Stimulator of interferon genes (STING)-CDC1 signature as a prognostic biomarker for cancer

Abstract

Compositions and methods for treating a tumor by targeting STING signaling are provided. Embodiments of the present disclosure also provide methods for determining suitability of a candidate for an immunotherapy and / or for evaluating prognosis of an immunotherapy.

Description

TITLESTIMULATOR OF INTERFERON GENES (STING)-CDCI SIGNATURE AS A PROGNOSTIC BIOMARKER FOR CANCERCROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 581 ,972, entitled “STIMULATOR OF INTERFERON GENES (STING)-CDCI SIGNATURE AS A PROGNOSTIC BIOMARKER FOR CANCER” and filed on September 11 , 2023, the disclosure of which is herein incorporated by reference in its entirety.ACKNOWLEDGEMENT OF GOVERNMENT SUPPORT

[0002] This invention was made with government support under Grant Nos. CA244719 and CA216839 awarded by the National Institutes of Health. The government has certain rights in the invention.SEQUENCE LISTING

[0003] This application contains a Sequence Listing that has been submitted via Patent Center in a computer readable format and is hereby incorporated by reference in its entirety. The computer readable file, created on September 11 , 2024, is named UTSD.P4289WO_SequenceListing.xml and is about 13,201 bytes in size.BACKGROUND

[0004] 1. Field

[0005] The present disclosure is directed to compositions and methods of determining prognosis of a patient following an immunotherapy treatment.

[0006] 2. Discussion of Related Art

[0007] STING (stimulator of interferon genes, also known as MITA, MYPS and encoded by TMEM 173 gene) is an endoplasmic reticulum (ER)-associated signaling protein that is essential for transcriptional regulation of numerous host defense genes against infection and cancer. STING is activated by 2’, 3’-cyclic guanosine monophosphate-adenosine monophosphate (cGAMP), an endogenous secondary messenger, which is produced by cGAMP synthase (cGAS) in response to microbial or self-DNA as a danger signal. Upon cGAMP binding, STING homodimer undergoes extensive conformational change that leads to oligomerization on the ER surface and translocation to the Golgi. STING oligomerization recruits and activates TANK-binding kinase 1 (TBK1) and inhibitor of KB kinases (IKKs), which in turn activate interferon regulatory factor 3 (I RF3) and nuclear factor KB (NFKB), respectively. IRF3 and NFKB cooperate to induce type I interferons and other inflammatory cytokines to mount a robust innate immune response. Besides immune activation, STING also triggersautophagy as a primordial function independent of TBK1 and IKK. Furthermore, high magnitude of STING signaling drives cell apoptosis in hepatocytes and lymphocytes through elevated ER stress. Understanding the cell context of STING activation and resulting molecular responses is paramount to mount a protective immune response against cancer.

[0008] This disclosure is based, in part of the surprising discovery that a polymeric STING- activating nanoparticle (PolySTI NG) can be used to investigate the role of immune cell subset in STING-mediated antitumor immunity. Exemplary experiments herein show that the cell tropism and “shock-and-lock” STING activation by PolySTI NG allow the identification of conventional type 1 dendritic cells (cDC1s) as a key cell driver for the rejection of malignant tumors. This reveals that direct targeting of cDC1s by a dual activating STING agonist offers a promising approach for STING-mediated cancer immunotherapy.SUMMARY

[0009] The present disclosure is based, at least in part, on the discovery that cDC1 cells play an important role in mediating the therapeutic efficacy of STING agonists and that monitoring their activity before or after administration of a cancer therapeutic.

[0010] Accordingly, in various aspects a method of predicting prognosis of a subject after administration of a cancer therapy is provided, the method comprising: (a) administering the cancer therapy to the subject; (b) quantifying a STING-activated cDC1 signature in a tumor sample obtained from a subject; and (c) determining that the subject will have a positive prognosis if the STING-activated cDC1 signature is equal to or greater than a threshold.

[0011] Further aspects of the instant disclosure are directed to methods of identifying a subject as a candidate for a cancer therapy, the methods comprising: (a) quantifying a STI NG- activated cDC1 signature in a tumor sample obtained from a subject; and (b) identifying the patient as a candidate for a cancer therapy where the cancer therapy is selected based on the STING-activated cDC1 signature in the sample.

[0012] In any of these methods, the cancer therapy may comprise a STING agonist, a chemotherapy, and / or immunotherapy. For instance, the cancer therapy may comprise a STING agonist, a chemotherapy and / or immunotherapy if the STING-activating cDC1 signature equal to or greater than a threshold. For instance, in an aspect, the cancer therapy may comprise an immunotherapy. In an aspect, the immunotherapy may comprise an immune checkpoint inhibitor, a cytokine therapy, or a CAR-T cell. In some aspects, the immune checkpoint inhibitor comprises Pembrolizumab. In other aspects, the cancer therapy comprises a STING agonist, optionally wherein the STING agonist comprises 2' 3'-cyclic GMP- AMP (cGAMP). In some aspects, the STING agonist is encapsulated in a biodegradable pH sensitive polymer (e.g., PEG-b-P(MAC-SC7A) (PSC7A)). In various aspects, the cancertherapy comprises chemotherapy (e.g., neoadjuvant chemotherapy). In various aspects, the cancer therapy may comprise immunotherapy (i.e., an immune checkpoint inhibitor like Pembrolizumab) and neoadjuvant chemotherapy.

[0013] In any of these methods, the cancer therapy may comprise radiation therapy or surgery. In any of these methods, the cancer therapy may comprise radiation therapy or surgery if the STING-activating CDC signature is below a threshold.

[0014] Further aspects of the instant disclosure are directed methods of treating a tumor in a subject, the method comprising: (a) quantifying a STING-activated cDC1 signature in a tumor sample obtained from a subject; and (b) administering a cancer therapy to the subject, where the cancer therapy is selected based on the STING-activating cDC1 signature in the sample.

[0015] In various aspects, the cancer therapy in (b) may comprise immunotherapy, a STING agonist, and / or chemotherapy if the STING-activating cDC1 signature is equal to or greater than a threshold. For instance, the cancer therapy in (b) may comprise immunotherapy. In various aspects, the immunotherapy comprises an immune checkpoint inhibitor, a cytokine therapy, or a CAR-T cell. The immune checkpoint inhibitor may comprise Pembrolizumab.

[0016] In various aspects, the cancer therapy in (b) may comprise chemotherapy (e.g., neoadjuvant chemotherapy). In various aspects, the cancer therapy in (b) may comprise neoadjuvant chemotherapy and an immune checkpoint inhibitor, optionally wherein the immune checkpoint inhibitor comprises Pembrolizumab.

[0017] In various aspects, the cancer therapy in (b) comprises a STING agonist, optionally wherein the STING agonist comprises 2' 3'-cyclic GMP-AMP (cGAMP). In various aspects, the STING agonist may be encapsulated in a pH sensitive biodegradable polymer such as, but not limited to, PEG-b-P(MAC-SC7A) (PSC7A).

[0018] In various aspects, the cancer therapy in (b) may comprise radiation therapy and / or surgery if the STING-activating cDC1 signature is below a threshold.

[0019] In further aspects, the methods of treating cancer herein may further comprise further steps in step (a). For instance, in an aspect step (a) may further comprise (i) administering an initial cancer therapy to the subject, and (ii) quantifying the STING-activated cDC1 signature in a tumor sample obtained from a subject after administering the initial cancer therapy.

[0020] In various aspects, the initial cancer therapy in step (a)(i) is the same as the cancer therapy in (b). In various aspects, the initial cancer therapy in step (a)(i) is different than the cancer therapy (b).

[0021] In various aspects, the initial cancer therapy in (a)(i) is a STING agonist. For example, the STING agonist may comprise 2' 3'-cyclic GMP-AMP (cGAMP). In various aspects, theSTING agonist may be encapsulated in a biodegradable pH sensitive polymer. The biodegradable pH sensitive polymer may comprise PEG-b-P(MAC-SC7A) (PSC7A).

[0022] In various aspects, the initial cancer therapy in (a)(i) may comprises a STING agonist and the cancer therapy in (b) comprises (i) an immunotherapy and / or neoadjuvant chemotherapy if the STING-activating cDC1 signature is equal to or greater than a threshold; or (ii) radiation therapy and / or surgery if the STING-activating cDC1 signature is below a threshold. In an aspect, the STING agonist may comprise 2' 3'-cyclic GMP-AMP (cGAMP). In an aspect, the STING agonist may be encapsulated in a pH sensitive biodegradable polymer. In further aspects, the biodegradable pH sensitive polymer may comprise PEG-b-P(MAC- SC7A) (PSC7A). In various aspects, the immunotherapy comprises an immune checkpoint inhibitor (e.g., Pembrolizumab).

[0023] In any of the foregoing or related aspects, the step of quantifying the STING-activated cDC1 signature may comprise quantifying levels of (a) one or more markers of cDC1 cells; (b) STING activation; (c) or one or more STING induced cytokines; or any combination thereof.

[0024] In various aspects, the one or more markers of cDC1 cells of (a) may be selected from XCR1 , BATF3, CLEC9A, CLNK, IRF8, CADM1 , and any combination thereof. For instance, in an aspect, the one or more markers of cDC1 cells may comprise XCR1. In any of these aspects, quantifying levels of the one or more markers of cDC1 cells may comprise measuring gene transcript levels of the one or more markers of cDC1 cells. In any of these aspects, quantifying levels of the one or more markers of cDC1 cells may comprise measuring protein levels of the one or more markers of cDC1 cells.

[0025] In various aspects, levels of STING activation in (b) may be measured by measuring levels of phosphorylated STING (phospho-STING) in the tumor sample.

[0026] In various aspects, the one or more STING induced cytokines quantified in (c) may be chemokines. For instance, in some aspects, the chemokines may comprise CCL4, CCL5, CXCL9, CXCL10, or any combination thereof. In certain aspects, the chemokines may comprise CXCL9 or CXCL10.

[0027] In any of these methods, the subject may be administered at least one cancer therapy orally, intraadiposally, intraarterially, intraarticularly, intracranially, intradermally, intralesionally, intramuscularly, intranasally, intraocularly, intrapericardially, intraperitoneally, intrapleurally, intraprostatically, intrarectally, intrathecally, intratracheally, intratumorally, intraumbilically, intravaginally, intravenously, intravesicularlly, intravitreally, liposomally, locally, mucosally, parenterally, rectally, subconjunctival, subcutaneously, sublingually, topically, transbuccally, transdermally, vaginally, in cremes, in lipid compositions, via acatheter, via a lavage, via continuous infusion, via infusion, via inhalation, via injection, via local delivery, or via localized perfusion.

[0028] In any of these methods, the tumor sample may be obtained from a solid tumor, a biopsy, or a surgical resection. In some aspects, the tumor sample is formalin fixed and paraffin embedded. In various aspects, the tumor sample may be obtained from a lung tumor, a breast cancer, a melanoma, a skin tumor, a pancreatic tumor, a head or neck tumor, or other solid tumors. For instance, in some aspects, the tumor sample may be obtained from a nonsmall cell lung carcinoma, a triple negative breast cancer, a head and neck cancer, or a melanoma.

[0029] In any of these methods, the subject may have or is suspected of having a solid tumor. For instance, the subject may have or be suspected of having lung cancer, breast cancer, skin cancer, pancreatic cancer, a head or neck cancer or any combination thereof. In some aspects, the subject may have or be suspected of having non-small cell lung carcinoma, a triple negative breast cancer, a head and neck cancer, a melanoma, or any combination thereof.

[0030] In any of these methods, the subject may be a mammal. In various aspects, the subject may be human.BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Embodiments of the present disclosure are illustrated by way of example in which like reference numerals indicate similar elements.

[0032] FIGs. 1A-1F show design and characterization of a polymeric STING-activating nanoparticle (PolySTING) for myeloid tropic STING activation. FIG. 1A depicts Schematic overview of PolySTING micelle nanoparticles with dual STING activation by 2’, 3’-cGAMP and PSC7A polymer. cGAMP is encapsulated in micelles self-assembled from pH-sensitive PSC7A polymers. FIG. 1 B shows IFN-p-luciferase expressions in ISG-THP1 cells after free cGAMP, PSC7A polymer, or PolySTING treatment over 24 hours. Equivalent cGAMP concentrations (5 pM) were used in these studies. FIG. 1C shows ex vivo imaging and tissue quantification of fluorescence intensity in MC38 tumors 24 hours post intratumoral administration of Cy5-labeled PolySTING. FIG. 1 D shows percentage of Cy5+ cells amongst cell populations in the MC38 tumors and tumor-draining lymph nodes following intratumoral administration of Cy5-labeled PolySTING. FIG. 1E shows percentage of caspase CD8+ T cells after intratumoral administration of PolySTING or Adu-S100 at the same dose (50 pg per mouse). FIG. 1F shows antitumor efficacy of PolySTING or Adu-S100 in MC38 tumor bearing mice. All the data in are represented as mean±sem, n>5 in B,D,E,F and n=3 in C. Staticalsignificance was calculated by two-tail t-test in B,D,E, or two-way ANOVA in F. ns: no significant difference, *: p<0.05, **: p<0.01 , ***: p<0.001 , ****: p<0.0001.

[0033] FIGs. 2A-2G show PolySTI NG achieves broad antitumor efficacy against established, metastatic, and distal tumors. FIG. 2A-FIG. 2D show that intratumoral administration of PolySTING led to growth inhibition of MC38 (FIG. 2A), TC-1 (FIG. 2B), BI6F10(FIG. 2C), or LLC2 (FIG. 2D) tumors in C57BL / 6 mice. FIG. 2E shows primary tumor growth and metastasis to the lung in Balb / c mice bearing orthotopic triple negative 4T 1 breast tumor after PolySTING and anti-PD-1 treatment. FIG. 2F shows injected primary and untreated contralateral tumor growth in C57BL / 6 mice bearing MC38 tumors after PolySTING and anti-PD-1 treatment. FIG. 2G shows MC38 tumor-bearing mice cured by PolySTING or surgical resection were rechallenged with MC38 on the primary tumor site or contralateral flank 45 days after inoculation. All the data are represented as mean±sem, n>6. Statical significance was calculated by two- way ANOVA, ns: no significant difference, **: p<0.01 , ***: p<0.001 , ****: p<0.0001.

[0034] FIGs. 3A-3L show identification of cDC1 for STI NG-mediated tumor rejection. FIG. 3A- 3D shows tumor growth in wildtype (FIG. 3B), host STING knockout (Tmem173'7') (FIG. 3C) or cancer STI NG knockout (MC38-Tmem173'7') (FIG. 3D) C57BL / 6 mice bearing MC38 tumors after PolySTING treatment (as depicted in FIG. 3A). FIG. 3E-3F depict tumor growth of lfna / p receptor knockout (Ifna / pR'7', FIG. 3E) or STINGS365A mutant mice (FIG. 3F) bearing MC38 tumors after PolySTING treatment. FIG. 3G-3L show tumor growth in wildtype mice with antibody blockade of (FIG. 3G) macrophages (anti-CSF1 R), (FIG. 3H) B cells (a mixture of anti-CD19 / CD22 / B220), and transgenic mice with depletion of different DC subtypes, including (FIG. 3I) MoDC (Ccr2-7-), (FIG. 3J) plasmacytoid DC (pDC, anti-CD317), (FIG. 3K) cDC2 (Irf4’ / _), (FIG. 3L) cDC1 (Batf3_ / mice, after PolySTING treatment. In all experiments, mice were intratumorally treated with PolySTING when the tumor volume reached around 200 mm3in MC38 tumors. Data are represented as mean±sem, n>6. Statical significance was calculated by two-way ANOVA, ns: no significant difference, ***: p<0.001 , ****: p<0.0001.

[0035] FIGs. 4A-4E show direct STING signaling in cDC1 is essential for PolySTING- mediated antitumor immunity. FIG. 4A shows tumor growth in conditional knockout of STING in cDC1s (XCR1creSTINGfl7fl) mice bearing MC38 tumors after PolySTING treatment. FIG. 4B- 4D shows MC38 tumor growth in Batf3'7' mice with or without PolySTING treatment after the mice were subcutaneously transferred (FIG. 4B) with cDC1s from STING wildtype mice (FIG. 4C), STING knockout or STINGS365A mutant mice (FIG. 4D). Mice were intratumorally treated with PolySTING when the tumor volume reached around 200 mm3. cDC1s were sorted from BMDCs of donor mice. (FIG. 4E) Cell number per tumor weight, percentage of antigen (SIINFEKL (SEQ ID NO: 1)) presentation and CD86 expression on CD8a± cDC1s or CD103+ cDC1s with control or PolySTING treatment. Tumor tissues were harvested and analyzed byflow cytometry at 24 hours after treatments. All the data are represented as mean±sem, n=5. Statical significance was calculated by wo-way ANOVA in A-D, and two-tail t test in E. ns: no significant difference, *: p<0.05, **: p<0.01 , ****: p<0.0001.

[0036] FIGs. 5A-5F show STING signaling boosts cDC1 activation and priming of CD8+ T cells. FIG. 5A is a schematic overview of experimental design using MC38-OVA tumor bearing mice. PolySTING or Adu-S100 were intratumorally administered on day 10 and 13 when average tumor volumes reached 150 mm3. Dendritic cells and CD8+ T cells were harvested on day 14 and 16, respectively, for flow cytometry analysis. FIG. 5B shows representative flow diagrams of CD8a+ cDC1 (gated on CD45+CD11c+MHCII+CD11 b-) and quantification of percentage of cDC1 in total DC population. FIG. 5C shows representative flow cytometric histograms of the costimulatory marker CD80 (gated on CD45+CD11c+MHCII+CD11 b- CD8a+ or CD103+ cDC1) and quantification of CD80 percentage in CD8a+ and CD103+ cDC1s. FIG. 5D shows percentage of antigen (SIINFEKL (SEQ ID NO: 1)) presentation on H- 2Kb complex of DCs in response to PolySTING or Adu-S100. FIG. 5E shows representative flow cytometric plots of OVA-specific CD8+ T cells from the tumor and tumor-draining lymph nodes in response to PolySTING or Adu-S100 treatment. FIG. 5F shows percentage of interferon-y (IFNy) and granzyme b (Gzmb) expressing CD8+ T cells in response to PolySTING or Adu-S100. All the data are represented as mean±sem, n=5. Statical significance was calculated by two-way ANOVA, ns: no significant difference, *: p<0.05, **: p<0.01 , *** p<0.001 , **** p<0.0001.

[0037] FIGs. 6A-6I show PolySTING-mediated migration of cDC1 and effect of T cells on antitumor efficacy. FIG. 6A shows expression of XCR1 , CLEC9A, and CCR7 on cDC1s in MC38 tumors 18 h after intratumoral PolySTING treatment. FIG. 6B shows expression of CCR7 on cDC1s in tumor-draining lymph nodes (tDLN) after PolySTING treatment. FIG. 6C shows cDC1 percentage in total DCs in MC38 tumors and FIG. 6D shows tumor growth after PolySTING treatment in wildtype or CCR7 knockout (CCR7_ / mice. FIG. 6E-6G show MC38 tumor growth in C57BL / 6 mice after depletion of (FIG. 6E) NK cells (anti-NK1.1), (FIG. 6F) CD4+ T cells (anti-CD4), or (FIG. 6G) CD8+ T cells (anti-CD8a). FIG. 6H shows tetramer+ CD8+ T cells from tDLN of wildtype and different genetic knockout mice with or without PolySTING treatment. FIG. 6I shows a schematic of STING-mediated cDC1 activation and priming of antigen-specific cytotoxic T cells. Mice receiving 5% glucose were used as controls. All the data are represented as mean±sem. n=6 in A,E-G, n=3 in B, n=5 in C,D, and n>3 in H. Statical significance was calculated by two-tail t test in A-C,H, or two-way ANOVA in D-G. ns: no significant difference, *: p<0.05, **: p<0.01 , ***: p<0.001 , ****: p<0.0001.

[0038] FIGs. 7A-7E show STING-activating cDC1 signature is associated with cancer patient survival. FIG. 7A shows quantification of chemokine profile of MC38 tumors from wildtype orcDC1 deficient (Batf3_ / mice after PolySTI NG treatment. FIG. 7B shows comparison of expression levels of chemokines CCL4 / 5 and CXCL9 / 10 in wildtype versus Batf3'7' mice after indicated treatments. All the data are represented as mean±sem, n=5 for wildtype and n=4 for Batf3'7' mice. FIG. 7C shows representative images of multiplex immunohistochemistry staining of NSCLC tumors from either NAC or NAPC-treated patients. FIG. 7D shows percentage of STING activating cDC1 was quantified and compared between NAC and NAPC- treated patients. FIG. 7E shows STING-activating cDC1 signature shows positive correlation with progression free survival in both NSCLC patients treated with either NAC or NAPC. Statistical significance was calculated by two-tail t-test in B and D, and Logrank test was used to determine statistical significance for survival in E. *: p<0.05, ***: p<0.001 , ****: p<0.0001.

[0039] FIGs. 8A-8I show physical characterization, cell tropism, and dose-response of PolySTI NG nanoparticle and free STING agonist. FIG. 8A shows synthetic scheme, size distribution and transmission electron micrograph of PolySTI NG nanoparticles. FIG. 8B shows qPCR measurement of ifn-p / cxcl10 mRNA expressions in THP1 cells after free cGAMP or PolySTING treatment at indicated time points, n=3 independent experiments. FIG. 8C shows the percentage of FITC+ cells amongst cell populations in the MC38 tumors and tDLNs following intratumoral administration of FITC-labeled cGAMP, n=5. FIG. 8D shows confocal microscopy and FIG. 8E and 8F show flow cytometry of fluorescein-cGAMP-loaded Cy5- labeled PSC7A nanoparticle uptake by bone marrow-derived dendritic cells (BMDCs, FIG. 8E) and macrophages (BMDMs, FIG. 8F) after 12 h incubation at different concentrations. FIG. 8G shows flow cytometric plots of T cell apoptosis (gated on CD45+CD3+CD8+Caspase 3+) induced by Adu-S100 compared to PolySTING treatment and control. FIG. 8H and 8I show MC38 tumor growth curves after intratumoral injection of Adu-S100 (FIG. 8H) or PolySTING (FIG. 8I) at indicated doses. The number of tumor free mice was indicated in brackets, n=5. Data are represented as mean±sem, n=3. Statical significance was calculated by two-tail t- test. *: p<0.05, **: p<0.01. Scale bar, 100 nm in 8A, and 50 pm in 8D.

[0040] FIGs. 9A-9E show PolySTING induces antitumor immunity against established and metastatic tumor models. FIG. 9A-9D shows individual tumor growth and overall survival after intratumoral administration of PolySTING, free cGAMP, or glucose control in MC38 (FIG. 9A), TC-1 (FIG. 9B), B16F10 (FIG. 9C), or LLC2 (FIG. 9D) tumors in C57BL / 6 mice. TF: tumor free. The survival data are represented as mean±sem. Statical significance was calculated by or Mantel-Cox tests, ****: p<0.0001. (FIG. 9E) Individual orthotopic 4T1 tumor growth image of luciferase signal on week 3 and primary tumor growth curve after different treatments. The representative images of luciferase signal on week 3 are shown here, while lung metastasis data are shown in Fig. 2E.

