Combination cancer therapy methods and agents

Abstract

The present disclosure relates, in general, to methods for treating a low CXCL9 or CXCL10 expressing cancer comprising administering to a subject having such cancer and in need thereof an effective amount of CXCL9, CXCL10 or the combination, in combination with an immune checkpoint inhibitor. The CXCL9, CXCL10 or combination may be administered as a polypeptide, a polynucleotide or as cells comprising a polynucleotide encoding CXCL9, CXCL10 or both. In one aspect, the treatment is amenable to patients with low or high mutational burden tumors.

Description

P-622477-PC COMBINATION CANCER THERAPY METHODS AND AGENTS CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U.S. provisional patent application serial no. 63 / 538,588, filed September 15, 2023, which is incorporate herein by reference in its entirety. GOVERNMENT SUPPORT

[0002] This invention was made with government support under HL072752 awarded by the National Institutes of Health. The government has certain rights in the invention. This work was supported by the U.S. Department of Veterans Affairs, and the Federal government has certain rights in the invention. REFERENCE TO SEQUENCE LISTING

[0003] The present application includes a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled “P-622477-PC_SQL_ST.26_12SEP24.xml”, created on September 12, 2024, which is 9,487 bytes in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety. BACKGROUND

[0004] Lung cancer is the most common cause of cancer death worldwide with approximately 85% of patients having non-small cell lung cancer (NSCLC). Recent approval of chemo- immunotherapy combinations has altered the treatment landscape in advanced NSCLC, such that all eligible patients can receive anti-PD-1 / PD-L1 immunotherapy in the front-line setting, either in combination with chemotherapy irrespective of tumor PD-L1 level, or monotherapy in select patients with tumor PD-L1>50%. This shift has led to improved patient outcomes in the front-line setting [the objective response rate (ORR) is approximately 55%], but also created an area of unmet need, namely effective treatment options for patients after progression on a PD -1 and / or PD-L1 inhibitor. Second-line chemotherapy is an option for these patients but is associated with significant toxicity and limited efficacy. As an alternative, treatment with a PD-1 or PD-L1 inhibitor beyond progression has been evaluated with minimal clinical benefit observed (the ORRis approximately 8%).

[0005] Studies reveal that responses to PD-1 / PD-L1 blockade are associated with high tumor mutational burden (TMB), increased CD8+ T cell tumor infiltration and high baseline tumor PD- L1 expression. In contrast, oncogenic driver mutations may contribute to resistance to anti-PD- 1 / PD-L1 immunotherapy. For example, LKB1 inactivating mutations have been implicated in driving primary resistance to anti- PD-1 therapy in KRAS-mutant lung adenocarcinoma (LUAC), probably by facilitating an immunosuppressive and angiogenic environment to promote tumor growth. In addition, patients with epidermal growth factor receptor (EGFR) mutations and / or anaplastic lymphoma kinase (ALK) rearrangements do not benefit from PD-1 / PD-L1 inhibition after failed tyrosine kinase inhibitor (TKI) therapy. EGFR and / or ALK-mutant tumors often harbor uninflamed and immunosuppressive tumor microenvironment (TME), which may contribute to their resistance to immunotherapy. Therefore, approaches that enhance tumor antigen presentation, overcome the immunosuppressive TME and inhibit tumor angiogenesis are anticipated to lead to improved efficacy of PD-1 / PD-L1 blockade.

[0006] It is towards improving the efficacy of PD-1 / PD-L1 blockade, and resistance to immune checkpoint inhibitor therapy in general, that the present disclosure is directed. SUMMARY

[0007] In one aspect, a method is provided for treating cancer or a solid tumor in a subject having reduced expression of CXCL9 and / or CXCL10, comprising: a. administering to the subject: (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or the combination thereof, (ii) a polynucleotide encoding the CXCL9 polypeptide, a polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, (iii) a cell comprising the polynucleotide encoding the CXCL9 polypeptide, a cell comprising the polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, or(iv) any combination thereof; and b. administering to the subject an immune checkpoint inhibitor.

[0008] In some embodiments, the cancer or a solid tumor in the subject has reduced expression of CXCL9. In some embodiments, the cancer or a solid tumor in the subject has reduced expression of CXCL10. In some embodiments, the subject has a chromosome 9p loss. In some embodiments, the subject has a chromosome 9p21.3 loss. In some embodiments, the subject has a chromosome 9p24.1 loss. In some embodiments, the reduced expression of CXCL9 and / or CXCL10 is by activated dendritic cells. In some embodiments, the reduced expression of CXCL9 and / or CXCL10 is by plasmacytoid dendritic cells. In some embodiments, the reduced expression of CXCL9 and / or CXCL10 is by macrophages. In some embodiments, the reduced expression of CXCL9 and / or CXCL10 is by M1 subtype macrophages.

[0009] In some embodiments, reduced expression of CXCL9 and or CXCL10 is no expression of CXCL9 or CXCL10. In some embodiments, reduced expression is less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or 1% of levels of one or both in a typical tumor.

[0010] In some embodiments, the cancer or solid tumor comprises an inactivating mutation of LKB-1.

[0011] In some embodiments, the a. administering comprises CXCL9. In some embodiments, the a. administering consists of CXCL9. In some embodiments, a. administering comprises CXCL10. In some embodiments, step a. administering consists of CXCL10. In some embodiments, step a. administering comprises the combination of CXCL9 and CXCL10. In some embodiments, step a. administering consists of the combination of CXCL9 and CXCL10.

[0012] In some embodiments, naïve T cells are decreased and central memory T cells are increased in the subject.

[0013] In some embodiments, the immune checkpoint inhibitor is an antibody, optionally, a monoclonal antibody. In some embodiments, the immune checkpoint inhibitor is selected from the group consisting of a CTLA-4 inhibitor, a CTLA-4 receptor inhibitor, a PD-1 inhibitor, a PD1-Ll inhibitor, a PD1-L2 inhibitor, a 4-lBB inhibitor, an OX40 inhibitor, a LAG-3 inhibitor, a TIM-3inhibitor, or a combination thereof. In some embodiments, the immune checkpoint inhibitor is a CTLA-4 inhibitor, optionally, ipilimumab or tremilimumab. In some embodiments, the immune checkpoint inhibitor is a PD1 inhibitor selected from a group consisting of: nivolumab, pembrolizumab, pidilizumab, lambrolizumab, BMS-936559, atezolizumab, AMP-224, AMP224, AUNP12, BGB108, MCLA134, MEDI0680, PDR00l, REGN2810, SHR1210, STIA110X, STIA1110 and TSR042. In some embodiments, the immune checkpoint inhibitor is a PD1-Ll inhibitor selected from a group consisting of: BMS-936559, MPDL3280A, MEDI-4736, MSB0010718C, ALN-PDL, BGBA317, KD033, KY1003, STIA100X, STIA1010, STIA1011, STIA1012 and STIA1014.

[0014] In some embodiments, the CXCL9 polypeptide comprises an amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2; and the CXCL10 polypeptide comprises an amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4.

[0015] In some embodiments, the polynucleotide encoding the CXCL9 polypeptide, CXCL10 polypeptide, or the combination thereof is inserted into a vector and the vector is administered to the subject, or the vector is introduced into an antigen presenting cell (APC) or a dendritic cell (DC) which is then administered to the subject or to the tumor site. In some embodiments, the vector is an adenovirus vector, a lentiviral vector, a CMV vector, a vaccinia virus vector, a sindbis virus vector, or a herpesvirus vector. In some embodiments, the adenoviral vector is a replication- deficient adenoviral vector.

[0016] In some embodiments, the cell comprising the polynucleotide encoding the CXCL9 polypeptide, CXCL10 polypeptide, or the combination thereof is an antigen presenting cell (APC) or a dendritic cell (DC). In some embodiments, the APC is a dendritic cell. In some embodiments, the dendritic cell is autologous to the subject, is from a donor or is from a cell line. In some embodiments, at least or about 1x10^6 cells comprising the polynucleotide encoding the CXCL9 polypeptide, about 1x10^6 cells comprising the polynucleotide encoding the CXCL10 polypeptide, or the combination thereof are administered to the subject. In some embodiments, the cells produce at least or about 10 ng of CXCL9 or CXCL10 per lxl0^6 cells in a 24-hour period.

[0017] In some embodiments, the subject comprises a solid tumor and the cells are administered to the subject intratumorally.

[0018] In some embodiments, the solid tumor is a non-small cell lung carcinoma (NSCLC) solid tumor. In some embodiments, the NSCLC is lung adenocarcinoma. In some embodiments, the NSCLC is lung squamous carcinoma. In some embodiments, the solid tumor is a melanoma. In some embodiments, the solid tumor is a head and neck squamous cell carcinoma.

[0019] In some embodiments, the (i) CXCL9 polypeptide, the CXCL10 polypeptide, or the combination thereof, (ii) polynucleotide encoding the CXCL9 polypeptide, polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, (iii) cell comprising the polynucleotide encoding the CXCL9 polypeptide, cell comprising the polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, or (iv) any combination thereof, is administered to the subject prior to, about 2 weeks prior to, or at the same time as the immune checkpoint inhibitor. In some embodiments, the (i) CXCL9 polypeptide, the CXCL10 polypeptide, or the combination thereof, (ii) polynucleotide encoding the CXCL9 polypeptide, polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, (iii) cell comprising the polynucleotide encoding the CXCL9 polypeptide, cell comprising the polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, or (iv) any combination thereof, is administered to the subject about more than once, once every two weeks, once every three weeks, or once a month. In some embodiments, the immune checkpoint inhibitor is administered to the subject more than once, once every 2 weeks, once every 3 weeks, or once a month. In some embodiments, the (i) CXCL9 polypeptide, the CXCL10 polypeptide, or the combination thereof, (ii) polynucleotide encoding the CXCL9 polypeptide, polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, (iii) cell comprising the polynucleotide encoding the CXCL9 polypeptide, cell comprising the polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, or (iv) any combination thereof, and the immune checkpoint inhibitor, are independently administered by a route selected from intratumorally, intravenously, intra-arterially, intraperitoneally, intranasally, intramuscularly, intradermally or subcutaneously, or via CT-guided or bronchoscopic IT injection. In some embodiments, the (i) CXCL9 polypeptide, the CXCL10 polypeptide, or the combination thereof, (ii) polynucleotide encoding the CXCL9 polypeptide, polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, (iii) cell comprising the polynucleotide encoding the CXCL9 polypeptide, cell comprising the polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, or (iv) any combination thereof, is administered intratumorally and the immune checkpoint inhibitor isadministered intravenously.

[0020] In some embodiments, the subject has a low mutational burden tumor. In some embodiments, the subject has a high mutational burden tumor. In some embodiments, the high mutational burden is determined by a biopsy of the tumor. In some embodiments, tumor-associated neoantigens are determined. In some embodiments, the efficacy of combination therapy is followed by elucidation of the neoantigen landscape of the tumor. In some embodiments, the tumor comprises a mutation selected from KRAS, TP53 (KP), JAK2 or STK11 / LKB1, or any combination thereof. In some embodiments, the tumor has intratumoral heterogeneity. In some embodiments, a mutational burden of the tumor is determined by diagnostic assay selected from FoundationOne CDx™, FoundationOne®, FoundationAct®, and FoundationOne®Heme.

[0021] In some embodiments, the tumor does not have an activating mutation in the epidermal growth factor receptor or an anaplastic lymphoma kinase gene (ALK) fusion.

[0022] In some embodiments, a somatic mutational load and tumor-associated neoantigens before, during and after treatment are used to initiate, prescribe and monitor therapy.

[0023] In some embodiments, a method is provided for treating a high mutational burden cancer or reducing the reoccurrence of a high mutational burden cancer in a subject having reduced expression of CXCL9 and / or CXCL10, in need thereof comprising administering an effective amount of a combination therapy comprising a) dendritic cells comprising an CXCL9 vector and dendritic cells comprising a CXCL10 vector, and b) an effective amount of anti-PD-1 antibody.

[0024] In some embodiments, a method is provided for treating a low mutational burden cancer or reducing the reoccurrence of a low mutational burden cancer in a subject having reduced expression of CXCL9 and / or CXCL10, in need thereof comprising administering an effective amount of a combination therapy comprising a) dendritic cells comprising an CXCL9 vector and dendritic cells comprising a CXCL10 vector, and b) an effective amount of anti-PD-1 antibody.

[0025] In some embodiments, a method is provided for treating cancer or a solid tumor in a subject comprising: a. determining the level of expression of CXCL9 and / or CXCL10 in the tumor; andb. if the level of expression of CXCL9 and / or CXCL10 is reduced, administer to the subject: (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or the combination thereof, (ii) a polynucleotide encoding the CXCL9 polypeptide, a polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, (iii) a cell comprising the polynucleotide encoding the CXCL9 polypeptide, a cell comprising the polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, or (iv) any combination thereof; and an immune checkpoint inhibitor.

[0026] In some embodiments, a method is provided for treating cancer or a solid tumor in a subject comprising: a. determining the level of signaling by CXCL9 and / or CXCL10; and b. if the level of signaling by CXCL9 and / or CXCL10 is reduced, administer to the subject: (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or the combination thereof, (ii) a polynucleotide encoding the CXCL9 polypeptide, a polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, (iii) a cell comprising the polynucleotide encoding the CXCL9 polypeptide, a cell comprising the polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, or (iv) any combination thereof; and an immune checkpoint inhibitor.BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figures 1A-1D depict the Spearman correlations between the expression levels of CXCL9, CXCL10 and CXCR3 and immune cell infiltration in human NSCLC derived from the TCGA database using xCell expression signatures. (Figures 1A-1B) Correlations between CXCL9, CXCL10 and CXCR3 expression levels in both (Figure 1A) LUAD and (Figure 1B) LUSC. (Figure 1C) Correlation table between CXCL9 / 10 and various immune cell signatures in LUAD. (Figure 1D) Same as in Figure 1C except for LUSC.

[0028] Figures 2A-2B depict the Spearman correlations graphs between CXCL9 / 10 signature and immune cell infiltration derived from the TCGA database in LUAD. Related to Figure 1. (A) CD8+T cells and CD4+Th2 T cells, but not Treg cells, positively correlate with CXCL9 / 10 signature levels. A weak correlation was found in CD4+Th1 T cells. (B) CXCL9 / 10 expression levels positively correlate with activated dendritic cells, total macrophages and M1 subtype macrophages. A weaker correlation was found with total dendritic cells.

[0029] Figures 3A-3D depict in vitro generation of CXCL9 / 10-DC. Related to Figure 4. (A) A schematic of in vitro generation of CXCL9 / 10-DC. (B) Validation of CXCL9 and CXCL10 secretion from DC 24 h post lentiviral transduction by ELISA. Vector virus transduced DC (Mock- DC) was included as a control. Each point represents a viral lot (n=6). (C) %CD86+DC of total DC (CD11c+CD11b+MHCIIhi) with or without lentiviral transduction revealed by flow cytometry (n=6). (D) FITC-Dextran uptake assay. DC phagocytosis was analyzed by FITC-Dextran uptake at 4°C or 37°C and quantified by flow cytometry (n=5). P values were determined by unpaired t- test. *, P<0.05; ****, P< 0.00005.

[0030] Figures 4A-4F depict in situ vaccination with CXCL9 / 10-DC inhibits murine lung cancer. (A) A schematic of in vivo mouse efficacy studies. On Day 6 (D6) post subcutaneous (SC) tumor inoculation, mice bearing ~50mm3tumors were randomized and subjected to treatments as detailed in STAR Methods via intratumoral (IT) injections on D6, D8 and D11. Tumor volumes were recorded every 2-3 days and tumor weights were measured on the day of euthanasia. (B) FVB mice were inoculated with KrasG12DTp53- / -Lkb1- / -(KPL)-3M tumor cells (1.25x105cells) and treated with i) PBS control; ii) CXCL9 and CXCL10 recombinant proteins at 20 ng each / injection; iii) Vector-transduced DC (Mock-DC, 2x106 / injection); or iv) CXCL9 / 10-DC (1x106CXCL9-DCand CXCL10-DC each / injection) (n=6-8 mice per group). (C) FVB mice were inoculated with KPL-3M tumor cells and treated with i) PBS control; ii) CXCL9-DC (2x106 / injection); iii) CXCL10-DC (2x106 / injection); or iv) CXCL9 / 10-DC as in B. (D) FVB mice were inoculated with KrasG12DTp53^^^^(KP)-3M tumor cells (2x106cells) and treated with i) PBS control; or ii) CXCL9 / 10-DC as in B. (E)129-E mice were inoculated with LKR13 (KrasG12D) tumor cells (2x106cells) and treated as in D. (F) BALB / c mice were inoculated with L1C2 tumor cells (1x106cells) and treated as in D (n=5-6 mice per group). Error bars represent SEM. P values were determined by one-way ANOVA adjusting for multiple comparisons for panels B-C, and two-tailed t-test for panels D-F. *, P<0.05; **, P< 0.005; ***, P< 0.0005.

[0031] Figures 5A-5E depict in vivo lifespan of DC following IT injections and immediate immune responses. Related to Figure 3. FVB mice were inoculated subcutaneously (SC) with 1.5x105KPL-3M cells. On D8 post inoculation, tumors were IT injected with PBS control (blue), 1x106CellTracker Red-labelled mock-DC (green), or CXCL9 / 10-DC (red) (n=6-8 mice per group). Tumors were harvested at designated timepoints post IT injections for flow cytometry and ELISA. (A) Frequency of Red-labelled DCs in the tumor as a percent of total CD45+cells and viability of labelled DC by Zombie staining. (B) Levels of CXCL9 and CXCL10 in the tumor at 24h and 48h post IT injections were analyzed by ELISA with total tumor extracts. (C) Frequency of endogenous cDC1s and cDC2s in the tumor as a percent of total CD45+cells 24h post DC injection. (D) Frequency of endogenous CD4+and CD8+T cells in the tumor as a percent of total CD45+cells 48h post DC injection. (E) CXCR3 expression in tumor infiltrating CD4+and CD8+T cells at 48h post IT injections. Error bars represent SEM. P values were determined by one-way ANOVA, adjusting for multiple comparisons. ns, not significant; *, P<0.05; **, P< 0.005; ***, P< 0.0005.

