Light irradiation was performed using an LED light irradiation device CL-1501 (with timer unit CL-TCN1, Asahi Spectra Co., Ltd., Japan).

[0070] (Cell growth method) Cell types: Human lung cancer cell line (A549), human ovarian endometrioid adenocarcinoma cell line (OVK-18), and human umbilical vein endothelial cell line (HUVEC) were purchased from the Riken Cell Bank (Japan). Human epidermoid carcinoma cell line (A431) and human cervical cancer cell line (HeLa) were purchased from the American Type Culture Collection (USA). Human pancreatic adenocarcinoma cell line (SUIT-2) was purchased from the Japanese Collection of Research Bioresources Cell Bank (Japan).

[0071] HeLa, A549, OVK-18, and A431 cells were grown in DMEM medium containing 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin. HUVECs were grown in endothelial cell basal medium containing 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin. SUIT-2 cells were grown in RPMI-1640 medium containing 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin in an incubator with 5% CO2 in air at 37°C.

[0072] (Cell viability test using WST-8 and cell membrane permeability evaluation of R8-PAD) A549 and HUVEC were cultured at 5 × 10 3Cells were seeded into a 96-well plate at a concentration of 1000 cells / well and grown for 24 hours. The medium was removed and the plate was washed twice with PBS. TPE-C-N (75 μL / well, 10 μM, PBS solution) was added, and the plate was shielded from light with aluminum foil and grown at 25°C for 5 minutes. PBS (25 μL / well) or the peptide drug R8-PAD (d(KLAKLAK)2-amide, 25 μL / well, 10 μM, PBS solution) with a molecular weight of approximately 3000 was added, and the plate was illuminated by LED light (365 nm, 10 mW / cm 2 ) for 5 minutes at 25°C. In the case of no light exposure, the plate was shielded from light with aluminum foil and left to stand at 25°C for 5 minutes. After washing twice with PBS (0.5% (w / v) heparin sodium (EMD Millipore Corp., USA)), the corresponding medium was added and the plate was left to stand in an incubator at 37°C for 4 hours. WST-8 (10 μL / well) was added and the plate was left to stand in an incubator for another 2 hours, and the absorbance at 450 nm was measured at 800 TS. TM Absorbance was measured using an Absorbance Microplate Reader (BioTek Instruments, USA). Cell viability was calculated according to the following formula: Cell viability (%) = (A test -A blank ) / (A control -A blank ) × 100 A test : Average absorbance A of the cells under the experimental conditions of interest blank : Average absorbance A of wells without cells seeded controlAverage absorbance of untreated cells. The results are shown in Figures 10 and 20. The results shown in Figure 10 clearly demonstrate that the compounds of the present invention are not cytotoxic. Furthermore, they do not exhibit cytotoxicity even when irradiated with light. Because R8-PAD contains oligoarginines, it has the ability to permeate cell membranes. The results shown in Figure 20 demonstrate that the addition of R8-PAD alone induced approximately 20% cell death, regardless of whether or not light was irradiated. Furthermore, the use of the compound of the present invention (TPE-C-N) significantly induced R8-RAD-mediated cell death even in the absence of light irradiation, demonstrating that light irradiation further improved the cell permeability of R8-PAD, thereby increasing cell death.

[0073] (Procedure for cell experiments using confocal laser microscope and luminescence microscope) (Evaluation of cell membrane permeability of Cy5-4S and FITC-R8) A549 cells (3 × 10 4 Cells (cells / well) were seeded and grown for 24 hours. The medium was removed, and the plate was washed twice with PBS. TPE-C-N (150 μL / well, 10 μM, PBS solution) was applied to the plate at 25°C for 5 minutes. The plate was shielded from light using aluminum foil. Then, Cy5-4S (50 μL / well, 40 μM in PBS) or FITC-R8 (50 μL / well, 10 μM, PBS solution) was applied to the plate, and LED light (365 nm, 10 mW / cm) was applied. 2) was irradiated for 5 minutes at 25°C. The unirradiated control group was covered with aluminum foil to protect from light. The PBS was removed, washed with PBS containing 0.5 mg / mL heparin, and 150 μL / well of PBS containing 0.5 mg / mL heparin was added. The cells were then observed using a 63x objective lens on a confocal laser scanning microscope (LSM 710, Carl Zeiss, Germany). For Cy5-4S, an excitation wavelength of 633 nm (detection wavelength: 647-759 nm) was used, and for FITC-R8, an excitation wavelength of 488 nm (detection wavelength: 493-630 nm) was used (Figures 18 and 19). Live cell images were captured using a BZ-X800 luminescence microscope (Keyence Corporation, Japan) with the attached sectioning module (BZ-H4XF) (40x objective lens). For red emission, excitation wavelengths of 600 / 60 nm (detection wavelengths: 700 / 75 nm) were used, and for blue emission, excitation wavelengths of 350 / 50 nm (detection wavelengths: 500 / 40 nm) were used. The relative emission intensity was calculated according to the following formula: relative emission intensity = (F test -F blank ) / (F control -F blank ) F test : Average luminescence of cells under the experimental conditions of interest F blank : Mean luminescence of untreated cells F control : Average luminescence of cells without Cy5-4S or TPE-C-N