[0041] FIGs. 10A-10C show PolySTI NG induces antitumor immunity against distal tumors and tumor rechallenging. (FIG. 10A) Individual tumor growth of injected primary and untreated contralateral tumor in C57BL / 6 mice bearing MC38 upon indicated treatment. (FIG. 10B) Injected primary and untreated contralateral tumor growth in C57BL / 6 mice bearing B16F10 tumors upon indicated treatment. Data are represented as mean±sem, n=6. Statical significance was calculated by two-way ANOVA, ****: p<0.0001. (FIG. 10C) Individual tumor growth after MC38 tumor rechallenging.

[0042] FIGs. 11A-11C show identification of cDC1 for STING-mediated tumor rejection. (FIG. 11 A) MC38 tumor growth in wildtype or cDC1 -deficient (Batf3_ / mice after 5% glucose or cGAMP treatment. Data are represented as mean±sem, n=5. Statical significance was calculated by two-way ANOVA, *: p<0.05, ****: p<0.0001. (FIG. 11 B) Genotype analysis of condition knockout mice (XCR1creSTINGfl / fl). PCR product of homozygous floxed STING is at ~450bp, and the size of XCR1 ere product is at 287bp for wildtype and ~160bp for mutant. Homozygous flox and heterozygous ere genotype show both products in one condition knockout mouse. C57BL / 6 wildtype mice are used as negative control. (FIG. 110) Individual MC38 tumor growth after intratumoral administration of PolySTI NG or glucose control in C57BL / 6 mice with indicated gene knockout. TF: tumor free.

[0043] FIGs. 12A-12B show PolySTI NG primes wildtype but not STING-deficient transferred cDC1s in Batf3'7' mice. (FIG. 12A) Kaplan-Meier survival curves upon indicated treatments in MC38 tumor-bearing wildtype or Batf3'7' C57BL / 6 mice. TF: tumor free. The survival data are represented as mean±sem, n>5. Statical significance was calculated by or Mantel-Cox tests, ****: p<0.0001. (FIG. 12B) Individual MC38 tumor growth upon intratumoral PolySTI NG treatments and subcutaneously transferred cDC1s from STING wildtype, knockout, S365A mutant mice.

[0044] FIGs. 13A-13F show dose-response of cDC1 activation and priming of CD8+ T cells by PolySTI NG. (FIG. 13A) Schematic overview of experimental design using MC38-OVA tumor bearing mice. Different doses of PolySTI NG (10, 50, 200 mg per mouse) or 5% glucose control were intratumorally administered on day 10 and 13 when average tumor volumes reached 150 mm3. cDC1 and CD8+ T cells were harvested on day 14 and 16, respectively, for flow cytometry analysis. (FIG. 13B) Quantification of percentage of cDC1 in total DC population. (FIG. 13C) Quantification of CD80 percentage in CD8a+ and CD103+ cDC1s. (FIG. 13D) Percentage of antigen (SIINFEKL) presentation on H-2Kb complex of cDC1s. (FIG. 13E) Percentage of OVA-specific CD8+ T cells from the tumor and tumor-draining lymph nodes. (FIG. 13F) Percentage of interferon-y (I FNy) and granzyme b (Gzmb) expressing CD8+ T cells. All the data are represented as mean ± SEM, n=4 mice in D, and n=5 mice in all otherexperiments. Statical significance was calculated by one-way ANOVA. *: p<0.05, **: p<0.01 , ***: p<0.001 , ****: pO.0001.

[0045] FIGs. 14A-14H show changes of immune profiles in MC38 tumors after PolySTING treatment in wildtype and cDC1 deficient mice. (FIG. 14A- FIG. 14D) Quantification of cytokine profile of MC38 tumors in wildtype (FIG. 14A, FIG. 14C) or Batf3_ / _(FIG. 14B, FIG. 14D) mice after PolySTING treatment. (FIG. 14E, FIG. 14F) Chemokine heatmap of MC38 tumors from wildtype (FIG. 14E) or Batf3_ / _(FIG. 14F) mice after PolySTING treatment. n=5 for wildtype and n=4 for Batf3_ / - mice. (FIG. 14G, FIG. 14H) Quantification of chemo and cytokine profiles of MC38 tumors in (FIG. 14G) wildtype or (FIG. 14H) Batf3-- mice after 50 pg PolySTING, Adu- S100, or 5% glucose treatment. n=5 in WT mice and n=4 in Batf3-- mice.

[0046] FIGs. 15A-15E show PolySTING mediated cDC1 recruitment and tumor growth inhibition in a CCL4 / 5-dependent manner. (FIG. 15A) mRNA expression of CCL4, CCL5, and XCL1 in MC38 tumor tissues after PolySTING or 5% glucose treatment. (FIG. 15B) Chemotaxis analysis of both subsets of cDC1s towards CCL4 / 5 (150 ng / ml) in transwell migration assays. (FIG. 15C- FIG. 15E) Blockade of CCL4 / 5 reduced cDC1 infiltration in MC38 tumors (FIG. 15C) and abrogated STING-mediated tumor growth inhibition (FIG. 15D, FIG. 15E). CCL4 and CCL5 neutralizing antibodies (50 pg each) were intravenously injected on day 3 and maintained every 3 days in MC38 tumor-bearing mice. All the data are represented as mean Sem, n>5 in A,C-E, and n=3 in B. Statical significance was calculated by two-tail t- test in A-C, two-way ANOVA in D, or Mantel-Cox tests in E. ns: no significant difference, *: p<0.05, **: p<0.01 , ***: p<0.001.

[0047] FIGs. 16A-16D show STING-activating cDC1 signature displays positive correlations with patient survival. STING activated chemokine expression levels (CCL4 / 5, CXCL9 / 10) positively correlates with cDC1 biomarkers (BATF3, CLEC9A, XCR1 , CLNK) and offers higher prognostic value than STING expressions for survival in (FIG. 16A) melanoma or (FIG. 16B) sarcoma patients. A total of 458 melanoma patients or 265 sarcoma patients from TCGA datasets were analyzed, and top and bottom quartiles were compared. The Logrank test was used to determine statistical significance for overall survival, ns: no significant difference, **: p<0.01 , ****■. p<0.0001. (FIG. 16C) Three additional representative images of multiplex immunohistochemistry staining of NSCLC tumors from either NAC or NAPC patients, respectively. (FIG. 16D) STING-activating cDCIsignature show positive correlation with overall survival in both NSCLC patients treated with either NAC or NAPC. The Logrank test was used to determine statistical significance for survival.

[0048] FIG. 17A-17B shows flow gating strategy of CD8a+ (FIG. 17A) and CD103+ cDC1s and CD8+ Tetramer+ T cells (FIG. 17B).

[0049] FIG. 18 shows assembly and characterization of PolySTING - a nanoparticle STING agonist.

[0050] FIG. 19 shows data that PC7A shows sustained STING activation over cGAMP.

[0051] FIG. 20 depicts a schematic and data showing that PolySTING displays myeloid but not T cell tropism.

[0052] FIG. 21 depicts data showing that PolySTING improves anti-tumor efficacy over Adu- S100.

[0053] FIG. 22 depicts data showing that STI NG status in host but not cancer cells is important for PolySTING efficacy.

[0054] FIG. 23 depicts data showing that blocking macrophages, B cells and NK cells does not impact PolySTING efficacy.

[0055] FIG. 24 depicts data showing that blocking moDC, pDC, and cDC2 does not impact PolySTING efficacy.

[0056] FIG. 25 depicts data showing that direct STING-IFN-I signaling within cDC1 is important for PolySTING efficacy.

[0057] FIG. 26 depicts data showing that STING activation boosts cDC1 priming.

[0058] FIG. 27 depicts data showing that PolySTING drives a chemokine signature.

[0059] FIG. 28 depicts data showing that PolySTING induced chemokines are associated with better survival.

[0060] The drawing figures do not limit the present disclosure to the specific embodiments disclosed and described herein. The drawings are not necessarily to scale, emphasis instead being placed on clearly illustrating principles of certain embodiments of the present disclosure.DETAILED DESCRIPTION

[0061] The following detailed description references the accompanying drawings that illustrate various embodiments of the present disclosure. The drawings and description are intended to describe aspects and embodiments of the present disclosure in sufficient detail to enable those skilled in the art to practice the present disclosure. Other components can be utilized and changes can be made without departing from the scope of the present disclosure. The following description is, therefore, not to be taken in a limiting sense.

[0062] STING (aka MITA, MYPS and encoded by TMEM 173 gene) is an endoplasmic reticulum (ER)-associated signaling protein that is essential for transcriptional regulation of numerous host defense genes against infection and cancer. STING is activated by 2’, 3’-cyclicguanosine monophosphate-adenosine monophosphate (cGAMP), an endogenous secondary messenger, which is produced by cGAMP synthase (cGAS) in response to microbial or self- DNA as a danger signal. Upon cGAMP binding, STING homodimer undergoes extensive conformational change that leads to oligomerization on the ER surface and translocation to the Golgi. STING oligomerization recruits and activates TANK-binding kinase 1 (TBK1) and inhibitor of KB kinases (IKKs), which in turn activate interferon regulatory factor 3 (IRF3) and nuclear factor KB (NFKB), respectively. IRF3 and NFKB cooperate to induce type I interferons and other inflammatory cytokines to mount a robust innate immune response. Besides immune activation, STING also triggers autophagy as a primordial function independent of TBK1 and IKK. Furthermore, high magnitude of STING signaling drives cell apoptosis in hepatocytes and lymphocytes through elevated ER stress. Understanding the cell context of STING activation and resulting molecular responses is paramount to mount a protective immune response against cancer.

[0063] In this disclosure, a polymeric STING-activating nanoparticle (PolySTI NG) was leveraged to investigate the role of immune cell subset in STING-mediated antitumor immunity. PolySTI NG combines a burst (shock) STING activation by cGAMP followed by a sustained (lock) effect from a synthetic polymer, PSC7A. PolySTI NG displays tropism toward myeloid cells with minimal uptake in T cells to avoid STING-mediated T cell death. The cell tropism and “shock-and-lock” STING activation by PolySTI NG allow the identification of conventional type 1 dendritic cells (cDC1s) as a key cell driver for the rejection of malignant tumors. Our findings reveal direct targeting of cDC1s by a dual activating STING agonist offers a promising approach for STING-mediated cancer immunotherapy.

[0064] Provided herein are compositions and methods improving outcomes of cancer therapies, especially immunotherapies.I. Terminology

[0065] For the purposes of promoting an understanding of the principles of the present disclosure, reference will now be made to preferred embodiments and specific language will be used to describe the same. It will nevertheless be understood that no limitation of the scope of the disclosure is thereby intended, such alteration and further modifications of the disclosure as illustrated herein, being contemplated as would normally occur to one skilled in the art to which the disclosure relates.

[0066] As used in the specification, articles “a” and “an” are used herein to refer to one or to more than one (i.e., at least one) of the grammatical object of the article. By way of example, “an element” means at least one element and can include more than one element.

[0067] “About” is used to provide flexibility to a numerical range endpoint by providing that a given value may be “slightly above” or “slightly below” the endpoint without affecting the desired result. The term “about” in association with a numerical value means that the numerical value can vary plus or minus by 5% or less of the numerical value.

[0068] Throughout this specification, unless the context requires otherwise, the word “comprise” and “include” and variations (e.g., “comprises,” “comprising,” “includes,” “including”) will be understood to imply the inclusion of a stated component, feature, element, or step or group of components, features, elements or steps but not the exclusion of any other integer or step or group of integers or steps.

[0069] As used herein, “and / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”).

[0070] As used herein, the transitional phrase “consisting essentially of” (and grammatical variants) is to be interpreted as encompassing the recited materials or steps “and those that do not materially affect the basic and novel characteristic(s)” of the claimed invention. Thus, the term “consisting essentially of” as used herein should not be interpreted as equivalent to “comprising.”

[0071] Moreover, the present disclosure also contemplates that in some embodiments, any feature or combination of features set forth herein can be excluded or omitted. To illustrate, if the specification states that a complex comprises components A, B and C, it is specifically intended that any of A, B or C, or a combination thereof, can be omitted and disclaimed singularly or in any combination.

[0072] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise- Indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if a concentration range is stated as 1% to 50%, it is intended that values such as 2% to 40%, 10% to 30%, or 1 % to 3%, etc., are expressly enumerated in this specification. These are only examples of what is specifically intended, and all possible combinations of numerical values between and including the lowest value and the highest value enumerated are to be considered to be expressly stated in this disclosure.

[0073] As used herein, “treatment,” “therapy” and / or “therapy regimen” refer to the clinical intervention made in response to a disease, disorder or physiological condition manifested by a patient or to which a patient may be susceptible. The aim of treatment includes the alleviationor prevention of symptoms, slowing or stopping the progression or worsening of a disease, disorder, or condition and / or the remission of the disease, disorder or condition.

[0074] As used herein, the term “neoadjuvant” such as “neoadjuvant chemotherapy” refers to a therapy involving the administration of one or more anti-cancer agents (e.g., one or more anti-cancer chemotherapy agents) to a subject before a primary treatment (e.g., surgery or administration of another chemotherapeutic agent) with the goal of shrinking tumor size and improving chance of successful removal or treatment. In some aspects, neoadjuvant chemotherapy comprises administering two or more chemotherapy drugs in succession. One non-limiting example of a neoadjuvant chemotherapy procedure may involve neoadjuvant paclitaxel (e.g., 175 mg / m2) plus carboplatin. Another non-limiting example of a neoadjuvant chemotherapy may comprise pemetrexed (e.g., at 500 mg / m2) plus carboplatin. Other neoadjuvant chemotherapies are known in the art.

[0075] As used herein, “prevent” or “prevention” refers to eliminating or delaying the onset of a particular disease, disorder or physiological condition, or to the reduction of the degree of severity of a particular disease, disorder or physiological condition, relative to the time and / or degree of onset or severity in the absence of intervention.

[0076] The term “effective amount” or “therapeutically effective amount” refers to an amount sufficient to effect beneficial or desirable biological and / or clinical results. The term “therapeutically effective amount,” as used herein, means an amount of a compound or combination of compounds that ameliorates, attenuates, or eliminates one or more symptoms of cancer or prevents or delays the onset of one or more symptoms of cancer as defined herein.

[0077] As used herein, “individual,” “subject,” “host,” and “patient” can be used interchangeably herein and refer to any mammalian subject for whom diagnosis, treatment, prophylaxis or therapy is desired, for example, humans, pets, livestock, horses or other animals. As used herein, the term “subject” and “patient” are used interchangeably herein and refer to both human and nonhuman animals. The term “nonhuman animals” of the disclosure includes all vertebrates, e.g., mammals and non-mammals, such as nonhuman primates, sheep, dog, cat, horse, cow, chickens, amphibians, reptiles, and the like. In some embodiments, the subject can be a human. In other embodiments, the subject can be a human in need of treating a cardiomyopathy (e.g., DCM).II. Compositions

[0078] The present disclosure provides for compositions for treating a cancer by activating STING (Stimulator of interferon genes) in receptive immune cell populations in tumors, thereby increasing targeted immune response against the tumor. In various aspects, the compositionsherein comprise a STING agonist (e.g., 2' 3'-cyclic GMP-AMP (cGAMP)) encapsulated in a biodegradable polymer. In various embodiments the biodegradable polymer also activates STING - and the composition comprises a dual-acting STING agonist.

[0079] In various aspects, the composition comprises a biodegradable polymer encapsulating a STING agonist. Suitable biodegradable polymers are described in detail in WO2020263733A1 which is incorporated herein by reference in its entirety. In various aspects, the biodegradable polymer also activates STING. In some aspects, the biodegradable polymer comprises PEG-6- P(MAC-SC7A) (PSC7A), which is depicted below for ease of reference.

[0080] Suitable STING agonists that may be included in these compositions herein are generally known and include, but are not limited to: cyclic dinucleotides (CDNs) such as 2' 3'- cyclic GMP-AMP (cGAMP), ADU-S100 / MIW815, BI-STING, BMS-986301, GSK532, JNJ- 4412, MK-1454, SB11285, or 3’3’-cyclic AIMP; non-CDN small molecules such as ALG- 031048, E7766, JNJ-6196, MK-2118, MSA-1 , MSA-2, SNX281 , SR-7171 , TAK676, and TTI- 10001 ; antibody drug conjugates like XMT-2056 and CRD-5500, ENPPI inhibitors such as MV-626, SR-8314, SR-8291 , or SR8541A. and bacterial vectors (e.g, SYNB1891 and STACT- TREX1) These and other STING agonists are described in Amouzegar et al., (Cancers (Basel). 2021 Jun; 13(11 ):2695), which is incorporated herein by reference in its entirety. In certain aspects, the STING agonist may comprise 2' 3'-cyclic GMP-AMP (cGAMP). Accordingly, in these illustrative embodiments, the compositions herein may comprise a micelle or other nanoparticle formed from PEG-6-P(MAC-SC7A) (PSC7A) encapsulating cGAMP. These compositions may be formulated into pharmaceutical compositions and / or formulations as described further below.

[0081] In certain embodiments, any one or more active agents disclosed herein (e.g., dualacting STING agonist) may be provided per se or as part of a pharmaceutical composition, where the active agent(s) can be mixed with suitable carriers or excipients. As used herein a “pharmaceutical composition” refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.

[0082] Hereinafter, the phrases “physiologically acceptable carrier” and “pharmaceutically acceptable carrier” which may be interchangeably used refer to a carrier or a diluent that doesnot cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. An adjuvant is included under these phrases.

[0083] In certain embodiments, compositions disclosed herein may further compromise one or more pharmaceutically acceptable diluent(s), excipient(s), or carrier(s). As used herein, a pharmaceutically acceptable diluent, excipient, or carrier, refers to a material suitable for administration to a subject without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained. Pharmaceutically acceptable diluents, carriers, and excipients can include, but are not limited to, physiological saline, Ringer’s solution, phosphate solution or buffer, buffered saline, and other carriers known in the art. Pharmaceutical compositions may also include stabilizers, antioxidants, colorants, other medicinal or pharmaceutical agents, carriers, adjuvants, preserving agents, stabilizing agents, wetting agents, emulsifying agents, solution promoters, salts, solubilizers, antifoaming agents, antioxidants, dispersing agents, surfactants, and combinations thereof. Herein the term “excipient” refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols. Techniques for formulation and administration of drugs may be found in “Remington's Pharmaceutical Sciences,” Mack Publishing Co., Easton, Pa., latest edition, which is incorporated herein by reference.

[0084] In certain embodiments, pharmaceutical compositions described herein may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries to facilitate processing of genetically modified endothelial progenitor cells into preparations which can be used pharmaceutically. In other embodiments, any of the well-known techniques, carriers, and excipients may be used as suitable and as understood in the art.

[0085] In certain embodiments, pharmaceutical compositions described herein may be an aqueous suspension comprising one or more polymers as suspending agents. In some aspects, polymers that may comprise pharmaceutical compositions described herein include: water-soluble polymers such as cellulosic polymers, e.g., hydroxypropyl methylcellulose; water-insoluble polymers such as cross-linked carboxyl-containing polymers; mucoadhesive polymers, selected from, for example, carboxymethylcellulose, carbomer (acrylic acid polymer), poly(methyl methacrylate), polyacrylamide, polycarbophil, acrylic acid / butyl acrylate copolymer, sodium alginate, and dextran; or a combination thereof. In other aspects, compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% total amount of polymers as suspending agent(s) by total weight of the composition.

[0086] In certain embodiments, pharmaceutical compositions disclosed herein may comprise a viscous formulation. In some aspects, viscosity of the composition may be increased by the addition of one or more gelling or thickening agents. In other aspects, compositions disclosed herein may comprise one or more gelling or thickening agents in an amount to provide a sufficiently viscous formulation to remain on treated tissue. In still other aspects, compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% total amount of gelling or thickening agent(s) by total weight of the composition. In yet other aspects, suitable thickening agents can be hydroxypropyl methylcellulose, hydroxyethyl cellulose, polyvinylpyrrolidone, carboxymethyl cellulose, polyvinyl alcohol, sodium chondroitin sulfate, sodium hyaluronate. In other aspects, viscosity enhancing agents can be acacia (gum arabic), agar, aluminum magnesium silicate, sodium alginate, sodium stearate, bladderwrack, bentonite, carbomer, carrageenan, Carbopol, xanthan, cellulose, microcrystalline cellulose (MCC), ceratonia, chitin, carboxymethylated chitosan, chondrus, dextrose, furcellaran, gelatin, Ghatti gum, guar gum, hectorite, lactose, sucrose, maltodextrin, mannitol, sorbitol, honey, maize starch, wheat starch, rice starch, potato starch, gelatin, sterculia gum, xanthum gum, gum tragacanth, ethyl cellulose, ethylhydroxyethyl cellulose, ethylmethyl cellulose, methyl cellulose, hydroxyethyl cellulose, hydroxyethylmethyl cellulose, hydroxypropyl cellulose, poly(hydroxyethyl methacrylate), oxypolygelatin, pectin, polygeline, povidone, propylene carbonate, methyl vinyl ether / maleic anhydride copolymer (PVM / MA), poly(methoxyethyl methacrylate), poly(methoxyethoxyethyl methacrylate), hydroxypropyl cellulose, hydroxypropylmethylcellulose (HPMC), sodium carboxymethyl-cellulose (CMC), silicon dioxide, polyvinylpyrrolidone (PVP: povidone), Splenda® (dextrose, maltodextrin and sucralose), or combinations thereof. In some embodiments, suitable thickening agent may be carboxymethyl cellulose.

[0087] In certain embodiments, pharmaceutical compositions disclosed herein may comprise additional agents or additives selected from a group including surface-active agents, detergents, solvents, acidifying agents, alkalizing agents, buffering agents, tonicity modifying agents, ionic additives effective to increase the ionic strength of the solution, antimicrobial agents, antibiotic agents, antifungal agents, antioxidants, preservatives, electrolytes, antifoaming agents, oils, stabilizers, enhancing agents, and the like. In some aspects, pharmaceutical compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% total amount of one or more agents by total weight of the composition. In other aspects, oneor more of these agents may be added to improve the performance, efficacy, safety, shelf-life and / or other property of the muscarinic antagonist composition of the present disclosure. In s aspects, additives will be biocompatible, and will not be harsh, abrasive, or allergenic.

[0088] In certain embodiments, pharmaceutical compositions disclosed herein may comprise one or more acidifying agents. As used herein, “acidifying agents” refers to compounds used to provide an acidic medium. Such compounds include, by way of example and without limitation, acetic acid, amino acid, citric acid, fumaric acid and other alpha hydroxy acids, such as hydrochloric acid, ascorbic acid, and nitric acid and others known to those of ordinary skill in the art. In some aspects, any pharmaceutically acceptable organic or inorganic acid may be used. In other aspects, compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% total amount of one or more acidifying agents by total weight of the composition.

[0089] In certain embodiments, pharmaceutical compositions disclosed herein may comprise one or more alkalizing agents. As used herein, “alkalizing agents” are compounds used to provide alkaline medium. Such compounds include, by way of example and without limitation, ammonia solution, ammonium carbonate, diethanolamine, monoethanolamine, potassium hydroxide, sodium borate, sodium carbonate, sodium bicarbonate, sodium hydroxide, triethanolamine, and trolamine and others known to those of ordinary skill in the art. In some aspects, any pharmaceutically acceptable organic or inorganic base can be used. In other aspects, compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% total amount of one or more alkalizing agents by total weight of the composition.