[0032] Figures 6A-6D depict in situ vaccination with CXCL9 / 10-DC facilitates T cell recruitment and activation required for the anti-tumor efficacy. (A) CXCL9 / 10-DC therapy-induced changes in CD8+T cells. Tumors were collected on D14 post inoculation (1.25x105KPL-3M inoculated SC in FVB mice) following treatment with PBS control or CXCL9 / 10-DC (IT 1x106CXCL9-DC and CXCL10-DC each / injection on D6, D8 and D11) (n=5-6 mice per group). CD8 naïve-like, CD8+CD44-CD62L+; CD8 effector, CD8+CD44+CD62L-. (B) CXCL9 / 10-DC therapy-induced changes in CD4+T cells revealed by flow cytometry as in A. CD4 Tconv, CD4+FOXP3+; CD4Treg, CD4+FOXP3+; CD4 naïve-like, CD4+CD44+CD62L+; CD4 effector, CD4+CD44+CD62L-. (C) CD8+T cells are required for CXCL9 / 10-DC-driven anti-tumor efficacy. On D6 post tumor inoculation (1.25x105KPL-3M inoculated SC), FVB mice bearing ~50mm3tumors were randomized and treated with i) PBS + isotype control; ii) CXCL9 / 10-DC (IT 1x106CXCL9-DC and CXCL10-DC each / injection on D6, D8 and D11) + isotype; iii) PBS + anti-mouse CD8 [200µg IP injection every two days starting on D6 until the end of the study]; or iv) CXCL9 / 10-DC + anti- mouse CD8 as detailed above (n=6-8 mice per group). (D) CD4+T cells are required for CXCL9 / 10-DC-driven anti-tumor efficacy. Same as in C except that anti-mouse CD4 was utilized. Error bars represent SEM. P values were determined by two-tailed t-test for panels A-B and one- way ANOVA adjusting for multiple comparisons for panels C-D. n.s., not significant; *, P<0.05; **, P< 0.005, ***, P< 0.0005, ****, P< 0.00005.

[0033] Figures 7A-7F depict flow phenotyping of immune cell subpopulations following CXCL9 / 10-DC therapy. Related to Figure 6. (A) Flow cytometry gating strategy of T and NK cells in the tumor. (B) Flow cytometry gating strategy of myeloid cells in the tumor. (C) Tumors were collected on D14 post inoculation (1.25x105KPL-3M delivered SC in FVB mice) following treatment with PBS control or CXCL9 / 10-DC (IT 1x106CXCL9-DC and CXCL10-DC each / injection on D6, D8 an D11) (n=6-8 mice per group). A significant increase in NKT (CD45+CD3+CD49b+) but not NK (CD45+CD3-CD49b+) cells was observed in response to CXCL9 / 10-DC treatment. (D) No significant changes in monocytes (CD45+MHCIIloCD11b+Ly6C+), macrophages (CD45+MHCIIhiCD64+), cDC1 (CD45+MHCIIhiCD11c+XCR1+CD11b-), cDC2 (CD45+MHCIIhiCD11c+XCR1-CD11b+) or neutrophils (CD45+MHCIIloCD11b+Ly6G+Ly6Clo) were observed in the same experiment as in C. (E) FVB mice were treated with an anti-mouse CD8 depleting antibody (200µg / IP injection) on D0. Mouse blood PBMC was collected on D2, D5 and D8 for flow cytometry measurement of CD8+T cells to confirm depletion (n=4-5 mice per group). (F) CD4+T cell depletion was confirmed by flow cytometry as in E. Error bars represent SEM. P values were determined by unpaired t-test for panels C-D, or one-way ANOVA, adjusting for multiple comparisons for panels E-F. *, P<0.05; **, P< 0.005; ****, P< 0.00005.

[0034] Figures 8A-8C depict T cell recruitment from LN is essential for CXCL9 / 10-DC-mediated anti-tumor efficacy. (A) Flow phenotyping of T cells in tumor draining lymph nodes (TDLNs)following CXCL9 / 10-DC therapy. TDLNs were collected on D16 post inoculation (1.25x105KPL-3M delivered SC in FVB mice) following treatment with PBS control or CXCL9 / 10-DC (IT 1x106CXCL9-DC and CXCL10-DC each / injection on D6, D8 and D11) (n=6-8 mice per group). (B) CXCR3+T cells are required for CXCL9 / 10-DC-mediated anti-tumor efficacy. On D6 post tumor inoculation (1.25x105KPL-3M delivered SC in FVB mice), mice bearing ~50mm3tumors were randomized and treated with i) PBS + isotype; ii) CXCL9 / 10-DC (IT 1x106CXCL9-DC and CXCL10-DC each / injection on D6, D8 and D11) + isotype; iii) PBS + anti-CXCR3 (IP at 200 µg / injection) every other day until the end of the study; or iv) CXCL9 / 10-DC + anti-CXCR3 as above (n=6-8 mice per group). (C) T cell migration from LN is required for CXCL9 / 10-DC- mediated anti-tumor efficacy. Same as in B except that fingolimod (FTY720) at 2mg / kg (IP every other day) instead of anti-CXCR3 was utilized. Error bars represent SEM. P values were determined by two-tailed t-test for panel A and one-way ANOVA adjusting for multiple comparisons for panels B-C. *, P<0.05; **, P< 0.005; ***, P< 0.0005; ****, P< 0.00005.

[0035] Figures 9A-9H depict spatial analysis of T cell recruitment following CXCL9 / 10-DC treatment by Multiplex immunofluorescence (MIF). Tumors were collected on D14 and D23 post inoculation (1.25x105KPL-3M delivered SC in FVB mice) following treatment with PBS control or CXCL9 / 10-DC (IT 1x106CXCL9-DC and CXCL10-DC each / injection on D6, D8 and D11) (n=6-8 mice per group). Tumor tissues were fixed and embedded for MIF staining, followed by quantification utilizing the InForm software (Akoya). (A) A representative image of a tumor section stained with a 7-plex MIF panel (CD4, CD8, GzmB, FOXP3, Ki67, PanC / K and DAPI). (B) Representative images of D23 control and CXCL9 / 10-DC-treated tumors stained with the same panel as in A. (C-H) Changes in the enumeration of CD8+T cells (C), CD4+T cells (D), %CD4+FOXP3+T cells of total CD4+T cells (E), GzmB+CD8+T cells (F), Ki67+CD8+(G) and Ki67+CD4+T cells (H), following treatment with control (blue) or CXCL9 / 10-DC (red) from D14 and D23 at 200µm intervals relative to the tumor border (n=6-8 mice per group). Intratumoral space is shaded in contrast to the peritumoral space. Error bars represent SEM. P values were determined by two-tailed t-test for panels C-H. *, P<0.05; **, P< 0.005; ***, P< 0.0005; ****, P< 0.00005. Colored asterisks over the bar represent the statistics for longitudinal changes from D14 to D23 of each group.

[0036] Figure 10 depicts quantification methods of spatial analysis and T cell recruitmentfollowing CXCL9 / 10-DC. Related to Figure 9. Tumors were collected on D14 and D23 post inoculation (1.25x105KPL-3M delivered SC in FVB mice) following treatment with PBS control or IT CXCL9 / 10-DC (1x106CXCL9-DC and CXCL10-DC each / injection on D6, D8 and D11) (n=6-8 mice per group). Tumor tissues were fixed and embedded for MIF staining, followed by cell segmentation and quantification. Spatial infiltration of a given cell type at 200µm intervals was quantified relative to the tumor border (indicated by green line) and corresponding neighboring regions (labeled as intratumoral and peritumoral).

[0037] Figures 11A-11F show that CXCL9 / 10-DC potentiates ICB immunotherapy in murine NSCLC models. (A) CXCL9 / 10-DC enhances the efficacy of anti-PD-1. On D6 post tumor inoculation (1.25x105KPL-3M delivered SC), FVB mice bearing ~50mm3tumors were randomized and treated with i) PBS control; ii) CXCL9 / 10-DC (IT 1x106CXCL9-DC and CXCL10-DC each / injection on D6, D8 and D11); iii) anti-PD-1 (IP injections at 200 μg / injection on D6, D8, D11 and D14); or iv) the combination of ii) and iii) (n=6-8 mice per group). Tumor growth curves and tumor weights at the time of euthanasia are presented. (B) Same as in A except that mice were SC inoculated with 1x1051940A-KPL tumor cells. (C) In-depth scRNA-seq analysis identifies distinct CD8+T cell subtypes (cells pooled from 5 tumors per group). Lineage trajectory interference (TI) analysis of CD8+T cell changes following various treatments. (D) Spatial quantification of CD8+Ki67+and CD8+GzmB+T cells were performed on D23 per Figure S6 (n=6-8 mice per group). (E) Therapy-induced changes in CD4+T cells revealed by scRNA- seq. Same as in C. (F) Spatial quantification of CD4+Ki67+and FOXP3+Treg cells. Same as in D. Error bars represent SEM. P values were determined by one-way ANOVA, adjusting for multiple comparisons for panels A-B and two-tailed t-test for panels D and F. *, P<0.05; **, P< 0.005; ***, P< 0.0005; ****, P< 0.00005.

[0038] Figures 12A-12I depict anti-tumor activities of CXCL9 / 10-DC therapy in combination with ICB, and therapy-induced immune changes in the TME. Related to Figure 11. (A) CXCL9 / 10- DC enhances the efficacy of anti-PD-L1. On D6 post tumor inoculation (1.25x105KPL-3M delivered SC), FVB mice bearing ~50mm3tumors were randomized and treated with i) PBS control; ii) CXCL9 / 10-DC (IT 1x106CXCL9-DC and CXCL10-DC each / injection on D6, D8 and D11); iii) anti-PD-L1 (IP injections at 200 μg / injection on D6, D8, D11 and D14); or iv) the combination of ii) and iii) (n=6-8 mice per group). Tumor growth curves and tumor weights at thetime of euthanasia are presented. (B) CXCL9 / 10-DC treatment reduces tumor density in the KPL- 3M model. H&E staining (top) was performed on representative tumors from each treatment group (n=6-8 mice per group) as indicated (top), while single-plex immunofluorescence (bottom) was performed on tumor sections utilizing PanC / K to evaluate tumor density. (C) Quantification of %Tumor area as defined by PanC / K positive regions in relation to total tissue area across the four treatment groups in the KPL-3M model. (D) CXCL9 / 10-DC and anti-PD-1 combination therapy inhibits lung metastasis in the 1940A-KPL model. Lung tissues from the control and combination treatment groups were harvested at the end of the study in the same experiment as described in Figure 11B, digested to single cells, and cultured in vitro for 10 days (n=4 per group). Tumor cells were then quantified by a luciferase assay measuring the genetically engineered Luc in tumor cells. (E) Therapy-induced changes in CD45+immune population of each treatment group as measured by single cell RNA sequencing (scRNA-seq) analysis of sorted CD45+cells (pooled from 5 tumors per group). A total of 31,948 cells passed quality control and clustered into nine major clusters, including epithelial cells, fibroblasts, plasma cells, plasmacytoid DCs (pDC), NK cells, T cells, B cells, neutrophils, and myeloid cells other than neutrophils (MoMacDC). (F) The expression of signature genes in each subcluster of CD8+T cells revealed by scRNA-seq. (G) Flow cytometry of CD8+IFNγ+and CD8+IFNγ+TNFα+effector T cells following CXCL9 / 10-DC and anti-PD-1 combination therapy when compared to control at D23 (n=6-8 mice per group). (H) The expression of signature genes in each subcluster of CD4+T cells revealed by scRNA-seq. (I) Flow cytometry of CD4+IFNγ+Th1 effector cells and CD4+IL-4+Th2 effector cells following CXCL9 / 10-DC and anti-PD-1 as in G. Error bars represent SEM. P values were determined by one-way ANOVA adjusting for multiple comparisons (A, C) or unpaired t-test (D, G, I). *, P<0.05; **, P< 0.005; ***, P< 0.0005; ****, P< 0.00005.

[0039] Figures 13A-13D show that CXCL9 / 10-DC and anti-PD-1 combination treatment generates systemic tumor-specific immunity. (A-B) Therapy-induced systemic changes in (A) CD8+or (B) CD4+T cells revealed by flow phenotyping. Spleens were collected on D16 post inoculation (1.25x105KPL-3M delivered SC in FVB mice) following treatment with i) PBS control; ii) CXCL9 / 10-DC (IT 1x106CXCL9-DC and CXCL10-DC each / injection on D6, D8 and D11); iii) anti-PD-1 (IP injections at 200μg / injection on D6, D8, D11 and D14); or iv) the combination of ii) and iii) (n=6-8 mice per group). Single cell suspensions were prepared andsubjected to flow cytometry. Central memory (CM), CD44+CD62L+; effector memory (EM), CD44+CD62L-. (C) FVB mice were inoculated bilaterally with 1.25x105KPL-3M cells. On D6 mice bearing ~50mm3tumors were randomized and treated ipsilaterally with i) PBS control; ii) CXCL9 / 10-DC (IT 1x106CXCL9-DC and CXCL10-DC each / injection on D6, D8 and D11); iii) anti-PD-1 (IP injections at 200 μg / injection on D6, D8, D11 and D14); or iv) the combination of ii) and iii) (n=7-9 mice per group). Tumor growth curves and tumor weights at the time of euthanasia from treated (ipsilateral) and untreated (contralateral) tumors are presented. (D) CXCL9 / 10-DC and anti-PD-1 combination treatment generates systemic tumor-specific immune memory. FVB mice cured of KPL-3M tumors following combination therapy were inoculated with 2.5x105KPL-3M tumor cells on the contralateral side, 90 days after tumor rejection (n=5 mice per group). In vivo bioluminescence imaging (IVIS) was utilized to monitor tumor growth through the luciferase reporter genetically engineered in the KPL-3M cells. The specificity of systemic anti- tumor immune memory is shown as a Kaplan-Meier plot of (E) KPL-3M cells or (F) syngeneic MyC-CaP cells. Error bars represent SEM. P values were determined by one-way ANOVA, adjusting for multiple comparisons for panels A-C. *, P<0.05; **, P< 0.005; ***, P< 0.0005; ****, P< 0.00005.

[0040] Figures 14A-14B show that CXCL9 / 10-DC and anti-PD-1 combination treatment induces systemic immune changes. Related to Figure 13. Therapy-induced systemic reduction in (A) CD8+or (B) CD4+naïve T cells revealed by flow phenotyping. Spleens were collected on D16 post inoculation (1.25x105KPL-3M delivered SC in FVB mice) following treatment with i) PBS control; ii) CXCL9 / 10-DC (IT 1x106CXCL9-DC and CXCL10-DC each / injection on D6, D8 and D11); iii) anti-PD-1 (IP injections at 200μg / injection on D6, D8, D11 and D14); or iv) the combination of ii) and iii) (n=6-8 mice per group). Single cell suspensions were prepared and subjected to flow cytometry. Naïve, CD44-CD62L+. Error bars represent SEM. P values were determined by one-way ANOVA adjusting for multiple comparisons. *, P<0.05; **, P< 0.005; ***, P< 0.0005; ****, P< 0.00005. DETAILED DESCRIPTION

[0041] The present subject matter may be understood more readily by reference to the following detailed description which forms a part of this disclosure. It is to be understood that this disclosure is not limited to the specific products, methods, conditions or parameters described and / or shownherein, and that the terminology used herein is for the purpose of describing particular embodiments by way of example only and is not intended to be limiting of the claims.

[0042] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

[0043] As employed above and throughout the disclosure, the following terms and abbreviations, unless otherwise indicated, shall be understood to have the following meanings.

[0044] In the present disclosure, the singular forms "a," "an," and "the" include the plural reference, and reference to a particular numerical value includes at least that particular value, unless the context clearly indicates otherwise. Thus, for example, a reference to "a compound" is a reference to one or more of such compounds and equivalents thereof known to those skilled in the art, and so forth. The term "plurality", as used herein, means more than one. When a range of values is expressed, another embodiment includes from the one particular and / or to the other particular value.

[0045] Similarly, when values are expressed as approximations, by use of the antecedent "about," it is understood that the particular value forms another embodiment. All ranges are inclusive and combinable. In the context of the present disclosure, by "about" a certain amount it is meant that the amount is within ± 20% of the stated amount, or preferably within ± 10% of the stated amount, or more preferably within ± 5% of the stated amount.

[0046] As used herein, the terms “treat”, “treatment”, or “therapy” (as well as different forms thereof) refer to therapeutic treatment, including prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological change associated with a disease or condition. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of the extent of a disease or condition, stabilization of a disease or condition (i.e., where the disease or condition does not worsen), delay or slowing of the progression of a disease or condition, amelioration or palliation of the disease or condition, and remission (whether partial or total) of the disease or condition, whether detectable or undetectable.Those in need of treatment include those already with the disease or condition as well as those prone to having the disease or condition or those in which the disease or condition is to be prevented.

[0047] As used herein, the terms "component," "composition," “formulation”, "composition of compounds," "compound," "drug," "pharmacologically active agent," "active agent," "therapeutic," "therapy," "treatment," or "medicament," are used interchangeably herein, as context dictates, to refer to a compound or compounds or composition of matter which, when administered to a subject (human or animal) induces a desired pharmacological and / or physiologic effect by local and / or systemic action. A personalized composition or method refers to a product or use of the product in a regimen tailored or individualized to meet specific needs identified or contemplated in the subject.

[0048] The terms "subject," "individual," and "patient" are used interchangeably herein, and refer to an animal, for example a human, to whom treatment with a composition or formulation in accordance with the present disclosure, is provided. The term "subject" as used herein refers to human and non-human animals. The terms "non-human animals" and "non-human mammals" are used interchangeably herein and include all vertebrates, e.g., mammals, such as non-human primates, (particularly higher primates), sheep, dog, rodent, (e.g., mouse or rat), guinea pig, goat, pig, cat, rabbits, cows, horses and non-mammals such as reptiles, amphibians, chickens, and turkeys. The compositions described herein can be used to treat any suitable mammal, including primates, such as monkeys and humans, horses, cows, cats, dogs, rabbits, and rodents such as rats and mice. In one embodiment, the mammal to be treated is human. For the uses in non-humans, the species appropriate sequences (polypeptide, polynucleotide) of CXCL9 and / or CXCL10 are used; for antibodies to immune checkpoint inhibitors, antibodies to the species appropriate immune checkpoint. For cell based delivery, the species appropriate cells are used. The human can be any human of any age. In an embodiment, the human is an adult. In another embodiment, the human is a child. The human can be male, female, pregnant, middle-aged, adolescent, or elderly. According to any of the methods of the present disclosure and in one embodiment, the subject is human. In another embodiment, the subject is a non-human primate. In another embodiment, the subject is murine, which in one embodiment is a mouse, and, in another embodiment is a rat. In another embodiment, the subject is canine, feline, bovine, equine, laprine or porcine. In anotherembodiment, the subject is mammalian.