[0074] When Cy5-4S was applied without TPE-C-N, no luminescence from Cy5-4S was detected in the cells, indicating that Cy5-4S has difficulty penetrating the cell membrane, regardless of whether light was irradiated or not (Figure 11(a), first and second from the left). After 20 minutes of incubation with TPE-C-N, Cy5-4S was applied under light irradiation. Strong luminescence from Cy5-4S was observed in the cytoplasm of some cells (Figure 11(a), fourth from the left). On the other hand, without light irradiation, no Cy5-4S was taken up into the cytoplasm (Figure 11(a), third from the left). The bright spots are thought to be aggregates formed by the cationic TPE-C-N and anionic Cy5-4S. In fact, when TPE-C-N and Cy5-4S were applied simultaneously, only bright spots were observed, regardless of whether light was irradiated or not. Cy5-4S is a compound represented by the following general formula:

[0075]

[0076] (Cell membrane permeation of the drug-mimetic small molecule dye Cy5-4S using TPE-C-N) A549 cells treated with TPE-C-N were exposed to the anionic dye Cy5-4S, which has poor cell membrane permeability, under light irradiation. To quantitatively assess the number of cells that incorporated the dye, we counted the number of cells with increased luminescence using a flow cytometer (FACS Attune) (Figure 12). Significant increases were confirmed in the mean luminescence (X-mean) across all cells and the percentage of cells that exhibited luminescence above the cell's own autoluminescence (R2 gate%). Notably, the percentage of cells that exhibited luminescence above the cell's maximum autoluminescence was approximately 9% of the total, indicating high cell membrane permeation efficiency.

[0077] Next, A549 cells treated with TPE-C-N were observed under a fluorescence microscope to confirm their localization at the cell membrane (Figure 13). As described in the previous section, cell membrane penetration of Cy5-4S was confirmed under light irradiation. When examined using the blue channel, strong luminescence was observed from the cell membrane. TPE-C-N remained localized at the cell membrane even after light irradiation, suggesting that it did not form a complex with the anionic dye through electrostatic interactions and then migrate into the cytoplasm. After light irradiation, the cells were washed three times with PBS containing heparin (0.5 mg / mL).

[0078] (Cell membrane permeation of the drug-mimetic small molecule dye PI using TPE-C-N) PI, a cationic dye used to stain the nuclei of dead cells (it does not permeate the cell membrane of live cells), was selected as the drug-mimetic dye and a similar cell membrane permeation test was performed (Figure 15). It was confirmed using a two-phase solvent system of hexane and water that TPE-C-N interacts with Cy5-4S through electrostatic interactions, but TPE-C-N does not interact with PI at all (coloration due to Cy5-4S was observed only in the hexane layer on the right side of Figure 14 and Figure 14(a)). The specific test method is as follows:

[0079] A549 cells (3 × 10 cells) were plated in an 8-well plate (μ-Slide 8 Well ibiTreat, Germany). 4 Cells (cells / well) were seeded and grown for 24 hours. The medium was removed, and the cells were washed twice with PBS. TPE-C-N (150 μL / well, 10 μM, PBS solution) was applied to the cells at 25°C for 5 minutes. The plate was shielded from light using aluminum foil. Then, PBS (50 μL / well) was applied and LED light (365 nm, 10 mW / cm) was applied. 2) was irradiated at 25°C for 5 minutes. The control group, which was not exposed to light, was covered with aluminum foil to protect from light. The PBS used for the treatment was removed, and the cells were washed with PBS (containing 0.5 mg / mL heparin), followed by the addition of DMEM (150 μL). The 0-minute treatment condition indicates that DMEM was added and immediately removed. The 15-minute treatment condition indicates that DMEM was removed after 15 minutes of treatment at 37°C. After the DMEM was removed, PI (150 μL, 10 μg / mL, PBS solution) was applied for 10 minutes at 25°C. The PBS used for the treatment was removed, and the cells were washed with PBS (containing 0.5 mg / mL heparin). PBS (150 μL / well, containing 0.5 mg / mL heparin) was added, and the cells were observed using a confocal laser scanning microscope. The results are shown in Figure 15. The green emission of PI (green channel) was observed at an excitation wavelength of 488 nm and a detection wavelength of 551–697 nm. The merge image shows the bright-field image overlaid with the green channel image. Immediately after light irradiation, PI permeates the cell membrane, resulting in nuclear staining. However, 15 minutes after light irradiation, PI did not permeate the cell membrane, and no nuclear staining was observed.