[0090] In certain embodiments, pharmaceutical compositions disclosed herein may comprise one or more antioxidants. As used herein, “antioxidants” are agents that inhibit oxidation and thus can be used to prevent the deterioration of preparations by the oxidative process. Such compounds include, by way of example and without limitation, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, hypophophorous acid, monothioglycerol, propyl gallate, sodium ascorbate, sodium bisulfite, sodium formaldehyde sulfoxylate and sodium metabisulfite and other materials known to one of ordinary skill in the art. In some aspects, compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% total amount of one or more antioxidants by total weight of the composition.

[0091] In certain embodiments, pharmaceutical compositions disclosed herein may comprise a buffer system. As used herein, a “buffer system” is a composition comprised of one or more buffering agents wherein “buffering agents” are compounds used to resist change in pH upondilution or addition of acid or alkali. Buffering agents include, by way of example and without limitation, potassium metaphosphate, potassium phosphate, monobasic sodium acetate and sodium citrate anhydrous and dihydrate and other materials known to one of ordinary skill in the art. In some aspects, any pharmaceutically acceptable organic or inorganic buffer can be used. In another aspect, compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% total amount of one or more buffering agents by total weight of the composition. In other aspects, the amount of one or more buffering agents may depend on the desired pH level of a composition. In some embodiments, pharmaceutical compositions disclosed herein may have a pH of about 6 to about 9. In other embodiments, pharmaceutical compositions disclosed herein may have a pH greater than about 8, greater than about 7.5, greater than about 7, greater than about 6.5, or greater than about 6. In a preferred embodiment, compositions disclosed herein may have a pH greater than about 6.8.

[0092] In certain embodiments, pharmaceutical compositions disclosed herein may comprise one or more preservatives. As used herein, “preservatives” refers to agents or combination of agents that inhibits, reduces or eliminates bacterial growth in a pharmaceutical dosage form. Non-limiting examples of preservatives include Nipagin, Nipasol, isopropyl alcohol and a combination thereof. In some aspects, any pharmaceutically acceptable preservative can be used. In other aspects, pharmaceutical compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% total amount of one or more preservatives by total weight of the composition.

[0093] In certain embodiments, pharmaceutical compositions disclosed herein may comprise one or more surface-acting reagents or detergents. In some aspects, surface-acting reagents or detergents may be synthetic, natural, or semi-synthetic. In other aspects, compositions disclosed herein may comprise anionic detergents, cationic detergents, zwitterionic detergents, ampholytic detergents, amphoteric detergents, nonionic detergents having a steroid skeleton, or a combination thereof. In still other aspects, pharmaceutical compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% total amount of one or more surface-acting reagents or detergents by total weight of the composition.

[0094] In certain embodiments, pharmaceutical compositions disclosed herein may comprise one or more stabilizers. As used herein, a “stabilizer” refers to a compound used to stabilize an active agent against physical, chemical, or biochemical process that would otherwise reduce the therapeutic activity of the agent. Suitable stabilizers include, by way of example and without limitation, succinic anhydride, albumin, sialic acid, creatinine, glycine and otheramino acids, niacinamide, sodium acetyltryptophonate, zinc oxide, sucrose, glucose, lactose, sorbitol, mannitol, glycerol, polyethylene glycols, sodium caprylate and sodium saccharin and others known to those of ordinary skill in the art. In some aspects, pharmaceutical compositions disclosed herein may comprise at least 5%, at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50% total amount of one or more stabilizers by total weight of the composition.

[0095] In certain embodiments, pharmaceutical compositions disclosed herein may comprise one or more tonicity agents. As used herein, a “tonicity agents” refers to a compound that can be used to adjust the tonicity of the liquid formulation. Suitable tonicity agents include, but are not limited to, glycerin, lactose, mannitol, dextrose, sodium chloride, sodium sulfate, sorbitol, trehalose and others known to those or ordinary skill in the art. Osmolarity in a composition may be expressed in milliosmoles per liter (mOsm / L). Osmolarity may be measured using methods commonly known in the art. In preferred embodiments, a vapor pressure depression method is used to calculate the osmolarity of the compositions disclosed herein. In some aspects, the amount of one or more tonicity agents comprising a pharmaceutical composition disclosed herein may result in a composition osmolarity of about 150 mOsm / L to about 500 mOsm / L, about 250 mOsm / L to about 500 mOsm / L, about 250 mOsm / L to about 350 mOsm / L, about 280 mOsm / L to about 370 mOsm / L or about 250 mOsm / L to about 320 mOsm / L.

[0096] In certain embodiments, the present disclosure provides compositions formulated for one or more routes of administration. Suitable routes of administration may, for example, include oral, rectal, transmucosal, transnasal, intestinal, and / or parenteral delivery. In some embodiments, compositions herein formulated can be formulated for parenteral delivery. In some embodiments, compositions herein formulated can be formulated intramuscular, subcutaneous, intramedullary, intravenous, intraperitoneal, and / or intranasal injections.

[0097] In certain embodiments, one may administer a composition herein in a local or systemic manner, for example, via local injection of the pharmaceutical composition directly into a tissue region of a patient. In some embodiments, a pharmaceutical composition disclosed herein can be administered parenterally, e.g., by intravenous injection, intracerebroventricular injection, intra-cisterna magna injection, intra-parenchymal injection, or a combination thereof. In some embodiments, a pharmaceutical composition disclosed herein can administered to subject as disclosed herein. In some embodiments, a pharmaceutical composition disclosed herein can administered to human patient. In some embodiments, a pharmaceutical composition disclosed herein can administered to a human patient via at least two administration routes. In some embodiments, the combination of administration routes by be intracerebroventricular injection and intravenous injection;intrathecal injection and intravenous injection; intra-cisterna magna injection and intravenous injection; and / or intra-parenchymal injection and intravenous injection.

[0098] In certain embodiments, pharmaceutical compositions of the present disclosure may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

[0099] In certain embodiments, pharmaceutical compositions for use in accordance with the present disclosure thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen. For injection, the active ingredients of a pharmaceutical composition herein may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, physiological salt buffer, or any combination thereof.

[0100] In certain embodiments, pharmaceutical compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection herein may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. In some embodiments, compositions herein may be suspensions, solutions or emulsions in oily or aqueous vehicles, and / or may contain formulatory agents such as suspending, stabilizing and / or dispersing agents.

[0101] In certain embodiments, pharmaceutical compositions herein formulated for parenteral administration may include aqueous solutions of the active preparation (e.g., a bisphosphonate, such as risedronate) in water-soluble form. In some embodiments, compositions herein comprising suspensions of the active preparation may be prepared as oily or water-based injection suspensions. Suitable lipophilic solvents and / or vehicles for use herein may include, but are not limited to, fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. In some embodiments, compositions herein comprising aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, and / or dextran. In some embodiments, compositions herein comprising a suspension may also contain one or more suitable stabilizers and / or agents which increase the solubility of the active ingredients (e.g., a STING agonist) to allow for the preparation of highly concentrated solutions.

[0102] In some embodiments, compositions herein may comprise the active ingredient in a powder form for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water-based solution, before use.

[0103] Pharmaceutical compositions suitable for use in context of the present disclosure may include compositions wherein the active ingredients can be contained in an amount effective to achieve the intended purpose. In some embodiments, a therapeutically effective amount means an amount of active ingredients (e.g., a STING agonist) effective to prevent, slow, alleviate or ameliorate symptoms of a disorder (e.g., cancer) or prolong the survival of the subject being treated.

[0104] Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

[0105] For any preparation used in the methods of the present disclosure, the therapeutically effective amount or dose can be estimated initially from in vitro and cell culture assays and or screening platforms disclosed herein. For example, a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.

[0106] In some embodiments, toxicity and therapeutic efficacy of the active ingredients disclosed herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals. In some embodiments, data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in a human subject. In some embodiments, a dosage for use herein may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in “The Pharmacological Basis of Therapeutics”).

[0107] In certain embodiments, dosage amounts and / or dosing intervals may be adjusted individually to brain or blood levels of the active ingredient that are sufficient to induce or suppress the biological effect (minimal effective concentration, MEC). In some embodiments, the MEC for an active ingredient (e.g., a STING agonist) may vary for each preparation but can be estimated from in vitro data. In some embodiments, dosages necessary to achieve the MEC herein may depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.

[0108] In certain embodiments, depending on the severity and responsiveness of the condition to be treated, dosing with compositions herein can be of a single or a plurality ofadministrations, with course of treatment lasting from several days to several weeks or until cure is affected or diminution of the disease state is achieved.

[0109] In certain embodiments, amounts of a composition herein to be administered will be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, and the like. In some embodiments, effective doses may be extrapolated from dose-responsive curves derived from in vitro or in vivo test systems.

[0110] In certain embodiments, the amount of STING agonist (e.g., PolySTING) contained in the dosage forms of the present disclosure will depend on the specific STING agonist composition selected and the continuous dosing schedule upon which the STING agonist is dosed to the subject. Continuous dosing schedules of daily, weekly, twice monthly, three times per month, and once monthly are non-limiting examples of dosing regimens suitable for use with the dosage forms of the present disclosure. The terms “three times per month” or “thrice monthly” mean that an oral dosage form is administered thrice, i.e., three times, during a monthly calendar period. In a thrice monthly schedule, the dosage forms disclosed herein may be administered on three consecutive days, or once about every nine to eleven days. The terms “twice per month” or “twice monthly” mean that an oral dosage form is administered twice, i.e., two times, during a monthly calendar period. In a twice monthly regimen, the dosage forms disclosed herein may be administered on consecutive days or once about every fourteen to sixteen days. The terms “monthly” or “once monthly” mean that a dosage form disclosed herein is administered once, i.e., one time during a monthly calendar period, that is, about every 28 to 31 days.III. Methods of Use

[0111] The present disclosure provides for methods of treating, attenuating, and preventing cancer in a subject in need thereof. The present disclosure also provides for methods of determining whether a subject is a candidate for cancer therapies. The present disclosure also relates to methods for determining a prognosis of a subject after administration of a cancer therapy (like an immunotherapy). Together these methods all provide for more targeted, effective therapies for a variety of cancers.

[0112] Certain aspects of the present disclosure relate to methods of preparing a targeted therapy for a suspect. In various aspects, methods herein can comprise determining whether a subject is a suitable candidate for a cancer therapy. In various aspects, methods herein can comprise determining or determining a prognosis of a candidate after treatment (i.e., predicting whether or not a certain therapy will be successful before clinically meaningful endpoints have been reached).STING-activating cDC1 signature

[0113] In general, the methods disclosed herein comprise determining a STING-activating cDC1 signature in a subject. In various aspects, quantifying the STING-activating cDC1 signature comprises quantifying levels of (a) one or more markers of cDC1 cells, (b) STING activation, or (c) one or more STING induced chemokines or cytokines in a sample obtained from a subject. Each are described in more detail herein below.(a) Markers of cDC1 cells

[0114] Dendritic cells are important immune cells that initiate the immune response by presenting antigenic peptides on major histocompatibility complex (MHC) molecules to induce T cell activation and differentiation. Classical dendritic cells (eDCs) encompass two subsets: classical type I DCs (cDC1) which specialize in cross-presentation, presenting exogenous antigen to induce naive CD8+ T cells to acquire cytotoxic T lymphocyte effector function and classical type II DCs (cDC2) which prime naive CD4+ T cells by presenting intracellular pathogens via their major histocompatibility complexes (MHCs). cDC1 cells play a major role in cancer immunity as they are responsible for presenting tumorigenic antigens to circulating immune cells and inducing cytotoxicity.

[0115] cDC1 cells are characterized by expression of certain transcription factors such as basic leucine zipper ATF-Like transcription factor 3 (BATF3), interferon regulatory factor 8 (IRF8) and inhibitor of DNA binding 2 (ID2). cDC1 cells also express specific cell surface markers such as X-C motif chemokine receptor 1 (XCR1), Cell adhesion molecule 1 (CADM1), Cytokine dependent hematopoietic cell linker (CLNK), and C-type lectin domain containing 9A (CLEC9A). Accordingly, in an aspect, quantifying the STING-activating cDC1 signature comprises quantifying levels of one or more of the above mentioned markers, or any other cDC1 marker known in the art in a sample obtained from a subject.

[0116] Accordingly, in an aspect, the methods provided herein comprise measuring levels of one or more markers of cDC1 cells, where the one or more markers comprise a nucleic acid or protein encoded by a gene selected from BATF3, CLEC9A, XCR1 , CLNK, IRF8, CADM1 and any combination thereof. In an aspect, the methods comprise measuring levels of two or more cDC1 markers comprising a nucleic acid or protein encoded by a gene selected from BATF3, CLEC9A, XCR1 , CLNK, IRF8, CADM1 and any combination thereof. In an aspect, the methods comprise measuring levels of three or more cDC1 markers comprising a nucleic acid or protein encoded by a gene selected from BATF3, CLEC9A, XCR1 , CLNK, IRF8, CADM1 and any combination thereof. In an aspect, the methods comprise measuring levels of four or more cDC1 markers comprising a nucleic acid or protein encoded by a gene selected from BATF3, CLEC9A, XCR1 , CLNK, IRF8, CADM1 and any combination thereof. In anaspect, the methods comprise measuring levels of five or more cDC1 markers comprising a nucleic acid or protein encoded by a gene selected from BATF3, CLEC9A, XCR1 , CLNK, I RF8, CADM1 and any combination thereof. In an aspect, the methods comprise measuring levels of six cDC1 markers comprising a nucleic acid or protein encoded by the following genes: BATF3, CLEC9A, XCR1 , CLNK, IRF8, and CADM1.

[0117] In an aspect, at least one marker of cDC1 comprises a nucleic acid or protein encoded by the XCR1 gene.

[0118] In some embodiments, levels of cDC1 markers may be determined by obtaining a gene expression profile from a sample collected from a subject. As used herein, the term “gene expression profile” refers to a pattern of genes expressed in a sample at the transcription level. Non-limiting examples of methods of measuring gene expression in a sample suitable for use herein include digital transcript counting, high-density expression array, DNA microarray, polymerase chain reaction (PCR), reverse transcriptase PCR (RT- PCR), real-time quantitative reverse transcription PCR (qRT-PCR), digital droplet PCR (ddPCR), serial analysis of gene expression (SAGE), Spotted cDNA arrays, GeneChip, spotted oligo arrays, bead arrays, RNA Seq, tiling array, northern blotting, hybridization microarray, in situ hybridization, or any combination thereof. In some aspects, a gene expression profile as disclosed herein can be obtained by any known or future method suitable to assess gene expression.

[0119] In some embodiments, levels of cDC1 markers may be determined by obtaining a protein expression profile from a sample collected from a subject. As used herein, the term “protein expression profile” refers to a pattern of proteins expressed in a sample collected from the subject. Non-limiting examples of methods of measuring protein expression in a sample suitable for use herein include Western blotting, enzyme-linked immunosorbent assay (ELISA), multi-analyte profiling (xMAP), mass spectrometry, HPLC, flow cytometry, fluorescence-activated cell sorting (FACS), liquid chromatography-mass spectrometry (LC / MS), immunoelectrophoresis, translation complex profile sequencing (TCP-seq), protein microarray, protein chip, capture arrays, reverse phase protein microarray (RPPA), two- dimensional gel electrophoresis or (2D-PAGE), functional protein microarrays, electrospray ionization (ESI), matrix-assisted laser desorption / ionization (MALDI), or a combination thereof. In some aspects, a protein expression profile as disclosed herein can be obtained by any known or future method suitable to assess protein expression.(b) STING Activation

[0120] In an aspect, methods disclosed herein comprise quantifying levels of STING activation. STING is phosphorylated by TANK-binding kinase 1 (TBK1) in response tostimulation at a C-terminal consensus motif as described by Liu et al., (Science 347, aaa2630(2015)). Accordingly, levels of STING activation may be determined by quantifying phosphorylated STING in a sample obtained from a subject.

[0121] Phosphorylated STING may be quantified using any standard method of measuring protein expression and / or phosphorylation. For instance, non-limiting methods include Western blotting, enzyme-linked immunosorbent assay (ELISA), multi-analyte profiling (xMAP), mass spectrometry, HPLC, flow cytometry, fluorescence-activated cell sorting (FACS), liquid chromatography-mass spectrometry (LC / MS), immunoelectrophoresis, translation complex profile sequencing (TCP-seq), protein microarray, protein chip, capture arrays, reverse phase protein microarray (RPPA), two- dimensional gel electrophoresis or (2D-PAGE), functional protein microarrays, electrospray ionization (ESI), matrix-assisted laser desorption / ionization (MALDI), or a combination thereof.(c) STING induced cytokines

[0122] Once activated, STING induces expression of various cytokines which contribute to anti-tumor immunity. Cytokines are small soluble proteins that contribute to cell signaling, particularly in the immune system. Chemokines are a superfamily of cytokines that mediate chemotaxis. Cytokines (including chemokines) act on surface receptors (chemokine or cytokine receptors) expressed by various immune cells. In an aspect, the methods herein comprise measuring levels of one or more STING induced cytokines. In an aspect, the one or more STING induced cytokine may comprise a STING induced chemokine. In various aspects, the one or more STING induced chemokines comprise CCL4, CCL5, CXCL9, CXCL10 or any combination thereof. In various aspects, the methods herein comprise measuring levels of two or more chemokines selected from CCL4, CCL5, CXCL9, and CXCL10. In various aspects, the methods herein comprise measuring levels of three or more chemokines selected from CCL4, CCL5, CXCL9, and CXCL10. In various aspects, the methods herein comprise measuring levels of all four chemokines selected from CCL4, CCL5, CXCL9, and CXCL10.

[0123] In various aspects, the methods herein comprise measuring levels of CXCL9, CXCL10 or any combination thereof. In various aspects, the methods herein comprise measuring levels of CCL4 and / or CCL5. In various aspects, the methods herein comprise measuring levels of at least one cytokine selected from CXCL9 and CXCL10 and at least one cytokine / chemokine selected from CCL4 and CCL5. In various aspects, the methods comprise measuring levels of CXCL9 and CCL4. In various aspects, the methods comprise measuring levels of CXCL9 and CCL5. In various aspects, the methods comprise measuring levels of CXCL9 and CXCL10. In various aspects, the methods comprise measuring levels of CXCL10 and CCL4. In various aspects, the methods comprise measuring levels of CXCL10 and CCL5. In variousaspects, the methods comprise measuring levels of CCL4 and CCL5. In various aspects, the methods comprise measuring levels of CXCL9, CXCL10, and CCL4. In various aspects, the methods comprise measuring levels of CXCL9, CXCL10 and CCL5. In various aspects the methods comprise measuring levels of CCL4, CCL5 and CXCL9. In various aspects the methods comprise measuring levels of CCL4, CCL5 and CXCL10. In various aspects the methods comprise measuring levels of CXCL9, CXCL10, CCL4 and CCL5.

[0124] In various aspects, the levels of one or more STING induced cytokines {e.g., chemokines) may be measured using any standard method of measuring protein expression. For example, non-limiting methods include Western blotting, enzyme-linked immunosorbent assay (ELISA), multi-analyte profiling (xMAP), mass spectrometry, HPLC, flow cytometry, fluorescence-activated cell sorting (FACS), liquid chromatography-mass spectrometry (LC / MS), immunoelectrophoresis, translation complex profile sequencing (TCP-seq), protein microarray, protein chip, capture arrays, reverse phase protein microarray (RPPA), two- dimensional gel electrophoresis or (2D-PAGE), functional protein microarrays, electrospray ionization (ESI), matrix-assisted laser desorption / ionization (MALDI), or a combination thereof.

[0125] In various aspects, a sample obtained from a subject may comprise a tumor sample. In various aspects, the tumor sample may be obtained from a solid tumor. In various aspects, the tumor sample may be obtained from a biopsy. In various aspects, the tumor sample may be obtained from a surgical resection. In various aspects, the sample may treated. For instance, in some aspects, the sample may be formalin-fixed and paraffin embedded.

[0126] In accord with the foregoing, the tumor samples used in these methods may be obtained from any solid tumor in the subject. In some embodiments, a solid tumor can be an abnormal mass of tissue that is devoid of cysts or liquid regions within the tumor. In some embodiments, solid tumors can be benign (not progressed to a cancer), a malignant or metastatic tumor. In some embodiments, a solid tumor herein can be a malignant cancer that has metastasized. In other embodiments, solid tumors contemplated herein can include, but are not limited to, sarcomas, carcinomas, lymphomas, gliomas or a combinational thereof. In accordance with some embodiments herein, tumors resistant to platinum-based chemotherapy can include, but are not limited to, a testicular tumor, ovarian tumor, cervical tumor, a kidney tumor, bladder tumor, head-and-neck tumor, liver tumor, stomach tumor, lung tumor, endometrial tumor, esophageal tumor, breast tumor, cervical tumor, central nervous system tumor, germ cell tumor, prostate tumor, Hodgkin's lymphoma, non-Hodgkin's lymphoma, neuroblastoma, sarcoma, multiple myeloma, melanoma, mesothelioma, osteogenic sarcoma or a combination thereof. In some embodiments, a targeted tumor contemplated herein can include a solid tumor such as ovarian tumors, breast tumors, or any combination thereof. For instance, in some aspects, the tumor is a lung tumor, a breast tumor,a pancreatic tumor, a skin tumor (e.g., skin cutaneous melanoma or sarcoma), or any other solid tumor. In some aspects, the tumor is a non-small cell lung carcinoma, a triple negative breast cancer, a head or neck cancer, or a melanoma.Methods of Applying STING-activated cDC1 signature to Improve Cancer Therapy Outcomes

[0127] The inventors have made the surprising discovery that measurements of STING activity before or after cancer therapy in a patient can help predict the efficacy of different cancer therapies (and particularly, immunotherapies) in different patient populations. Accordingly, methods are provided herein that practically apply the STING-activated cDC1 signature to improve cancer therapies.Methods of Predicting Prognosis or Identifying a Candidate for a Therapy

[0128] In various aspects, a method is provided for predicting prognosis of a patient after administration of a cancer therapy, the method comprising: (a) administering the cancer therapy to the subject, (b) quantifying a STING-activated cDC1 signature in a tumor sample obtained from the subject, and (c) determining that the subject will have a positive prognosis if the cDC1 signature exceeds threshold.

[0129] Various cancer therapies are described in detail below and incorporated by reference here. In various aspects, the cancer therapy of (a) comprises a STING agonist (e.g., any STING agonist described herein). In an aspect, the STING agonist comprises 2' 3'-cyclic GMP- AMP (cGAMP). In further aspects, the STING agonist is encapsulated in a biodegradable pH sensitive polymer (e.g., PEG-b-P(MAC-SC7A) (PSC7A)). Exemplary STING agonist compositions are described above and would be suitable cancer therapies to use in (a).