[0049] Conditions and disorders in a subject for which a particular drug, compound, composition, formulation (or combination thereof) is said herein to be "indicated" are not restricted to conditions and disorders for which that drug or compound or composition or formulation has been expressly approved by a regulatory authority, but also include other conditions and disorders known or reasonably believed by a physician or other health or nutritional practitioner to be amenable to treatment with that drug or compound or composition or formulation or combination thereof.

[0050] The present disclosure evaluated in situ vaccination with CXCL9 / 10-engineered DC (CXCL9 / 10-DC) in combination with immune checkpoint blockade (ICB) immunotherapies as a novel strategy to promote anti-tumor immune responses as well as to enhance the efficacy of ICB immunotherapies in murine NSCLC models. It was found that intratumoral (IT) CXCL9 / 10-DC leads to enhanced T cell infiltration and activation in the tumor microenvironment (TME), resulting in effective tumor growth inhibition in multiple murine NSCLC models. IT CXCL9 / 10- DC-induced anti-tumor effects are dependent on CD4 and CD8 T cells, CXCR3, and T cell trafficking from the lymph node (LN). It was found that IT CXCL9 / 10-DC, in combination with PD-1 or PD-L1 inhibition, overcomes ICB resistance in a LKB1-null murine model and establishes tumor-specific immune memory indicative of systemic anti-tumor immunity. These studies provide a mechanistic understanding of IT CXCL9 / 10-DC-mediated host immune activation as monotherapy or in combination with anti-PD-1 / PD-L1. These findings provide evidence supporting the clinical translation of IT CXCL9 / 10-DC as a novel strategy to overcome resistance and to enhance clinical efficacy of ICB immunotherapy in NSCLC. In some embodiments, identifying low expression of CXCL9 / 10 provides the rationale for treatment with the combination disclosed herein.

[0051] Despite the unprecedented progress made in immunotherapy as standard-of-care for cancer patients in recent years, therapeutic resistance is still the major hurdle to achieve durable responses in the majority of patients. Recent studies reveal that impaired tumor antigen presentation and an immunosuppressive TME are correlated with resistance to ICB. Strategies that enhance tumor antigen presentation and promote tumor-specific T cell responses hold significant potential for augmenting the efficacy of ICB in NSCLC refractory to ICB immunotherapy, among othertumors. In one embodiment, one approach to improve the efficacy of ICB is in situ vaccination with chemokine gene-modified functional DC to restore tumor antigen presentation and ameliorate the immunosuppressive TME. Given the essential role of the CXC9 / 10-CXCR3 signaling axis in promoting both T cell infiltration and optimal T cell activation in the TME, as well as orchestrating a productive anti-tumor immune response, the IT CXCL9 / 10-DC vaccination strategy was evaluated in preclinical NSCLC models. It was demonstrate that 1) IT CXCL9 / 10-DC elicits an anti-tumor effect as a monotherapy in multiple murine models of lung cancer and enhances the efficacy of anti-PD-1 in a resistant murine NSCLC model with the establishment of tumor-specific immune memory; 2) IT CXCL9 / 10-DC promotes T cell infiltration and activation alone or in combination with anti-PD-1, revealed by MIF, flow cytometry and scRNA-seq; and 3) Both CD4+ and CD8+ T cells and trafficking from TDLN are required for IT CXCL9 / 10-DC-mediated anti- tumor efficacy as evident by depletion studies. These studies provide compelling evidence that IT CXCL9 / 10-DC could be a viable strategy to overcome resistance to ICB in NSCLC, in particular in those patients whose tumors demonstrate a paucity of CXCL9 / 10 chemokines.

[0052] The analysis of the CXCL9 / 10-CXCR3 axis gene expression signature from the TCGA dataset suggests an array of interactions with multiple immune cell subtypes. High expression of this signature correlates with activated DCs and M1 macrophages, consistent with the secretion of chemokines by these cell types following anti-tumor activation. The CXCL9 / 10 signature also correlates with a higher T cell infiltration signature. As seen in Figure 2A, however, not all tumors with high CXCL9 / 10 expression have high T cell infiltration, suggesting that elevated CXCL9 / 10 expression alone may not be sufficient for optimal immune activation. This may be due to a lack of antigen presentation, the presence of immunosuppressive factors in the TME or an inadequate signal to recruit activated T cells. One potential caveat of the TCGA database is that the tumor specimen collection prioritized high tumor cell content; therefore, TCGA biobank may under- represent immune cells in the TME. Although TCGA provides insight into the significance of the CXCL9 / 10-CXCR3 axis in lung cancer, future studies are required to identify additional determinants of immune responses that focus on genetic drivers and tumor heterogeneity.

[0053] In situ vaccination with CXCL9 / 10-DC effectively promotes anti-tumor T cell responses in a variety of NSCLC murine models. Increased effector state and PD-1 activation suggest engagement with tumor cells reflected in the decrease of tumor growth. Spatial analysis of theKPL-3M tumor model demonstrated dense tumor growth with a leading tumor edge, accurately reflecting previous findings of an immunosuppressive environment devoid of T cells. T cell activation was observed predominantly at the leading tumor edge, suggesting that tumor eradication may be initiated at the leading edge while T cells may not necessarily need to penetrate the tumor to elicit cytolytic activities. Specific activation of CD8+ granzyme B+ T cells potentially contributed to tumor burden reduction while activated CD4+ T cells were prevalent across multiple tumor regions. In-depth subtyping of these CD4+ T cells by scRNA-seq revealed a preference for a Th2 response. This aligns with the TCGA data indicating a stronger correlation with Th2 CD4+ T cells in LUAD, while the functional importance of the Th2 subtype in CXCL9 / 10-DC-mediated anti-tumor effect is currently unknown. Future studies will investigate the prominent role of CD4+ subtypes in mediating therapeutic response by functional assays and genetic approaches. Direct inhibition of tumor growth or indirect activation of other anti-tumor immune cell types are potential components of CD4+ T cell-mediated responses.

[0054] The present studies demonstrate that CXCL9 / 10-DC therapy is dependent on T cell recruitment from TDLN, which highlights the importance of the chemokine gradient for a successful immune response. As previously shown, IT-injected DCs have a limited persistence. Despite this limited persistence, it is anticipated that the CXCL9 / 10-DC vaccination therapy will initially recruit T cells to initiate immune response that will overcome the immunosuppressive TME, which can be further potentiated by the restoration of tumor antigen presentation by DC. Future studies will assess longitudinal trafficking of injected versus endogenous DCs and the accompanying changes in T cell recruitment in the TME and TDLN.

[0055] Previous studies have highlighted the role and importance of immune checkpoint blockade (ICB) in maintaining an effective T cell immune response. In situ CXCL9 / 10-DC monotherapy, though successful in recruiting activated T cells, still leaves tumors susceptible to checkpoint inhibition. T cells recruited by CXCL9 / 10-DC benefit from ICB, leading to an improved and prolonged anti-tumor response. In turn, ICB benefits from the increased recruitment of T cells that were previously suppressed by the PD-1 / PD-L1 interaction. The 30% cure rate attests to the benefit of this combination therapy where systemic tumor-specific memory was demonstrated. In contrast, not all mice respond to combination treatment, thus requiring further investigation into whether tumor heterogeneity and clonal evolution can provide insight into mechanisms of escape. Althoughthere was an increase in recruited T cells and activation status, not all recruited T cells expressed activation markers, suggesting the recruitment of bystander T cells.

[0056] A recent landmark study of large-scale metadata analysis revealed that CXCL9 expression and TMB were the strongest predictors of response to ICB. Other studies further show that somatic copy-number alterations (SCNAs) can be associated with loss of CXCL9 / 10, immune suppression, cytotoxic lymphocyte depletion in the tumor and failure to respond to ICB. This suggests that aneuploid-dependent immune suppression may require the addition of chemokines for effective therapy in patients who lack CXCL9 / 10, which may be crucial for shaping the initial immune cell infiltration and host anti-tumor response. Preclinical studies and a phase I trial in NSCLC have shown that IT injection of DC secreting C-C motif chemokine ligand 21 (CCL21-DC), a chemokine promoting co-localization of naïve T cells and antigen- experienced DC, can enhance tumor infiltration of CD8+ T cells and promote systemic tumor- specific immune responses. Combination therapy of IT CCL21-DC plus anti-PD-1 is currently being evaluated in NSCLC patients resistant to prior ICB therapy (NCT03546361). Preclinical studies showed that the IT CCL21-DC therapy was dependent on the expression of CXCL9 / 10. The present studies provide preclinical evidence in support of the clinical investigation of IT CXCL9 / 10-DC therapy as an innovative strategy to potentiate the efficacy of ICB and overcome resistance in NSCLC, particularly in those patients whose tumors demonstrate a paucity of CXCL9 / 10 chemokines.

[0057] One approach to overcome the immunosuppressive tumor microenvironment (TME) is to utilize in situ vaccination with chemokine gene-modified functional antigen presenting cells (APCs) to enhance tumor antigen presentation and promote tumor-specific T cell activation. It has been shown that the chemokines CXCL9 and CXCL10 are important signaling molecules secreted by CD103+ dendritic cells (DCs) to recruit effector T cells and orchestrate effective anti-tumor immunity. Furthermore, CXCL9 / 10 (i.e., one or the combination of CXCL9 and CXCL10) have anti-angiogenic properties, which can shift the angiogenic balance from tumor-induced angiogenesis to angiostasis. Thus, in one embodiment, a method of treatment is described herein using IT injection of CXCL9 / 10-secreting DCs (CXCL9 / 10-DCs) to potentiate the response to anti-PD-1 therapy. In one embodiment an immune checkpoint inhibitor such as but not limited to anti-PD-1 therapy is co-administered. Using a genetically engineered murine model (GEMM) of lung cancer bearing increased tumor mutational burden (TMB) recapitulating the mutationallandscape of clinical NSCLC, the efficacy of the cell-based therapy and the combination therapy are demonstrated. In situ vaccination with CXCL9 / 10-DC may become an effective approach to sensitize non-responsive NSCLC to anti-PD-1 / PD-L1 immunotherapy. Efficacy in low mutational burden tumors as well as in high mutational burden tumors is provided. CXCL9 / 10

[0058] CXCL9 and CXCL10 useful in the methods disclosed herein encompass both naturally occurring polypeptides as well as variations and modified forms thereof.

[0059] CXCL9 / 10 as used herein refers to the chemokines CXCL9 or CXCL10, or their combination, and may refer to them individually or combination in the form of polypeptides, polynucleotides, or cells comprising one or both polynucleotides and / or expressing one or both polypeptides. CXCL9 / 10 also refers to any combination of any of the foregoing, such as the combination of CXCL9 and CXCL10 polypeptides, the combination of CXCL9 and CXCL10 polynucleotides, the combination of cells, one comprising the CXCL9 polynucleotide and one comprising the CXCL10 polynucleotides; and in other combinations, such as CXCL9 polypeptide and a cell expressing CXCL10, CXCL10 polypeptide and a cell comprising CXCL9 polynucleotide. Moreover, each of CXCL9 or CXCL10 in any of the polypeptide, polynucleotide or cell forms may be used individually in the practice of the disclosure, or in combination.

[0060] Chemokine (C-X-C motif) ligand 9 (CXCL9) is a small cytokine (11.7 kDa) belonging to the CXC chemokine family that is also known as Monokine induced by gamma interferon (MIG). CXCL9 is one of the chemokines that plays role to induce chemotaxis, promote differentiation and multiplication of leukocytes, and cause tissue extravasation. The human CXCL9 chemokine amino acid sequence is depicted in SEQ ID NO:1. The murine CXCL9 chemokine amino acid sequence is depicted in SEQ ID NO:2.

[0061] The amino acid sequence for human CXCL9 is: MKKSGVLFLL GIILLVLIGV QGTPVVRKGR CSCISTNQGT IHLQSLKDLK QFAPSPSCEK IEIIATLKNG VQTCLNPDSA DVKELIKKWE KQVSQKKKQK NGKKHQKKKV LKVRKSQRSR QKKTT (SEQ ID NO:1).

[0062] The amino acid sequence for murine CXCL9 is: MKSAVLFLLG IIFLEQCGVR GTLVIRNARC SCISTSRGTI HYKSLKDLKQ FAPSPNCNKT EIIATLKNGD QTCLDPDSAN VKKLMKEWEK KISQKKKQKR GKKHQKNMKN RKPKTPQSRR RSRKTT (SEQ ID NO:2).

[0063] In one non-limiting example, a polynucleotide encoding human CXCL9 has the sequence: ATGAAGAAAAGTGGTGTTCTTTTCCTCTTGGGCATCATCTTGCTGGTTCTGATTGGAG TGCAAGGAACCC CAGTAGTGAGAAAGGGTCGCTGTTCCTGCATCAGCACCAACCAAGGGACTATCCAC CTACAATCCTTGAA AGACCTTAAACAATTTGCCCCAAGCCCTTCCTGCGAGAAAATTGAAATCATTGCTAC ACTGAAGAATGGA GTTCAAACATGTCTAAACCCAGATTCAGCAGATGTGAAGGAACTGATTAAAAAGTG GGAGAAACAGGTCA GCCAAAAGAAAAAGCAAAAGAATGGGAAAAAACATCAAAAAAAGAAAGTTCTGAA AGTTCGAAAATCTCA ACGTTCTCGTCAAAAGAAGACTACATAA (SEQ ID NO: 5).

[0064] In one non-limiting example, a polynucleotide encoding murine CXCL9 has the sequence: ATGAAGTCCGCTGTTCTTTTCCTCTTGGGCATCATCTTCCTGGAGCAGTGTGGAGTTC GAGGAACCCTAG TGATAAGGAATGCACGATGCTCCTGCATCAGCACCAGCCGAGGCACGATCCACTAC AAATCCCTCAAAGA CCTCAAACAGTTTGCCCCAAGCCCCAATTGCAACAAAACTGAAATCATTGCTACACT GAAGAACGGAGAT CAAACCTGCCTAGATCCGGACTCGGCAAATGTGAAGAAGCTGATGAAAGAATGGGAAAAGAAGATCAGCC AAAAGAAAAAGCAAAAGAGGGGGAAAAAACATCAAAAGAACATGAAAAACAGAA AACCCAAAACACCCCA AAGTCGTCGTCGTTCAAGGAAGACTACATAA (SEQ ID NO:6).

[0065] C-X-C motif chemokine 10 (CXCL10) also known as interferon gamma-induced protein 10 (IP-10) or small-inducible cytokine B10, is an 8.7 kDa protein that in humans is encoded by the CXCL10 gene. The human CXCL10 chemokine amino acid sequence is depicted in SEQ ID NO:3. The murine CXCL10 chemokine amino acid sequence is depicted in SEQ ID NO:4.

[0066] The amino acid sequence of human CXCL10 is: MNQTAILICC LIFLTLSGIQ GVPLSRTVRC TCISISNQPV NPRSLEKLEI IPASQFCPRV EIIATMKKKG EKRCLNPESK AIKNLLKAVS KERSKRSP (SEQ ID NO:3)

[0067] The amino acid sequence of murine CXCL10 is: MNPSAAVIFC LILLGLSGTQ GIPLARTVRC NCIHIDDGPV RMRAIGKLEI IPASLSCPRV EIIATMKKND EQRCLNPESK TIKNLMKAFS QKRSKRAP (SEQ ID NO:4)

[0068] In one non-limiting example, a polynucleotide encoding human CXCL10 has the sequence: ATGAATCAAACTGCCATTCTGATTTGCTGCCTTATCTTTCTGACTCTAAGTGGCATTC AAGGAGTACCTC TCTCTAGAACTGTACGCTGTACCTGCATCAGCATTAGTAATCAACCTGTTAATCCAA GGTCTTTAGAAAA ACTTGAAATTATTCCTGCAAGCCAATTTTGTCCACGTGTTGAGATCATTGCTACAATG AAAAAGAAGGGT GAGAAGAGATGTCTGAATCCAGAATCGAAGGCCATCAAGAATTTACTGAAAGCAGT TAGCAAGGAAAGGT CTAAAAGATCTCCTTAA (SEQ ID NO:7).

[0069] In one non-limiting example, a polynucleotide encoding murine CXCL10 has thesequence: ATGAACCCAAGTGCTGCCGTCATTTTCTGCCTCATCCTGCTGGGTCTGAGTGGGACT CAAGGGATCCCTC TCGCAAGGACGGTCCGCTGCAACTGCATCCATATCGATGACGGGCCAGTGAGAATG AGGGCCATAGGGAA GCTTGAAATCATCCCTGCGAGCCTATCCTGCCCACGTGTTGAGATCATTGCCACGAT GAAAAAGAATGAT GAGCAGAGATGTCTGAATCCGGAATCTAAGACCATCAAGAATTTAATGAAAGCGTT TAGCCAAAAAAGGT CTAAAAGGGCTCCTTAA (SEQ ID NO:8)

[0070] CXCL9 and CXCL10 include naturally occurring mammalian CXCL9 and CXCL10, and variants and fragments thereof. Preferably the CXCL9 and CXCL10 are of human or mouse origin. Most preferably the CXCL9 and CXCL10 are human CXCL9 and CXCL10.

[0071] CXCL9 and CXCL10 polypeptides for use in the methods disclosed herein can be CXCL9 or CXCL10 variants, CXCL9 or CXCL10 fragments, analogues, and derivatives.

[0072] As described elsewhere, each of these chemokines, in the form of a polypeptide, a polynucleotide, a cell comprising a polynucleotide, of either CXCL9 or CXCL10 or both, may be administered to the subject together with the checkpoint inhibitor. For example, CXCL9 may be the only chemokine used in the methods described herein, and may be administered as a polypeptide, polynucleotide or cell comprising the polynucleotide, or any combination thereof. In another example, CXCL10 may be the only chemokine used in the methods described herein, and may be administered as a polypeptide, polynucleotide or cell comprising the polynucleotide, or any combination thereof. In another example, both CXCL9 and CXCL10 are used in the methods described here but they may be administered independently as a polypeptide, polynucleotide or cell comprising a polynucleotide, or any combination thereof. In one example, CXCL9 is administered intratumorally as a polypeptide, and CXCL10 administered intratumorally as a cell comprising a polynucleotide encoding CXCL10. In one embodiment, two or three means ofdelivery may be used for one or both chemokines, for example, the polypeptide and the polynucleotide, or the polypeptide and the cell, or the polynucleotide and the cell. In other embodiments, any combination of means of delivery, routes of delivery, and dosing schedules of either or both chemokines (in any form) is embraced herein.