[0080] These results suggest that: ・TPE-C-N can permeate cell membranes with drugs that do not interact with it; ・The cell membrane permeability effect is maintained for a while, not just during light irradiation. However, this effect is lost after about 15 minutes; ・The staining results after 0 minutes are not caused by cell death. These results demonstrate that this method of permeating cell membranes using TPE-C-N under light irradiation is effective in permeating a variety of drugs without impairing cellular homeostasis.

[0081] (Cell Membrane Permeation of the Drug-Mimetic Small Molecular Dye Cy5-4S Using TPE-C-N: HeLa Cells) Similar confocal laser scanning microscopy experiments were performed on HeLa cells (human cervical cancer), a relatively easy-to-handle, commonly used tumor cell type (Figure 16). After 20 minutes of TPE-C-N exposure at 37°C, Cy5-4S was applied for 10 minutes at room temperature under light irradiation. The dye was delivered to the cytoplasm, resulting in corresponding luminescence (Figure 16, fourth panel from the left). Without TPE-C-N exposure, no cell membrane permeation of Cy5-4S was observed, regardless of the presence or absence of light (Figure 16, first and second panels from the left). On the other hand, when Cy5-4S was applied with TPE-C-N but without light irradiation, some cells exhibited luminescence derived from Cy5-4S (Figure 16, third panel from the left). This is thought to be because TPE-C-N is an amphiphilic molecule, and thus has the ability to induce drug permeation through the cell membrane, similar to existing lipofectamine. However, the cell membrane permeation efficiency was clearly lower than when light was irradiated, demonstrating the significance of this method. These results also demonstrated that this method is effective regardless of cell type.

[0082] (Procedure for cell experiments using a flow cytometer) (Evaluation of cell membrane permeability of Cy5-4S) HeLa, A549, SUIT-2, OVK-18, HUVEC, and A431 cells (1 × 10 5 Cells (cells / well) were seeded and grown for 24 hours. A431 cells were grown for 48 hours. The medium was removed and the plate was washed twice with PBS. TPE-C-N (750 μL / well, 10 μM, PBS solution) was applied to the plate at 25°C for 5 minutes. The plate was shielded from light using aluminum foil. Then, Cy5-4S (250 μL / well, 40 μM, PBS solution) was applied and LED light (365 nm, 10 mW / cm 2) at 25°C for 10 minutes. The control group, which was not exposed to light, was covered with aluminum foil to protect from light. The PBS used for the treatment was removed, and the cells were washed with PBS (containing 0.5 mg / mL heparin). Trypsin was then applied to recover the cells. 200 μL of PBS was added to disperse the cells, which were then centrifuged at 3000 rpm for 5 minutes at 4°C. The cells were washed again with 200 μL of PBS, and then dispersed in 300 μL of PBS. The cell suspension was passed through a cell strainer (pore size 100 μm) and analyzed using a FACS Attune flow cytometer (Thermo Fisher Scientific). Detection was performed using a yellow laser (561 nm) in the red emission region (695 nm / 40 nm). The results are from analyzing 10,000 cells for each sample. The relative percentage of the cell population containing Cy5-4S that had permeated the membrane was calculated as follows: relative gate % = C test ×100 / C control C test C: Number of cells containing membrane-permeated Cy5-4S (number of cells with high luminescence intensity) control Figure 17 shows the cell counts when Cy5-4S was applied without TPE-C-N and without light irradiation. When Cy5-4S was applied without TPE-C-N and light irradiation, some cells showed luminescence due to Cy5-4S. However, light irradiation clearly improved cell membrane penetration efficiency, demonstrating the significance of this method. These results also demonstrate that this method is effective not only for cancer cells but also for normal cells such as HUVECs. A431 cells are one of the cells for which lipofectamine is difficult to penetrate, demonstrating the usefulness of this method as a complementary technique for cell populations for which lipofectamine is not applicable.