[0130] In various aspects, the cancer therapy in (a) comprises a chemotherapy (e.g., a neoadjuvant chemotherapy) and / or immunotherapy. Various immunotherapies and chemotherapies are described in more detail herein below. In some aspects, the immunotherapy may comprise an immune checkpoint inhibitor, a cytokine therapy, or a CAR- T cell. For instance, in some aspects the immunotherapy comprises an immune checkpoint inhibitor such as Pembrolizumab. In some aspects, the chemotherapy comprises a neoadjuvant chemotherapy. In some aspects, the cancer therapy in (a) comprises a neoadjuvant chemotherapy and an immune checkpoint inhibitor such as, but not limited to, Pembrolizumab.

[0131] In various aspects, a method of identifying a patient as a candidate for a cancer therapy is provided. In an aspect, the method may comprise (a) quantifying a STING-activated cDC1 signature in a tumor sample obtained from a subject and (b) identifying the patient as acandidate for the cancer therapy if the STING-activated cDC1 signature exceeds a threshold. STING-activated cDC1 signature and methods for measuring it are described herein above.Methods of Treating Cancer

[0132] Various methods of treating cancer in a subject in need thereof are provided herein.

[0133] In some aspects, the method of treating cancer comprises administering a STING agonist to the subject. In some aspects, the STING agonist is comprised in a composition provided herein (e.g., a nanoparticle formed from a biodegradable pH sensitive polymer like PCS7A encapsulating a STING agonist like cGAMP).

[0134] In various aspects, the methods of treating cancer further comprise quantifying a STING activated cDC1 signature in a tumor sample obtained from the subject. The STING- activated cDC1 signature may be quantified before or after administration of a cancer therapy (e.g., a STING agonist, an immunotherapy, or a chemotherapy).

[0135] For instance, in an aspect, a method for treating cancer (i.e. , a tumor) in a subject is provided, the method comprising (a) administering a cancer therapy to the subject, (b) quantifying a STING-activated cDC1 signature in a tumor sample obtained from the subject, and (c) continuing or discontinuing the cancer therapy based on the STING-activated cDC1 signature. For example, in an aspect, the cancer therapy may be continued if the STING- activated cDC1 signature exceeds a threshold. In another aspect, the cancer therapy may be discontinued if the STING activated cDC1 signature is below a threshold.

[0136] In another aspect, a method for treating cancer (i.e., a tumor) in a subject is provided, the method comprising (a) quantifying a STING-activated cDC1 signature in a tumor sample obtained from a subject and (b) administering a cancer therapy to the subject, wherein the identity of the cancer therapy depends on the STING-activated cDC1 signature. For example, the method can comprise administering an immunotherapy, a STING agonist, and / or a chemotherapy as the cancer therapy in (b) if the STING-activated cDC1 signature is at or above a threshold. Alternatively, the method can comprise administering a cancer therapy other than an immunotherapy, a STING agonist, and / or a chemotherapy as the cancer therapy in (b) if the STING activated cDC1 signature is below a threshold. For instance, the cancer therapy in (b) may comprise radiation therapy and / or surgery if the STING activated cDC1 signature is below a threshold.

[0137] In some aspects, these methods may comprise an additional step, where the subject is pre-treated with a cancer therapy before step (a). Accordingly, in some aspects, a method for treating cancer (i.e., a tumor) is provided, the method comprising (a)(i) administering an initial cancer therapy to the subject, (a)(ii) quantifying a STING-activated cDC1 signature atumor sample obtained from the subject and (b) administering a cancer therapy to the subject based on the outcome of the STING-activated cDC1 signature. In some aspects, the method comprises (a)(i) administering an initial cancer therapy to the subject, (a)(ii) quantifying a STING-activated cDC1 signature in a tumor sample obtained from the subject and (b) administering a cancer therapy to the subject based on the outcome of the STING-activated cDC1 signature.

[0138] In various aspects, the initial cancer therapy in (a)(i) may be different than the cancer therapy in (b). In various aspects, the initial cancer therapy in (a)(i) may be the same as the cancer therapy in (b).

[0139] In various aspects, the initial cancer therapy in (a)(i) may be a STING agonist (e.g., 2' 3'-cyclic GMP-AMP (cGAMP)). In various aspects, the initial cancer therapy in (a)(i) may be a STING agonist encapsulated by a polymer {e.g., a pH sensitive biodegradable polymer). In an aspect, the polymer may also activate STING. In an aspect, the polymer may comprise PEG- b-P(MAC-SC7A) (PSC7A). In an aspect, the initial cancer therapy in (a)(i) may comprise any composition described herein above.

[0140] In various aspects, the initial cancer therapy in (a)(i) may be an immunotherapy. For instance, the immunotherapy may comprise an immune checkpoint inhibitor, a cytokine therapy, or a CAR-T cell. In some aspects, the immune checkpoint inhibitor may comprise Pembrolizumab. Other immunotherapies are described in detail below and may also be administered in (a)(i).

[0141] In various aspects, the initial cancer therapy in (a)(i) may be a chemotherapy. In an aspect, the initial cancer therapy may comprise neoadjuvant chemotherapy.

[0142] In various aspects, the cancer therapy in (b) may be an immunotherapy. In various aspects, the cancer therapy in (b) may comprise an immunotherapy and / or a chemotherapy if the STING-activated cDC1 signature meets or exceeds a threshold. In various aspects, the cancer therapy in (b) may comprise a cancer therapy other than immunotherapy or chemotherapy e.g., surgery, radiation, hormone therapy, or other therapies described herein below). In various aspects, the cancer therapy in (b) may be a cancer therapy other than immunotherapy or chemotherapy {e.g., surgery, radiation, hormone therapy, or other therapies described herein below) if the STING-activated cDC1 signature is below a threshold. As used herein, the term “cancer therapy other than immunotherapy or chemotherapy” refers to any cancer therapy that does not target the immune system and / or does not comprise administration of any standard chemotherapeutic agents (e.g., those described below). In some aspects, the cancer therapy other than immunotherapy or chemotherapy in (b) comprises a surgery or radiation therapy.

[0143] In some aspects, the initial cancer therapy in (a)(i) is a STING agonist (e.g., cGAMP encapsulated in PSC7A) and the cancer therapy in (b) is an immunotherapy if the STING- activated cDC1 signature meets or exceeds a threshold. In some aspects, the initial cancer therapy in (a) is immunotherapy and the cancer therapy in (b) is an immunotherapy if the STING-activated cDC1 signature meets or exceeds a threshold.

[0144] In some aspects, the initial cancer therapy in (a)(i) is a STING agonist (e.g., cGAMP encapsulated in PSC7A) and the cancer therapy in (b) is a neoadjuvant chemotherapy if the STING-activated cDC1 signature meets or exceeds a threshold. In some aspects, the initial cancer therapy in (a) is immunotherapy and the cancer therapy in (b) is neoadjuvant chemotherapy if the STING-activated cDC1 signature meets or exceeds a threshold. In some aspects, the initial cancer therapy in (a) is neoadjuvant chemotherapy and the cancer therapy in (b) is immunotherapy if the STING-activated cDC1 signature meets or exceeds a threshold.

[0145] In some aspects, the first cancer therapy in (a)(i) is a STING agonist (e.g., cGAMP encapsulated in PSC7A) and the second cancer therapy in (b) is a cancer therapy other than immunotherapy or chemotherapy if the STING-activated cDC1 signature is below a threshold. In some aspects, the first cancer therapy in (a)(i) is immunotherapy and the second cancer therapy in (b) is a cancer therapy other than immunotherapy or chemotherapy if the STING- activated cDC1 signature is below a threshold. In some aspects, the first cancer therapy in (a)(i) comprises neoadjuvant chemotherapy and the second cancer therapy in (b) is a cancer therapy other than immunotherapy or chemotherapy if the STING-activated cDC1 signature is below a threshold. In some aspects, the cancer therapy other than immunotherapy or chemotherapy in (b) comprises surgery, or radiation therapy. In other words, the cancer therapy in (b) may not comprise chemotherapy (especially, neoadjuvant chemotherapy) or immunology if the STING-activated cDC1 signature is below a threshold.

[0146] In any of these aspects, the immunotherapy may comprise an immune checkpoint inhibitor (e.g., Pembrolizumab). In any of these aspects, the STING agonist may comprise comprises 2' 3'-cyclic GMP-AMP (cGAMP) and it may be encapsulated in a pH sensitive biodegradable polymer like PEG-b-P(MAC-SC7A) (PSC7A) as described herein above. Other cancer therapies may be used in any of the methods provided herein above and are described in more detail below.Cancer Therapies

[0147] In various aspects, the cancer therapy can comprise a STING agonist (e.g., cGAMP encapsulated in PSC7A as described herein), immunotherapy, chemotherapy, radiation therapy, hormone therapy, targeted therapy, oncolytic viruses, polysaccharides, neoantigens, surgery or a combination thereof. In various aspects, the cancer therapy can comprisechemotherapy, immunotherapy or any combination thereof. In various aspects, the cancer therapy can comprise an immunotherapy. In various aspects, the cancer therapy does not comprise immunotherapy. In various aspects, the cancer therapy comprises a chemotherapy (e.g., neoadjuvant chemotherapy). In various aspects, the cancer therapy does not comprise a chemotherapy (e.g., neoadjuvant chemotherapy).(a) STING agonist

[0148] In some embodiments, one or more cancer therapies may comprise a STING agonist. Various STING agonists are known in the art and may include, but are not limited to: cyclic dinucleotides (CDNs) such as 2' 3'-cyclic GMP-AMP (cGAMP), ADU-S100 / MIW815, BISTING, BMS-986301, GSK532, JNJ-4412, MK-1454, SB11285, or 3’3’-cyclic AIMP; Non-CDN small molecules such as ALG-031048, E7766, JNJ-6196, MK-2118, M SA- 1 , MSA-2, SNX281 , SR-7171 , TAK676, and TTI-10001 ; antibody drug conjugates like XMT-2056 and CRD-5500, ENPPI inhibitors such as MV-626, SR-8314, SR-8291 , or SR8541A, and bacterial vectors (e.g, SYNB1891 and STACT-TREX1). These and other STING agonists are described in Amouzegar et al., Cancers (Basel). 2021 Jun; 13(11):2695, which is incorporated herein by reference in its entirety. In various aspects, the STING agonist may comprise cGAMP. In various aspects, the STING agonist may be encapsulated by a biodegradable pH sensitive polymer. In some aspects, the biodegradable pH sensitive polymer comprises PEG-b-P(MAC- SC7A) (PSC7A). Accordingly, in an aspect the STING agonist may comprise any composition disclosed herein above.(b) Immunotherapy

[0149] In some embodiments, one or more cancer therapies may be immunotherapy. Immunotherapy may comprise, for example, use of cancer vaccines, an immune checkpoint inhibitor, a cytokine therapy, sensitized antigen presenting cells, or other modified immune cells (e.g., CAR-T cells). The immunotherapy can involve passive immunity for short-term protection of a host, achieved by the administration of pre-formed antibody directed against a cancer antigen or disease antigen (e.g., administration of a monoclonal antibody, optionally linked to a chemotherapeutic agent or toxin, to a tumor antigen). Immunotherapy can also focus on using the cytotoxic lymphocyte-recognized epitopes of cancer cell lines.

[0150] In some aspects, the immunotherapy comprises a checkpoint inhibitor. In some aspects, the checkpoint inhibitor is a PD-1 or PDL-1 inhibitor. PD-1 can act in the tumor microenvironment where T cells encounter an infection or tumor. Activated T cells upregulate PD-1 and continue to express it in the peripheral tissues. Cytokines such as IFN-gamma induce the expression of PDL1 on epithelial cells and tumor cells. PDL2 is expressed on macrophages and dendritic cells. The main role of PD-1 is to limit the activity of effector T cellsin the periphery and prevent excessive damage to the tissues during an immune response. Alternative names for“PD-1” include CD279 and SLEB2. Alternative names for “PDL1” include B7-H1 , B7-4, CD274, and B7-H. Alternative names for “PDL2” include B7-DC, Btdc, and CD273. In some embodiments, PD-1 , PDL1 , and PDL2 are human PD-1 , PDL1 and PDL2.

[0151] In some embodiments, the PD-1 inhibitor is a molecule that inhibits the binding of PD- 1 to its ligand binding partners. In a specific aspect, the PD-1 ligand binding partners are PDL1 and / or PDL2. In another embodiment, a PDL1 inhibitor is a molecule that inhibits the binding of PDL1 to its binding partners. In a specific aspect, PDL1 binding partners are PD-1 and / or B7-1 . In another embodiment, the PDL2 inhibitor is a molecule that inhibits the binding of PDL2 to its binding partners. In a specific aspect, a PDL2 binding partner is PD-1. The inhibitor may be an antibody, an antigen binding fragment thereof, an immunoadhesin, a fusion protein, or oligopeptide. Exemplary antibodies are described in U.S. Patent Nos. 8,735,553, 8,354,509, and 8,008,449, all incorporated herein by reference. Other PD-1 inhibitors for use in the methods and compositions provided herein are known in the art such as described in U.S. Patent Application Nos. US2014 / 0294898, US2014 / 022021 , and US2011 / 0008369, all incorporated herein by reference.

[0152] In some embodiments, the PD-1 inhibitor is an anti-PD-1 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody). In some embodiments, the anti-PD- 1 antibody is selected from the group consisting of nivolumab, pembrolizumab, and pidilizumab. In some embodiments, the PD-1 inhibitor is pembrolizumab. In some embodiments, the PD-1 inhibitor is nivolumab. In some embodiments, the PD-1 inhibitor is pidilizumab. In some embodiments, the PD-1 inhibitor is an immunoadhesin (e.g., an immunoadhesin comprising an extracellular or PD-1 binding portion of PDL1 or PDL2 fused to a constant region (e.g., an Fc region of an immunoglobulin sequence)). In some embodiments, the PDL1 inhibitor comprises AMP- 224. Nivolumab, also known as MDX- 1106-04, MDX-1106, ONO-4538, BMS-936558, and OPDIVO®, is an anti-PD-1 antibody described in W02006 / 121168. Pembrolizumab, also known as MK-3475, Merck 3475, lambrolizumab, KEYTRUDA®, and SCH-900475, is an anti-PD-1 antibody described in W02009 / 114335. Pidilizumab, also known as CT-011 , hBAT, or hBAT-1 , is an anti-PD-1 antibody described in W02009 / 101611. AMP-224, also known as B7-DCIg, is a PDL2-FC fusion soluble receptor described in W02010 / 027827 and WO2011 / 066342. Additional anticancer PD-1 inhibitors include MEDI0680, also known as AMP-514, and REGN2810.

[0153] In some embodiments, the immune checkpoint inhibitor is a PDL1 inhibitor such as Durvalumab, also known as MEDI4736, atezolizumab, also known as MPDL3280A, avelumab, also known as MSB00010118C, MDX-1105, BMS-936559, or combinationsthereof. In certain aspects, the immune checkpoint inhibitor is a PDL2 inhibitor such as rHlgM12B7.

[0154] In some embodiments, the inhibitor comprises the heavy and light chain CDRs or VRs of nivolumab, pembrolizumab, or pidilizumab. Accordingly, in one embodiment, the inhibitor comprises the CDR1 , CDR2, and CDR3 domains of the VH region of nivolumab, pembrolizumab, or pidilizumab, and the CDR1 , CDR2 and CDR3 domains of the VL region of nivolumab, pembrolizumab, or pidilizumab. In another embodiment, the antibody competes for binding with and / or binds to the same epitope on PD-1 , PDL1 , or PDL2 as the above- mentioned antibodies. In another embodiment, the antibody has at least about 70, 75, 80, 85, 90, 95, 97, or 99% (or any derivable range therein) variable region amino acid sequence identity with the above-mentioned antibodies.

[0155] Another immune checkpoint that can be targeted in the methods provided herein as an additional anti-cancer therapy is the cytotoxic T-lymphocyte-associated protein 4 (CTLA- 4), also known as CD152. The complete cDNA sequence of human CTLA-4 has the Genbank accession number L15006. CTLA-4 is found on the surface of T cells and acts as an “off” switch when bound to B7-1 (CD80) or B7-2 (CD86) on the surface of antigen-presenting cells. CTLA4 is a member of the immunoglobulin superfamily that is expressed on the surface of Helper T cells and transmits an inhibitory signal to T cells. CTLA4 is similar to the T-cell costimulatory protein, CD28, and both molecules bind to B7-1 and B7-2 on antigen-presenting cells. CTLA-4 transmits an inhibitory signal to T cells, whereas CD28 transmits a stimulatory signal. Intracellular CTLA-4 is also found in regulatory T cells and may be important to their function. T cell activation through the T cell receptor and CD28 leads to increased expression of CTLA-4, an inhibitory receptor for B7 molecules. Inhibitors of the disclosure may block one or more functions of CTLA-4, B7-1 , and / or B7-2 activity. In some embodiments, the inhibitor blocks the CTLA-4 and B7-1 interaction. In some embodiments, the inhibitor blocks the CTLA- 4 and B7-2 interaction.

[0156] In some embodiments, the immune checkpoint inhibitor is an anti-CTLA-4 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody), an antigen binding fragment thereof, an immunoadhesin, a fusion protein, or oligopeptide.

[0157] Anti-human-CTLA-4 antibodies (or VH and / or VL domains derived therefrom) suitable for use in the present methods can be generated using methods well known in the art. Alternatively, art recognized anti-CTLA-4 antibodies can be used. For example, the anti-CTLA- 4 antibodies disclosed in: US 8,119,129, WO 01 / 14424, WO 98 / 42752; WO 00 / 37504 (CP675,206, also known as tremelimumab; formerly ticilimumab), U.S. Patent No. 6,207,156; Hurwitz et al., 1998; can be used in the methods disclosed herein. The teachings of each ofthe aforementioned publications are hereby incorporated by reference. Antibodies that compete with any of these art-recognized antibodies for binding to CTLA-4 also can be used. For example, a humanized CTLA-4 antibody is described in International Patent Application No. W02001 / 014424, W02000 / 037504, and U.S. Patent No. 8,017,114; all incorporated herein by reference.

[0158] A further anti-CTLA-4 antibody useful as a checkpoint inhibitor in the methods and compositions of the disclosure is ipilimumab (also known as 10D1 , MDX- 010, MDX- 101 , and Yervoy®) or antigen binding fragments and variants thereof (see, e.g., WOO 1 / 14424).

[0159] In some embodiments, the inhibitor comprises the heavy and light chain CDRs or VRs of tremelimumab or ipilimumab. Accordingly, in one embodiment, the inhibitor comprises the CDR1 , CDR2, and CDR3 domains of the VH region of tremelimumab or ipilimumab, and the CDR1 , CDR2 and CDR3 domains of the VL region of tremelimumab or ipilimumab. In another embodiment, the antibody competes for binding with and / or binds to the same epitope on PD- 1 , B7-1 , or B7-2 as the above- mentioned antibodies. In another embodiment, the antibody has at least about 70, 75, 80, 85, 90, 95, 97, or 99% (or any derivable range therein) variable region amino acid sequence identity with the above-mentioned antibodies.

[0160] In certain aspects, the immunotherapy comprises an adoptive T-cell therapy. Adoptive T cell therapy is a form of passive immunization by the transfusion of T-cells (adoptive cell transfer). They are found in blood and tissue and usually activate when they find foreign pathogens. Specifically, they activate when the T-cell's surface receptors encounter cells that display parts of foreign proteins on their surface antigens. These can be either infected cells, or antigen presenting cells (APCs). They are found in normal tissue and in tumor tissue, where they are known as tumor infiltrating lymphocytes (TILs). They are activated by the presence of APCs such as dendritic cells that present tumor antigens. Although these cells can attack the tumor, the environment within the tumor is highly immunosuppressive, preventing immune- mediated tumor death.

[0161] Multiple ways of producing and obtaining tumor targeted T-cells have been developed. T-cells specific to a tumor antigen can be removed from a tumor sample (TILs) or filtered from blood. Subsequent activation and culturing is performed ex vivo, with the results reinfused. Activation can take place through gene therapy, or by exposing the T cells to tumor antigens.

[0162] In some aspects, the immunotherapy comprises a CAR-T cell therapy. Chimeric antigen receptors (CARs, also known as chimeric T cell receptors or artificial T cell receptors) are engineered receptors that combine a new specificity with an immune cell to target cancer cells. Typically, these receptors graft the specificity of a monoclonal antibody onto a T cell.The receptors are called chimeric because they are fused of parts from different sources. CAR-T cell therapy refers to a treatment that uses such transformed cells for cancer therapy.

[0163] The basic principle of CAR-T cell design involves recombinant receptors that combine antigen-binding and T-cell activating functions. The general premise of CAR-T cells is to artificially generate T-cells targeted to markers found on cancer cells. Scientists can remove T-cells from a person, genetically alter them, and put them back into the patient for them to attack the cancer cells. Once the T cell has been engineered to become a CAR-T cell, it acts as a “living drug”. CAR-T cells create a link between an extracellular ligand recognition domain to an intracellular signaling molecule which in turn activates T cells. The extracellular ligand recognition domain is usually a single-chain variable fragment (scFv). An important aspect of the safety of CAR-T cell therapy is how to ensure that only cancerous tumor cells are targeted, and not normal cells. The specificity of CAR-T cells is determined by the choice of molecule that is targeted.

[0164] In some aspects, the immunotherapy comprises a cytokine therapy. Cytokines are proteins produced by many types of cells present within a tumor. They can modulate immune responses. The tumor often employs them to allow it to grow and reduce the immune response. These immune-modulating effects allow them to be used as drugs to provoke an immune response. Two commonly used cytokines are interferons and interleukins.

[0165] Interferons are produced by the immune system. They are usually involved in anti-viral response, but also have use for cancer. They fall in three groups: type I (IFNa and I FN p) , type II (IFNy) and type III (IFNA).

[0166] Interleukins have an array of immune system effects. IL-2 is an exemplary interleukin cytokine therapy.(c) Chemotherapy

[0167] In some embodiments, one or more cancer therapies may be chemotherapy. Chemotherapeutic agents may be selected from any one or more of cytotoxic antibiotics, antimetabolities, anti-mitotic agents, alkylating agents, arsenic compounds, DNA topoisomerase inhibitors, taxanes, nucleoside analogues, plant alkaloids, and toxins; and synthetic derivatives thereof. Suitable classes of chemotherapeutic agents include (a) Alkylating Agents, such as treosulfan, trofosfamide and nitrogen mustards (e.g., mechlorethamine, cylophosphamide, ifosfamide, melphalan, chlorambucil), ethylenimines and methylmelamines (e.g., hexamethylmelamine, thiotepa), alkyl sulfonates (e.g., busulfan), nitrosoureas (e.g., carmustine, lomustine, chlorozoticin, streptozocin) and triazines (e.g., dicarbazine), (b) Antimetabolites, such as folic acid analogs (e.g., methotrexate), pyrimidine analogs (e.g., 5-fluorouracil, floxuridine, cytarabine, azauridine) and purine analogs andrelated materials (e.g., 6-mercaptopurine, 6-thioguanine, pentostatin), (c) Natural Products, such as vinca alkaloids (e.g., vinblastine, vincristine), other plant alkyloids (paclitaxel, docetaxol), epipodophylotoxins (e.g., etoposide, teniposide), antibiotics (e.g., dactinomycin, daunorubicin, doxorubicin, bleomycin, plicamycin and mitoxanthrone), enzymes (e.g., L- asparaginase), and biological response modifiers (e.g., Interferon-a), (d) DNA topoisomerase inhibitors (doxorubicin, epirubicin, etoposide, camptothecin, topotecan, irinotecan, teniposide, crisnatol, and mitomycin), (e) DNA antimetabolites (2'-deoxy-5-fluorouridine, aphidicolin glycinate, and pyrazoloimidazole) and antimitotic agents (halichondrin, colchicine, and rhizoxin) and (e) Miscellaneous Agents, such as platinum coordination complexes (e.g., cisplatin, carboplatin), substituted ureas (e.g., hydroxyurea), methylhydiazine derivatives (e.g., procarbazine), and adreocortical suppressants (e.g., taxol and mitotane). In some embodiments, cisplatin is a particularly suitable chemotherapeutic agent. Compositions comprising one or more chemotherapeutic agents (e.g., FLAG, CHOP) may also be used. FLAG comprises fludarabine, cytosine arabinoside (Ara-C) and G-CSF. CHOP comprises cyclophosphamide, vincristine, doxorubicin, and prednisone.