[0073] In one embodiment, the CXCL9 polypeptide comprises an amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2. In one embodiment, the CXCL9 polypeptide consists of an amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2. In one embodiment, the polynucleotide encoding CXCL9 polypeptide comprises the sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In one embodiment, the polynucleotide encoding CXCL9 polypeptide consists of the sequence of SEQ ID NO: 5 or SEQ ID NO: 6. In one embodiment, the CXCL10 polypeptide comprises an amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4. In one embodiment, the CXCL10 polypeptide consists of an amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 4. In one embodiment, the polynucleotide encoding CXCL10 polypeptide comprises the sequence of SEQ ID NO: 7 or SEQ ID NO: 8. In one embodiment, the polynucleotide encoding CXCL10 polypeptide consists of the sequence of SEQ ID NO: 7 or SEQ ID NO: 8. In one embodiment, a cell comprising the polynucleotide encoding the CXCL9 polypeptide comprises the sequence of SEQ ID NO:5 or SEQ ID NO:6. In one embodiment, a cell comprising the polynucleotide encoding the CXCL10 polypeptide comprises the sequence of SEQ ID NO:7 or SEQ ID NO:8. In one embodiment, a cell comprising the polynucleotide encoding the CXCL9 polypeptide and the CXCL10 polypeptide comprises the sequence of SEQ ID NO:5 or SEQ ID NO:6, and SEQ ID NO:7 or SEQ ID NO:8. Reduced expression of CXCL9 and / or CXCL10

[0074] In one embodiment, NSCLC patients with chromosome 9p loss have been shown to have reduced CXCL9 and CXCL10 in the TME that is associated with profound immunoresistance and poor response to ICB immunotherapy. Aneuploidy, also known as somatic copy number alterations (SCNAs) referring to the presence of an aberrant number of chromosomes, is highly associated with tumorigenesis. In some embodiments, chromosome 9p homozygous deletions (9p loss) are among the top 10 most common genomic alterations occurring in 21.8% of all cancers (Klockner, T.C. & Campbell, C.S. Selection forces underlying aneuploidy patterns in cancer. Mol Cell Oncol 11, 2369388 (2024). PMC11197905. PMID 38919375). In some embodiments,chromosome 9p21.3 loss is found in ~15% of LUAD and ~25% of LUSC, which eliminate CDKN2A / B tumor suppressors and often encompass co-deletions of a cluster of 16 type I IFN genes (see, for example, Klockner, T.C. & Campbell, C.S. Selection forces underlying aneuploidy patterns in cancer. Mol Cell Oncol 11, 2369388 (2024). PMC11197905. PMID 38919375; Han, G., et al. 9p21 loss confers a cold tumor immune microenvironment and primary resistance to immune checkpoint therapy. Nat Commun 12, 5606 (2021). PMC8460828. PMID 34556668; Barriga, F.M., et al. MACHETE identifies interferon-encompassing chromosome 9p21.3 deletions as mediators of immune evasion and metastasis. Nat Cancer 3, 1367-1385 (2022). PMC9701143 PMID 36344707; Alessi, J.V., et al. Impact of Aneuploidy and Chromosome 9p Loss on Tumor Immune Microenvironment and Immune Checkpoint Inhibitor Efficacy in NSCLC. J Thorac Oncol (2023). PMID 37247843). Recent studies analyzing human TCGA and clinical data demonstrate that 9p21.3 loss is associated with a profound reduction of CXCL9 / 10 in the TME, an immune-cold tumor phenotype and primary resistance to ICB in multiple cancer types (see, for example, Han, G., et al. 9p21 loss confers a cold tumor immune microenvironment and primary resistance to immune checkpoint therapy. Nat Commun 12, 5606 (2021). PMC8460828. PMID 34556668; Barriga, F.M., et al. MACHETE identifies interferon-encompassing chromosome 9p21.3 deletions as mediators of immune evasion and metastasis. Nat Cancer 3, 1367-1385 (2022). PMC9701143 PMID 36344707; Alessi, J.V., et al. Impact of Aneuploidy and Chromosome 9p Loss on Tumor Immune Microenvironment and Immune Checkpoint Inhibitor Efficacy in NSCLC. J Thorac Oncol (2023). PMID 37247843; Davoli, T., Uno, H., Wooten, E.C. & Elledge, S.J. Tumor aneuploidy correlates with markers of immune evasion and with reduced response to immunotherapy. Science 355(2017). PMC5592794. PMID 28104840; William, W.N., Jr., et al. Immune evasion in HPV(-) head and neck precancer-cancer transition is driven by an aneuploid switch involving chromosome 9p loss. Proceedings of the National Academy of Sciences of the United States of America 118(2021). PMC8126856. PMID 33952700). NSCLC patients with chromosome 9p loss showed a nearly 4-fold reduction in the ORR to ICB (7.6% vs 28.7% in WT patients from the MSKCC study, and 5.7% vs 27.2% from the DFCI study), as well as significantly shorter PFS and OS as compared to WT patients (Alessi, J.V., et al. Impact of Aneuploidy and Chromosome 9p Loss on Tumor Immune Microenvironment and Immune Checkpoint Inhibitor Efficacy in NSCLC. J Thorac Oncol (2023). PMID 37247843).

[0075] Moreover, in some embodiments, the following mechanisms may be operative in 9p loss-mediated immunosuppression supporting the treatment methods disclosed herein. IFNE is the predominant type I IFN constitutively expressed by tumor cells, which may inhibit tumorigenesis via suppression of cell proliferation, induction of cell death and / or host immune activation. Type I IFN may stimulate host anti-tumor immune responses via multiple mechanisms, including activation of: 1) NK cells that promote direct tumor killing and IFNγ production, 2) DCs that promote maturation and tumor antigen presentation functions to enhance tumor-specific T cell activation, 3) CD4+and CD8+T cells that enhance effector functions and memory differentiation, and 4) NK and effector T cells in the TME that can lead to the production of IFNγ, which can induce CXCL9 / 10 expression by tumor-residing DC, macrophages and tumor cells. Elevated CXCL9 / 10 can then promote tumor infiltration of CXCR3+NK and T cells to establish a sustained host anti-tumor immune activation. In cancers with 9p21.3 loss, diminished cancer cell IFNE expression can lead to defective immune activation and subsequent reduction of IFNγ secretion by NK and effector T cells. As prominent downstream genes of IFNγ signaling, CXCL9 / 10 production by DCs and macrophages is impaired, resulting in suppressed recruitment of CXCR3+NK and effector T cells and an immune-desert phenotype. Thus, as disclosed herein, a subject with reduced CXCL9 and or CXCL10 expression, or lack thereof, is a candidate for combination therapy using CXCL 9 and / or CXCL10 and an immune checkpoint inhibitor.

[0076] In other embodiments, deletion of JAK2 in tumors with 9p24.1 loss would lead to defective IFNγ signaling and impaired CXCL9 / 10 induction in tumor cells to further enhance the immunosuppression in the TME; such subjects are also candidates for combination therapy with CXCL9 and / or CXCL10 and an immune checkpoint inhibitor. Such mutations have been identified in melanoma as well as in head and neck squamous cell carcinoma.

[0077] Thus, as noted above, potential mechanisms of 9p loss-mediated immunosuppression via cytokines in the TME comprise the steps of: IFNs orchestrate anti-tumor immune activation in WT cells, leading to the production of CXCL9 / 10. Tumors with 9p loss have defective IFNγ secretion and IFNγ signaling activation, resulting in impaired CXCL9 / 10 production and an immune-desert phenotype. In some embodiments, vaccination with CXCL9 / 10-DC in combination with administration of an immune checkpoint inhibitor provides a strategy to overcome 9p loss- mediated immunosuppression.

[0078] In some embodiments, chromosome 9p loss can be identified through whole exosome sequencing (WES) detecting deletions of the CDKN2A and / or MTAP genes located on chromosome 9p21 (see, for example, Han, G., et al. 9p21 loss confers a cold tumor immune microenvironment and primary resistance to immune checkpoint therapy. Nat Commun 12, 5606 (2021). PMC8460828. PMID 34556668), or interphase fluorescent in situ hybridization (I-FISH) (see for example, El-Mokadem, I., et al. Chromosome 9p deletion in clear cell renal cell carcinoma predicts recurrence and survival following surgery. Br J Cancer 111, 1381-1390 (2014). PMC4183850. PMID 25137021) utilizing patients’ tumor biopsies.

[0079] In one embodiment, reduced or low or no expression of CXCL9 and / or CXCL10 as described herein embraces a defect in CXCL9 and / or CXCL10 signalling. Defective signalling by CXCL9 and / or CXCL10 thus embraces the methods disclosed herein. By way of non-limiting example, the chemokine receptor GPR182 does not induce downstream signalling (see Le Mercier et al., GPR182 is an endothelium-specific atypical chemokine receptor that maintains hematopoietic stem cell homeostasis. Proc Nat Acad Sci U S A 118(17), e2021596118 (2021). PMC8092405. PMID: 33875597; Torphy et al., GPR182 limits antitumor immunity via chemokine scavenging in mouse melanoma models. Nat Commun 13(1):97 (2022). PMID35013216. PMC PMC8748779). Thus, the reduced, poor or no signalling by a defective CXCL9 and / or CXCL10 receptor can be addressed by the methods disclosed herein. Thus, in some embodiments, a subject having reduced expression of CXCL9 and / or CXCL10 comprises a subject with defective CXCL9 and / or CXCL10 signaling. Methods for Assessing Expression Levels of CXCL9 and / or CXCL10

[0080] In some embodiments, CXCL9 and / or CXCL10 levels are determined in fresh biopsy specimens. In some embodiments, CXCL9 and / or CXCL10 levels are determined in preserved or frozen biopsy specimens, tissue blocks, thin sections, or any other material obtained from a patient and / or the tumor or TME. Methods for measuring CXCL9 and / or CXCL10 levels described herein are merely exemplary and non-limiting.

[0081] In some embodiments, initiation of combination therapy as described herein in a cancer patient is performed upon determining that the level of expression of CXCL9 and / or CXCL10 is reduced compared to the respective level of expression in a reference population of similar tumors.In some embodiments, reduced expression of CXCL9 and / or CXCL10 is no expression of CXCL9 or CXCL10. In some embodiments, reduced expression is less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or 1% of levels of one or both in a typical tumor.

[0082] In some embodiments, reduced expression of CXCL9 is no expression of CXCL9. In some embodiments, reduced expression of CXCL9 is less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or 1% of levels in a typical tumor.

[0083] In some embodiments, reduced expression of CXCL10 is no expression of CXCL10. In some embodiments, reduced expression of CXCL10 is less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or 1% of levels in a typical tumor.

[0084] In some embodiments, reduced expression of both CXCL9 and CXCL10 is no expression of CXCL9 and CXCL10. In some embodiments, reduced expression of CXCL9 and CXCL10 is independently (for each or CXCL9 and CXCL10) less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or 1% of levels in a typical tumor.

[0085] By way of non-limiting examples, CXCL9 and CXCL10 levels in the TME can be assessed by IHC of FFPE tumor biopsies (see, for example, Fukuda, Y., et al. Endogenous CXCL9 affects prognosis by regulating tumor-infiltrating natural killer cells in intrahepatic cholangiocarcinoma. Cancer Sci 111, 323-333 (2020). PMC7004525. PMID 31799781; Seitz, S., et al. CXCL9 inhibits tumour growth and drives anti-PD-L1 therapy in ovarian cancer. Br J Cancer 126, 1470-1480 (2022). PMC9090786. PMID 35314795; Kim, M., Choi, H.Y., Woo, J.W., Chung, Y.R. & Park, S.Y. Role of CXCL10 in the progression of in situ to invasive carcinoma of the breast. Sci Rep 11, 18007 (2021). PMC8429587. PMID 34504204; Bronger, H., et al. CXCL9 and CXCL10 predict survival and are regulated by cyclooxygenase inhibition in advanced serous ovarian cancer. Br J Cancer 115, 553-563 (2016). PMC4997538. PMID 27490802).

[0086] Primary polyclonal rabbit CXCL9 antibody (Cat. #PA5-34743, Invitrogen) and anti- CXCL10 antibody (CXCL10) (ab9807, 1:500 dilution; Abcam), as well as monoclonal mouse antibodies against CXCL9 (clone 49106, R&D Systems, Minneapolis, MN, USA) and CXCL10 (clone sc-101500, Santa Cruz Biotechnology, Santa Cruz, CA, USA), have been reported for IHC in the literature.

[0087]

[0078] CXCL9 and CXCL10 levels in the TME can be assessed by RNA in-situ hybridization (RISH) of FFPE tumor biopsies, using the RNAscope Multiplex Fluorescent Reagent Kit v2 (see for example Reschke, R., et al. Immune cell and tumor cell-derived CXCL10 is indicative of immunotherapy response in metastatic melanoma. J Immunother Cancer 9(2021). PMC8487215. PMID 34593622; Larkin, R.M., et al. Augmentation of tumor expression of HLA- DR, CXCL9, and CXCL10 may improve olfactory neuroblastoma immunotherapeutic responses. J Transl Med 22, 524 (2024). PMC11140921. PMID 38822345).

[0088] ). Positive (POLRA2, PPIB, UBC) and negative RNA probe (dapB) controls, CXCL10 RNA probe (HS-CXCL10, ACD Catalog Nr.311851) and CXCL9 RNA probe (Hs-CXCL9, ACD, Cat# 440,168) have been reported in the literature for RNAscope. Immune Checkpoint Inhibition

[0089] Immune checkpoint inhibition, checkpoint inhibition, immune checkpoint inhibitor or checkpoint inhibitor refer similarly to a therapeutic agent that inhibits one or more of the immune checkpoints that suppresses T cell engagement. Non-limiting examples of checkpoints include CTLA-4, PD-1 and PD-L1; additional examples are provided below. Non limiting examples of immune checkpoint inhibitors include antibodies such as anti-CTLA-4, anti-PD-1, anti-PD-L1, and those described in detail further below. Any one or more checkpoint inhibitor may be used with the CXCL9 / 10 as described herein in the practice of the disclosure.

[0090] In one non-limiting example, PD-1 is an immunoglobulin in the CD28 family. PD-1 is a type I transmembrane glycoprotein containing an extracellular Ig variable-type (V-type) domain involved in ligand binding and a cytoplasmic tail involved in intracellular signaling. Binding of PD-1 with PD-L1 (or the other ligand PD1-L2) induces the recruitment of SHP-1 and SHP-2 to PD-1, resulting in de-phosphorylation of CD3ζ, PKCθ and ZAP70 essential for T cell receptor (TCR) signaling, and down-regulation of T lymphocyte activation. Under healthy conditions, PD- L1 attenuates unwanted immune responses, such as autoimmunity.

[0091] Pembrolizumab is a humanized anti-PD-1 antibody used in cancer immunotherapy. Pembrolizumab is a highly selective humanized mAb designed to block the interaction between PD-1 and its ligands, programmed cell death ligand 1 (PD-L1) and programmed cell death ligand 2 (PD-L2). Pembrolizumab is an IgG4 / kappa isotype with a stabilizing sequence alteration in theFc region. The theoretical molecular weights of the heavy and light chains derived from the amino acid sequences, excluding glycosylation, are 49.4 kiloDaltons (KDa) and 23.7 KDa, respectively.

[0092] Clinical trials testing the safety and efficacy of pembrolizumab in treating NSCLC patients have led to the approval of the agent for this disease. The KEYNOTE-001 study revealed responses in approximately 20% of the patients with a modest side-effect profile. Importantly, patients with >50% PD-L1 baseline tumor staining experienced greater benefit from anti-PD-1 therapy than those with <50% tumor PD-L1 expression, with the ORR defined by Response Evaluation Criteria in Solid Tumors (RECIST) criteria of 45.2% in patients with >50% PD-L1 staining, versus 16.5% in patients with 1-49% PD-L1 staining and 10.7% in patients with <1% PD-L1 staining. In the KEYNOTE-010 phase II / III study, 2mg / kg and 10mg / kg q3w of pembrolizumab showed significant benefit over 75mg / m2 q3w docetaxel in randomized, stage IV pre-treated patients with >1% PD-L1 staining. In the KEYNOTE-024 study, 200mg of pembrolizumab showed significant benefit over investigators’ choice of standard of care chemotherapy in treatment-naïve patients with >50% PD-L1 staining. Despite robust and durable responses to anti-PD-1 therapy in a subgroup of NSCLC patients, most patients do not respond to PD-1 checkpoint inhibitors as single agents (12). Therefore, rational and effective combination strategies with PD-1 inhibitors are needed to enhance the efficacy of the anti-PD1 therapy in advanced NSCLC patients.

[0093] Antibodies to PD-1 have been described in US Patent Nos. 8,735,553; 8,617,546; 8,008,449; 8,741,295; 8,552,154; 8,354,509; 8,779,105; 7,563,869; 8,287,856; 8,927,697; 8,088,905; 7,595,048; 8,168,179; 6,808,710; 7,943,743; 8,246,955; and 8,217,149.

[0094] It is contemplated that any known anti-PD-1 antibody can be used in the present methods. In various embodiments, the anti-PD-1 antibody inhibits or blocks binding of the PD-1 receptor to one or both of its ligands, PD-L1 and PD-L2. In exemplary aspects, the monoclonal antibody that specifically binds to PD-1 is Nivolumab (BMS936558; Bristol Meyers Squibb), Pembrolizumab (MK-3475; Merck), Pidilizumab (CT-011; CureTech), Lambrolizumab, BMS-936559, Atezolizumab, or AMP-224 (GSK / Amplimmune), AMP224 (MedImmune); AUNP12 (Dr. Reddy's Laboratories Ltd.); BGB108 (BeiGene); MCLA134 (Merus BV); MEDI0680 (MedImmune); PDR001 (Novartis); REGN2810 (Regeneron / Sanofi); SHR1210 (Jiangsu HengruiMedicine / Incyte); STIA110X (Sorrento); STIA1110 (Sorrento); TSR042 (AnaptysBio / Tesaro).