[0083] (Cell Membrane Permeation of the Drug-Mimetic Small Molecular Dye FITC-R8 Using TPE-C-N) We evaluated the cell membrane permeation of FITC-R8, an oligoarginine conjugated with the luminescent dye FITC, with a molecular weight of approximately 2000. Because this oligoarginine itself exhibits cell membrane permeability, it is a molecule that exhibits a certain degree of cell membrane permeation even without this method. Using TPE-C-N, we evaluated the cell membrane permeation efficiency of FITC-R8 in A549 cells under light irradiation (Figures 18 and 19). While some luminescence was observed with FITC-R8 alone, the addition of TPE-C-N significantly increased the luminescence. On the other hand, the addition of TPE-C-N to FITC-R8 under light irradiation significantly increased the luminescence. These results demonstrate that this method is also effective for the cell membrane permeation of drugs with a molecular weight of approximately 2000.

[0084] (Cell Membrane Permeation of Nucleic Acid Drug ASO) We evaluated the cell membrane permeation of antisense nucleic acid drugs (ASOs), which are nucleic acid drugs with a molecular weight of approximately 5000. ASOs bind to intracellular target RNA and induce cleavage of the target RNA by RNase H. The MALAT1-ASO used in this study reduces the expression level of MALAT1 RNA, a long non-coding RNA. Quantifying MALAT1 RNA expression levels can be used to evaluate the cell membrane permeation efficiency of ASOs. MALAT1 RNA expression levels in cells untreated with TPE-C-N and ASO served as a control group, and three treatments were compared: TPE-C-N alone, ASO alone, and both TPE-C-N and ASO. The results are shown in Figure 21. Without light irradiation, almost no difference in MALAT1 RNA expression was observed. However, with light irradiation, a significant decrease in MALAT1 RNA expression was observed only when both TPE-C-N and ASO were treated.

[0085] The procedure for this experiment is as follows: 1.8 × 10 cells of MIA PaCa-2 / CMV-Luc (cell number: JCRB1681, hereinafter abbreviated as MIA PaCa-2-Luc), a stable luciferase-expressing strain, were placed on a 96-well plate. 4Cells were seeded at 1000 cells / well and grown for 24 hours. In this experiment, DMEM (low glucose, FBS-free, phenol red-free) and DMEM (low glucose, 5% FBS-containing, phenol red-containing) were used. The former was designated Medium A, and the latter Medium B. Medium C containing 40 μM TPE-C-N was prepared by diluting TPE-C-N (2.0 mM, DMF solution) with Medium A. Medium D containing ASO was prepared by diluting ASO (50 μM) with Medium A. Medium E containing ASO was prepared by diluting ASO (50 μM) with Medium B. The ASOs were purchased from Gene Design, Inc., and their sequences are as follows (uppercase letters: LNA (locked nucleic acid); lowercase letters: DNA; ^: Phosphorothioate linkage): MALAT1-ASO: G^C^A^t^t^c^t^a^a^t^a^g^c^A^G^C

[0086] The medium for the grown MIA PaCa-2-Luc cells was removed and washed twice with PBS (120 μL). Medium A (50 μL / well) and medium C containing TPE-C-N (25 μL / well, 40 μM) were added, and the plate was shielded from light with aluminum foil and left to stand for 5 minutes. In experiments without TPE-C-N, PBS (25 μL) was added instead of TPE-C-N. Medium D (25 μL / well) containing ASO was added, and the cells were then exposed to LED light (365 nm, 10 mW / cm). 2) was irradiated for 10 minutes at 25°C. In the system without ASO, medium A (25 μL / well) was used instead of medium D containing ASO. When not irradiated, the plate was shielded from light with aluminum foil and left to stand at 25°C for 10 minutes. After washing once with PBS (containing heparin (0.5 mg / mL), 120 μL / well), medium B (75 μL / well) and medium E containing ASO (25 μL / well) were added, and the plate was left to stand in an incubator at 37°C in an air atmosphere with a 5% carbon dioxide concentration for 30 minutes. After washing once with PBS (120 μL / well), medium B (100 μL / well) was added, and the plate was left to stand in an incubator at 37°C in an air atmosphere with a 5% carbon dioxide concentration for 3.5 hours.