[0168] Cisplatin has been widely used to treat cancers such as, for example, metastatic testicular or ovarian carcinoma, advanced bladder cancer, head or neck cancer, cervical cancer, lung cancer or other tumors. Cisplatin is not absorbed orally and must therefore be delivered via other routes such as, for example, intravenous, subcutaneous, intratumoral or intraperitoneal injection. Cisplatin can be used alone or in combination with other agents, with efficacious doses used in clinical applications including about 15 mg / m2 to about 20 mg / m2 for 5 days every three weeks for a total of three courses being contemplated in certain embodiments. In some embodiments, the amount of cisplatin delivered to the cell and / or subject in conjunction with the construct comprising an Egr-1 promoter operably linked to a polynucleotide encoding the therapeutic polypeptide is less than the amount that would be delivered when using cisplatin alone.

[0169] Other suitable chemotherapeutic agents include antimicrotubule agents, e.g., Paclitaxel (“Taxol”) and doxorubicin hydrochloride (“doxorubicin”). The combination of an Egr- 1 promoter / TNFa construct delivered via an adenoviral vector and doxorubicin was determined to be effective in overcoming resistance to chemotherapy and / or TNF-a, which suggests that combination treatment with the construct and doxorubicin overcomes resistance to both doxorubicin and TNF-a.

[0170] Doxorubicin is absorbed poorly and is preferably administered intravenously. In certain embodiments, appropriate intravenous doses for an adult include about 60 mg / m2 to about 75 mg / m2 at about 21 -day intervals or about 25 mg / m2 to about 30 mg / m2 on each of 2 or 3 successive days repeated at about 3 week to about 4 week intervals or about 20 mg / m2 oncea week. The lowest dose should be used in elderly patients, when there is prior bone-marrow depression caused by prior chemotherapy or neoplastic marrow invasion, or when the drug is combined with other myelopoietic suppressant drugs.

[0171] Nitrogen mustards are another suitable chemotherapeutic agent useful in the methods of the disclosure. A nitrogen mustard may include, but is not limited to, mechlorethamine (HN2), cyclophosphamide and / or ifosfamide, melphalan (L-sarcolysin), and chlorambucil. Cyclophosphamide (CYTOXAN®) (available from Mead Johnson) and NEOSTAR® (available from Adria), is another suitable chemotherapeutic agent. Suitable oral doses for adults include, for example, about 1 mg / kg / day to about 5 mg / kg / day, intravenous doses include, for example, initially about 40 mg / kg to about 50 mg / kg in divided doses over a period of about 2 days to about 5 days or about 10 mg / kg to about 15 mg / kg about every 7 days to about 10 days or about 3 mg / kg to about 5 mg / kg twice a week or about 1.5 mg / kg / day to about 3 mg / kg / day. Because of adverse gastrointestinal effects, the intravenous route is preferred. The drug also sometimes is administered intramuscularly, by infiltration or into body cavities.

[0172] Additional suitable chemotherapeutic agents include pyrimidine analogs, such as cytarabine (cytosine arabinoside), 5-fluorouracil (fluouracil; 5-Fll) and floxuridine (fluorodeoxyuridine; FudR). 5-Fll may be administered to a subject in a dosage of anywhere between about 7.5 to about 1000 mg / m2. Further, 5-Fll dosing schedules may be for a variety of time periods, for example up to six weeks, or as determined by one of ordinary skill in the art to which this disclosure pertains.

[0173] Gemcitabine diphosphate (GEMZAR®, Eli Lilly & Co., “gemcitabine”), another suitable chemotherapeutic agent, is recommended for treatment of advanced and metastatic pancreatic cancer, and will therefore be useful in the present disclosure for these cancers as well.

[0174] The amount of the chemotherapeutic agent delivered to the patient may be variable. In one suitable embodiment, the chemotherapeutic agent may be administered in an amount effective to cause arrest or regression of the cancer in a host, when the chemotherapy is administered with the construct. In other embodiments, the chemotherapeutic agent may be administered in an amount that is anywhere between 2 to 10,000 fold less than the chemotherapeutic effective dose of the chemotherapeutic agent. For example, the chemotherapeutic agent may be administered in an amount that is about 20 fold less, about 500 fold less or even about 5000 fold less than the chemotherapeutic effective dose of the chemotherapeutic agent. The chemotherapeutics of the disclosure can be tested in vivo for the desired therapeutic activity in combination with the construct, as well as for determinationof effective dosages. For example, such compounds can be tested in suitable animal model systems prior to testing in humans, including, but not limited to, rats, mice, chicken, cows, monkeys, rabbits, etc. In vitro testing may also be used to determine suitable combinations and dosages, as described in the examples.(d) Radiation Therapy

[0175] In some embodiments, one or more cancer therapies may be radiation therapy. The radiation used in radiation therapy can be ionizing radiation. Radiation therapy can also be gamma rays, X-rays, or proton beams. Examples of radiation therapy include, but are not limited to, external-beam radiation therapy, interstitial implantation of radioisotopes (1-125, palladium, iridium), radioisotopes such as strontium-89, thoracic radiation therapy, intraperitoneal P-32 radiation therapy, and / or total abdominal and pelvic radiation therapy. In some aspects, the radiation therapy can be administered as external beam radiation or teletherapy wherein the radiation is directed from a remote source. In other aspects, the radiation treatment can also be administered as internal therapy or brachytherapy wherein a radioactive source is placed inside the body close to cancer cells or a tumor mass. Also encompassed is the use of photodynamic therapy comprising the administration of photosensitizers, such as hematoporphyrin and its derivatives, Vertoporfin (BPD-MA), phthalocyanine, photosensitizer Pc4, demethoxy-hypocrellin A; and 2BA-2-DMHA.

[0176] In some embodiments, the amount of ionizing radiation is greater than 20 Gy and is administered in one dose. In some embodiments, the amount of ionizing radiation is 18 Gy and is administered in three doses. In some embodiments, the amount of ionizing radiation is at least, at most, or exactly 2, 4, 6, 8, 10, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 18, 19, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, or 40 Gy (or any derivable range therein). In some embodiments, the ionizing radiation is administered in at least, at most, or exactly 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 does (or any derivable range therein). When more than one dose is administered, the does may be about 1 , 4, 8, 12, or 24 hours or 1 , 2, 3, 4, 5, 6, 7, or 8 days or 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, or 16 weeks apart, or any derivable range therein.

[0177] In some embodiments, the amount of IR may be presented as a total dose of IR, which is then administered in fractionated doses. For example, in some embodiments, the total dose is 50 Gy administered in 10 fractionated doses of 5 Gy each. In some embodiments, the total dose is 50-90 Gy, administered in 20-60 fractionated doses of 2-3 Gy each. In some embodiments, the total dose of IR is at least, at most, or about 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40,41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77,78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, 101 , 102, 103, 104, 105, 106, 107, 108, 109, 110, 111 , 112, 113, 114, 115, 116, 117, 118, 119, 120, 125, 130, 135, 140, or 150 (or any derivable range therein). In some embodiments, the total dose is administered in fractionated doses of at least, at most, or exactly 1 , 2, 3, 4, 5, 6,7, 8, 9, 10, 12, 14, 15, 20, 25, 30, 35, 40, 45, or 50 Gy (or any derivable range therein). In some embodiments, at least, at most, or exactly 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40,41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 100 fractionated doses are administered (or any derivable range therein). In some embodiments, at least, at most, or exactly 1 , 2, 3, 4, 5, 6, 7,8, 9, 10, 11 , or 12 (or any derivable range therein) fractionated doses are administered per day. In some embodiments, at least, at most, or exactly 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 (or any derivable range therein) fractionated doses are administered per week.(e) Hormone Therapy

[0178] In some embodiments, one or more cancer therapies may be hormonal therapy, Hormonal therapeutic treatments can comprise, for example, hormonal agonists, hormonal antagonists (e.g., flutamide, bicalutamide, tamoxifen, raloxifene, leuprolide acetate (LLIPRON), LH-RH antagonists), inhibitors of hormone biosynthesis and processing, and steroids (e.g., dexamethasone, retinoids, deltoids, betamethasone, cortisol, cortisone, prednisone, dehydrotestosterone, glucocorticoids, mineralocorticoids, estrogen, testosterone, progestins), vitamin A derivatives (e.g., all-trans retinoic acid (ATRA)); vitamin D3 analogs; antigestagens (e.g., mifepristone, onapristone), or antiandrogens (e.g., cyproterone acetate).(f) Targeted Therapies

[0179] In some embodiments, the one or more cancer therapies comprise a targeted therapy. Targeted therapies are drugs or other substances that block the growth and spread of cancer by interfering with specific molecules (“molecular targets”) that are involved in the growth, progression, and / or spread of cancer. Targeted cancer therapies are sometimes called “molecularly targeted drugs,” “molecularly targeted therapies,” “precision medicines,” or similar names. Non-limiting examples of targeted therapies include hormone therapies, signal transduction inhibitors, gene expression modulators, apoptosis inducers, angiogenesis inhibitors, immunotherapies, toxin delivery molecules, and the like. In particular embodiments, the targeted therapy may be a poly ADP ribose polymerase (PARP) inhibitor (e.g., niraparib). PARP (e.g., PARP-1 and / or PARP-2) inhibitors are well known in the art (e.g., Olaparib, ABT-888, BSI-201 , BGP-15, INO-1001 , PJ34, 3-aminobenzamide, 4-amino-1 ,8- naphthalimide, 6(5H)-phenanthridinone, benzamide, NLI1025).(g) Oncolytic virus

[0180] In some embodiments, one or more cancer therapies comprise an oncolytic virus. An oncolytic virus is a virus that preferentially infects and kills cancer cells. As the infected cancer cells are destroyed by oncolysis, they release new infectious virus particles or virions to help destroy the remaining tumor. Oncolytic viruses are thought not only to cause direct destruction of the tumor cells, but also to stimulate host anti-tumor immune responses for long-term immunotherapy.(h) Polysaccharides

[0181] In some embodiments, one or more cancer therapies comprise polysaccharides. Certain compounds found in mushrooms, primarily polysaccharides, can up-regulate the immune system and may have anti-cancer properties. For example, beta-glucans such as lentinan have been shown in laboratory studies to stimulate macrophage, NK cells, T cells and immune system cytokines and have been investigated in clinical trials as immunologic adjuvants.(i) Neoantigens

[0182] In some embodiments, one or more cancer therapies comprise neoantigen administration. Many tumors express mutations. These mutations potentially create new targetable antigens (neoantigens) for use in T cell immunotherapy. The presence of CD8+ T cells in cancer lesions, as identified using RNA sequencing data, is higher in tumors with a high mutational burden. The level of transcripts associated with cytolytic activity of natural killer cells and T cells positively correlates with mutational load in many human tumors.(j) Surgery

[0183] In some aspects, the one or more cancer therapy may comprise surgery. Approximately 60% of persons with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative, and palliative surgery. Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and / or destroyed and may be used in conjunction with other therapies, such as the treatment of the present embodiments, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy, and / or alternative therapies. Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and microscopically-controlled surgery (Mohs’ surgery).

[0184] Upon excision of part or all of cancerous cells, tissue, or tumor, a cavity may be formed in the body. Treatment may be accomplished by perfusion, direct injection, or local application of the area with an additional anti-cancer therapy. Such treatment may be repeated, for example, every 1 , 2, 3, 4, 5, 6, or 7 days, or every 1 , 2, 3, 4, and 5 weeks or every 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , or 12 months. These treatments may be of varying dosages as well.

[0185] In certain embodiments, the duration and / or dose of treatment with cancer therapies may vary according to the particular anti-cancer agent or combination thereof. An appropriate treatment time for a particular cancer therapeutic agent will be appreciated by the skilled artisan. In some embodiments, the continued assessment of optimal treatment schedules for each cancer therapeutic agent is contemplated, where the genetic signature of the cancer of the subject as determined by the methods of the disclosure is a factor in determining optimal treatment doses and schedules.

[0186] In any of these aspects the cancer therapy (e.g., the first cancer therapy and / or the second cancer therapy) is administered orally, intraadiposally, intraarterially, intraarticularly, intracranially, intradermally, intralesionally, intramuscularly, intranasally, intraocularly, intrapericardially, intraperitoneally, intrapleurally, intraprostatically, intrarectally, intrathecally, intratracheally, intratumorally, intraumbilically, intravaginally, intravenously, intravesicularlly, intravitreally, liposomally, locally, mucosally, parenterally, rectally, subconjunctival, subcutaneously, sublingually, topically, transbuccally, transdermally, vaginally, in cremes, in lipid compositions, via a catheter, via a lavage, via continuous infusion, via infusion, via inhalation, via injection, via local delivery, or via localized perfusion. For instance, in certain aspects the cancer therapy (e.g., the first cancer therapy and / or the second cancer therapy) is administered via intraarterial administration, intramuscular administration, intraperitoneal administration, intratumoral administration, or intravenous administration.

[0187] In any of these aspects the STING agonist (e.g., the dual-acting STING agonist disclosed herein) is administered orally, intraadiposally, intraarterially, intraarticularly, intracranially, intradermally, intralesionally, intramuscularly, intranasally, intraocularly, intrapericardially, intraperitoneally, intrapleurally, intraprostatically, intrarectally, intrathecally, intratracheally, intratumorally, intraumbilically, intravaginally, intravenously, intravesicularlly, intravitreally, liposomally, locally, mucosally, parenterally, rectally, subconjunctival, subcutaneously, sublingually, topically, transbuccally, transdermally, vaginally, in cremes, in lipid compositions, via a catheter, via a lavage, via continuous infusion, via infusion, via inhalation, via injection, via local delivery, or via localized perfusion. For instance, in certain aspects the STING agonist (e.g., the dual-acting STING agonist disclosed herein) is administered via intraarterial administration, intramuscular administration, intraperitoneal administration, intratumoral administration, or intravenous administration.

[0188] Suitable tumors that may be targeted according to the methods herein can include any solid tumor. In some embodiments, a solid tumor can be an abnormal mass of tissue that is devoid of cysts or liquid regions within the tumor. In some embodiments, solid tumors can be benign (not progressed to a cancer), a malignant or metastatic tumor. In some embodiments, a solid tumor herein can be a malignant cancer that has metastasized. In other embodiments, solid tumors contemplated herein can include, but are not limited to, sarcomas, carcinomas, lymphomas, gliomas or a combinational thereof. In accordance with some embodiments herein, tumors resistant to platinum-based chemotherapy can include, but are not limited to, a testicular tumor, ovarian tumor, cervical tumor, a kidney tumor, bladder tumor, head-and- neck tumor, liver tumor, stomach tumor, lung tumor, endometrial tumor, esophageal tumor, breast tumor, cervical tumor, central nervous system tumor, germ cell tumor, prostate tumor, Hodgkin's lymphoma, non-Hodgkin's lymphoma, neuroblastoma, sarcoma, multiple myeloma, melanoma, mesothelioma, osteogenic sarcoma or a combination thereof. In some embodiments, a targeted tumor contemplated herein can include a solid tumor such as ovarian tumors, breast tumors, or any combination thereof. For instance, in some aspects, the tumor is a lung tumor, a breast tumor, a pancreatic tumor, a skin tumor, or any other solid tumor. In some aspects, the tumor is a non-small cell lung carcinoma, a triple negative breast cancer, a head or neck cancer, or a melanoma.

[0189] In certain embodiments, compositions disclosed herein can treat and / or prevent cancer in a subject in need. In some embodiments, compositions disclosed herein can impair tumor growth compared to tumor growth in an untreated subject with identical disease condition and predicted outcome. In some embodiments, tumor growth can be stopped following treatment with compositions disclosed herein. In other embodiments, tumor growth can be impaired at least about 5% or greater to at least about 100%, at least about 10% or greater to at least about 95% or greater, at least about 20% or greater to at least about 80% or greater, at least about 40% or greater to at least about 60% or greater compared to an untreated subject with identical disease condition and predicted outcome. In other words, tumors in subject treated using a composition of the disclosure have tumors that grow at least 5% less (or more as described above) when compared to an untreated subject with identical disease condition and predicted outcome. In some embodiments, tumor growth can be impaired at least about 5% or greater, at least about 10% or greater, at least about 15% or greater, at least about 20% or greater, at least about 25% or greater, at least about 30% or greater, at least about 35% or greater, at least about 40% or greater, at least about 45% or greater, at least about 50% or greater, at least about 55% or greater, at least about 60% or greater, at least about 65% or greater, at least about 70% or greater, at least about 75% or greater, at least about 80% or greater, at least about 85% or greater, at least about 90% orgreater, at least about 95% or greater, at least about 100% compared to an untreated subject with identical disease condition and predicted outcome. In some embodiments, tumor growth can be impaired at least about 5% or greater to at least about 10% or greater, at least about 10% or greater to at least about 15% or greater, at least about 15% or greater to at least about 20% or greater, at least about 20% or greater to at least about 25% or greater, at least about 25% or greater to at least about 30% or greater, at least about 30% or greater to at least about 35% or greater, at least about 35% or greater to at least about 40% or greater, at least about 40% or greater to at least about 45% or greater, at least about 45% or greater to at least about 50% or greater, at least about 50% or greater to at least about 55% or greater, at least about 55% or greater to at least about 60% or greater, at least about 60% or greater to at least about 65% or greater, at least about 65% or greater to at least about 70% or greater, at least about 70% or greater to at least about 75% or greater, at least about 75% or greater to at least about 80% or greater, at least about 80% or greater to at least about 85% or greater, at least about 85% or greater to at least about 90% or greater, at least about 90% or greater to at least about 95% or greater, at least about 95% or greater to at least about 100% compared to an untreated subject with identical disease condition and predicted outcome.

[0190] In some embodiments, treatment of tumors with compositions disclosed herein can result in a shrinking of a tumor in comparison to the starting size of the tumor. In some embodiments, tumor shrinking is at least about 5% or greater to at least about 10% or greater, at least about 10% or greater to at least about 15% or greater, at least about 15% or greater to at least about 20% or greater, at least about 20% or greater to at least about 25% or greater, at least about 25% or greater to at least about 30% or greater, at least about 30% or greater to at least about 35% or greater, at least about 35% or greater to at least about 40% or greater, at least about 40% or greater to at least about 45% or greater, at least about 45% or greater to at least about 50% or greater, at least about 50% or greater to at least about 55% or greater, at least about 55% or greater to at least about 60% or greater, at least about 60% or greater to at least about 65% or greater, at least about 65% or greater to at least about 70% or greater, at least about 70% or greater to at least about 75% or greater, at least about 75% or greater to at least about 80% or greater, at least about 80% or greater to at least about 85% or greater, at least about 85% or greater to at least about 90% or greater, at least about 90% or greater to at least about 95% or greater, at least about 95% or greater to at least about 100% (meaning that the tumor is completely gone after treatment) compared to the starting size of the tumor.

[0191] In certain embodiments, compositions disclosed herein can improve patient life expectancy compared to the cancer life expectancy of an untreated subject with identical disease condition and predicted outcome. As used herein, “patient life expectancy” is defined as the time at which 50 percent of subjects are alive and 50 percent have passed away. Insome embodiments, patient life expectancy can be indefinite following treatment with a composition disclosed herein. In other aspects, patient life expectancy can be increased at least about 5% or greater to at least about 100%, at least about 10% or greater to at least about 95% or greater, at least about 20% or greater to at least about 80% or greater, at least about 40% or greater to at least about 60% or greater compared to an untreated subject with identical disease condition and predicted outcome. In some embodiments, patient life expectancy can be increased at least about 5% or greater, at least about 10% or greater, at least about 15% or greater, at least about 20% or greater, at least about 25% or greater, at least about 30% or greater, at least about 35% or greater, at least about 40% or greater, at least about 45% or greater, at least about 50% or greater, at least about 55% or greater, at least about 60% or greater, at least about 65% or greater, at least about 70% or greater, at least about 75% or greater, at least about 80% or greater, at least about 85% or greater, at least about 90% or greater, at least about 95% or greater, at least about 100% compared to an untreated subject with identical disease condition and predicted outcome. In some embodiments, patient life expectancy can be increased at least about 5% or greater to at least about 10% or greater, at least about 10% or greater to at least about 15% or greater, at least about 15% or greater to at least about 20% or greater, at least about 20% or greater to at least about 25% or greater, at least about 25% or greater to at least about 30% or greater, at least about 30% or greater to at least about 35% or greater, at least about 35% or greater to at least about 40% or greater, at least about 40% or greater to at least about 45% or greater, at least about 45% or greater to at least about 50% or greater, at least about 50% or greater to at least about 55% or greater, at least about 55% or greater to at least about 60% or greater, at least about 60% or greater to at least about 65% or greater, at least about 65% or greater to at least about 70% or greater, at least about 70% or greater to at least about 75% or greater, at least about 75% or greater to at least about 80% or greater, at least about 80% or greater to at least about 85% or greater, at least about 85% or greater to at least about 90% or greater, at least about 90% or greater to at least about 95% or greater, at least about 95% or greater to at least about 100% compared to an untreated patient with identical disease condition and predicted outcome.

[0192] In some embodiments, the methods of the present disclosure increase anti-tumor activity (e.g., reduce cell proliferation, tumor growth, tumor volume, and / or tumor burden or load or reduce the number of metastatic lesions over time) by at least about 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, or more as compared to levels prior to treatment or in a control subject. In some embodiments, reduction is measured by comparing cell proliferation, tumor growth, and / or tumor volume in a subject before and after administration of the pharmaceutical composition. In some embodiments, the method oftreating or ameliorating a cancer in a subject allows one or more symptoms of the cancer to improve by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or more. In some embodiments, methods disclosed herein may include administration of the compositions herein to reduce tumor volume, size, load or burden in a subject to an undetectable size, or to less than about 1%, 2%, 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, or 90% of the subject's tumor volume, size, load or burden prior to treatment. In other embodiments, methods disclosed herein may include administration of the compositions herein to reduce the cell proliferation rate or tumor growth rate in a subject to an undetectable rate, or to less than about 1 %, 2%, 5%, 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, or 90% of the rate prior to treatment.