[0095] In exemplary aspects, the monoclonal antibody that specifically binds to PD-L1 is BMS- 936559 (BMS / Ono), MPDL3280A (Roche / Genentech), or MEDI-4736 (MedImmune), MSB0010718C (Merck / Serono), ALN-PDL (Alnylam); BGBA317 (BeiGene); KD033 (Kadmon Corp.); KY1003 (Kymab Ltd.); STIA100X (Sorrento); STIA1010 (Sorrento); STIA1011 (Sorrento); STIA1012 (Sorrento);and STIA1014 (Sorrento).

[0096] For studies using anti-PD-1 in the mouse, a mouse PD-1 specific antibody is used, such as but not limited to monoclonal antibody clone RMP-1-14, catalog no. BP0146, from Bio X Cell, Lebanon NH. Studies in other animal models can use the appropriate species-specific antibody.

[0097] Other immune checkpoint inhibitors are embraced herein, and the disclosure is not limited to any particular immune checkpoint inhibitor co-administered with CXCL9 / 10 as described herein.

[0098] As used herein “Programmed cell death protein 1” or “PD-1” refers to a cell surface receptor involved in immune checkpoint blockade mediated by binding to two ligands, PD-L1 and PD-L2. PD-1 binding to its ligands has been shown to reduce T-cell proliferation, cytokine production, and cytotoxic activity.

[0099] Cytotoxic T-lymphocyte antigen 4 (CTLA-4)(CD152) is a well-known costimulatory molecule involved in the B7-1 / B7-2 costimulatory pathway of T cell activation. CTLA-4 is expressed on the surface of helper T cells and transmits an inhibitory signal to T cells (See e.g., Krummel et al., J. Exp. Med. 182 (2): 459-65, 1995). Antibodies that bind CTLA-4 include ipilimumab and tremilimumab.

[0100] An “antigen presenting cell" (APC) is a cell that is capable of activating T cells, and includes, but is not limited to, monocytes / macrophages, B cells and dendritic cells (DCs). The term "dendritic cell" or "DC" refers to any member of a diverse population of morphologically similar cell types found in lymphoid or non-lymphoid tissues. These cells are characterized by their distinctive morphology, high levels of surface MHC-class II expression. DCs can be isolated from a number of tissue sources. DCs have a high capacity for sensitizing MHC-restricted T cells and are very effective at presenting antigens to T cells in situ. The antigens may be self-antigens thatare expressed during T cell development and tolerance, and foreign antigens that are present during normal immune processes.

[0101] The term “therapeutically effective amount” is used herein to indicate the amount of target- specific composition of the disclosure that is effective to ameliorate or lessen symptoms or signs of disease to be treated.

[0102] The terms “treat”, “treated”, “treating” and “treatment”, as used with respect to methods herein refer to eliminating, reducing, suppressing or ameliorating, either temporarily or permanently, either partially or completely, a clinical symptom, manifestation or progression of an event, disease or condition. Such treating need not be absolute to be useful.

[0103] The terms "cancer", “cancerous", or “malignant” refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Exemplary cancers contemplated herein are described more fully in the Detailed Description.

[0104] The "treatment of cancer", refers to one or more of the following effects: (1) inhibition, to some extent, of tumor growth, including, (i) slowing down and (ii) complete growth arrest; (2) reduction in the number of tumor cells; (3) maintaining tumor size; (4) reduction in tumor size; (5) inhibition, including (i) reduction, (ii) slowing down or (iii) complete prevention, of tumor cell infiltration into peripheral organs; (6) inhibition, including (i) reduction, (ii) slowing down or (iii) complete prevention, of metastasis; (7) enhancement of anti-tumor immune response, which may result in (i) maintaining tumor size, (ii) reducing tumor size, (iii) slowing the growth of a tumor, (iv) reducing, slowing or preventing invasion and / or (8) relief, to some extent, of the severity or number of one or more symptoms associated with the disorder.

[0105] As used herein, “pharmaceutical composition” refers to a composition suitable for administration to a subject animal, including humans and mammals. A pharmaceutical composition comprises a pharmacologically effective amount of a virus or antigenic composition of the disclosure and also comprises a pharmaceutically acceptable carrier. A pharmaceutical composition encompasses a composition comprising the active ingredient(s), and the inert ingredient(s) that make up the pharmaceutically acceptable carrier, as well as any product which results, directly or indirectly, from combination, complexation or aggregation of any two or moreof the ingredients. Accordingly, the pharmaceutical compositions of the present disclosure encompass any composition made by admixing a compound or conjugate of the present disclosure and a pharmaceutically acceptable carrier. CXCL9 / 10 Modified Dendritic Cells Vectors

[0106] A method for delivery of a CXCL9 / 10 expression construct involves the use of an expression vector. In one embodiment, for the studies described herein, DC were transduced with a lentiviral construct expressing murine CXCL9 and, separately, other DC were transduced with a lentiviral construct expressing murine CXCL10. In one embodiment a vector encoding both CXCL9 and CXCL10 can be provided on the same vector, or separate vectors encoding each CXCL can be introduced into the same cells. However, the disclosure is not so limiting.

[0107] In one embodiment, a lentiviral vector may be used for improved stability and better expression. Alternatively, other vectors can be used to express CXCL9 or CXCL10 or both.

[0108] The nucleotide sequence for CXCL9 may be obtained based on the sequence provided in SEQ ID NO:2. PCR products of CXCL9 may be generated and “sticky ends” generated through restriction digestion. These products are then ligated onto a lentiviral vector. This vector is then transfected with helper vectors onto 293T cells to generate lentivirus containing CXCL9 protein expression which were subsequently used to infect dendritic cells for delivery into the tumor. CXCL10-DCs may be generated using a similar process. Alternatively, other viral vectors can be used.

[0109] Exemplary vectors include viral vectors, liposomes or plasmid vectors, as well as other gene delivery vectors. Viral vectors include adenovirus, an adeno-associated virus, a lentivirus, a retrovirus, a vaccinia virus, modified Ankara virus, and vesicular stomatitis virus.

[0110] Although adenovirus vectors are known to have a low capacity for integration into genomic DNA, this feature is counterbalanced by the high efficiency of gene transfer afforded by these vectors. “Adenovirus expression vector” is meant to include those constructs containing adenovirus sequences sufficient to (a) support packaging of the construct in host cells withcomplementary packaging functions and (b) to ultimately express a heterologous gene of interest that has been cloned therein.

[0111] The expression vector comprises a genetically engineered form of adenovirus. Knowledge of the genetic organization of adenovirus, a 36 kb, linear, double-stranded DNA virus, allows substitution of large pieces of adenoviral DNA with foreign sequences (Grunhaus and Horwitz, 1992). In contrast to retrovirus, the adenoviral infection of host cells does not result in chromosomal integration because wild-type adenoviral DNA can replicate in an episomal manner without potential genotoxicity. Also, adenoviruses are structurally stable, and no genome rearrangement has been detected after extensive amplification.

[0112] Adenovirus is particularly suitable for use as a gene transfer vector because of its mid-sized genome, ease of manipulation, high titer, wide target-cell range and high infectivity.

[0113] In various embodiments, the vector is a replication deficient adenoviral vector.

[0114] In various embodiments, the adeno-associated virus (AAV) is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8 or combinations thereof.

[0115] In one example as described in detail below, DC were transduced with a lentiviral construct expressing murine CXCL9 and CXCL10.

[0116] For the uses herein, DC may be obtained from the patient by leukapheresis or other method to collect dendritic cells from the patient’s blood. The DC will then be cultured and transduced with the vector comprising the polynucleotide encoding CXCL9 or CXCL10. In other embodiments, DC are from a donor or cell line. In one embodiment the donor or cell line DCs are HLA matched to the recipient. In one embodiment the DCs are partially HPA matched. Methods of Use

[0117] Exemplary conditions or disorders that can be treated with the proposed combination therapy include cancers, such as esophageal cancer, pancreatic cancer, metastatic pancreatic cancer, metastatic adenocarcinoma of the pancreas, bladder cancer, stomach cancer, fibrotic cancer, glioma, malignant glioma, diffuse intrinsic pontine glioma, recurrent childhood brainneoplasm renal cell carcinoma, clear-cell metastatic renal cell carcinoma, kidney cancer, prostate cancer, metastatic castration resistant prostate cancer, stage IV prostate cancer, metastatic melanoma, melanoma, malignant melanoma, recurrent melanoma of the skin, melanoma brain metastases, stage IIIA skin melanoma; stage IIIB skin melanoma, stage IIIC skin melanoma; stage IV skin melanoma, malignant melanoma of head and neck, lung cancer, non-small cell lung cancer (NSCLC), squamous cell non-small cell lung cancer, breast cancer, recurrent metastatic breast cancer, hepatocellular carcinoma, Hodgkin’s lymphoma, follicular lymphoma, non-Hodgkin’s lymphoma, advanced B-cell NHL, HL including diffuse large B-cell lymphoma (DLBCL), multiple myeloma, chronic myeloid leukemia, adult acute myeloid leukemia in remission; adult acute myeloid leukemia with Inv(16)(p13.1q22); CBFB-MYH11; adult acute myeloid leukemia with t(16;16)(p13.1;q22); CBFB-MYH11; adult acute myeloid leukemia with t(8;21)(q22;q22); RUNX1-RUNX1T1; adult acute myeloid leukemia with t(9;11)(p22;q23); MLLT3-MLL; adult acute promyelocytic leukemia with t(15;17)(q22;q12); PML-RARA; alkylating agent-related acute myeloid leukemia, chronic lymphocytic leukemia, Richter’s syndrome; Waldenstrom’s macroglobulinemia, adult glioblastoma; adult gliosarcoma, recurrent glioblastoma, recurrent childhood rhabdomyosarcoma, recurrent Ewing sarcoma / peripheral primitive neuroectodermal tumor, recurrent neuroblastoma; recurrent osteosarcoma, colorectal cancer, MSI positive colorectal cancer; MSI negative colorectal cancer, nasopharyngeal nonkeratinizing carcinoma; recurrent nasopharyngeal undifferentiated carcinoma, cervical adenocarcinoma; cervical adenosquamous carcinoma; cervical squamous cell carcinoma; recurrent cervical carcinoma; stage IVA cervical cancer; stage IVB cervical cancer, anal canal squamous cell carcinoma; metastatic anal canal carcinoma; recurrent anal canal carcinoma, recurrent head and neck cancer; carcinoma, squamous cell of head and neck, head and neck squamous cell carcinoma (HNSCC), ovarian carcinoma, colon cancer, gastric cancer, advanced GI cancer, gastric adenocarcinoma; gastroesophageal junction adenocarcinoma, bone neoplasms, soft tissue sarcoma; bone sarcoma, thymic carcinoma, urothelial carcinoma, recurrent Merkel cell carcinoma; stage III Merkel cell carcinoma; stage IV Merkel cell carcinoma, myelodysplastic syndrome and recurrent mycosis fungoides and Sezary syndrome.

[0118] In various embodiments, the cancer is lung cancer. In various embodiments, the lung cancer is non-small cell lung carcinoma (NSCLC). In various embodiments, the lung cancer is stage IV NSCLC expressing PD-L1 in less than 50% of cells.

[0119] In various embodiments, the NSCLC or other solid tumor is a squamous cell or non- squamous cell tumor. In various embodiments, the subject has a low tumor mutational burden. In various embodiments, the subject has a high tumor mutational burden. Tumor mutational burden may be monitored by diagnostic assay, e.g., from FoundationOne (Cambridge, MA), such as FoundationOne CDx™, FoundationOne®, FoundationAct®, or FoundationOne®Heme.

[0120] In various embodiments, the patient has a NSCLC tumor accessible by CT-guided intervention or bronchoscopy, and the patient is naïve to systemic treatment for NSCLC. In various embodiments, the CXCL9 / 10-DC is administered via CT-guided or bronchoscopic IT injection.

[0121] As described herein, certain cancers are characterized by having a high mutational burden. In various embodiments, a method of treating cancer or a solid tumor having a high mutational burden in a subject is provided comprising a. administering to the subject (i) a CXCL9 polypeptide, CXCL10 polypeptide, or the combination thereof, (ii) a polynucleotide encoding the CXCL9 polypeptide, CXCL10 polypeptide, or the combination thereof, (iii) a cell comprising the polynucleotide encoding the CXCL9 polypeptide, CXCL10 polypeptide, or the combination thereof, or (iv) any combination thereof; and (b) administering to the subject an immune checkpoint inhibitor.

[0122] In various embodiments, a method of treating a cancer or a solid tumor in a subject is provided comprising the steps of a. identifying the presence of a high mutational burden in the tumor of the subject; b. administering to the subject having a high mutational burden tumor (i) a CXCL9 polypeptide, CXCL10 polypeptide, or the combination thereof, (ii) a polynucleotide encoding the CXCL9 polypeptide, CXCL10 polypeptide, or the combination thereof, (iii) a cell comprising the polynucleotide encoding the CXCL9 polypeptide, CXCL10 polypeptide, or the combination thereof, or (iv) any combination thereof; and (b) administering to the subject an immune checkpoint inhibitor.

[0123] In one embodiment of the foregoing methods, the high mutational burden is determined by a biopsy of the tumor. In one embodiment, tumor-associated neoantigens are determined. In one embodiment, the efficacy of combination therapy is followed by elucidation of the neoantigen landscape of the tumor. In one embodiment, the tumor comprises a mutation selected from KRAS, TP53 (KP) or STK11 / LKB1, or any combination thereof. In one embodiment, the tumor hasintratumoral heterogeneity. In one embodiment, the tumor mutational burden is determined by diagnostic assay selected from FoundationOne CDx™, FoundationOne®, FoundationAct®, and FoundationOne®Heme.

[0124] In one embodiment, the high mutational burden tumor does not have an activating mutation in the epidermal growth factor receptor or an anaplastic lymphoma kinase gene (ALK) fusion. In one embodiment, the somatic mutational load and tumor-associated neoantigens before, during and after treatment are used to initiate, prescribe and monitor therapy.

[0125] In one embodiment, a method for treating cancer or reducing the reoccurrence of a high mutational burden cancer in a subject in need thereof comprising administering an effective amount of a combination therapy comprising a) dendritic cells comprising an CXCL9 / 10 construct on days 0, 21, and 42, and b) an effective amount of anti-PD-1 antibody every three weeks starting on day 0.

[0126] In various embodiments thereof, the tumor does not have an activating mutation in the epidermal growth factor receptor or an anaplastic lymphoma kinase gene (ALK) fusion.

[0127] In various embodiments thereof, the somatic mutational load and tumor-associated neoantigens before, during and after treatment are used to initiate, prescribe and monitor therapy.

[0128] In some embodiments, in the cancer treated with the present method, less than 50% of tumor cells express the PD-L1 protein on their surface. In various embodiments, the cancers have greater than 50% PD-L1 staining on their cell surface, and therefore greater than 50% of tumor cells express the PD-L1 protein on their surface.

[0129] It is further contemplated that the present methods are useful in subjects treated with first line pembrolizumab plus chemotherapy, or, alternatively, in subjects that fail initial therapy with this combination.

[0130] In some embodiments, cancers that can be treated with the present methods include metastatic NSCLC and other solid tumors as described herein.

[0131] In various embodiment, the methods of the disclosure can be used to treat patients with low mutational burden tumors.

[0132] In some embodiments, a method is provided for treating cancer or a solid tumor in a subject having reduced expression of CXCL9 and / or CXCL10, comprising: a. determining the level of expression of CXCL9 and / or CXCL10 in the tumor; and b. if the level of expression of CXCL9 and / or CXCL10 is reduced, administer to the subject: (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or the combination thereof, (ii) a polynucleotide encoding the CXCL9 polypeptide, a polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, (iii) a cell comprising the polynucleotide encoding the CXCL9 polypeptide, a cell comprising the polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, or (iv) any combination thereof; and an immune checkpoint inhibitor.

[0133] It is contemplated that the methods herein reduce tumor size or tumor burden in the subject, and / or reduce metastasis in the subject. In various embodiments, tumor size or tumor volume in the subject is decreased by about 25-50%, about 40-70% or about 50-90% or more. In various embodiments, the methods reduce the tumor size or tumor volume by 10%, 20%, 30%, or more. In various embodiments, the methods reduce tumor size or tumor volume by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100%.

[0134] It is contemplated that the methods herein reduce tumor burden, and also reduce or prevent the recurrence of tumors once the cancer has gone into remission.

[0135] It is also contemplated that administration of the CXCL9 / 10-DC increases CD8 T cell infiltration into a tumor. In various embodiments, the CD8 cells are increased by 2-fold or more in the treated subject compared to a subject not receiving combination therapy. It is provided that the CXCL9 / 10-DC increases PD-L1 expression in a tumor.

[0136] In various embodiments, the one or both CXCL9 and CXCL10 polypeptides, one or both CXCL9 and CXCL10 polynucleotides, or antigen presenting cells such as dendritic cells expressing CXCL9, CXCL10, or both, are administered intratumorally, intravenously, intra- arterially, intraperitoneally, intranasally, intramuscularly, intradermally or subcutaneously, or via CT-guided or bronchoscopic IT injection. In various embodiments, the checkpoint inhibitor is administered intravenously.

[0137] The route of administration of the CXCL9 polypeptide, CXCL10 polypeptide, or the combination thereof, polynucleotide or APC such dendritic cells, and of the checkpoint inhibitor will vary depending on the desired outcome. Generally, for initiation of an immune response, injection of the agent at or near the desired site of inflammation or response is utilized. Alternatively, other routes of administration may be warranted depending upon the disease condition. That is, for suppression of neoplastic or tumor growth, injection of the pharmaceutical composition at or near the tumor site is preferred.