[0087] Cell Lysis & RT Kit (TOYOBO Super Prep TMCell lysis, RNA extraction, and cDNA conversion were performed using the Cell Lysis & RT Kit for qPCR. Each well contained 24.85 μL of lysis solution mixed with 0.15 μL of gDNA remover (solution P), 4.75 μL of stop solution mixed with 0.25 μL of Nase inhibitor (solution Q), and 4 μL of 5x RT master mix mixed with 12 μL of nuclease-free water (solution R). 16 μL of solution R was dispensed into a PCR plate (VIOLAMO, 96-well PCR plate (non-skirted)) in advance. The medium from the ASO-treated cells was removed, and the plate was washed once with PBS (120 μL / well). Solution P (25 μL / well) was added, and the plate was mixed for 5–10 minutes using a shaker (Fisher Scientific, FISHER MICROPLATE VORTEX). Cell lysis was confirmed under a microscope, and solution Q (5 μL) was added. The mixture was vortexed for 30 seconds and then allowed to stand for 1.5 minutes. 4 μL of the cell lysate was added to the PCR plate containing solution R. The plate was capped (VIOLAMO, 8 strips PCR Tube Cap (Dome)) and centrifuged (3200 rpm) at 4°C for 3 minutes. Reverse transcription was performed using a thermal cycler (Eppendorf Mastercycler® X50s). The temperature cycle was 37°C for 20 minutes, 50°C for 5 minutes, 98°C for 5 minutes, and terminated at 4°C. The cDNA and cell plate were then stored at -80°C.

[0088] Real-time PCR (RT-PCR) was performed using the reverse-transcribed cDNA to quantify the expression level of MALAT1 RNA. Analysis was performed by the ΔΔCt method using GAPDH mRNA as an internal standard. The DNA primers used in RT-PCR are as follows. The primer set was purchased from Thermo Fisher Scientific Inc. Primer set for GAPDH mRNA detection (internal standard): hGAPDH-Fw (GAGTCAACGGATTTGGTCGT) hGAPDH-Rv (GACAAGCTTCCCGTTCTCAG) Primer set for MALAT1 RNA detection (target gene): hMALAT1-F4 (GGTCTCCCCACAAGCAACTT) hMALAT1-R4 (AACCCACCAAAGACCTCGAC)

[0089] 2×Master mix (10 μL, ABI PowerUp TM A total of 20 μL was prepared using SYBR® Green Master Mix), primer set (1 μL, final concentration: 200 nM), cDNA (2 μL), and Otsuka distilled water (7 μL), and dispensed into a real-time PCR 96-well plate (ABI, MicroAmp® Fast 96-well Reaction Plate (0.1 mL)). Separate wells were prepared for detecting GAPDH mRNA and MALAT1 RNA. The plate was sealed (ABI, MicroAmp TM Optical Adhesive Film) and spun down for 10 seconds (Labnet, MPS 1000). TM The PCR was performed by preheating at 95 °C for 30 seconds, followed by 45 cycles of denaturation at 95 °C for 3 seconds and extension at 60 °C for 30 seconds.

[0090] (Remaining TPE-CN in cells) A549 cells were plated in 8-well slides (μ-Slide 8 Well ibiTreat, Germany) at 3 × 10 per well.4 Cells were seeded at a density of 1000 μL / well. The cells were cultured for 24 hours to allow cell attachment. After removing the medium, the cells were washed twice with PBS (150 μL / well). Next, PBS containing TPE-C-N (150 μL / well, 10 μM) was added, and the plate was shielded from light with aluminum foil and left to stand for 5 minutes. Then, PBS (50 μL / well) was added. The cells were then exposed to 365 nm LED light (intensity: 10 mW / cm). 2 ) was irradiated at 25°C for 5 minutes. The PBS was removed, and the cells were washed with PBS (containing 0.5 mg / mL heparin). Medium B (150 μL / well) was added and cultured at 37°C for 1, 3, and 6 hours. The cells were then washed with PBS (containing 0.5 mg / mL heparin), and PBS (150 μL / well, containing 0.5 mg / mL heparin) was added. Luminescence images were observed using a BZ-X800 luminescence microscope (Keyence Corporation, Japan) with the attached sectioning module (BZ-H4XF) (objective: 40x magnification). Blue emission was observed using an excitation wavelength of 350 / 50 nm (detection wavelength: 500 / 40 nm). The results are shown in Figure 22. These results demonstrate that TPE-CN gradually disappears from the cells and does not remain.

[0091] (2-1) Synthesis of TPE-C4

[0092]