[0193] In some embodiments, a subject to be treated by any of the methods and / or compositions herein can present with one or more cancerous solid tumors, metastatic nodes, of a combination thereof. In some embodiments, a subject herein may have a cancerous tumor cell source that can be less than about 0.2 cm3 to at least about 20 cm3 or greater, at least about 2 cm3 to at least about 18 cm3 or greater, at least about 3 cm3 to at least about 15 cm3 or greater, at least about 4 cm3 to at least about 12 cm3 or greater, at least about 5 cm3 to at least about 10 cm3 or greater, or at least about 6 cm3 to at least about 8 cm3 or greater.

[0194] In certain embodiments, the compositions disclosed herein can be effective for treating at least one tumor cell in a solid tumor from a subject in need. In some embodiments, the amount of viable tumor cells may be reduced by at least about 5% or greater, at least about 10% or greater, at least about 15% or greater, at least about 20% or greater, at least about25% or greater, at least about 30% or greater, at least about 35% or greater, at least about40% or greater, at least about 45% or greater, at least about 50% or greater, at least about55% or greater, at least about 60% or greater, at least about 65% or greater, at least about70% or greater, at least about 75% or greater, at least about 80% or greater, at least about85% or greater, at least about 90% or greater, at least about 95% or greater, at least about100% compared to an untreated subject with identical disease condition and predicted outcome.

[0195] Conventional methods, known to those of ordinary skill in the art of medicine, can be used to administer the compositions disclosed herein to a subject, depending upon the type of disease to be treated or the site of the disease. In some embodiments, compositions herein can be administered to a subject by intravenous infusion, by subcutaneous administration, by inhalation, by intranasal administration or other mode of administration. In some embodiments, compositions herein can be administered to a subject via intra-tumoral injection.

[0196] In some embodiments, any of the methods disclosed herein can further include monitoring occurrence of one or more beneficial or adverse effects in the subject. Exemplary adverse effects include, but are not limited to, hepatic impairment, hematologic toxicity, neurologic toxicity, cutaneous toxicity, gastrointestinal toxicity, or a combination thereof. When one or more adverse effects are observed, the method disclosed herein can further include reducing or increasing the dose of the STING agonists disclosed herein (or other cancer therapy) depending on the adverse effect or effects in the subject. The present disclosure also advantageously provides for monitoring beneficial effects in the subject (i.e., determining prognosis of a given treatment) based on detected STING-induced cDC1 activation and signaling in the subject. According to these beneficial and surprising effects, earlier detection of cDC1 signaling can help guide treatment (e.g., determine whether the treatment should be continued or discontinued).

[0197] A suitable subject includes a human, a livestock animal, a companion animal, a lab animal, or a zoological animal. In one embodiment, the subject may be a rodent, e.g., a mouse, a rat, a guinea pig, etc. In another embodiment, the subject may be a livestock animal. Nonlimiting examples of suitable livestock animals may include pigs, cows, horses, goats, sheep, llamas and alpacas. In yet another embodiment, the subject may be a companion animal. Non-limiting examples of companion animals may include pets such as dogs, cats, rabbits, and birds. In yet another embodiment, the subject may be a zoological animal. As used herein, a “zoological animal” refers to an animal that may be found in a zoo. Such animals may include non-human primates, large cats, wolves, and bears. In a specific embodiment, the animal is a laboratory animal. Non-limiting examples of a laboratory animal may include rodents, canines, felines, and non-human primates. In certain embodiments, the animal is a rodent. Non-limiting examples of rodents may include mice, rats, guinea pigs, etc. In preferred embodiments, the subject is a human.IV. Kits

[0198] The present disclosure provides kits for use in treating a tumor. Such kits can include one or more containers including one or more disclosed active agents (e.g., a PolySTI NG composition). In some embodiments, kits can include one or more containers including one or more one or more disclosed active agents (e.g., PEG-6- P(MAC-SC7A) (PSC7A) and cGAMP).

[0199] In some embodiments, the kits herein can include instructions for use in accordance with any of the methods described herein. The included instructions can have a description of administration of the one or more disclosed active agents to treat, delay the onset, or alleviate a target disease as those described herein, or a combination thereof. In some embodiments,the kit can further include a description of selecting an individual suitable for treatment based on identifying whether that individual has the target disease, e.g., applying a diagnostic method as described herein. In still other embodiments, the instructions can have a description of administering any one of the compositions described herein to an individual at risk of the target disease.

[0200] In some embodiments, kit instructions relating to the use of one or more disclosed active agents can generally include information as to dosage, dosing schedule, and route of administration for the intended treatment. The containers can be unit doses, bulk packages (e.g., multi-dose packages) or sub-unit doses. Instructions supplied in the kits of the disclosure are typically written instructions on a label or package insert (e.g., a paper sheet included in the kit), but machine-readable instructions (e.g., instructions carried on a magnetic or optical storage disk) are also acceptable.

[0201] The label or package insert indicates that the composition is used for treating, delaying the onset and / or alleviating the disease and / or symptom thereof (e.g., cancer). In some embodiments, instructions are provided for practicing any of the methods described herein.

[0202] The kits of this disclosure are in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. Also contemplated are packages for use in combination with a specific device, such as an inhaler, nasal administration device (e.g., an atomizer) or an infusion device such as a minipump. In some embodiments, a kit has a sterile access port (for example the container can be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). In some embodiments, the container also has a sterile access port (for example the container is an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).

[0203] In some embodiments, kits herein can optionally provide additional components such as buffers and interpretive information. Normally, the kit comprises a container and a label or package insert(s) on or associated with the container. In some embodiments, the disclosure provides articles of manufacture comprising contents of the kits described above.*******

[0204] Having described several embodiments, it will be recognized by those skilled in the art that various modifications, alternative constructions, and equivalents may be used without departing from the spirit of the present disclosure. Additionally, a number of well-known processes and elements have not been described in order to avoid unnecessarily obscuring the present disclosure. Accordingly, this description should not be taken as limiting the scope of the present disclosure.

[0205] Those skilled in the art will appreciate that the presently disclosed embodiments teach by way of example and not by limitation. Therefore, the matter contained in this description or shown in the accompanying drawings should be interpreted as illustrative and not in a limiting sense. The following claims are intended to cover all generic and specific features described herein, as well as all statements of the scope of the method and assemblies, which, as a matter of language, might be said to fall there between.EXAMPLES

[0206] The following examples are included to demonstrate preferred embodiments of the disclosure. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventor to function well in the practice of the present disclosure, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the present disclosure.Summary of Examples

[0207] The following Examples describe data and experiments aimed at two goals: (A) Developing a PolySTI NG nanoparticle with dual STING activation and without T cell tropism and (B) identifying an immune cell subset that drives antitumor immunity.

[0208] Regarding Aim (A) - The PolySTING nanoparticle was tested. This particle, described in more detail in the Examples below is formed as shown in FIG. 18, where a STING agonist (cGAMP) is enclosed through self-assembly inside a PSC7A polymer nanoparticle. The PSC7A polymer was chosen, as described further below, because it has been shown to have potent and sustained activation of STING over cGAMP (FIG. 19) (see Li Luo et al. Nature Bomed. Engineering 2021 which is incorporated by reference herein in its entirety). Surprisingly, this PolySTING nanoparticle displayed myeloid but not T cell tropism (FIG. 20). It also has improved efficacy at inhibiting tumor growth compared to a comparable STING agonist, Adu-S100 (FIG. 21).

[0209] Regarding Aim (B) - it was found that STING status in the host but not cancer cells was important (FIG. 22), but that blocking macrophages, B cells, and NK cells does not impact PolySTING efficacy (FIG. 23). Therefore, whether dendritic cells were responsible for STING- mediated antitumor immunity was tested. Surprisingly, blocking three types of DC cells (moDC, pDC, and cDC2) all did not affect PolySTING efficacy (FIG. 24). Rather, it was found that direct STING-IFN-I signaling within cDC1 is important for PolySTING efficacy (FIG. 25). In support of this, STING activation actually was found to boost cDC1 priming (FIG. 26).PolySTI NG was also found to drive a chemokine signature (FIG. 27) which was ultimately shown to be associated with better survival in patients treated with different cancer therapies (FIG. 28).

[0210] In summary, it was found that STING licensing of conventional type 1 dendritic cells (cDC1s) is essential to achieving antitumor immunity. In fact, direct STING signaling within cDC1 is sufficient for antitumor response. Regarding Aim A, it was found that nanoparticle STING agonist (PolySTING) shows therapeutic benefit over small molecule CDN (Adu-S100). Regarding Aim B, it was found that a unique chemokine signature (CCL4 / 5, CXCL9 / 10) may serve as an early biomarker to predict response to chemotherapies or immunotherapies.Example 1- Materials and Methods

[0211] _Study design: The primary objective of this study was to use a “shock-and-lock” STING-activating nanoparticle (PolySTING) as a tool to uncover new biological insights on cell context dependence of STING-mediated antitumor immunity. Conventional small molecule agonists (cGAMP or ADU-S100) were used as a treatment of reference. The tumor growth and animal survival of different tumor-bearing mice were monitored. Mice of specific gene knockout or conditional knockout were genotyped, while mice of specific immune cell blockade were confirmed via flow cytometry before each experiment. Through loss (XCR1creSTINGfl / fl)- and gain (cDC1 adoptive transfer)-of-function studies, we demonstrated direct STING signaling in cDC1 is both necessary and sufficient for the rejection of multiple established and metastatic murine tumors. The immune orchestration of cDC1 and CD8+ T cells in tumors / tDLNs by different treatments was carefully characterized and the chemokine / cytokine profiles of tumors were quantified in wildtype and cDC1 -deficient mice. We further collected tumor tissues from non-small cell lung cancer patients who have received NAC or NAPC treatment, and performed mIHC staining to evaluate the clinical value of STING-activating cDC1 signature. Sample size was determined via a priori power analysis based on means and SEMs estimated from pilot experiments or the literature. The number of samples combined and the number of independent experiments are included in the figure legends.

[0212] Patient participants and ethical approvals: A total of 58 non-small cell lung cancer (NSCLC) patients who received two cycles of neoadjuvant chemotherapy (NAC, 30 cases) or neoadjuvant pembrolizumab chemotherapy (NAPC, 28 cases) prior to surgical resection were included in this study. The squamous cell carcinoma patients received neoadjuvant paclitaxel 175 mg / m2 plus carboplatin (area under curve 5; 5 mg / mL per min) and the adenocarcinoma patients received pemetrexed 500 mg / m2 plus carboplatin, with or without intravenous pembrolizumab 200 mg on day 1 , 21 days each cycle, for two cycles before surgical resection,and then followed by two cycles after surgical resection. Clinicopathological parameters included age, gender, smoking index, clinical tumor node metastasis (TNM) stage, pathological type. Progression-free survival (PFS) was defined as the time from the date of surgery to the date of recurrence or last follow-up. Overall survival (OS) was defined as time from the date of surgery to the date of any caused death or last follow-up. The last follow-up was conducted on October 10, 2022, with a median follow-up time of 97 and 35 months for NAC and NAPC patients, respectively. The study was approved by the Ethics Committee of Tianjin Cancer Institute & Hospital (protocol number: bc2020060). All patients enrolled in the study provided written informed consent.

[0213] Cell lines and culture: Tmeml S’7- MC38 cells were generated by knocking out Tmem173 genes by CRISPR / Cas9 technology following a published procedure (38). he guide sequence 5 -CACCTAGCCTCGCACGAACT-3' (SEQ ID NO: 9) for Tmem173 was cloned into px458 plasmids (non-integrating plasmid with green fluorescent protein-selecting marker) and then was transiently transfected into tumor cells using Lipofectamine 2000 (Thermo Fisher Scientific). LLC2 cells were kindly provided by Zhijian ‘James’ Chen, UT Southwestern Medical Center. TC-1 cells were kindly provided by T. C. Wu, Johns Hopkins University. 4T1 -luciferase cells were kindly provided by S. Huang, Massey Cancer Center, Virginia Commonwealth University. MC38, MC38-OVA, and BI6F10 cells were purchased from ATCC (Manassas, VA). All the cells were cultured in complete DMEM medium (Gibco-BRL Life Technologies, Canada) supplemented with 10% fetal bovine serum (FBS) (HyClone, USA), 100 U / ml penicillin, and 100 mg / ml streptomycin (Gibco-BRL Life Technologies, Canada). THP1-ISG cells from ATCC were cultured in RPMI medium supplemented with 10% FBS and 0.05 mM P-mercaptoethanol (P-ME). All cells were grown at 37 °C in a humid atmosphere with 5% CO2. Bone marrow cells were filtered through a 70 pm strainer and treated with Red Blood Cell Lysis Buffer (Sigma). Single-cell suspensions of bone marrow cells were cultured in RPMI- 1640 medium containing 10% FBS, supplemented with 20 ng / ml GM-CSF and 10 ng / ml IL-4 for BMDC, or 20 ng / ml M-CSF for BMDM (Peprotech). The medium was half replenished every 2 days. Cell lines were routinely monitored for mycoplasma contamination. All cells used in this study tested negative for mycoplasma contamination.

[0214] Mice: XCR1creand STINGfl / flmice were purchased from the Jackson Laboratory. The STING™ mice were first crossed with XCR1cremice to generate F1 mice. Then the Fl mice were inbred to generate the cre+ mice with homozygous STING™. The insertion of ere and flox elements were confirmed by PCR per Jackson Laboratory’s protocol with the following primers: XCR1 : (forward) TCAAGTTCCGCAGACACCTA (SEQ ID NO: 10), (reverse) GTGCACGAAGTGTTGCTTTG (SEQ ID NO: 11), and (reverse)ACCGTCGACCCCATAGTCAT (SEQ ID NO: 12); and STING: (forward)TTTTCATCTGCCTTCCAGGT (SEQ ID NO: 13) and (reverse)GCGCACACACACTAAAAACTG (SEQ ID NO: 14). Tmeml73-Z- mice, IfnafBR7- mice, Ccr2’z- mice, Batf3'z' mice, lrf4 / _mice, Ccr7_ / _mice were purchased from the Jackson Laboratory. C57BL / 6 wild-type (WT) mice, BALB / c mice were purchased from Charles River Laboratories. All the mice were maintained under specific pathogen-free conditions and housed in a barrier facility under a 12 h — 12 h light — dark cycle and maintained on standard chow (2916, Teklad Global). The temperature range for the housing room is 68 — 79 °F (average is around 72 °F) and the humidity range is 30 — 50% (average is around 50%). The experimental groups included randomly chosen female littermates of ages around 8 weeks and the same strain. All experiments were performed in accordance with the procedures approved by the AAALAC- accredited Institutional Animal Care and Use Committee at UT Southwestern Medical Center and were compliant with all relevant ethical guidelines.

[0215] Preparation of PolySTING nanoparticles: PEO-b-P(MAC-SC7A«HC1) (PSC7A) copolymer was synthesized following a previously published procedure (39). cGAMP-PSC7A nanoparticles (PolySTING) were prepared by mixing 25 mL 2’3’-cGAMP (2 mg / mL) in 1 mL PSC7A polymer solution (1 mg / mL) containing 5% D-glucose at pH 5, and then adjusted to pH 7 using NaOH (1 M) to induce micelle assembly with cGAMP loading. After micelle formation, the nanoparticles were characterized using dynamic light scattering (Zeta Sizer, Malvern, He-Ne laser, A = 633 nm) to measure the hydrodynamic size, size distribution and zeta potential. Transmission electron microscopy was used to analyze particle morphology. The cGAMP loading efficiency (>90%) was quantified via high-performance liquid chromatography (1260 Infinity II, Agilent).

[0216] Microscopic imaging of cell uptake of PolySTING. BMDCs and BMDMs were grown in a four-well glass chamber and treated with fluorescently labelled PolySTING (cGAMP- fluorescein encapsuled in Cy5-labeled PSC7A) for the indicated time. Cells were fixed in 4% paraformaldehyde, then stained for CD1 lc (Alexa Fluor 594 anti-mouse CD11c antibody, clone: N418, BioLegend), or CD1 lb (Alexa Fluor 594 anti-mouse CD1 lb antibody, clone: M1 / 70, BioLegend) using an immunofluorescence kit (Cell Signaling Technologies). Samples were stained with DAPI (Thermo Fisher Scientific) and imaged using the built-in software (ZEN 2.6) of the Zeiss 700 confocal laser scanning microscope with a 63* oil-immersion objective. Imaged v.1.52d was used to quantify colocalization using the Pearson’s correlation coefficient. Data are representative of at least 20 cells.

[0217] Tumor growth and treatments. For subcutaneous tumor xenografts, C57BL / 6 mice were inoculated with 1 xio6MC38 colon carcinoma cells, 1 xio6LLC2 lung cancer cells, 1.5X105TC-1 tumor cells, or 1.5x105BI6F10 melanoma cells on the right flank on day 0. The metastatic breast cancer model in Balb / c mice was constructed by mammary fat pad injectionof lx1064T1 -luciferase cancer cells. MC38 tumor-bearing C57BL / 6 mice were treated by intratumoral injection of PolySTING (50 g cGAMP in 1 mg PSC7A with a final volume of 1 mL, 50 pL per mice) on day 11 , 14 and 17. BI6F10 tumor-bearing mice were treated on day 8, 11 and 14. TC-1 tumor-bearing mice were treated on day 7, 10 and 13. LLC2 tumor bearing mice were treated on day 5, 8 and 11.4T1 tumor-bearing mice were treated with PolySTING on day 8, 11 and 14. Meanwhile, anti-PD-1 (200 pg) was intraperitoneally injected one day before PolySTING and was given 3 times. Mice were monitored for tumor growth. Tumor volumes were measured with a caliper by the length (L), width (W) and calculated as V = LxWxW / 2. For distal tumor model, C57BL / 6 mice were subcutaneously injected with 1x106MC38 cells or 2x105BI6F10 cells on the primary site, followed by subcutaneous injection of 1x106MC38 cells on day 4 or 2x105BI6F10 cells on day 6 on the contralateral sites. Mice were intratumorally injected with PolySTING on day 10, 13 and 16. Anti-PD-1 was given one day before PolySTING. Mice were monitored for tumor growth on both primary and distal sites. For MC38 rechallenge study, the tumors of C57BL / 6 wildtype mice were removed by surgical resection on day 30 and then mice were injected with 1x106MC38 cells on distal site on day 45. Meanwhile, C57BL / 6 naive mice were injected with MC38 cells on day 45. Cured mice from PolySTING treatment were rechallenged with the same amount of MC38 cells on primary site and distal site. Mice were monitored for tumor growth.

[0218] In vivo immune cell depletion experiments. For the NK cell depletion assay, mice were i.p. injected with anti-NK1.1 antibody (500 pg, clone PK136, BioXcell) on day 3 after tumor inoculation and then were maintained with 250 pg of anti-NK1.1 antibody every 3 days to deplete NK cells. For CD8+ or CD4+ T cell depletion, mice were treated with anti-CD8a antibody (200 pg, clone YTS169.4, BioXcell) or anti-CD4 antibody (200 p,g, clone GK1.5, BioXcell) by i.p. injection on day 3 after tumor inoculation and then were maintained with same dosage of antibodies every 3 days. For B cell depletion, mice were i.p. treated with a cocktail of antibodies (40), including CD19 (clone 1 D3, BioXcell), B220 (clone RA3.3A1 / 6.1 , BioXcell), and CD22 (clone CY34.1 ; BioXcell) weekly, each at 150 mg per mouse. After 48 h, the mice were injected with a secondary antibody (mouse anti-rat Kappa light chain, clone MAR 18.5, BioXcell) at 150 mg. In addition, mice were injected at 250 mg weekly for 4 weeks. For macrophage depletion, mice were treated with 500 pg of anti-CD115 antibody (clone AFS98, BioXcell) every 3 days. Plasmacytoid dendritic cells (pDC) depletion in C57BL / 6 mice was achieved by i.p. injection of mice with 200 pL of anti-PDCA1 antibody (clone 927, BioXcell) at 2 mg / mL.

[0219] Adoptive transfer of dendritic cells. BMDCs were generated by culturing bone marrow cells flushed from the femurs of C57BL / 6 naive mice, STING knockout mice, or STINGs365A mutant mice. The RPMI 1640 medium supplemented with 10% FBS, Pen / Strep, sodiumpyruvate, 20 ng / mL GM-CSF, 10 ng / mL IL-4 and 200 ng / mL Flit-3L was prepared for culturing BMDCs. Non-adherent and loosely adherent immature DCs were collected on day 6 and induction efficacy of BMDCs was detected by determining the expression of CD11c (routinely 70% — 80% CD11c+). CD103+ cDC1 and CD8a+ cDC1 were sorted by flow cytometry (41) and then mixed as total cDC1. Then 5x105cDC1s were subcutaneously injected into MC38 tumor-bearing Batf3'7' mice by the tumor one day before PolySTI NG treatment. Mice were monitored for tumor growth.

[0220] Flow cytometry. Tumor tissue or tumor-draining lymph nodes (tDLN) were harvested from mice with indicated treatment and minced using surgical scissors. Tissues were then digested using 160 pg / mL collagenase IV (Sigma — Aldrich) and 20 pg / mL DNase I (Sigma — Aldrich) in RPMI 1640 media at 37 °C for 30 minutes and then washed and strained through a 70 pm filter (BD Falcon). LIVE / DEAD™ Fixable Aqua Dead Cell Stain Kit (Invitrogen™, L34966), PerCP anti-mouse CD45 (clone 30-F11 , BD), Brilliant Violet 650 anti-mouse Ly-6C Antibody (clone HK1.4, BioLegend), Brilliant Violet 421 anti-Mouse CD11 b (clone M1 / 70, BD), Brilliant Violet 786 anti-mouse CD11c (clone HL3, BD), PE / Cyanine7 anti-mouse l-A / l-E (clone M5 / 114.15.2, BioLegend), BV605 anti-mouse CD103 (clone M290, BD), Alexa Fluor 700 antimouse CD8a (clone 53-6.7, BioLegend), APC anti-mouse CD86 (clone GL-1 , BioLegend), PE / Cyanine 7 anti-mouse CD80 (clone 16-10A1 , BioLegend), PE anti-mouse XCR1 (clone ZET, BioLegend), PE anti-mouse CLEC9A (clone 7H11 , BioLegend), PE / Cyanine 7 antimouse CCR7 (clone 4B12, BioLegend), Brilliant Violet 786 anti-mouse CD3e (clone 145- 2C11 , BD), Alexa Fluor 700 anti-mouse CD8 (clone 53-6.7, BioLegend), Brilliant Violet 605 anti-mouse CD4 (clone RM4-5, BioLegend), APC anti-mouse IFN-y (clone XMG1.2, BioLegend), FITC anti-mouse Granzyme B (clone GB11 , BioLegend), PE anti-mouse H-2Kb bound to SIINFEKL (SEQ ID NO: 1) (clone 25-D1.16, BioLegend) APC anti-mouse T-Select H-2Kb MuLV p15E Tetra mer-KSPWFTTL (SEQ ID NO: 8) (code TB-M507-2, MBL) were used for flow cytometry analyses. Cell suspensions were incubated with Fc Block TruStain FcX Clone 93 (BioLegend) in PBS containing 0.5% bovine serum albumin and 2 mM EDTA before staining with fluorochrome labeled antibodies, followed by staining with live / dead dyes and selective antibodies of cell surface markers. Intracellular markers, including IFN-y and granzyme B, were stained after cell fixation and permeabilization with True-NuclearTm transcription factor buffer set per protocol (BioLegend). Data were collected on BD LSR Fortessa or Beckman CytoFLEX flow cytometer and analyzed by FlowJo (Tree Star Inc., Ashland, OR) software. All gating strategies were shown in FIG. 17A-17B.