[0138] As noted herein, the CXCL9 / 10 may comprise CXCL9, CXCL10, or both. The form of administration of one or both may be in the form of a polypeptide, a polynucleotide, or a cell comprising the polypeptide. Both the CXCL and the form of administration are independently selected for each CXCL. Thus, in some embodiments, CXCL9 may be delivered as a CXCL9 polypeptide, CXCL9 encoding polynucleotide or cell comprising the polynucleotide encoding CXCL9, or any combination thereof. Thus, in some embodiments, CXCL10 may be delivered as a CXCL10 polypeptide, CXCL10 encoding polynucleotide or cell comprising the polynucleotide encoding CXCL10, or any combination thereof. In some embodiments, both CXCL9 and CXCL10 may be administered; CXCL9 may be delivered as a CXCL9 polypeptide and CXCL10 delivered as CXCL10 polypeptide; or as CXCL9 encoding polynucleotide and CXCL10 encoding polynucleotide; or cell comprising the polynucleotide encoding CXCL9 and the polynucleotide encoding CXCL10, or any combination thereof. In another embodiment wherein both CXCL9 and CXCL10 are delivered, each may be independently delivered as a polypeptide, polynucleotide or cell encoding the polynucleotide, or any combination thereof. By way of non-limiting example, the CXCL9 may be delivered as a polypeptide and the CXCL10 as a polynucleotide. In another example, CXCL9 may be delivered as a polypeptide and CXCL10 delivered in a cell comprising the CXCL10 polynucleotide. In another example, the CXCL9 may be delivered by a cellcomprising the CXCL9 polynucleotide, and the CXCL10 as a polypeptide. In another example, CXCL9 may be delivered as a polynucleotide and CXCL10 delivered in a cell comprising the CXCL10 polynucleotide. Thus, any combination of one or both CXCLs and one or more methods of delivery are embodied herein. Of course, an immune checkpoint inhibitor is also delivered. As noted herein, the dose level, dosing regimen such as frequency and duration of dosing, of the CXCL9 / 10 and the immune checkpoint inhibitor (including one or more immune checkpoint inhibitors) is provided herein.

[0139] As noted herein, a polynucleotide encoding human CXCL9 may comprise SEQ ID NO:5 or consist of SEQ ID NO:5. As noted herein, a polynucleotide encoding murine CXCL9 may comprise SEQ ID NO:6 or consist of SEQ ID NO:6. As noted herein, a polynucleotide encoding human CXCL10 may comprise SEQ ID NO:7 or consist of SEQ ID NO:7. As noted herein, a polynucleotide encoding murine CXCL10 may comprise SEQ ID NO:8 or consist of SEQ ID NO:8.

[0140] As noted herein, a cell comprising the polynucleotide encoding the CXCL9 polypeptide, CXCL10 polypeptide, or the combination thereof may comprise a polynucleotide encoding human CXCL9 comprising SEQ ID NO:5 or consisting of SEQ ID NO:5. As noted herein, a cell comprising a polynucleotide encoding murine CXCL9 may comprise SEQ ID NO:6 or consist of SEQ ID NO:6. As noted herein, a cell comprising a polynucleotide encoding human CXCL10 may comprise SEQ ID NO:7 or consist of SEQ ID NO:7. As noted herein, a cell comprising a polynucleotide encoding murine CXCL10 may comprise SEQ ID NO:8 or consist of SEQ ID NO:8. As noted herein, a cell comprising a polynucleotide encoding human CXCL9 and human CXCL10 may comprise SEQ ID NO:5 or consist of SEQ ID NO:5, and may comprise SEQ ID NO:7 or consist of SEQ ID NO:7. As noted herein, a cell comprising a polynucleotide encoding murine CXCL9 and murine CXCL10 may comprise SEQ ID NO:6 or consist of SEQ ID NO:6, and may comprise SEQ ID NO:8 or consist of SEQ ID NO:8. In some embodiments, a cell may comprise both a human and murine chemokine.

[0141] In one embodiment, the form of CXCL9 and independently the form of CXCL10, may be delivered intratumorally (IT).

[0142] It should be noted that despite the use of the term combination, the CXCL9 / 10 andcheckpoint inhibitor do not need to be administered at the same time or by the same route of administration or in the same formulation. Each may have a different dosing schedule; in one embodiment, the dosing schedules are temporally overlapping; in one embodiment one is started before the other; in one embodiment one ends before the other; in one embodiment the course of therapy of one agent ends before the other begins (wherein the anti-tumor efficacy of both agents is greater than either alone; i.e., is synergistic). Combination refers to the concurrent use of both a CXCL9 / 10 and a checkpoint inhibitor to achieve the anti-tumor activity described herein. In one embodiment, the anti-tumor effect of the combination of the CXCL9 / 10 and immune checkpoint inhibitor is greater than either agent individually; in one embodiment the effect is greater than the combination of the effect of each agent individually; in one embodiment, the combination is synergistic.

[0143] Examples of other routes of systemic administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation) transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution; fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as EDTA; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose.

[0144] In one embodiment, the pharmaceutical composition can be delivered via slow release formulation or matrix comprising CXCL9 polypeptide, CXCL10 polypeptide, or the combination thereof or DNA constructs suitable for expression of CXCL9 / 10 into or around a site within the body. In this manner, a transient lymph node can be created at a desired implant location to attract dendritic cells and T cells initiating an immune response.

[0145] The selection of the one or more immune checkpoint inhibitors to be administered with the CXCL9 / 10 may be guided as described herein. While the examples herein refer to anti-PD1 antibody, the disclosure is not so limited and is generally directed to the combination of CXCL9 / 10 with any one or more immune checkpoint inhibitor.

[0146] In the example of anti-PD-1, it is contemplated that the anti-PD-1 antibody is administeredevery three weeks starting on day 0. In various embodiments, the anti-PD-1 antibody is pembrolizumab administered at a dose of 200 mg every three weeks.

[0147] In various embodiments, each of the CXCL9-DC and CXCL10-DC are administered in a dose from 5 x 106cells / injection to 3 x 107cells / injection, e.g., 5 x 106, 1 x 107, or 3 x 107cells / injection. It is contemplated that the dendritic cells comprising a vector-CXCL9 / 10, such as a lentiviral construct (CXCL9 / 10-DC), are administered at 3-week intervals, e.g., on days 0, 21, and 42. As noted, these are merely exemplary dosing regimens and the skilled artisan carrying out the disclosure will readily determine the optimal dosing regimen for the particular subject, the tumor stage, etc.

[0148] As noted here, studies were carried out in experimental models in mice. In one embodiment, the equivalent or suitable human dose, dose level, and / or dosing regimen of the CXCL9 or CXCL10 polypeptide, polynucleotide, or cells, and those of the immune checkpoint inhibitor, may be readily determined and applied to the methods for use in humans. Considerations such as differences in body weight, blood volume, exposure, absorption, distribution, metabolism, elimination, and other considerations readily known or determinable by a skilled artisan is used to apply the teaching herein to provide human clinical utility. The disclosure herein is not limited in any manner to the findings described herein in models of human disease and are applicable to humans as well as other animals using the same considerations.

[0149] It is further contemplated that other adjunct therapies may be administered, where appropriate. For example, the patient may also be administered surgical therapy, chemotherapy, a cytotoxic agent, photodynamic therapy or radiation therapy where appropriate.

[0150] A wide variety of chemotherapeutic agents may be used in combination with the combination therapy of the present disclosure. These can be, for example, agents that directly cross-link DNA, agents that intercalate into DNA, and agents that lead to chromosomal and mitotic aberrations by affecting nucleic acid synthesis. A variety of chemotherapeutic agents are intended to be of use in the combined treatment methods disclosed herein. Chemotherapeutic agents contemplated as exemplary include, e.g., etoposide (VP- 16), adriamycin, 5-fluorouracil (5FU), camptothecin, actinomycin-D, mitomycin C, cisplatin (CDDP) and even hydrogen peroxide.

[0151] As will be understood by those of ordinary skill in the art, the appropriate doses of chemotherapeutic agents will be generally around those already employed in clinical therapies wherein the chemotherapeutics are administered alone or in combination with other chemotherapeutics. By way of example only, agents such as cisplatin, and other DNA alkylating may be used. Cisplatin has been widely used to treat cancer, with efficacious doses used in clinical applications of 20 mg / in2 for 5 days every three weeks for a total of three courses. Cisplatin is not absorbed orally and must therefore be delivered via injection intravenously, subcutaneously, intratumorally or intraperitoneally.

[0152] Agents that directly cross-link nucleic acids, specifically DNA, are envisaged and are shown herein, to eventuate DNA damage leading to a synergistic antineoplastic combination. Agents such as cisplatin, and other DNA alkylating agents may be used.

[0153] Further useful agents include compounds that interfere with DNA replication, mitosis and chromosomal segregation. Such chemotherapeutic compounds include adriamycin, also known as doxorubicin, etoposide, verapamil, podophyllotoxin, and the like. Widely used in a clinical setting for the treatment of neoplasms, these compounds are administered through bolus injections intravenously at doses ranging from 25-75 mg / in2 at 21-day intervals for adriamycin, to 35-50 mg / in2 for etoposide intravenously or double the intravenous dose orally.

[0154] Agents that disrupt the synthesis and fidelity of polynucleotide precursors may also be used. Particularly useful are agents that have undergone extensive testing and are readily available. As such, agents such as 5-fluorouracil (5-FU) are preferentially used by neoplastic tissue, making this agent particularly useful for targeting to neoplastic cells. Although quite toxic, 5-FU, is applicable in a wide range of carriers, including topical, however intravenous administration with doses ranging from 3 to 15 mg / kg / day being commonly used.

[0155] Plant alkaloids such as TAXOL are also contemplated for use in certain aspects of the present disclosure. TAXOL is an experimental antimitotic agent, isolated from the bark of the ash tree, Taxus brevifolia. It binds to tubulin (at a site distinct from that used by the vinca alkaloids) and promotes the assembly of microtubules. TAXOL is currently being evaluated clinically; it has activity against malignant melanoma and carcinoma of the ovary. Maximal doses are 30 mg / m2 per day for 5 days or 210 to 250 mg / m 2 given once every 3 weeks. Of course, all of these dosagesare exemplary, and any dosage in between these points is also expected to be of use in the teachings herein.

[0156] The foregoing exemplary chemotherapeutic agents that are useful in connection with combined therapy are not intended to be limiting and use of such agent or agents will be guided by the skilled practitioner. Each of the agents listed therein are exemplary and by no means limiting. The skilled artisan is directed to "Remington's Pharmaceutical Sciences" 15th Edition, chapter 33, in particular pages 624-652. Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biologics standards. Example 1 Materials and Methods

[0157] In vivo studies. FVB / NCrl mice, 129-E mice and BALB / c were purchased from Charles River Laboratories. Tumor cells were SC-implanted in 7-9-week-old female mice at optimal doses as indicated in figure legends. Tumor length and width were measured by caliper and the volume calculated by the equation: 0.4*length*width^2. For immunotherapy studies, mice bearing ~50mm3 tumors were randomized and treated with genetically engineered DCs as detailed below, anti-PD-1 antibody (BioXcell, Clone RMP1-14), or anti-PD-L1 antibody (BioXcell, Clone 10F.9G2). In tumor re-challenge studies, mice were euthanized when tumor volume reached 1500 mm3. Mice were housed in pathogen-free facilities at UCLA and all procedures were approved by the UCLA Animal Research Committee (ARC protocol # 2017-049).

[0158] Cell lines. The murine cell lines 1940A, KPL-3M, KP-3M and LKR-13 have been described previously28. L1C2 cells and MyC-CaP cells were acquired from American Type Culture Collection (ATCC). Cell lines were maintained in culture media (RPMI-1640 medium supplemented with 10% FBS and 1% penicillin / streptomycin) at 37oC in a humidified atmosphere of 5% CO2and utilized before 5 passages. Cell cultures were routinely tested for mycoplasma contamination and genotyped to ensure authenticity and purity. All procedures have been approved by the UCLA Institutional Biosafety Committee (BUA-2019-233-012-A).

[0159] Human data. The NSCLC gene expression RNAseq data were downloaded from UCSC Xena for both TCGA Lung Adenocarcinoma (LUAD) and TCGA Lung Squamous Cell Carcinoma (LUSC). Immune profiles derived from RNA-seq using the Xcell approach were downloaded from TIMER 2. Spearman correlation coefficients (R basic package) were utilized to assess the association between abundance of immune cells and CXCL9 / 10 expression.

[0160] Generation of CXCL9 / 10-DC. BMDCs were generated as previously described24,27. Briefly, bone marrow cells were cultured in DC media: 10% FBS in RPMI 1640 with 20ng / mL murine GM-CSF (Peprotech) and 10ng / mL murine IL-4 (Peprotech). Cells were seeded at 3 x 106cells / mL into a sterile non-tissue culture-treated 6 well plastic plate (Falcon) at 2 mL per well in a humidified CO2incubator (37°C, 5% CO2). On D3, media was changed with fresh DC media without depletion of loosely adherent cells. On D6, DCs were harvested by gently pipetting loosely adherent and floating cells. Cells were resuspended at a concentration of 1x106cells / mL into a new non-tissue culture-treated 6 well plastic plate and spinfected at 800g for 2h at 32°C in the presence of lentivirus encoding murine CXCL9 (pHIV-CXCL9) or CXCL10 (pHIV- CXCL10). Following transduction, cells were washed two times with DPBS (Corning) prior to injection. Equal numbers of cells transduced to secrete CXCL9 or CXCL10 were combined to constitute CXCL9 / 10-DC. DC viability was assessed by Trypan-blue staining before and after CXCL9 / 10 transduction for all experiments. For trafficking experiments, Mock-DCs and CXCL9 / 10-DCs were labelled with CellTracker Red CMTPX Dye (Invitrogen) per manufacturer’s protocol. Murine CXCL9 coding sequence was inserted into pHIV-EGFP (Addgene) using the cloning sites XbaI (NEB) and BamHI (NEB) to generate pHIV-CXCL9. For pHIV-CXCL10, murine CXCL10 coding sequence was inserted into pHIV-dTomato (Addgene) with EcoRI (NEB) and XbaI (NEB).

[0161] FITC-Dextran uptake. FITC-Dextran solution (Sigma) was made at a concentration of 25 mg / mL in Milli-Q water. FACS tubes were pre-conditioned at 4oC or 37oC and 2x106DCs were placed in 200 µL of RPMI + 10% FBS. 10 µL of the FITC-Dextran solution was added to the tubes and placed either at 4oC or 37oC for 15 minutes. DCs without FITC-Dextran were incubated at 37oC for 15 minutes as a control. After 15 minutes, cells were washed with 1 mL of FACS Buffer (1X DPBS + 2% FBS) and spun for 5 minutes at 1,500 RPM. After spinning, cells were then fixed with 100 µL of 0.5% Formalin (Epredia) for 20 minutes at room temperature.Cells were washed 2X with FACS buffer and analyzed by flow cytometry using the NovoCyte Quanteon Flow Cytometer (Agilent).

[0162] ELISA. Quantification of mouse CXCL9 (DY#492) and CXCL10 (DY#466) secretion from lentivirally transduced DCs or tumor extracts was performed using Mouse DuoSet ELISA Kit following the manufacturer’s directions (R&D Systems). The absorbance readings were taken using a BioRad absorbance plate reader. A standard curve was created by plotting the mean absorbance for each standard on the y-axis against the concentration on the x-axis and a best fit curve was drawn. Sample concentrations were determined based on the standard curve.

[0163] In vivo antibody-mediated cell depletion and T cell recruitment. CD8+and CD4+T cell depletions were accomplished with mouse anti-CD8 (BioXcell, Clone 2.43) and mouse anti-CD4 (BioXcell, Clone GK1.5), respectively. Depleting antibodies were given via IP injection at 200µg / injection every two days starting on D6. For T cell recruitment studies, mouse anti-CXCR3 antibody (BioXcell, Clone CXCR3-173) was administered IP at 200 µg / injection. Prevention of T cell LN egress was performed with fingolimod hydrochloride (FTY720; Cayman, 10006292) administered IP every other day at 2 mg / kg. All antibody experiments utilized isotype controls (BioXcell, Clone 2A3 or LTF-2).

[0164] Tissue preparation for single cell suspension, ELISA, and metastatic cell growth. Single cell suspension of murine tumor, spleen and TDLN were performed as previously described 27,28 and subjected to flow phenotyping and scRNA-seq analyses. For tumor extracts utilized in ELISA, a quarter of each tumor was homogenized for 6 seconds in 300μL of cold lysis buffer (ThermoFisher) with protease inhibitor (ThermoFisher). Samples were incubated on ice for 20 min and subsequently stored at -80°C. Prior to performing ELISA, samples were thawed and centrifuged at 14,000g for 15min. Equal amounts of protein from each sample, as determined by BCA Protein Assay (ThermoFisher), were utilized for ELISA. To prepare lung tissues for the evaluation of metastatic tumor cell growth, murine lungs were harvested and minced into smaller pieces using a sharp blade before incubation with 1mg / mL Collagenase IV (Roche) for 1h at 37°C with frequent agitation. Following red blood cell (RBC) lysis, cells were filtered through a 100μm filter and plated in a 6-well plate. At 24h, non-adherent cells were removed. On D10, tumor cells were quantified by luminescence using the Bright-Glo Luciferase Assay System (Promega).

[0165] Immunophenotyping by flow cytometry. Surface staining of single cell suspensions was performed for 30 minutes at 4oC as previously described (Salehi-Rad, R., Lim, R.J., Du, Y., Tran, L.M., Li, R., Ong, S.L., Ling Huang, Z., Dumitras, C., Zhang, T., Park, S.J., et al. (2023). CCL21- DC in situ vaccination in murine NSCLC overcomes resistance to immunotherapy and generates systemic tumor-specific immunity. J Immunother Cancer 11. 10.1136 / jitc-2023-006896; Salehi- Rad, R., Li, R., Tran, L.M., Lim, R.J., Abascal, J., Momcilovic, M., Park, S.J., Ong, S.L., Shabihkhani, M., Huang, Z.L., et al. (2021). Novel Kras-mutant murine models of non-small cell lung cancer possessing co-occurring oncogenic mutations and increased tumor mutational burden. Cancer Immunol Immunother. 10.1007 / s00262-020-02837-9). Intracellular staining for FOXP3 and Ki67 was performed using the FOXP3 Transcription Factor Staining Buffer Set (eBioscience) per manufacturer’s protocol. Cytokine production was evaluated by intracellular staining after in vitro stimulation with Cell Stimulation Cocktail (eBioscience) for 4h, using the intracellular fixation buffer (eBioscience), as previously described28. CXCR3 staining in the tumor was also performed using the intracellular fixation buffer (eBioscience), given that it has been demonstrated in the literature that CXCR3 receptor can be internalized upon ligand binding (Colvin, R.A., Campanella, G.S., Sun, J., and Luster, A.D. (2004). Intracellular domains of CXCR3 that mediate CXCL9, CXCL10, and CXCL11 function. J Biol Chem 279, 30219-30227. 10.1074 / jbc.M403595200; Eiger, D.S., Boldizsar, N., Honeycutt, C.C., Gardner, J., Kirchner, S., Hicks, C., Choi, I., Pham, U., Zheng, K., Warman, A., et al. (2022). Location bias contributes to functionally selective responses of biased CXCR3 agonists. Nat Commun 13, 5846. 10.1038 / s41467-022-33569-2). Data acquisition was performed on Attune NxT cytometer (ThermoFisher) and Novocyte Quanteon (Agilent), and data analyzed by FlowJo software (TreeStar).