[0093] A 100 mL two-necked recovery flask was dried under reduced pressure and purged with nitrogen. Tetrakis(4-hydroxyphenyl)ethylene (0.15 g, 0.38 mmol) dissolved in dry DMF (15 mL) was added. 1-Bromobutane (1.0 g, 7.6 mmol), K2CO3 (1.3 g, 9.3 mmol), and dry DMF (5 mL) were added, in that order, to this pale yellow solution. The reaction mixture was stirred at 80 °C for 1 h and then heated and stirred at 155 °C for 21 h. The reaction mixture was allowed to cool to room temperature, and water was added until no white solid remained. The reaction mixture was filtered, and the resulting white solid was washed with water. TPE-C4 (0.071 g, 0.12 mmol, 30%) was obtained. TPE-C4: white solid; mp: 104.0-107.5 °C. IR (ATR) 571, 607, 830, 974, 1009, 1171, 1241, 1471, 1507, 1571, 1605, 2871, 2932, 2957 cm -1 . 1 H NMR (400 MHz, CDCl3, 25 °C): δ 0.96 (t, J = 7.3 Hz, 12H), 1.43−1.49 (m, 8H), 1.70−1.74 (m, 8H), 3.88 (t, J = 6.4 Hz, 8H), 6.62 (d, J = 8.7 Hz, 8H), 6.91 (d, J = 8.7 Hz, 8H). 13 C NMR (100 MHz, CDCl3, 25 °C): δ 14.0, 19.4, 31.6, 67.6, 113.7, 132.7, 136.9, 138.4, 157.5. HRMS (ESI) calcd for C 42 H 52 O4Na ([M+Na] + ): 643.3758, found: 643.3758.

[0094] (2-2) Synthesis of TPE-C4-CHO

[0095] A 200 mL two-necked recovery flask was dried under reduced pressure and purged with nitrogen. TPE-C4 (0.071 g, 0.12 mmol) dissolved in TFA (20 mL) was added. To this purple solution was added hexamethylenetetramine (8.2 g, 58 mmol). The reaction solution was heated and stirred at 80 °C for 1 hour, then at 88 °C for 21 hours. After cooling to room temperature, water (60 mL) was added and the mixture was stirred at room temperature for 2 hours. After extraction with ethyl acetate (20 mL × 2), the organic layer was dried over MgSO4, and the solvent was evaporated under reduced pressure to yield TPE-C4-CHO as a yellow viscous solid (0.050 g, 0.068 mmol, 59%). TPE-C4-CHO: yellow solid; IR (ATR) 652, 815, 913, 1109, 1163, 1263, 1387, 1493, 1601, 1681, 2872, 2960, 3300 cm -1 , 1 H NMR (400 MHz, CDCl3, 25 °C): δ 0.98 (t, J = 7.3 Hz, 12H), 1.47−1.53 (m, 8H), 1.78−1.81 (m, 8H), 4.01 (t, J = 6.4 Hz, 8H), 6.71 (d, J = 8.7 Hz, 4H), 7.15 (dd, J = 2.3, 8.7 Hz, 4H), 7.42 (d, J = 2.3 Hz, 4H), 10.35 (s, 4H). 13 C NMR (100 MHz, CDCl3, 25 °C): δ 14.0, 19.4, 31.2, 68.4, 112.4, 124.6, 130.9, 135.3, 138.5, 139.0, 160.5, 189.7. HRMS (ESI) calcd for C 46 H 52 O8Na ([M+Na] + ): 755.3554, found: 755.3552.

[0096] (2-3) Synthesis of TPE-C4-N

[0097] A 100 mL two-necked recovery flask was dried under reduced pressure and purged with nitrogen. Then, dried 4Å molecular sieves, dry MeOH (15 mL), and TPE-C4-CHO (0.050 g, 0.068 mmol) were added in that order, followed by rinsing with dry MeOH (10 mL). N,N-Dimethyl-1,3-propanediamine (0.092 g, 0.82 mmol) was added to the reaction mixture, which was then heated and stirred at 68 °C for 12 hours. The reaction mixture was filtered through Celite, and the filtrate was stirred at 0 °C for 30 minutes. NaBH4 (0.060 g, 1.6 mmol) was added, and the mixture was stirred for 12 hours, gradually warming from 0 °C to room temperature. 10% HCl (aq) was added to the reaction solution until the pH reached 3, and saturated K2CO3 (aq) was added until the pH reached 9. The organic solvent was distilled off under reduced pressure, and then the water was removed by freeze-drying. The resulting solid was dissolved in CHCl3 and centrifuged, after which the organic layer was removed and dried under reduced pressure using a hand pump. A small amount of K2CO3 was added. 3 The solid was washed with (aq) and dissolved in CHCl3, and the organic layer was dried over MgSO4. The organic solvent was removed under reduced pressure to give TPE-C4-N (0.036 g, 0.033 mmol, 48%) as a yellow oil.