[0221] Tetramer CD8+ T cell assay. C57BL / 6 wildtype mice as well as different types of genetic knockout mice (Batf3'7', Tmem173'7', Ifna R'7', STINGs365A, Irf4'7were subcutaneously inoculated with lx106MC38 cancer cells on the right flank on day 0. Mice werethen treated with PolySTI NG when the tumor volume reached 150-200 mm3. Tumor draining lymph nodes from these mice were made into single cell suspensions the second day after three times of PolySTING treatment. The ratio of tetramer+ CD8+ T cells with or without PolySTING treatment from mice were analyzed by flow cytometry.

[0222] Multiplex cytokine and chemokine analysis. Fresh MC38 tumor tissue from wildtype or Batf3_ / _C57BL / 6 mice with and without PolySTING treatment were analyzed for levels of cytokine / chemokine expressions by choosing mouse cytokine / chemokine 44-plex discovery assay array (MD44). Tumor tissue homogenate preparation was performed according to the manufacturer’s instructions (Eve Technologies).

[0223] Tissue isolation and quantitative PCR analysis. Fresh MC38 tumor tissues were homogenized by using Precellys Evolution machine (Bertin). Total RNAs were extracted from tumor tissues using the RNeasy mini kit (Qiagen). RNA quantity and quality was then confirmed using the NanoDrop (DeNovix DS-11) system. Genomic DNA was removed and cDNA was synthesized using an iScript gDNA clear cDNA synthesis kit (Bio-Rad). Bio-Rad SsoAdvanced universal SYBR green supermix and CFX connect real-time system were used for PCR analysis. Results were corrected by GAPDH and plotted in GraphPad Prism version 9.0. The DNA primers used were as follows: mouse Cc14: AGCCAGCTGTGGTATTCCTG (SEQ ID NO: 2), AGGGGCAGGAAATCTGAACG (SEQ ID NO: 3); mouse Cc15: CTCACCATATGGCTCGGACA (SEQ ID NO: 4), CTTCTCTGGGTTGGCACACA (SEQ ID NO: 5); mouse CxcH : CTTTCCTGGGAGTCTGCTGC (SEQ ID NO: 6), CAGCCGCTGGGTTTGTAAGT (SEQ ID NO: 7).

[0224] Dendritic cell chemotaxis assay. Chemotaxis of cDC1s was analyzed by using transwell migration assays. BMDCs (1x106cells) were dispersed in RPMI medium with 1 % BSA and seeded into 5 pm pore size transwell inserts (Corning) of a 24-well tissue culture plate containing 500 ml RPMI / BSA medium with CCL4 (R&D) and CCL5 (R&D) at a final concentration of 150 ng / mL. After incubation for 3 h, migrated CD103+ cDC1 or CD8a+ cDC1 cells in the lower compartment were collected and quantified by flow cytometry. Migration was calculated as fold change between CCL4 / 5-treated group over the control group.

[0225] Bioinformatic analysis of cancer patient data. RNA-seq by expectation-maximization (RSEM)-normalized expression datasets from The Cancer Genome Atlas (TCGA) were used. Hierarchical clustering of expression data was plotted as heatmaps using the ‘gplots’ package (version 3.0.1), where red indicates higher and blue indicates lower expressions relative to the mean expression per gene. For generation of gene expression signatures, normalized expression values were Iog2-transformed and ranked by the mean expression value of signature genes. The following gene signatures were used: STING expression (Tmem173),PolySTI NG-activated chemokines (CCL4, CCL5, CXCL9, CXCL10), cDC1 (CLEC9A, XCR1 , CLNK, BATF3). Overall survival analyses were performed for the top and bottom quartile expression ranked values for selected genes or the ranked sum expression of gene signature and plotted for Kaplan-Meier curves using GraphPad Prism version 9.0.

[0226] Multiplex immunohistochemistry and multispectral analysis. Formalin-fixed and paraffin-embedded (FFPE) tumor tissues from patients post-NAC or -NAPC were collected for multiplex immunohistochemistry (mIHC) staining. mIHC staining was performed using a PerkinElmer Polaris 7-color Technology Kit according to the manufacturer’s instructions. Spectra Systems was used to scan and photograph multispectral images at 20* magnification with the same exposure times with 10 randomly fields in each stained slides selected. The multispectral images were split and segmented using InForm image analysis software. Individual cells were identified with a nuclear segmentation algorithm using DAPI staining, together with a cellular mask around each nucleus to quantitate surface marker expression for each cell.

[0227] Statistical analysis. Statistical analysis was performed using Microsoft Excel and Graphpad Prism Version 9.0. Values reported in figures are expressed as the standard error of the mean, unless otherwise indicated. For normally distributed datasets, we used 2-tailed Student’s t test and two-way ANOVA followed by Bonferroni’s multiple comparison test. For survival analysis, p values were calculated using the Log Rank test, p values > 0.05 were considered not significant (ns), p values < 0.05 were considered significant. * p value < 0.05, ** p value < 0.01 , *** p value < 0.001 , **** p value < 0.0001 .Example 1 - PolySTING is a potent STING agonist against hot and cold tumors

[0228] We produced PolySTING nanoparticles by encapsulating cGAMP in a micelle nanoparticle self-assembled from a STING-activating polymer, polyethylene oxide-b-PSC7A (PSC7A, Fig. 1A and Fig. 8A). Previous work shows canonical STING activation by cGAMP alone led to rapid STING activation in 6 hours followed by degradation in lysosomes and loss of interferon expression after 12 hours, whereas polymer-induced STING condensation and activation prolonged the expression of type I interferons over 48 hours (10). After cGAMP loading in PSC7A micelles, dynamic light scattering analysis shows a diameter of 25±3 nm, and transmission electron microscopy displays a spherical morphology (Fig. 8A). After incubation in ISG-THP1 cells over 24 hours, PolySTING produced robust IFN-f3 expression (>250-fold over saline control) compared to cGAMP (3-fold) or PSC7A NP (12-fold) groups (Fig. 1 B). Time-dependent cytokine analysis illustrates a shock-and-lock mode of STING activation by PolySTING compared with a transient response by cGAMP (Fig. 8B).

[0229] We used Cy5-labeled PolySTI NG to quantify the nanoparticle biodistribution after intratumoral administration in MC38 colon carcinoma. Abundant accumulation of PolySTI NG was found in the tumor and tumor-draining lymph nodes (tDLN) at 24 hours over other organs (Fig. 10). Flow cytometry analysis shows significantly higher cell uptake in the immune cells (CD45±) over cancer cells (CD45-) in MC38 tumors (Fig. 1 D). Further examination of subsets of immune cell populations displayed significant tropism toward the dendritic cells, macrophages, and natural killer cells over T cells in the tumor microenvironment and tumordraining lymph nodes. In contrast, fluorescein isothiocyanate (FITC)-labeled cGAMP did not show marked cell tropism across immune cell populations in tumor tissues, and only negligible cGAMP signal (<1 %) was found in tDLNs (Fig. 80). In vitro studies show bone marrow-derived dendritic cells (BMDCs) or macrophages (BMDMs) readily endocytose PolySTING with increased cGAMP uptake over free cGAMP (Fig. 8D to 8F). Intratumoral injection of small molecule STING agonists (e.g., Adu-S100) have been reported to cause T cell apoptosis and loss of T cell memory at high doses (11). For this purpose, we evaluated the effect of PolySTING (50 pg) versus Adu-S100 (50 pg) on T cell viability and tumor growth inhibition. Data show significantly increased apoptosis in CD8+ T cells 24 hours after one injection of Adu-S100 compared to PolySTING (Fig. 1 E and Fig. 8G). Furthermore, MC38 tumors regress after initial treatment by Adu-S100 followed by relapse, whereas PolySTING treatment led to complete tumor eradication (Fig. 1 F). Additional dose-response studies show that PolySTING achieved a much broader therapeutic window from 20 to 100 pg for tumor eradication, whereas Adu-S100 had the optimal antitumor effect at 20 pg (two of the five mice were tumor free) (Fig. 8H and 8I) These data show PolySTING is more potent than cGAMP or Adu-S100 for treatment of immunogenic tumor.

[0230] PolySTING displays broad antitumor efficacy with prolonged survival compared with free cGAMP or glucose controls in immunogenic (e.g., MC38, human papilloma virus E6 / E7- transfected TC-1 tumor, Fig. 2A and 2B, and Fig. 9A and 9B) and immune-cold murine tumors (e.g., BI6F10 melanoma, Lewis lung LLC2 carcinoma, Fig. 2C and 2D, and Fig. 90 and 9D). To further explore if local treatment can generate sufficient T cells against metastasis, we selected triple negative 4T1 orthotopic mammary carcinoma that will have spontaneous lung metastasis starting on second week after inoculation. PolySTING monotherapy on day 11 not only inhibited the primary tumor growth, but also generated systemic immunity against the formation of metastatic 4T1 foci in the lung (Fig. 2E and Fig. 9E). Impressively, PolySTING treatment is more potent than anti-PD-1 treatment for reducing metastasis. In the MC38 and BI6F10 distal tumor models, PolySTING also drives growth inhibition in distal tumors after injection in the primary tumors (Fig. 2F, and Fig. 10A and 10B). Furthermore, combination of PolySTING with anti-PD-1 exhibited therapeutic synergy in MC38 distal tumors. Mice curedby PolySTI NG displayed long-term T cell memory as shown by the MC38 rechallenging experiment at both the healed primary tumor location and the contralateral site (Fig. 2G and Fig. 10C). Therefore, local treatment of PolySTING generates potent systemic immunity at distal and metastatic sites with long-term memory effect.Example 2 - Host STING-IFN-I signaling is important for PolySTING-mediated antitumor efficacy

[0231] We investigated the role of STING in the host versus MC38 cancer cells in antitumor immunity. We compared the tumor growth inhibition using STING wildtype MC38 cancer cells in host Tmem173’z- (STING knockout) mice, and Tmem173’z- MC38 cells in STING wildtype mice. PolySTING-mediated tumor eradiation was abolished in host Tmem173’z- animals with MC38 tumors but was retained in Tmem173-z- MC38 tumors with wildtype mice (Fig. 3A to 3D). The predominant role of host STING in immune protection is also reported in an E0771 tumor model after ionizing radiation (12). Without PolySTING treatment, faster MC38 tumor growth was observed in Tmem173-Z- mice than wildtype mice, suggesting the presiding role of endogenous STING signaling in immune protection against immunogenic MC38 tumors. STING-mediated type I interferon (IFN-I), nuclear factor KB (NF-KB), and / or autophagy signaling are proposed to contribute to host defense against cancer or viral infection (7, 13- 15). We evaluated the efficacy of PolySTING in mice deficient of the interferon-a / p receptor (Ifna / pR'7'), and a STING mutant mouse (STINGS365A) that blocks IRF3 binding and IFN-I production but not NF-KB activation or autophagy induction (15). Neither animal models exhibited antitumor efficacy upon PolySTING treatment over the wildtype mice (Fig. 3E and 3F). Collectively, these data indicate that the host STING-IFN-I signaling is essential in PolySTING-mediated immunity against MC38 tumors.Example 3 - Identification of cDC1 for STING-mediated tumor rejection

[0232] To determine which immune cell subsets are important for PolySTING-mediated effect, we use antibody depletion or mice with deficiency in different subset of antigen presenting cells. MC38 tumor growth inhibition was evaluated by antibody blockade of B cells (a mixture of anti-CD19 / CD22 / B220), macrophages (anti-CSF1 R), and in transgenic mice with depletion of different DC subtypes, including monocyte-derived DC (MoDC, Ccr2_ / (16), plasmacytoid DC (pDC, anti-CD317) (17), cDC1 (Batf3-Z-) (18), and cDC2 (Irf4-Z) (19). Depletions of B cells, macrophages, MoDCs, pDCs, and cDC2s did not exhibit a clear difference in antitumor efficacy over control mice after PolySTING treatment (Fig. 3G to 3K). In contrast, mice with cDC1 deficiency (Batf3’z’) abolished the antitumor efficacy by PolySTING (Fig. 3L). cGAMP is a widely used STI NG agonist for cancer therapy. Although free cGAM P did not display obvious cell tropism (Fig 8C), it still required cDC1 to induce antitumor immunity, because cGAMP-induced tumor growth inhibition is also abrogated in Batf3'7' mice (Fig. 11 A). Compared to free cGAMP, PolySTING has a stronger therapeutic effect in wildtype mice, likely due to the higher and more persistent STING signaling (Fig. 1 B and Fig. 8B) and increased uptake in myeloid cells (Fig. 8E and 8F).

[0233] To further determine whether the therapeutic contribution of cDC1 is dependent on endogenous STING activation or secondary to the IFN-I produced by neighboring cells, we constructed and investigated mice with conditional knockout of STING in cDC1 (XCR1creSTINGfl / fl, Fig. 11 B) and monitored tumor growth after PolySTING treatment (Fig. 4A and Fig. 11C). Tumor growth inhibition of MC38 tumors by PolySTING was abrogated in XCR1creSTINGfl / flmice, indicating STING signaling within cDC1s is required for the antitumor immunity.

[0234] Next, we performed cell transfer studies in Batf3_ / - mice to evaluate the sufficiency of cDC1 in STING-mediated antitumor efficacy. BMDCs were treated with GM-CSF, IL-4 and Flt3-L, and cDC1s were isolated and enriched through flow sorting (Fig. 4B). The combined CD8a+ and CD103+ cDC1s were subcutaneously injected adjacent to the MC38 tumors 12 hours prior to PolySTING treatment. Notably, adoptive transfer of cDCIs restored antitumor immunity and prolonged survival by PolySTING in Batf3_ / _mice, whereas PolySTING treatment or cDC1 transfer alone showed negligible efficacy (Fig. 40, and Fig. 12A and 12B). Transfer of cDCIs from STING knockout or STINGs365A mutant mice did not lead to immune protections against MC38 tumors in Batf3_ / _mice (Fig. 4D). Lack of immune protection by cDC1 transfer from STINGs365A mutant mice supports previous findings that type I interferon is required by dendritic cells for immune rejection of tumors (20, 21).

[0235] To better define tumor specific responses, we utilized the MC38-OVA tumor model to investigate the priming of transferred cDCIs (wildtype versus STING knockout) in the Batf3'7' mice (Fig. 4E). In the MC38-OVA tumors, significant increase of both subsets of wildtype cDCIs (cell number was normalized to the weight of tumor) were observed with 10- and 4- fold higher CD8a+ and CD103+ cDCIs in PolySTING group over the glucose control, respectively. In contrast, STING deficient cDCIs show marginal difference between the two groups. Most notable increase is the OVA peptide (SIINFEKL (SEQ ID NO: 1)) presentation on H-2Kb MHC-I complex for wildtype cDCIs, where PolySTING treatment elevated antigen presentation over 15- and 4-fold for CD8a± and CD103+ cDCIs, respectively. In contrast, STING deficient cDCIs did not show any significant changes after PolySTING treatment in either subset of cDCIs. Co-stimulation of cDCIs (e.g., CD86) is also elevated in both subsets of cDCIs after PolySTING treatment. These results illustrate robust STING-dependent cDC1 infiltration and activation after PolySTING treatment.Example 4 - PolySTING boosts cDC1 activation and priming of CD8+ T cells in vivo

[0236] We further investigated STING-mediated potentiation of dendritic cells in antigen presentation, co-stimulation and CD8+ T cell priming after intratumoral injection in MC38-OVA tumors (Fig.13A). A dose of 50 g of PolySTING induced the strongest cDC1 activation level and cytotoxic T cell response compared with doses of 10 or 200 pg in both tumors and tDLNs (Fig. 13B to 13F), in accordance with prior therapeutic efficacy findings (Fig. 8I).

[0237] We next performed a side-by-side comparison of PolySTING (50 pg) and Adu-S100 (50 pg). MC38-OVA cells (1x106 cells) were inoculated in C57BL / 6 mice and grown to 100- 150 mm3. On day 10 and 13, PolySTING (50 pg) or Adu-S100 (50 pg) was injected intratumorally, where tumors were harvested on day 14 for DC analysis and on day 16 for T cell analysis (Fig. 5A). Results show significantly increased cDC1s in the MC38-OVA tumors from PolySTING group over either Adu-S100 or glucose control group (Fig. 5B, flow diagrams of CD8a+ cDC1 are shown in Fig. 4B). Co-stimulation signals (e.g., CD80) were dramatically increased in both the CD8a+ and CD103+ cDC1s over Adu-S100 and glucose groups (Fig. 5C). Percentage of dendritic cells with OVA peptide (SIINFEKL (SEQ ID NO: 1)) presentation on H-2Kb MHC-I complex also significantly increased in the PolySTING group over the glucose control, but the difference with Adu-S100 group is insignificant (Fig. 5D). Dendritic cell activation by PolySTING resulted in significantly increased production of OVA-specific CD8+ T cells in both the tumor microenvironment and tumor-draining lymph nodes than the Adu- S100 and glucose groups (Fig. 5E). Tumor-resident CD8+ T cells are cytotoxic as demonstrated by the elevated interferon-y and granzyme B expressions from PolySTING treatment (Fig. 5F). Combined with the previous data on Adu-S100-induced apoptosis in CD8+ T cells (Fig. 1 E), these results highlight the importance of cell selectivity by PolySTING in mounting a productive antitumor immunity over known STING agonists such as Adu-S100.

[0238] Flow cytometry analysis shows CD103+ cDC1s from MC38 tumors also have significantly increased expressions of X-C motif chemokine receptor 1 (XCR1), C-type lectin domain containing 9A (CLEC9A) and C-C motif receptor 7 (CCR7) after STING activation (Fig. 6A). CCR7 is a cell surface chemokine receptor that drives DC homing to lymphoid organs (22). In the tumor draining lymph nodes, elevated CCR7 expressions were found on both subsets of cDC1s (Fig. 6B). CCR ^ mice rejected cDC1 migration to lymph nodes and lost STING-mediated tumor growth inhibition (Fig. 6C and 6D). These data demonstrate cDC1 trafficking to tumor-draining lymph nodes is important to prime the tumor-specific T cell immunity.

[0239] Lastly, we depleted NK, CD4+ or CD8+ T cells and investigated their impact on PolySTING-mediated tumor clearance. Data revealed an indispensable role of CD8+ T cellsbut not NK or CD4+ T cells in tumor rejection (Fig. 6E to 6G). Through an in vivo priming assay, MC38 tetramer+ CD8+ T cells yielded approximately 5-fold higher proliferation in the PolySTING treatment group over control in wildtype C57BL / 6 mice (Fig. 6H). In contrast, only minimal tetramer+ CD8+ T populations were detected in Batf3'7', Tmem173'7', Ifna / pR'7', or STINGs365A mice, whereas Irf4'7' (cDC2 knockout) mice maintained the production of antigen-specific CD8+ T cells. In summary, these data illustrate the important role of cDC1 activation by PolySTING in antigen presentation, co-stimulation, and migration to lymph nodes for the priming of CD8+ T cells against tumor cells (Fig. 6I).Example 5- PolySTING-activated chemokine signature is associated with improved patient survival.

[0240] We quantified the changes of immune profiles in the MC38 tumors in wildtype and cDC1 deficient (Batf3_ / mice after PolySTING treatment. Tumors were harvested and homogenized 12 hours after a single injection of PolySTING or glucose control. Gene expression analysis shows elevated cytokine expressions in interferon-p, G-CSF, GM-CSF and IL-6 from wildtype mice and IL-6, IL-i p and G-CSF from the Batf3'7' mice (Fig. 14A to 14D). For the chemokine profiles, CXCL9 / 10 and C-C motif chemokine ligand 4 and 5 (CCL4 / 5) are the top upregulated chemokines (>10-fold) in the wildtype mice (Fig. 7A and Fig. 14E and 14G). Direct comparison of these four chemokines in wildtype versus Batf3'7' mice show significantly reduced gene expression levels in Batf3'7' mice (Fig. 7B and Fig. 14F and 14H), whereas such differences were not detected in Adu-S100 groups (Fig. 7B). Adu-S100 presented a different chemokine profile, wherein CXCL9 was down-regulated, whereas CCL20 and CXCL1 were up-regulated (Fig. 14G and 14H). CXCL9 / 10 produced by cDC1s have been reported to drive adoptive T cell infiltration into tumors (23), while CCL4 / 5 upregulation in ovarian cancer patients has shown favorable response to checkpoint blockade therapy (24).

[0241] Chemokines CCL5 and X-C motif chemokine ligand 1 (XCL1) from NK cells have been reported to induce cDC1 migration into tumors (25). In our study, RT-PCR analysis of MC38 tumors show significant increase in mRNA expressions of CCL4 and CCL5 but not XCL1 after PolySTING treatment (Fig. 15A). An in vitro chemotaxis assay showed significant cDC1 enrichment in transwells containing CCL4 or CCL5, confirming their induction effect in cDC1 migration (Fig. 15B). In mice, PolySTING expanded the infiltration of both subsets of cDC1 cells in the tumor microenvironment, while neutralization of CCL4 / 5 retarded STING-mediated cDC1 migration (Fig. 15C) and tumor growth inhibition and survival (Fig. 15D and 15E).