[0166] scRNA-seq sequencing following flow sorting. Single cell suspensions from 5 murine tumors in each treatment group were pooled, stained with Zombie-NIR LIVE / DEAD stain and CD45 antibody for 30 min at 4oC. Live / CD45+leukocytes were sorted by BD Biosciences Aria II cell sorter with 100µm nozzle. Samples were processed for 10X Single Cell 3’ Gene Expression V3 (10X Genomics) with Novaseq S2 (Illumina) with paired ends for library construction and sequencing performed at the UCLA Technology Center for Genomics & Bioinformatics (TCGB) core.

[0167] Raw reads were aligned by CellRanger 4.0 using mm10 for the reference genome and Ensembl v.93 for transcript annotation. Raw count matrices were processed further by DoubletFinder to detect doublets and Seurat pipeline (v 3.1.5) for pre-processing, dimensional reduction, and cell clustering analyses. In brief, low-quality cells were filtered out if mitochondrial content > 10%, detected genes < 250, and total UMI > 105. A total of 50,771 cells were retained for further analysis. The data was normalized using the Seurat sctransform approach for the top 3,000 highest variance genes (Hafemeister, C., and Satija, R. (2019). Normalization and variance stabilization of single-cell RNA-seq data using regularized negative binomial regression. Genome Biol 20, 296. 10.1186 / s13059-019-1874-1). The Louvain algorithm-based cluster analyses were based on the first 35 principal components with a resolution of 1.2 and visualized by the uniform manifold approximation and projection (UMAP) method. Cell clusters were annotated by major lineages, using the enrichment approach to determine if the overlap between cluster and cell lineage markers based on Panglao database is significant. For further analysis, cells were re- clustered to determine subpopulations and trajectory based on pseudotime analysis using the R slingshot package.

[0168] Multiplex Immunofluorescence (MIF). Tumor tissues were collected and fixed with zinc fixative (BD Pharmingen) for 24-48 h before embedding (Mori, H., Soonsawad, P., Schuetter, L., Chen, Q., Hubbard, N.E., Cardiff, R.D., and Borowsky, A.D. (2015). Introduction of Zinc-salt Fixation for Effective Detection of Immune Cell-related Markers by Immunohistochemistry. Toxicol Pathol 43, 883-889. 10.1177 / 0192623315587593). MIF was performed utilizing the Ventana Discovery Ultra (Roche) and Opal fluorophores (Akoya Biosciences). 5µm-thick tissue sections on Superfrost microscopic slides (VWR International) were deparaffinized using EZ-Prep reagent (Roche) followed by antigen retrieval in CC1 buffer (pH 9, 95 °C; Roche). Discovery Inhibitor (Roche) was applied to inhibit enzymatic activities followed by 6 sequential rounds of staining. Each round included the addition of a primary antibody followed by detection using the OmniMap secondary antibody (Roche). Signal amplification was performed utilizing Opal fluorophores at the conditions suggested by the manufacturer. Between rounds of staining, the tissue sections underwent heat-induced epitope retrieval to remove the primary-secondary-HRP antibody complexes before staining with the subsequent antibody. The primary antibodies and corresponding fluorophores were stained with Opal 480, 520, 570, 620, 690 and 780 (Akoya Biosciences). The slides were then counterstained with Spectral DAPI (Akoya Biosciences) andmounted with ProLong Diamond antifade mounting medium (Thermo Fisher Scientific). Stained slides were imaged using the Vectra Polaris imaging system (Akoya Biosciences). A whole slide scan was acquired with 20x resolution and imported into the inForm software (Akoya Biosciences) followed by spectral unmixing. Slide scans were then imported into HALO (Indica Labs) for stitching and whole slide spatial analysis. Cell characterization and phenotyping were performed before spatial analysis of the whole tumor region. The data was then exported and graphed with Prism (Graphpad). The representative MIF images were exported using inForm software following spectral unmixing.

[0169] Quantification and Statistical Analysis. Experiments were performed at least twice except for the scRNA-seq and MIF studies, which were performed once. Results from one representative experiment are shown with biological replicates detailed in figure legends. Statistical analyses were performed in Prism 9 (GraphPad) unless otherwise noted. Statistical significance was determined using an unpaired, parametric t-test with 95% confidence interval. Results are reported as mean ± SEM, unless indicated. Differences between groups were assessed using either two-tailed unpaired t-tests or one-way ANOVA with Bonferroni multiple- comparisons. Statistical significance is reported as the following: *, P<0.05; **, P< 0.01; ***, P<0.001; ****, P< 0.0001.

[0170] Resources may be found in Lim et al., CXCL9 / 10-engineered dendritic cells promote T cell activation and enhance immune checkpoint blockade for lung cancer, Cell Reports Medicine 5, 101479, April 16, 2024. EXAMPLE 2 The CXCL9 / 10 and CXCR3 axis correlates with tumor-infiltration of immune-activating cell subtypes in human NSCLC

[0171] Analysis of NSCLC data from The Cancer Genome Atlas (TCGA) identified a strong correlation (Spearman correlation coefficient > 0.55) among the expression of CXCL9, CXCL10 and their cognate receptor (CXCR3) in both lung adenocarcinoma (LUAD) and lung squamous carcinoma (LUSC) (Figures 1A-1B). Immune infiltration profiles derived from gene expressionby xCELL (Aran, D., Hu, Z., and Butte, A.J. (2017). xCell: digitally portraying the tissue cellular heterogeneity landscape. Genome Biol 18, 220. 10.1186 / s13059-017-1349-1) and TIMER (Li, T., Fu, J., Zeng, Z., Cohen, D., Li, J., Chen, Q., Li, B., and Liu, X.S. (2020). TIMER2.0 for analysis of tumor-infiltrating immune cells. Nucleic Acids Res 48, W509-W514. 10.1093 / nar / gkaa407) approaches were utilized to determine the associations between immune infiltration profiles and the average expression of CXCL9 / 10 (Figures 1C-1D). Among lymphocytes, tumor CXCL9 / 10 expression in both LUAD and LUSC showed strong positive correlations with the infiltration of both CD8+T cells and CD4+T helper type 2 (Th2) effector T cells and a weak association with CD4+Th1 effector T cells, consistent with the established role of the CXCL9 / 10-CXCR3 axis in T cell recruitment (Figures 1C-1D and Figure 2A). A strong association with B cell infiltration, some known to express CXCR3, was also observed, consistent with immune activation. Within the myeloid compartment, CXCL9 / 10 expression positively correlated with both plasmacytoid DC (pDC) and monocytes, which are known to express CXCR3. A correlation was also found with conventional DC (cDC) infiltration in both LUAD and LUSC, with the strongest association observed with activated DCs (Figures 1C-1D and Figure 2B). CXCL9 / 10 expression showed a positive correlation with infiltrating macrophages, specifically the M1 subtype, but not the M2 subtype (Figures 1C-1D and Figure 2B). These data are consistent with previous reports demonstrating that cDCs and macrophages are the predominant cell types that secrete CXCL9 / 10. Other cell subtypes, including cancer-associated fibroblasts (CAF), natural killer (NK), natural killer T (NKT) cells, neutrophils, and eosinophils, showed no or weak correlations with CXCL9 / 10 expression in LUAD and LUSC. These findings support the notion that CXCL9 / 10 expression in the TME is associated with an anti-tumor immune signature. Example 3 In situ vaccination with CXCL9 / 10-DC inhibits lung cancer in preclinical murine models

[0172] To generate CXCL9 / 10-DC, bone marrow-derived DCs (BMDC) were transduced with a lentiviral construct encoding CXCL9 or CXCL10 (Figure 3A and Methods). Transduced CXCL9- DC and CXCL10-DC secreted 15-22 ng / ml of the corresponding chemokine per million cells after 24h in vitro culture (Figure 3B). Equal numbers of transduced CXCL9-DC and CXCL10-DC were combined to generate CXCL9 / 10-DC. CXCL9 / 10 transduction did not alter the phenotype of BMDC (CD11c+CD11b+MHCIIhi), while a minor increase of the activation marker CD86 wasobserved (Figure 3C). CXCL9 / 10 DCs retained phagocytic ability, as determined by the FITC- Dextran uptake assay (Figure 3D).

[0173] The anti-tumor efficacy of in situ vaccination with CXCL9 / 10-DC was assessed in multiple syngeneic murine models of lung cancer (Figure 4A). LKB1-inactivating mutations in KRAS- mutant NSCLC are associated with a suppressed state of cell-mediated immunity and drive resistance to ICB. IT CXCL9 / 10-DC vaccination significantly inhibited the growth of KrasG12DTp53− / −Lkb1− / −-3M (KPL-3M) tumors harboring high TMB (7.2 mutations / Mb)28. IT PBS control, recombinant CXCL9 / 10 chemokines, and vector control virus-transduced DC (Mock-DC) did not provide anti-tumor efficacy (Figure 4B). IT CXCL9-DC or CXCL10-DC provided similar efficacy as compared to CXCL9 / 10-DC in the KPL-3M tumor-bearing mice (Figure 4C). We had previously shown that the depletion of either CXCL9 or CXCL10 inhibits anti-tumor responses in murine lung cancer, underscoring non-redundant functions of these cytokines in cancer immunity. Additionally, recent studies have highlighted the importance of both CXCL9 and CXCL10 in mediating anti-tumor immunity independently. Therefore, we proceeded with a combined CXCL9 / 10-DC vaccination approach. CXCL9 / 10-DC vaccination mitigated tumor growth in three additional syngeneic murine lung cancer models, including high TMB KrasG12DTp53− / −(KP-3M; 22.1 mutations / Mb), low TMB KrasG12D(LKR13; 0.7 mutations / Mb), and bronchoalveolar carcinoma (L1C2) (Figures 4D-4F). Example 4 CXCL9 / 10-DC-induced T cell recruitment and activation are requisite for anti-tumor efficacy

[0174] In vivo trafficking of CXCL9 / 10-DC following a single IT injection was investigated by flow cytometry following CellTracker Red labeling. Mock-DC was included as a control. Following IT vaccination, a continuous decrease in the frequency of CXCL9 / 10-DC and Mock- DC was observed over time, which was predominantly a result of decreased viability (Figure 5A). Tumor vaccination with CXCL9 / 10-DC induced a statistically significant elevation in the concentrations of CXCL9 and CXCL10 within the TME at 24h, surpassing levels observed with PBS control and Mock-DC (Figure 5B). This increase was transient, as the levels of CXCL9 andCXCL10 declined at 48h, aligning with the temporal decline of the injected DCs in the TME (Figures 5A-5B). The kinetics of in vivo DC viability and CXCL9 / 10 expression in the TME support our treatment regimen of multiple IT injections every 2-3 days (Figure 4A). Although the DC vaccines had a limited lifespan, IT CXCL9 / 10-DC induced infiltration of both endogenous cDC1s and cDC2s into the tumor at 24h (Figure 5C). This was followed by an increase in both CD4+and CD8+T cells in the TME at 48h (Figure 5D). No differences in the expression of CXCR3 were observed within the T cell compartment of the TME at this early time point (Figure 5E). These results indicate that CXCL9 / 10-DC vaccination promotes infiltration of endogenous DCs and T cells into the tumor.

[0175] To evaluate the downstream effects of CXCL9 / 10-DC on mediators of anti-tumor immunity in the TME, flow phenotyping was performed on day 14 (D14) following IT CXCL9 / 10- DC or PBS control on D6, D8, and D11 (Figures 7A-7B). IT CXCL9 / 10-DC promoted an increase in CD8+T cell infiltration into the tumor compared to the control (Figure 6A). Within the CD8+T cells, CXCL9 / 10-DC vaccination led to an increase in the effector cells (CD62L−CD44+) and a decrease in terminally exhausted PD-1+TIM3+CD8+effector T cells (Figure 6A). A significant increase in total CD4+T cells was also observed in the TME following CXCL9 / 10-DC treatment, driven by an increase in CD4+FOXP3−T conventional helper (Tconv) cells with no changes observed in regulatory T cells (Treg: CD4+FOXP3+) (Figure 6B). Within the Tconv cells, CXCL9 / 10-DC treatment induced a shift from naïve-like (CD62L+CD44−) to an effector (CD62L−CD44+) state, similar to that in CD8+T cells (Figure 6B). CXCL9 / 10-DC vaccination induced an increase in PD-1+activated CD4+FOXP3−effector T cells with a concurrent decrease in PD-1+TIM3+terminally exhausted T cells (Figure 6B). A statistically significant increase in NKT but not NK cells was observed following CXCL9 / 10-DC therapy (Figure 7C). No significant changes were noted in monocytes, macrophages, cDC1s, cDC2s or neutrophils (Figure 7D). These data suggest that following an induction of endogenous cDC into the tumor, the downstream mediators of IT CXCL9 / 10-DC are predominantly T cells.

[0176] To evaluate the functional importance of endogenous T cells following CXCL9 / 10-DC vaccination, CD8 and CD4 depletion studies were performed with blocking antibodies. CD8+T cell depletion abolished the anti-tumor efficacy of IT CXCL9 / 10-DC (Figures 6C and 7E). CD4+T cell depletion led to increased tumor growth in the control group, supporting the essential roleof CD4+T cells in controlling tumor progression (Figures 6D and 7F). CD4+T cell depletion completely abrogated the anti-tumor efficacy of CXCL9 / 10-DC. These data demonstrate that the anti-tumor efficacy of CXCL9 / 10-DC vaccination is dependent on both endogenous CD8+and CD4+T cells. Example 5 T cell recruitment from LN is required for CXCL9 / 10-DC-mediated anti-tumor efficacy

[0177] Recent reports have demonstrated that in situ vaccination with BMDCs facilitates activation of de novo T cell responses by endogenous cDC1s in tumor draining lymph nodes (TDLNs). Evaluation of TDLNs following IT CXCL9 / 10-DC therapy in KPL-3M tumor-bearing mice showed enhanced proliferation of both CD4+and CD8+T cells, ascertained by Ki67+staining, and an increased T cell effector polarization, determined by CXCR3 expression (Figure 8A). To assess the dependency of IT CXCL9 / 10-DC efficacy on the CXCL9 / CXCL10 / CXCR3 axis, which mediates effector T cell recruitment, efficacy studies were performed in the presence of CXCR3- neutralizing antibody. Treatment of mice bearing KPL-3M tumors intraperitoneally (IP) with CXCR3 blockade enhanced tumor growth compared to the isotype control (Figure 8B). CXCR3 blockade resulted in a partial reduction of the anti-tumor efficacy of IT CXCL9 / 10-DC, compared to the IT vehicle control. We then utilized fingolimod (FTY720), a sphingosine 1-phosphate inhibitor that blocks T cell egress from the LN and observed that FTY720 abolished the efficacy of IT CXCL9 / 10-DC (Figure 8C). These data demonstrate that IT CXCL9 / 10-DC-mediated anti- tumor efficacy is dependent on the CXCR3 axis as well as T cell egress from the LN into the tumor. Example 6 Spatial analysis of T cell recruitment following CXCL9 / 10-DC treatment

[0178] To evaluate the spatial distribution of endogenous T cells within the TME, multiplex immunofluorescence (MIF) was performed on D14 and D23 tumors utilizing a 7-plex panel [CD4,CD8, FOXP3, Granzyme B (GzmB; activation), Ki67 (proliferation), PanC / K (tumor marker) and DAPI (DNA marker)] (Figure 9A). Analysis of stained tumor sections revealed the greatest accumulation of immune cells at the edge of the tumor following IT CXCL9 / 10-DC (Figure 9B). Whole slide quantification showed a significant increase in CD8+T cells in both the intratumoral and peritumoral regions following CXCL9 / 10-DC therapy compared to PBS control (Figures 9C and 10). While a progressive decrement in CD8+T cell tumor infiltration was observed in control mice from D14 to D23, CXCL9 / 10 vaccination induced progressive recruitment of CD8+T cells to the tumor margin over time (Figure 9C). In accordance with results obtained by flow cytometry (Figure 6), MIF showed a 4-5-fold increase of CD4+T cells in the TME as compared to CD8+T cells (Figure 9D). IT CXCL9 / 10-DC led to enhanced and progressive accumulation of CD4+T conv cells (CD4+FOXP3−) from D14 to D23 compared to vehicle control (Figure 9D). In contrast, control mice had a cumulative decline in tumor-infiltrating CD4+T conv cells and a concurrent increase in Tregs on D23 compared to D14 (Figures 9D-9E). IT CXCL9 / 10-DC led to an increased depth of tumor penetration by CD4+T cells when compared to CD8+T cells (Figure 9D). In contrast to total CD8+T cells, which had the highest accumulation in the 0 to 200 micron peritumoral region, the largest density of CD8+GzmB+T cells was observed in the 0 to -200 micron intratumoral region on D14 (Figure 9F), suggesting anti-tumor cytolytic activity at the tumor border. Previous studies have shown the importance of the localization of CD8+T cells at the tumor border in predicting responses to ICB. We observed a marked reduction in both GzmB+and Ki67+CD8+T cells as well as Ki67+CD4+T conv cells on D23 compared to D14 following IT CXCL9 / 10-DC (Figures 9F-9H), consistent with a progressive decline in T cell proliferation and activity, likely due to enhanced immunosuppression in the TME. Example 7 CXCL9 / 10-DC potentiates ICB immunotherapy in LKB1-deficient NSCLC murine models with varying TMB

[0179] We hypothesized that the progressive decrease in T cell proliferation and cytolytic activity following IT CXCL9 / 10-DC monotherapy could be due to adaptive immune resistance mediated by upregulation of checkpoint inhibitors within the TME. Combination therapy of IT CXCL9 / 10-DC and intraperitoneal (IP) PD-1 / PD-L1 inhibition was evaluated in two murine models of LKB1- deficient NSCLC with varying TMB. Treatment of KPL-3M (TMB high) tumor-bearing mice with IP anti-PD-1 or IT CXCL9 / 10-DC monotherapy provided modest anti-tumor efficacy, with no observed tumor eradication. The combination of CXCL9 / 10-DC and anti-PD-1 or anti-PD-L1 elicited robust tumor regression, resulting in complete eradication of tumors in approximately 30% of the mice (Figures 11A and 12A). Histological evaluation of paraffin-embedded tumors demonstrated decreased tumor content following IT CXCL9 / 10-DC as monotherapy, or in combination with anti-PD-1, as determined by the ratio of PanC / K+(tumor) areas to total tissue area (Figures 12B-12C). In contrast to KPL-3M, which has a high TMB, anti-PD-1 therapy in mice bearing 1940A-KPL tumors with low TMB (1.7 mutations / Mb) did not alter tumor growth rates, consistent with prior reports. However, combination therapy with IT CXCL9 / 10-DC vaccination and anti-PD-1 resulted in robust anti-tumor responses, which were significantly greater than IT CXCL9 / 10 monotherapy (Figure 11B). Combination therapy also reduced metastatic tumor cell growth from lung digests compared to vehicle control, as determined by luciferase assay utilizing the genetically engineered Luc in the 1940A-KPL tumor cells as a readout for cell growth, suggesting decreased pulmonary metastases in response to combination therapy (Figure 12D). Example 8 Anti-PD-1 therapy augments CXCL9 / 10-DC vaccination-induced effector T cell proliferation and activity

[0180] Single cell RNA-sequencing (scRNA-seq) of sorted CD45+tumor-infiltrating immune cells was conducted on D14 following IT CXCL9 / 10-DC and anti-PD-1 as monotherapies or in combination. Seven immune clusters were identified, including pDC, NK, T, B, neutrophils (Neu), and non-neutrophil myeloid (MoMacDC) cells (Figure 12E). An increase in T cells was accompanied by a decrease in the predominant neutrophil population following IT CXCL9 / 10-DC monotherapy or in combination with anti-PD-1, as compared to PBS control or anti-PD-1 alone (Figure 12E). Monotherapy with anti-PD-1 induced minimal changes in immune cell subtypes compared to control.

