Pet-mh mutant of pet degrading enzyme, and encoding gene, recombinant plasmid, engineered strain and use thereof

Abstract

The present application belongs to the technical field of enzyme engineering, and specifically relates to a PET-mh mutant of a PET degrading enzyme, and an encoding gene, a recombinant plasmid, an engineered strain and the use thereof. The PET-mh mutant of a PET degrading enzyme provided in the present application is prepared by means of mutating amino acids at positions 29, 62, 63, 68, 124, 152, 176, 177, 183, 208 and 219 in a protein having an amino acid sequence as shown in SEQ ID NO: 1. Compared with the protein having the amino acid sequence as shown in SEQ ID NO: 1, the mutant has significantly improved activity or thermal stability, and has relatively high application value for implementing efficient degradation of PET. Further provided in the present application are an encoding gene encoding the mutant, a recombinant plasmid containing the encoding gene, an engineered strain containing the recombinant plasmid, and the use thereof.

Description

PET-degrading enzyme PET-mh mutant and its encoding gene, recombinant plasmid, engineered bacteria and application

[0001] This patent application claims priority to Chinese patent application No. CN202311211045.9 filed on September 19, 2023. The disclosure of the prior application is incorporated herein by reference in its entirety. Technical Field

[0002] The present application relates to the field of enzyme engineering technology, and in particular to a PET-degrading enzyme PET-mh mutant and its encoding gene, recombinant plasmid, engineered bacteria and application. Background Art

[0003] Polyethylene terephthalate (PET) is one of the most widely used plastics. Its advantages include strong chemical resistance, high thermal stability, light weight, and easy storage. It is used in the production of packaging materials, mineral water bottles, mobile phone cases, and many other daily necessities. It is a common engineering polymer with an annual production of approximately 50 million tons. Due to the chemical inertness of the ester bonds and aromatic nuclei in PET, PET plastic is difficult to degrade. With the increasing use of PET plastic, PET waste has accumulated in the environment, becoming one of the main culprits of the "white pollution" problem. It has been reported that micron-sized PET is present in food, becoming part of the human food chain and posing a potential threat to human health.

[0004] Current recycling strategies for PET waste primarily include physical and chemical recycling, but both methods are prone to secondary environmental pollution. Biological methods, which utilize enzymes or microorganisms to degrade PET into monomeric molecules such as terephthalic acid (TPA) and ethylene glycol, offer advantages such as mild degradation conditions (ambient temperature and pressure), a single, easily recyclable degradation product, and environmental friendliness. These methods align with the concept of sustainable development and are considered the most promising approach for reducing PET plastic pollution. However, biological degradation of PET plastics is plagued by issues such as poor enzyme stability and low catalytic efficiency. Through biosynthesis, researchers have generated several PET-degrading enzymes with enhanced degradation activity. However, these enzymes require high-temperature melt recrystallization and micronization in a crusher to reduce the effects of the PET's high crystallinity and hydrophobic surface on enzymatic degradation, making the degradation process complex and costly. Technical issues

[0005] The present application provides a PET-mh mutant of a PET-degrading enzyme, its encoding gene, recombinant plasmid, engineered bacteria, and applications. The PET-mh mutant of the PET-degrading enzyme has high activity and thermal stability, can improve the degradation efficiency of PET, and can also efficiently degrade high-crystallinity PET, thereby simplifying the PET degradation process and reducing costs. Technical Solutions

[0006] In order to achieve the above application objectives, this application adopts the following technical solutions:

[0007] In a first aspect, the present application provides a PET degrading enzyme PET-mh mutant, wherein the amino acid sequence of the PET degrading enzyme PET-mh mutant is as follows: at least one of the amino acids at positions 29, 62, 63, 68, 124, 152, 176, 177, 183, 208, and 219 in the amino acid sequence shown in SEQ ID No. 1 is mutated.

[0008] The protein with an amino acid sequence as shown in SEQ ID No. 1 has good degradation activity for PET. In the present application, by mutating amino acids at specific positions in the amino acid sequence, a mutant with better activity and thermal stability than the protein can be obtained. The obtained mutant can improve the efficiency of PET degradation, providing a new option for PET bio-scale conversion and monomer recovery.

[0009] In combination with the first aspect, in some embodiments, the PET degrading enzyme PET-mh mutant has an amino acid sequence as follows: the amino acid at position 29 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-alanine.