[0242] We next examined The Cancer Genome Atlas (TCGA) database to evaluate PolySTI NG-induced chemokine signatures (CCL4 / 5, CXCL9 / 10) in cancer patients with skincutaneous melanoma or sarcoma. In parallel, we also probed BATF3, CLEC9A, XCR1 and CLNK, a collective of biomarkers reported for cDC1s (25). Positive correlations were found between STING chemokine and cDC1 signatures in both sets of patient samples (Pearson correlation coefficient r>0.7, Fig. 16A and 16B). Furthermore, PolySTI NG-induced chemokine signatures (CCL4 / 5, CXCL9 / 10) are associated with improved survival outcomes in both cancer patient populations, whereas analysis by bulk STING expressions has no statistical significance (Fig.16A and 16B).Example 6 - STING-activated cDC1 signature is elevated in resected patient tumors after neoadjuvant checkpoint and chemotherapy

[0243] Based on the mechanistic findings from murine studies, we performed multiplex immunohistochemistry (mIHC) staining of formalin-fixed and paraffin-embedded tumor tissues from non-small cell lung cancer patients who have received either neoadjuvant chemotherapy (NAC, n=30) or neoadjuvant Pembrolizumab and chemotherapy (NAPC, n=28) (Table 1 , below).Table 1 : Patient and pathological characteristics of non-small cell lung cancer patients treated with neoadjuvant chemotherapy (NAC) or neoadjuvant Pembrolizumab and chemotherapy (NAPC).*P values (>0.05) indicate no significant biases in the selection of patients based on the clinical and pathological characteristics

[0244] We used XCR1+STING+CXCL9+ biomarkers to stain for STING-activating cDC1 cells, and further investigated their physical contact with CD8+ T cells in the tumor microenvironment (Fig. 7C and Fig. 16C). Interestingly, patients who received NAPC therapy significantly elevated STING-activating cDC1 signatures over patients treated by chemotherapy alone (p<0.001 , Fig. 7D), suggesting immune checkpoint therapy by Pembrolizumab is responsible for the cDC1 recruitment and activation in the tumormicroenvironment in a subset of patients. The activated cDC1 further engages CD8+ T cells to augment the antitumor immunity. In accordance with mIHC analysis, we further divided the cancer patients into STING-activating cDCIhigh (above medium level) and cDCIIow (below medium level) groups. STING-activating cDCIhigh postulated a positive prediction of prolonged progression free survival and overall survival in both NAC and NAPC patients, whereas low abundance of STING-activating cDC1 signature led to poor survival outcome more pronouncedly in patients without immunotherapy (Fig. 7E and Fig. 16D). These findings indicate that the STING-activating cDC1 signature (XCR1+STING+CXCL9+) may serve as a prognostic clinical biomarker for cancer patient response to therapies.Example 7 - Discussion

[0245] Genomic instability of cancer cells places DNA sensing and cGAS-STING signaling as a key immune activation mechanism against cancer (3). However, immune system often displays dual host-protective and tumor-promoting responses that are antipodally activated to modulate immunity (26). This dichotomous relationship is illustrated by contradicting reports where STING signaling has opposite effect on antitumor response. For immune protection, DNA from dying cancer cells was shown to activate cGAS-STING pathway, leading to the induction of type I interferons that prime T cells and natural killer cells against tumor cells (14, 27). On the other hand, chromosome instability has also been reported to activate the cGAS- STING pathway with inflammatory responses that promote cancer metastasis (28, 29). Massague et al show cGAMP transfer from tumor cells to astrocytes produces inflammatory cytokines which activate STAT1 and NF-KB pathways leading to tumor growth and chemoresistance (29). More recently, the same group reported an opposite effect where STING signaling in cancer cells suppresses metastatic outbreak in an indolent lung cancer model (30). STING is broadly expressed in majority of host cells including cancer cells, where multifaceted cellular functions likely exert complex functions in antitumor immunity. Therefore, understanding the cell context of STING activation is important to elucidate mechanisms that drive antitumor immunity.

[0246] Use of small molecule STING agonists (e.g., DMXAA, Adu-S100) for this purpose is challenging because they are readily taken up by T cells, and high magnitude of STING signaling has been shown to drive T cell deaths (8, 31) and ablate T cell memory response (11). To overcome this limitation, we utilized PolySTING, a nanoparticle STING agonist, to selectively target myeloid cells but not T cells to avoid T cell deaths. Prior studies have shown STING-activating nanoparticles are able to improve pharmacokinetics and cytosolic delivery of cyclic dinucleotides for STING activation (32-34). Irvine et al showed lipid nanodiscs increased dendritic cell infiltration in the MC38 tumors for T cell priming (32). Weichselbaum et al reported zinc cyclic di-AMP nanoparticles disrupted tumor endothelial cells and targetedmacrophages for augmented antitumor immunity (34), whereas Wilson et al showed STING- activation nanoparticles led to vascular normalization with improved vascular integrity and T cell infiltration (35). In this study, our PolySTI NG design synergizes canonical STING activation by cGAMP with non-canonical activation by PSC7A, which prevents STING degradation and prolongs the expression of type I interferons (10). Using PolySTING and MC38 tumors as a model system, we systematically investigated the contributions of different immune cell subsets in tumor clearance. Data show depletion of cDC2, pDC, moDC, macrophages in the myeloid compartment or blocking of B and NK cells had minimal effect on tumor rejection (Fig. 3G to 3K), whereas mice deficient of cDC1s (Batf3_ / abrogated antitumor efficacy of PolySTING (Fig. 3L). This cDC1 requirement supports a recent study using cGAMP-loaded virus-like nanoparticles (36). Our data further demonstrate STING signaling within cDC1s is important because PolySTING efficacy is abolished in XCR1creSTINGfl / flmice (Fig. 4A), as well as transfer of cDC1s from STING knockout mice cannot rescue the abrogated PolySTING efficacy in Batf3_ / - mice (Fig. 4C). Moreover, cDC1 recruitment in tumors harnesses an autocrine effect by CCL4 / 5 chemokines (25), which is highly induced by PolySTING in wildtype but not in Batf3_ / - mice (Fig. 7A and 7B). The collective chemokine signatures (CCL4 / 5, CXCL9 / 10) are further associated with better survival outcomes of melanoma and sarcoma patients over bulk STING expressions observed from the TCGA database (Fig. 15A and 15B). Additionally, high expressions of STING-activating cDC1s in tumor tissues from non-small cell lung cancer patients were observed in those treated with Pembrolizumab in combination with chemotherapy (NAPC) (Fig 70 and 7D, and Fig. 16C). The correlation between STING-activating cDCI high and improved progression-free survival and overall survival were further validated (Fig. 7E and Fig. 16D). For cancer patients who have low STING-activating cDC1 signatures even after immune checkpoint therapy (-50% patients in Fig. 7D), PolySTING therapy may offer a synergistic treatment modality to boost cDC1 infiltration as demonstrated in the mouse tumor studies.

[0247] In mice with cDC1 deficiency, transfer of wildtype cDC1s but not STING deficient cDC1s restore antitumor immunity with PolySTING treatment (Fig. 40). Recently, Murphy et al reported intratumoral injection of cDC1s but not cDC2s or GM-CSF-derived DCs led to rejection of immunogenic fibrosarcoma in mice lacking endogenous cDC1s (37). Using the MC38-OVA tumor model, our data further demonstrate PolySTING can boost transferred cDC1s in antigen presentation and co-stimulation (Fig. 4E). Recent data show early priming of CD4+ T cells against tumor antigens also requires cDC1 s, and in turn, cognate CD4+ T cell interactions and CD40 signaling are required to license cDC1 for the activation of CD8+ T cells (37). PolySTING-cDC1-mediated antitumor immunity bypasses the co-licensing requirement of CD4+ T cells as blocking of CD4+ T cells had little effect on tumor clearance(Fig. 6F). Further studies are warranted to elucidate the molecular and cellular mechanisms of sufficiency in direct STING activation of cDC1s for CD8+ T cell priming.

[0248] In summary, using a nanoparticle STING agonist, we discovered the importance of STING licensing of conventional type I dendritic cells (cDC1s) over other immune cell subsets in mounting a robust antitumor immunity. A STING-activating cDC1 signature (XCR1+STING+CXCL9+) may serve as a prognostic clinical biomarker for patient response to cancer immunotherapy. Our findings indicate direct targeting of STING pathways in the cDC1s offers an effective strategy to restore protective immunity against solid tumors.REFERENCES1. G. N. Barber, STING: infection, inflammation and cancer. Nat Rev Immunol 15, 760- 770 (2015).2. H. Ishikawa, G. N. Barber, STING is an endoplasmic reticulum adaptor that facilitates innate immune signalling. Nature 455, 674-678 (2008).3. T. Li, Z. J. Chen, The cGAS-cGAMP-STING pathway connects DNA damage to inflammation, senescence, and cancer. J Exp Med 215, 1287-1299 (2018).4. A. Ablasser et al., cGAS produces a 2’-5’-linked cyclic dinucleotide second messenger that activates STING. Nature 498, 380-384 (2013).5. J. Wu et al., Cyclic GMP-AMP is an endogenous second messenger in innate immune signaling by cytosolic DNA. Science 339, 826-830 (2013).6. L. Sun, J. Wu, F. Du, X. Chen, Z. J. Chen, Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway. Science 339, 786-791 (2013).7. X. Gui et al., Autophagy induction via STING trafficking is a primordial function of the cGAS pathway. Nature 567, 262-266 (2019).8. M. F. Gulen et al., Signalling strength determines proapoptotic functions of STING. Nat. Commun. 8, 427 (2017).9. J. Petrasek et al., STING-IRF3 pathway links endoplasmic reticulum stress with hepatocyte apoptosis in early alcoholic liver disease. Proc. Natl. Acad. Sci. U.S.A. 110, 16544-16549 (2013).10. S. Li et al., Prolonged activation of innate immune pathways by a polyvalent STING agonist. Nat. Biomed. Eng. 5, 455-466 (2021).11. K. E. Sivick et al., Magnitude of Therapeutic STING Activation Determines CD8(+) T Cell-Mediated Anti-tumor Immunity. Cell Rep. 25, 3074-3085 e3075 (2018).12. J. A. Carozza etal., Extracellular cGAMP is a cancer-cell-produced immunotransmitter involved in radiation-induced cancer immunity. Nat Cancer 1 , 184-+ (2020).13. H. Ishikawa, Z. Ma, G. N. Barber, STING regulates intracellular DNA-mediated, type I interferon-dependent innate immunity. Nature 461 , 788-792 (2009).14. S.-R. Woo et al., STING-dependent cytosolic DNA sensing mediates innate immune recognition of immunogenic tumors. Immunity 41, 830-842 (2014).15. S. Yum, M. Li, Y. Fang, Z. J. Chen, TBK1 recruitment to STING activates both IRF3 and NF-KB that mediate immune defense against tumors and viral infections. Proc. Natl. Acad. Sci. U.S.A. 118, (2021).16. F. Baharom et al., Intravenous nanoparticle vaccination generates stem-like TCF1 + neoantigen-specific CD8+ T cells. Nature Immunol. 22, 41-52 (2021).17. R. Toivonen et al., Activation of plasmacytoid dendritic cells in colon-draining lymph nodes during citrobacter rodentium infection involves pathogen-sensing and inflammatory pathways distinct from conventional dendritic cells. J. Immunol. 196, 4750-4759 (2016).18. K. Hildner et al., Batf3 deficiency reveals a critical role for CD8alpha+ dendritic cells in cytotoxic T cell immunity. Science 322, 1097-1100 (2008).19. M. Binnewies et al., Unleashing type-2 dendritic cells to drive protective antitumor CD4+ T cell immunity. Cell 177, 556-571. e516 (2019).20. M. S. Diamond et al., Type I interferon is selectively required by dendritic cells for immune rejection of tumors. J. Exp. Med. 208, 1989-2003 (2011).21. M. B. Fuertes et al., Host type I IFN signals are required for antitumor CD8+ T cell responses through CD8a+ dendritic cells. J. Exp. Med. 208, 2005-2016 (2011).22. L. Ohl et al., CCR7 governs skin dendritic cell migration under inflammatory and steady-state conditions. Immunity 21 , 279-288 (2004).23. S. Spranger, D. Dai, B. Horton, T. F. Gajewski, Tumor-Residing Batf3 Dendritic Cells Are Required for Effector T Cell Trafficking and Adoptive T Cell Therapy. Cancer Cell 31 , 711-723 e714 (2017).24. D. Dangaj etal., Cooperation between Constitutive and Inducible Chemokines Enables T Cell Engraftment and Immune Attack in Solid T umors. Cancer Cell 35, 885-+ (2019).25. J. P. Bottcher et al., NK Cells Stimulate Recruitment of cDC1 into the Tumor Microenvironment Promoting Cancer Immune Control. Cell 172, 1022-1037 e1014 (2018).26. R. D. Schreiber, L. J. Old, M. J. Smyth, Cancer immunoediting: integrating immunity’s roles in cancer suppression and promotion. Science 331 , 1565-1570 (2011).27. O. Demaria et al., STING activation of tumor endothelial cells initiates spontaneous and therapeutic antitumor immunity. P Natl Acad Sci USA 112, 15408-15413 (2015).28. S. F. Bakhoum et al., Chromosomal instability drives metastasis through a cytosolic DNA response. Nature 553, 467-+ (2018).29. Q. Chen et al., Carcinoma-astrocyte gap junctions promote brain metastasis by cGAMP transfer. Nature 533, 493-498 (2016).30. J. Hu et al., STING inhibits the reactivation of dormant metastasis in lung adenocarcinoma. Nature 616, 806-813 (2023).31. J. J. Wu, N. Dobbs, K. Yang, N. Yan, Interferon- Independent Activities of Mammalian STING Mediate Antiviral Response and Tumor Immune Evasion. Immunity 53, 115-+ (2020).32. E. L. Dane et al., STING agonist delivery by tumour-penetrating PEG-lipid nanodiscs primes robust cancer immunity. Nat Mater 21, 710-+ (2022).33. D. Shae et al., Endosomolytic polymersomes increase the activity of cyclic dinucleotide STING agonists to enhance cancer immunotherapy. Nat Nanotechnol 14, 269-+ (2019).34. K. T. Yang et al., Zinc cyclic di-AMP nanoparticles target and suppress tumours via endothelial STING activation and tumour-associated macrophage reinvigoration. Nat Nanotechnol 17, 1322-+ (2022).35. L. Wang-Bishop etal., STING-activating nanoparticles normalize the vascular-immune interface to potentiate cancer immunotherapy. Science Immunology 8, eadd1153.36. B. Jneid et al., Selective STING stimulation in dendritic cells primes antitumor T cell responses. Sci Immunol 8, (2023).37. S. T. Ferris etal., cDC1 prime and are licensed by CD4(+) T cells to induce anti-tumour immunity. Nature 584, 624-629 (2020).38. Mender et al., Telomere Stress Potentiates STING-Dependent Anti-tumor Immunity. Cancer Cell 38, 400-411 e406 (2020).39. X. Wang et al., Polycarbonate-based ultra-pH sensitive nanoparticles improve therapeutic window. Nat. Commun. 11 , 5828 (2020).40. Y. Lu et al., Complement signals determine opposite effects of B cells in chemotherapy-induced immunity. Cell 180, 1081-1097. e1024 (2020).41. B. T. Edelson et al., Peripheral CD103+ dendritic cells form a unified subset developmentally related to CD8a+ conventional dendritic cells. J. Exp. Med. 207, 823- 836 (2010).

Claims

CLAIMSWhat is claimed is:

1. A method of predicting prognosis of a subject after administration of a cancer therapy, the method comprising: a) administering the cancer therapy to the subject; b) quantifying a STING-activated cDC1 signature in a tumor sample obtained from a subject; and c) determining that the subject will have a positive prognosis if the STING- activated cDC1 signature is equal to or greater than a threshold.

2. The method of claim 1 , wherein the cancer therapy comprises a STING agonist, optionally, wherein the STING agonist comprises 2' 3'-cyclic GMP-AMP (cGAMP).

3. The method of claim 2, wherein the STING agonist is encapsulated in a biodegradable pH sensitive polymer.

4. The method of claim 3, wherein the biodegradable pH sensitive polymer comprises PEG-b-P(MAC-SC7A) (PSC7A).

5. The method of claim 1 , wherein the cancer therapy comprises chemotherapy and / or immunotherapy.

6. The method of claim 5, wherein the immunotherapy comprises an immune checkpoint inhibitor, a cytokine therapy, or a CAR-T cell.

7. The method of claim 6, wherein the immune checkpoint inhibitor comprises Pembrolizumab.

8. The method of claim 5, wherein the cancer therapy comprises neoadjuvant chemotherapy.

9. The method of claim 5, wherein the cancer therapy comprises neoadjuvant chemotherapy and an immune checkpoint inhibitor, optionally wherein the immune checkpoint inhibitor comprises Pembrolizumab.

10. A method of identifying a subject as a candidate for a cancer therapy, the method comprising: a) quantifying a STING-activated cDC1 signature in a tumor sample obtained from a subject; andb) identifying the patient as a candidate for a cancer therapy where the cancer therapy is selected based on the STING-activated cDC1 signature in the sample.

11. The method of claim 10, wherein the cancer therapy comprises a STING agonist, a chemotherapy, and / or immunotherapy if the STING-activating cDC1 signature equal to or greater than a threshold.

12. The method of claim 11 , wherein the cancer therapy comprises an immunotherapy.

13. The method of claim 12, wherein the immunotherapy comprises an immune checkpoint inhibitor, a cytokine therapy, or a CAR-T cell.

14. The method of claim 13, wherein the immune checkpoint inhibitor comprises Pembrolizumab.

15. The method of claim 11 , wherein the cancer therapy comprises a STING agonist, optionally wherein the STING agonist comprises 2' 3'-cyclic GMP-AMP (cGAMP).

16. The method of claim 15, wherein the STING agonist is encapsulated in a biodegradable pH sensitive polymer.

17. The method of claim 16, wherein the biodegradable pH sensitive polymer comprises PEG-b-P(MAC-SC7A) (PSC7A).

18. The method of claim 11 , wherein the cancer therapy comprises neoadjuvant chemotherapy.

19. The method of claim 11 , wherein the cancer therapy comprises neoadjuvant chemotherapy and an immune checkpoint inhibitor.

20. The method of claim 10, wherein the cancer therapy is radiation therapy, or surgery if the STING-activating CDC signature is below a threshold.21 . A method of treating a tumor in a subject, the method comprising: a) quantifying a STING-activated cDC1 signature in a tumor sample obtained from a subject; and b) administering a cancer therapy to the subject, where the cancer therapy is selected based on the STING-activating cDC1 signature in the sample.

22. The method of claim 21 , wherein the cancer therapy in (b) comprises immunotherapy, a STING agonist, and / or chemotherapy if the STING-activating cDC1 signature is equal to or greater than a threshold.

23. The method of claim 22, wherein the cancer therapy in (b) comprises immunotherapy.

24. The method of claim 23, wherein the immunotherapy comprises an immune checkpoint inhibitor, a cytokine therapy, or a CAR-T cell.

25. The method of claim 24, wherein the immune checkpoint inhibitor comprises Pembrolizumab.

26. The method of claim 22, wherein the cancer therapy in (b) comprises neoadjuvant chemotherapy.

27. The method of claim 22, wherein the cancer therapy in (b) comprises neoadjuvant chemotherapy and an immune checkpoint inhibitor, optionally wherein the immune checkpoint inhibitor comprises Pembrolizumab.

28. The method of claim 22, wherein the cancer therapy in (b) comprises a STING agonist, optionally wherein the STING agonist comprises 2' 3'-cyclic GMP-AMP (cGAMP).

29. The method of claim 28, wherein the STING agonist is encapsulated in a pH sensitive biodegradable polymer.

30. The method of claim 29, wherein the pH sensitive biodegradable polymer comprises PEG-b-P(MAC-SC7A) (PSC7A).31 . The method of claim 21 , wherein the cancer therapy in (b) comprises radiation therapy and / or surgery if the STING-activating cDC1 signature is below a threshold.

32. The method of claim 21 , wherein step (a) further comprises: i) administering an initial cancer therapy to the subject, and ii) quantifying the STING-activated cDC1 signature in a tumor sample obtained from a subject after administering the initial cancer therapy.

33. The method of claim 32, wherein the initial cancer therapy in step (a) (i) is the same as the cancer therapy in (b).

34. The method of claim 32, wherein the initial cancer therapy in step (a) (i) is different than the cancer therapy (b).

35. The method of claim 32, wherein the initial cancer therapy in (a)(i) is a STING agonist, optionally wherein the STING agonist comprises 2' 3'-cyclic GMP-AMP (cGAMP).

36. The method of claim 35, wherein the STING agonist is encapsulated in a biodegradable pH sensitive polymer.

37. The method of claim 36, wherein the biodegradable pH sensitive polymer comprises PEG-b-P(MAC-SC7A) (PSC7A).

38. The method of claim 32, wherein the initial cancer therapy in (a) comprises a STING agonist and the cancer therapy in (b) comprises (i) an immunotherapy and / or neoadjuvant chemotherapy if the STING-activating cDC1 signature is equal to or greater than a threshold; or (ii) radiation therapy and / or surgery if the STING-activating cDC1 signature is below a threshold.

39. The method of claim 38, wherein the STING agonist comprises 2' 3'-cyclic GMP-AMP (cGAMP).

40. The method of claim 39, wherein the STING agonist is encapsulated in a pH sensitive biodegradable polymer.

41. The method of claim 40, wherein the biodegradable pH sensitive polymer comprises PEG-b-P(MAC-SC7A) (PSC7A).

42. The method of claim 38, wherein the immunotherapy comprises an immune checkpoint inhibitor, optionally wherein the immune checkpoint inhibitor comprises Pembrolizumab.

43. The method of any one of claims 1 to 42, wherein quantifying the STING-activated cDC1 signature comprises quantifying levels of (a) one or more markers of cDC1 cells; (b) STING activation; (c) or one or more STING induced cytokines; or a combination thereof.

44. The method of claim 43, wherein the one or more markers of cDC1 cells of (a) are selected from XCR1 , BATF3, CLEC9A, CLNK, IRF8, CADM1 , and any combination thereof.

45. The method of claim 44, wherein the one or more markers of cDC1 cells comprises XCR1.

46. The method of claim 44, wherein quantifying levels of the one or more markers of cDC1 cells comprises measuring gene transcript levels of the one or more markers of cDC1 cells.

47. The method of claim 44, wherein quantifying levels of the one or more markers of cDC1 cells comprises measuring protein levels of the one or more markers of cDC1 cells.

48. The method of claim 43, wherein levels of STING activation in (b) are measured by measuring levels of phosphorylated STING (phospho-STING) in the tumor sample.

49. The method of claim 43, wherein the one or more STING induced cytokines are chemokines.

50. The method of claim 49, wherein the chemokines comprise CCL4, CCL5, CXCL9, CXCL10, or any combination thereof.

51. The method of claim 50, wherein the chemokines comprise CXCL9 or CXCL10.

52. The method of any one of claims 1 to 51 , wherein the subject is administered at least one cancer therapy orally, intraadiposally, intraarterially, intraarticularly, intracranially, intradermally, intralesionally, intramuscularly, intranasally, intraocularly, intrapericardially, intraperitoneally, intrapleurally, intraprostatically, intrarectally, intrathecally, intratracheally, intratumorally, intraumbilically, intravaginally, intravenously, intravesicularlly, intravitreally, liposomally, locally, mucosally, parenterally, rectally, subconjunctival, subcutaneously, sublingually, topically, transbuccally, transdermally, vaginally, in cremes, in lipid compositions, via a catheter, via a lavage, via continuous infusion, via infusion, via inhalation, via injection, via local delivery, or via localized perfusion.

53. The method of any one of claims 1 to 52, wherein the tumor sample is obtained from a solid tumor, a biopsy, or a surgical resection.

54. The method of any one of claims 1 to 53, wherein the tumor sample is formalin fixed and paraffin embedded.

55. The method of any one of claims 1 to 54, wherein the tumor sample is obtained from a lung tumor, a breast cancer, a melanoma, a skin tumor, a pancreatic tumor, a head or neck tumor, or other solid tumors.

56. The method of claim 55, wherein the tumor sample is obtained from a non-small cell lung carcinoma, a triple negative breast cancer, a head and neck cancer, or a melanoma.

57. The method of any one of claims 1 to 56, wherein the subject has or is suspected of having a solid tumor.

58. The method of claim 57, wherein the subject has or is suspected of having lung cancer, breast cancer, skin cancer, pancreatic cancer, a head or neck cancer or any combination thereof.

59. The method of claim 58, wherein the subject has or is suspected of having non-small cell lung carcinoma, a triple negative breast cancer, a head and neck cancer, a melanoma, or any combination thereof.

60. The method of any one of claims 1 to 59, wherein the subject is a mammal.

61. The method of any one of claims 1 to 60, wherein the subject is human.

Images