[0098] TPE-C4-N: yellow oil; IR (ATR) 594, 739, 807, 974, 1027, 1130, 1240, 1466, 1498, 2762, 2813, 2871, 2934 cm -1 , 1 H NMR (400 MHz, CDCl3, 25 °C): δ = 0.96 (t, J = 7.4 Hz, 12H), 1.44−1.52 (m, 8H), 1.55−1.59 (m, 8H), 1.72−1.75 (m, 8H), 2.19 (s, 24H), 2.25 (t, J = 7.4 Hz, 8H), 2.39 (t, J = 6.7 Hz, 8H), 3.57 (s, 8H), 3.89 (t, J = 6.7 Hz, 8H), 6.56 (d, J = 9.2 Hz, 4H), 6.83−6.84 (m, 8H).13 C NMR (100 MHz, CDCl3, 25 °C): δ = 14.0, 19.5, 28.1, 31.6, 45.7, 47.2, 49.3, 58.3, 67.6, 110.3, 127.2, 131.4, 133.3, 136.5, 138.6, 155.5. HRMS (ESI) calcd for C 66 H 109 N8O 4 ([M+H] + ): 1077.8566, found: 1077.8552.

[0099] (3-1) Synthesis of TPE-C16-CHO

[0100]

[0101] A 200 mL two-necked round-bottom flask was heated under a nitrogen atmosphere and dried under reduced pressure. TPE-OH (0.91 g, 2.3 mmol), TFA (35 mL), and hexamethylenetetramine (1.4 g, 9.5 mmol) were added, in that order, and the mixture was heated and stirred at 88 °C for 5 hours. After cooling to room temperature, pure water (70 mL) was added, and the mixture was extracted with ethyl acetate. After the organic solvent was evaporated under reduced pressure, the resulting brown liquid was treated with NaHCO3 (aq) until bubbling ceased. The mixture was extracted with ethyl acetate, and the organic layer was washed with saturated brine. After the organic solvent was removed under reduced pressure, a yellow-brown solid (1.3 g) was obtained. A 200 mL two-necked round-bottom flask was heated under a nitrogen atmosphere and dried under reduced pressure. The resulting tan solid (0.50 g), dry DMF (60 mL), 1-bromohexadecane (1.6 g, 5.3 mmol), and K2CO3 (2.6 g, 19 mmol) were added in that order, and the mixture was heated and stirred at 155 °C for 14 h. Purified water (120 mL) was added to the reaction mixture, which was then filtered through a separatory funnel. The tan solid on the funnel was washed with MeOH. The product was purified by silica gel chromatography (hexane / AcOEt = 30:1) to give TPE-C16-CHO as a pale yellow solid (0.38 g, 0.27 mmol, 12%).

[0102] TPE-C16-CHO:mp:94.0-96.2°C. IR (ATR) 725, 816, 917, 1112, 1172, 1264, 1390, 1467, 1496, 1603, 1682, 2850, 2917 cm -1 . . . . 1 H NMR (400 MHz, CDCl3, 25 °C): δ = 0.88 (t, J = 7.4 Hz, 12H), 1.26–1.45 (m, 104H), 1.77–1.83 (m, 8H), 3.99 (t, J = 6.7 Hz, 8H), 6.70 (d, J = 8.7 Hz, 4H), 7.15 (dd, J = 8.7, 2.3 Hz, 4H), 7.42 (d, J = 2.3 Hz, 4H), 10.35 (s, 4H). 13 C NMR (100 MHz, CDCl3, 25 °C): δ = 14.6, 23.2, 26.5, 29.5, 29.8, 30.0, 30.1, 30.2, 32.4, 69.1, 112.7, 124.9, 131.2, 135.6, 135.6. 138.8, 139.3, 160.8, HRMS (ESI) calcd 94 H 148 O8Na ([M+Na] + ):1429.1100, found: 1429.1089.

[0103] (32) TPE-C16-N mixture

[0104] A 200 mL two-neck round-bottom flask was heated under a nitrogen atmosphere and dried under reduced pressure. After replacing the atmosphere with nitrogen, 4Å molecular sieves, dry MeOH (70 mL), TPE-C16-CHO (0.10 g, 0.072 mmol), and N,N-dimethyl-1,3-propanediamine (0.19 g, 1.7 mmol) were added, and the mixture was heated and stirred at 75 °C for 5 h. After cooling to room temperature, the reaction mixture was filtered through Celite to remove solids, and the filtrate was stirred at 0 °C for 30 min. NaBH4 (0.070 g, 1.7 mmol) was then added, and the mixture was gradually warmed from 0 °C to room temperature and stirred for 12 h. Pure water (20 mL) was added to the reaction mixture, followed by the addition of 10% HCl (aq) until the solution reached pH 3. K2CO3 (aq) was then added until the pH reached 9. The water was removed by lyophilization, and the remaining solid was dissolved in anhydrous DCM and filtered through a pad of Celite. The organic solvent was removed under reduced pressure. The solid was washed with a small amount of K2CO3 (aq) and dissolved in CHCl3. The organic layer was dried over MgSO4, filtered, and the solvent was removed under reduced pressure to give TPE-C16-N as a yellow oily liquid (0.080 g, 0.046 mmol, 64%).