[0181] Within the CD8+T cells, five sub-lineages, including pre-activated, activated, effector, exhausted, and proliferative, were identified (Figures 11C and 12F). Trajectory inference analysis, including cells from all clusters except those in the proliferative cluster, revealed that pre-activated CD8+T cells could evolve through two independent paths to either an effector or exhausted state (Figure 11C). IT CXCL9 / 10-DC as monotherapy or in combination with anti-PD-1 induced an enrichment of a CD8+effector phenotype accompanied by a decrement of the exhausted state compared to control or anti-PD-1, with the highest magnitude of changes observed with combination therapy (Figure 11C). Flow cytometry confirmed increased IFNγ and TNFα production in tumor-infiltrating CD8+T cells in response to combination therapy compared to control, suggesting enhanced effector function (Figure 12G). The distribution of CD8+T cells based on their differentiation paths was nearly identical between anti-PD-1 and the control groups (Figure 11C). We then utilized MIF to assess whether the addition of anti-PD-1 to IT CXCL9 / 10- DC monotherapy can augment the proliferation and cytolytic function of T cells, which was previously shown to diminish on D23 following IT CXCL9 / 10-DC monotherapy (Figures 9F- 9H). The combination of anti-PD-1 with IT CXCL9 / 10-DC induced an overall increase in cytotoxic GzmB+CD8+and proliferative Ki67+CD8+T cells across all regions of the TME compared to monotherapies, with the most pronounced increase observed at the tumor border (0 to 200) (Figure 11D).

[0182] CD4+T cells were comprised of six clusters, corresponding to naïve / stem-like, activated, exhausted Th1, effector Tconv Th1 subtype, Th2 subtype, and Treg phenotypes (Figures 11E and 12H). Trajectory inference analysis revealed potential evolution of naïve / stem-like CD4+T cells through an activated state and subsequently three distinct paths resulting in exhausted Th1, Th1 subtypes and Th2 subtypes. CXCL9 / 10-DC vaccination, as monotherapy or in combination, increased effector CD4+T cells, which were predominantly driven by the T conv Th2 phenotype, accompanied by a decrement of the Treg component compared to control or anti-PD-1 (Figure 11E). Combination therapy of CXCL9 / 10-DC and anti-PD-1 resulted in a decrease of exhausted Th1 when compared to the other groups (Figure 11E). Although anti-PD-1 therapy increased CD4+T cell tumor infiltration, the sublineage composition was similar to control. Flow cytometry analysis confirmed that combination therapy augmented the production of both Th1 and Th2 cytokines compared to control (Figure 12I). MIF analysis demonstrated an overall increase in proliferative CD4+T cells following combination therapy, while the vehicle control group showedan increase in Treg abundance across all regions of the tumor, with the most pronounced increase at the tumor border (0 to 200) (Figure 11F). These spatial data combined with studies from Figures 9E-9H, demonstrate that IT CXCL9 / 10-DC vaccination enhances T cell recruitment to the tumor margin, and the addition of anti-PD-1 promotes sustained proliferation and effector functions of tumor-infiltrating CD4+and CD8+T cells, which likely mediate the anti-tumor efficacy of combination therapy (Figures 11A-11B). Example 9 Combination treatment with CXCL9 / 10-DC and anti-PD-1 generates systemic tumor- specific immunity

[0183] To assess systemic immune responses, spleens of KPL-3M tumor-bearing mice from the same studies as in Figure 11A were analyzed by flow cytometry. While anti-PD-1 alone led to a modest increase in CD44+CD62L−effector memory (EM) CD8+and CD4+T cells, CXCL9 / 10-DC treatment induced a significant increase in both EM and CD44+CD62L+central memory (CM) T cells with a concurrent decrease in naïve T cells (Figures 13A-13B and 14A-14B). An increase in PD1+CD8+T cells, which has been shown to contain a pool of systemic tumor-specific T cells, and PD1+CD4+T cells was also observed in response to CXCL9 / 10-DC, with the highest magnitude following combination therapy (Figures 13A-13B). To functionally assess potential systemic anti-tumor effects, mice bearing bilateral KPL-3M tumors were treated ipsilaterally with IT CXCL9 / 10 in combination with IP anti-PD-1 and bilateral tumor growth was monitored (Figure 13C). Ipsilateral tumor vaccination with IT CXCL9 / 10-DC resulted in inhibition of contralateral tumor growth, suggestive of systemic immunity following local tumor vaccination. Addition of anti-PD-1 significantly augmented the efficacy of ipsilateral IT CXCL9 / 10-DC vaccination, indicative of improved systemic anti-tumor immune responses (Figure 13C).

[0184] To evaluate whether combination therapy led to the development of tumor-specific immune memory, tumor re-challenge was performed utilizing mice that had eradicated KPL-3M tumors following CXCL9 / 10-DC combined with anti-PD-1. Cured mice and age-matched naïve control mice were inoculated with KPL-3M tumor cells on the contralateral flank, 3 months afterthe initial rejection of the primary tumors (Figure 13D). Tumor establishment was verified on D2 by bioluminescence imaging (Figure 13D). Tumor growth in cured mice continued to increase on D4 but decreased by D7 and was completely eradicated by D14 (Figures 13D-13E). In contrast, all age-matched naïve mice succumbed to tumor challenge in approximately 30 days (Figure 13E). To confirm tumor specificity, cured mice were re-challenged with a syngeneic prostate cancer cell line, MyC-CaP (Figure 13F). Both naïve and cured mice succumbed to the MyC-CaP tumor challenge, indicating that systemic anti-tumor immunity is specific to the KPL-3M tumors. These data demonstrate that the combination treatment with CXCL9 / 10-DC and anti-PD-1 leads to enduring systemic tumor-specific immune memory.

Claims

WHAT IS CLAIMED:

1. A method of treating cancer or a solid tumor in a subject having reduced expression of CXCL9 and / or CXCL10, comprising a. administering to the subject: (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or the combination thereof, (ii) a polynucleotide encoding the CXCL9 polypeptide, a polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, (iii) a cell comprising the polynucleotide encoding the CXCL9 polypeptide, a cell comprising the polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, or (iv) any combination thereof; and b. administering to the subject an immune checkpoint inhibitor.

2. The method of claim 1, wherein the cancer or a solid tumor in the subject has reduced expression of CXCL9.

3. The method of claim 1, wherein the cancer or a solid tumor in the subject has reduced expression of CXCL10.

4. The method of claim 1, wherein the subject has reduced CXCL9 and / or CXCL10 signaling.

5. The method of any one of claims 2-3, wherein the subject has a chromosome 9p loss.

6. The method of claim 5, wherein the subject has a chromosome 9p21.3 loss.

7. The method of claim 5, wherein the subject has a chromosome 9p24.1 loss.

8. The method of any one of claims 1-3, wherein the reduced expression of CXCL9 and / or CXCL10 is by activated dendritic cells.

9. The method of any one of claim 1-3, wherein the reduced expression of CXCL9 and / or CXCL10 is by plasmacytoid dendritic cells.

10. The method of any one of claims 1-3, wherein the reduced expression of CXCL9 and / or CXCL10 is by macrophages.

11. The method of any one of claims 2-3, wherein the reduced expression of CXCL9 and / or CXCL10 is by M1 subtype macrophages.

12. The method of claim 1, wherein the cancer or solid tumor comprises an inactivating mutation of LKB-1.

13. The method of claim 1, wherein step a. administering comprises CXCL9.

14. The method of claim 1, wherein step a. administering consists of CXCL9.

15. The method of claim 1, wherein step a. administering comprises CXCL10.

16. The method of claim 1, wherein step a. administering consists of CXCL10.

17. The method of claim 1, wherein step a. administering comprises the combination of CXCL9 and CXCL10.

18. The method of claim 1, wherein step a. administering consists of the combination of CXCL9 and CXCL10.

19. The method of claim 1, wherein naïve T cells are decreased and central memory T cells are increased in the subject.

20. The method of claim 1, wherein the immune checkpoint inhibitor is an antibody, optionally, a monoclonal antibody.

21. The method of claim 1, wherein the immune checkpoint inhibitor is selected from the group consisting of a CTLA-4 inhibitor, a CTLA-4 receptor inhibitor, a PD-1 inhibitor, a PD1-Ll inhibitor, a PD1-L2 inhibitor, a 4-lBB inhibitor, an OX40 inhibitor, a LAG-3 inhibitor, a TIM-3 inhibitor, or a combination thereof.

22. The method of claim 21, wherein the immune checkpoint inhibitor is a CTLA-4 inhibitor, optionally, ipilimumab or tremilimumab.

23. The method of claim 21, wherein the immune checkpoint inhibitor is a PD1 inhibitor selected from a group consisting of: nivolumab, pembrolizumab, pidilizumab, lambrolizumab, BMS-936559, atezolizumab, AMP-224, AMP224, AUNP12, BGB108, MCLA134, MEDI0680, PDR00l, REGN2810, SHR1210, STIA110X, STIA1110 and TSR042.

24. The method of claim 21, wherein the immune checkpoint inhibitor is a PD1-Ll inhibitor selected from a group consisting of: BMS-936559, MPDL3280A, MEDI-4736, MSB0010718C, ALN-PDL, BGBA317, KD033, KY1003, STIA100X, STIA1010, STIA1011, STIA1012 and STIA1014.

25. The method of claim 1 wherein the CXCL9 polypeptide comprises an amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2; and the CXCL10 polypeptide comprises an amino acid sequence of SEQ ID NO: 3 or SEQ ID NO:

4.

26. The method of claim 1, wherein the polynucleotide encoding the CXCL9 polypeptide, CXCL10 polypeptide, or the combination thereof is inserted into a vector and the vector is administered to the subject, or the vector is introduced into an antigen presenting cell (APC) or a dendritic cell (DC) which is then administered to the subject or to the tumor site.

27. The method of claim 26, wherein the vector is an adenovirus vector, a lentiviral vector, a CMV vector, a vaccinia virus vector, a sindbis virus vector, or a herpesvirus vector.

28. The method of claim 27, wherein the adenoviral vector is a replication-deficient adenoviral vector.

29. The method of claim 1, wherein the cell comprising the polynucleotide encoding the CXCL9 polypeptide, CXCL10 polypeptide, or the combination thereof is an antigen presenting cell (APC) or a dendritic cell (DC).

30. The method of claim 29, wherein the APC is a dendritic cell.

31. The method of claim 30, wherein the dendritic cell is autologous to the subject, is from a donor or is from a cell line.

32. The method of claim 1, wherein at least or about 1x10^6 cells comprising the polynucleotide encoding the CXCL9 polypeptide, about 1x10^6 cells comprising the polynucleotide encoding the CXCL10 polypeptide, or the combination thereof are administered to the subject.

33. The method of claim 1, wherein the cells produce at least or about 10 ng of CXCL9 or CXCL10 per lxl0^6 cells in a 24-hour period.

34. The method of claim 1, wherein the subject comprises a solid tumor and the cells are administered to the subject intratumorally.

35. The method of claim 34, wherein the solid tumor is a non-small cell lung carcinoma (NSCLC) solid tumor.

36. The method of claim 35 wherein the NSCLC is lung adenocarcinoma.

37. The method of claim 35 wherein the NSCLC is lung squamous carcinoma.

38. The method of claim 1, wherein the solid tumor is a melanoma or a head and neck squamous cell carcinoma.

39. The method of claim 1, wherein the (i) CXCL9 polypeptide, the CXCL10 polypeptide, or the combination thereof, (ii) polynucleotide encoding the CXCL9 polypeptide, polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, (iii) cell comprising the polynucleotide encoding the CXCL9 polypeptide, cell comprising the polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, or (iv)any combination thereof, is administered to the subject prior to, about 2 weeks prior to, or at the same time as the immune checkpoint inhibitor.

40. The method of claim 1, wherein the (i) CXCL9 polypeptide, the CXCL10 polypeptide, or the combination thereof, (ii) polynucleotide encoding the CXCL9 polypeptide, polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, (iii) cell comprising the polynucleotide encoding the CXCL9 polypeptide, cell comprising the polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, or (iv) any combination thereof, is administered to the subject about more than once, once every two weeks, once every three weeks, or once a month.

41. The method of claim 1, wherein the immune checkpoint inhibitor is administered to the subject more than once, once every 2 weeks, once every 3 weeks, or once a month.

42. The method of claim 1, wherein the (i) CXCL9 polypeptide, the CXCL10 polypeptide, or the combination thereof, (ii) polynucleotide encoding the CXCL9 polypeptide, polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, (iii) cell comprising the polynucleotide encoding the CXCL9 polypeptide, cell comprising the polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, or (iv) any combination thereof, and the immune checkpoint inhibitor, are independently administered by a route selected from intratumorally, intravenously, intra-arterially, intraperitoneally, intranasally, intramuscularly, intradermally or subcutaneously, or via CT-guided or bronchoscopic IT injection.

43. The method of claim 1, wherein the (i) CXCL9 polypeptide, the CXCL10 polypeptide, or the combination thereof, (ii) polynucleotide encoding the CXCL9 polypeptide, polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, (iii) cell comprising the polynucleotide encoding the CXCL9 polypeptide, cell comprising the polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, or (iv) any combination thereof, is administered intratumorally and the immune checkpoint inhibitor is administered intravenously.

44. The method of any one of claims 1-43, wherein the subject has a low mutational burden tumor.

45. The method of any one of claims 1-43, wherein the subject has a high mutational burden tumor.

46. The method of claim 45, wherein the high mutational burden is determined by a biopsy of the tumor.

47. The method of claim 46, wherein tumor-associated neoantigens are determined.

48. The method of claim 1, wherein the efficacy of combination therapy is followed by elucidation of the neoantigen landscape of the tumor.

49. The method of claim 1, wherein the tumor comprises a mutation selected from KRAS, TP53 (KP), JAK2 or STK11 / LKB1, or any combination thereof.

50. The method of claim 1, wherein the tumor has intratumoral heterogeneity.

51. The method of claim 1, wherein a mutational burden of the tumor is determined by diagnostic assay selected from FoundationOne CDx™, FoundationOne®, FoundationAct®, and FoundationOne®Heme.

52. The method of claim 1, wherein the tumor does not have an activating mutation in the epidermal growth factor receptor or an anaplastic lymphoma kinase gene (ALK) fusion.

53. The method of claim 1, wherein a somatic mutational load and tumor-associated neoantigens before, during and after treatment are used to initiate, prescribe and monitor therapy.

54. A method for treating a high mutational burden cancer or reducing the reoccurrence of a high mutational burden cancer in a subject having reduced expression of CXCL9 and / or CXCL10, in need thereof comprising administering an effective amount of a combination therapy comprising a) dendritic cells comprising an CXCL9 vector and dendritic cells comprising a CXCL10 vector, and b) an effective amount of anti-PD-1 antibody.

55. A method for treating a low mutational burden cancer or reducing the reoccurrence of a low mutational burden cancer in a subject having reduced expression of CXCL9 and / or CXCL10, in need thereof comprising administering an effective amount of a combination therapy comprising a) dendritic cells comprising an CXCL9 vector and dendritic cells comprising a CXCL10 vector, and b) an effective amount of anti-PD-1 antibody.

56. A method for treating a cancer or solid tumor in a subject comprising: a. determining the level of expression of CXCL9 and / or CXCL10 in the tumor; and b. if the level of expression of CXCL9 and / or CXCL10 is reduced, administer to the subject: (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or the combination thereof, (ii) a polynucleotide encoding the CXCL9 polypeptide, a polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, (iii) a cell comprising the polynucleotide encoding the CXCL9 polypeptide, a cell comprising the polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, or (iv) any combination thereof; and an immune checkpoint inhibitor.

57. A method for treating a cancer or solid tumor in a subject comprising: a. determining the level of signaling by CXCL9 and / or CXCL10; and b. if the level of signaling by CXCL9 and / or CXCL10 is reduced, administer to the subject: (i) a CXCL9 polypeptide, a CXCL10 polypeptide, or the combination thereof, (ii) a polynucleotide encoding the CXCL9 polypeptide, a polynucleotide encoding the CXCL10 polypeptide, or the combination thereof,(iii) a cell comprising the polynucleotide encoding the CXCL9 polypeptide, a cell comprising the polynucleotide encoding the CXCL10 polypeptide, or the combination thereof, or (iv) any combination thereof; and an immune checkpoint inhibitor.

Images