[0105] TPE-C16-N: IR (ATR) 720, 809, 1041, 1130, 1241, 1466, 1500, 1605, 1682, 2852, 2922 cm -1 . 1 H NMR (400 MHz, CDCl3, 25 °C): δ = 0.88 (t, J = 7.3 Hz, 12H), 1.26-1.42 (m, 104H), 1.60-1.66 (m, 8H), 1.73-1.75 (m, 8H), 2.19 (s, 24H), 2.26 (t, J = 7.3 Hz, 8H), 2.43-2.49 (m, 8H), 3.63 (s, 8H), 3.88 (t, J = 6.7 Hz, 8H), 6.58 (d, J = 9.1 Hz, 4H), 6.86-6.88 (m, 8H). 13C NMR (100 MHz, CDCl3, 25 °C): δ = 14.3, 22.8, 25.9, 26.4, 28.2, 29.5, 29.6, 29.8, 29.9, 32.1, 33.0, 45.7, 47.2, 49.4, 58.2, 68.0, 110.3, 127.3, 131.4, 133.3, 136.6, 138.6, 155.5. HRMS (ESI) calcd for C 114 H 205 N8O4 ([M+H] + ):1751.6112, found: 1751.6258。

[0106] A549 cells were incubated with TPE-C4-N (Fig. 23a), TPE-CN (Fig. 23b), or TPE-C16-N (Fig. 23c) for 5 min, followed by incubation with Cy-5 in the dark or under light for 5 min. After washing, the distribution of Cy-5 fluorescence signals within the cells was observed using confocal laser scanning microscopy (CLSM). While little Cy-5 fluorescence signal was observed in cells treated with TPE-C4-N, significant fluorescence enhancement was observed in cells treated with TPE-CN and TPE-C16-N. This result indicated that short lipophilic alkyl chains are poor transmembrane transporters of charged molecules. To further quantify the intracellular transport of Cy-5, we calculated the average FL intensity per unit area (relative FL intensity) of CLSM images obtained from three independent experiments (Fig. 23d). Both TPE-CN and TPE-C16-N significantly improved the delivery efficiency of Cy-5 under light irradiation, with no significant difference in mean fluorescence intensity between the two. Using a similar procedure, A549 cells were treated with TPE-CN and TPE-C16-N, and the membrane permeation efficiency of Cy-5 was evaluated using a flow cytometer (BD Accuri C6 Plus) (Figure 23e). The flow cytometer analysis method was the same as described above (Procedure for cell experiments using a flow cytometer), except for the flow cytometer used. Specifically, while the above procedure uses a FACS Attune (Thermo Fisher Scientific) flow cytometer with a yellow laser for excitation and detection, the BD Accuri C6 Plus flow cytometer used a red laser (640 nm), which is suitable for the absorption wavelength of Cy-5, and detection was performed in the red emission region (675 / 25 nm). Because a laser suitable for Cy-5 excitation was used, the effect of Cy-5 incorporation was clearly confirmed, unlike the results of the luminescence intensity analysis of A549 cells using a flow cytometer (FACS Attune) in Figure 17. When TPE-C16-N was applied in the dark, the gate% was 37±8%, indicating that there is a certain degree of drug delivery effect even without light irradiation. On the other hand, when TPE-C16-N and TPE-CN were applied and exposed to light, the gate% was significantly improved to 88±10% and 77±5%, respectively.The distribution map of the luminescence intensity shown by each cell in Figure 23f also shows that the drug delivery effect can be easily evaluated when detected with a red laser.

[0107] The compounds of the present invention can be used as aggregated luminescent compounds and as cell membrane permeation enhancers.

Claims

1. A compound represented by the following general formula (1): (In the formula, R １ are the same or different and each is a straight-chain aliphatic alkyl group having 1 to 20 carbon atoms. ２ are the same or different and each represents a linear aliphatic alkyl group having 1 to 17 carbon atoms or -NR ３ ２ .R ３ are the same or different, and are linear aliphatic alkyl groups having 1 to 4 carbon atoms.) 2. A cell membrane permeation enhancer comprising the compound according to claim 1.

3. A method for introducing a compound into the inside of a cell membrane, comprising the steps of: (1) mixing a cell with the compound according to claim 1; (2) mixing the compound to be introduced; and (3) irradiating the cell with light.

Images