[0010] In combination with the first aspect, in some embodiments, the PET degrading enzyme PET-mh mutant has an amino acid sequence as follows: the amino acid at position 62 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-threonine.

[0011] In combination with the first aspect, in some embodiments, the PET degrading enzyme PET-mh mutant has an amino acid sequence as follows: the amino acid at position 63 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-threonine.

[0012] In combination with the first aspect, in some embodiments, the PET degrading enzyme PET-mh mutant has an amino acid sequence as follows: the amino acid at position 68 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-asparagine.

[0013] In combination with the first aspect, in some embodiments, the PET degrading enzyme PET-mh mutant has an amino acid sequence as follows: the amino acid at position 124 in the amino acid sequence shown in SEQ ID No. 1 is mutated to S-glycine.

[0014] In combination with the first aspect, in some embodiments, the PET degrading enzyme PET-mh mutant has an amino acid sequence as follows: the amino acid at position 152 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-methionine.

[0015] In combination with the first aspect, in some embodiments, the PET degrading enzyme PET-mh mutant has an amino acid sequence as follows: the amino acid at position 176 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-arginine.

[0016] In combination with the first aspect, in some embodiments, the PET degrading enzyme PET-mh mutant has an amino acid sequence as follows: the amino acid at position 177 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-isoleucine.

[0017] In combination with the first aspect, in some embodiments, the PET degrading enzyme PET-mh mutant has an amino acid sequence as follows: the amino acid at position 183 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-tyrosine.

[0018] In combination with the first aspect, in some embodiments, the PET degrading enzyme PET-mh mutant has an amino acid sequence as follows: the amino acid at position 208 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-threonine.

[0019] In combination with the first aspect, in some embodiments, the PET degrading enzyme PET-mh mutant has an amino acid sequence as follows: the amino acid at position 219 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-methionine.

[0020] In combination with the first aspect, in some embodiments, the PET degrading enzyme PET-mh mutant has an amino acid sequence as follows: at least one of the amino acids at positions 63, 68, 152, 183, 208, and 219 in the amino acid sequence shown in SEQ ID No. 1 is mutated.

[0021] In some embodiments, the PET-mh mutant of the PET-degrading enzyme has an amino acid sequence in which at least amino acid position 183 of the amino acid sequence set forth in SEQ ID No. 1 is mutated. Experiments have demonstrated that even when only amino acid position 183 of the amino acid sequence set forth in SEQ ID No. 1 is mutated, the resulting mutant exhibits significantly improved performance relative to the protein. Furthermore, mutating amino acid position 183 in conjunction with other amino acids in the amino acid sequence set forth in SEQ ID No. 1 may also yield a synergistic effect.

[0022] Specifically, as a more preferred technical solution, the PET-mh mutant of the PET-degrading enzyme has an amino acid sequence in which any one of amino acids at positions 63, 68, 124, 152, 176, and 177, as well as amino acid position 183, of the amino acid sequence shown in SEQ ID No. 1 are mutated. This combination of mutations can further improve the efficiency of PET degradation.

[0023] In some embodiments, the PET degrading enzyme PET-mh mutant has an amino acid sequence as follows: the amino acid at position 124 or 152 and the amino acid at position 183 in the amino acid sequence shown in SEQ ID No. 1 are mutated together.

[0024] In some embodiments, the PET-mh mutant of the PET degrading enzyme has an amino acid sequence in which any one of amino acids at positions 63, 68, 152, 176, and 208, as well as amino acids at positions 124 and 183, of the amino acid sequence shown in SEQ ID No. 1 are mutated. More preferably, the PET-mh mutant of the PET degrading enzyme has an amino acid sequence in which amino acid position 208, as well as amino acids at positions 124 and 183, of the amino acid sequence shown in SEQ ID No. 1 are mutated.

[0025] High-crystallinity PET is more difficult to degrade than low-crystallinity PET, and its degradation efficiency is poorer under the same conditions. Mutating amino acid position 183, or mutating amino acids 124 or 152 and 183, or mutating amino acids 124, 183, and 208 in the amino acid sequence of SEQ ID No. 1, yields mutants that significantly improve the degradation efficiency of low-crystallinity PET and also greatly improve the degradation efficiency of high-crystallinity PET compared to the protein, demonstrating improved practicality.

[0026] In a second aspect, the present application also provides the use of the above-mentioned PET degrading enzyme PET-mh mutant in hydrolyzing PET: adding the PET degrading enzyme PET-mh mutant to a potassium phosphate buffer with a concentration of 80mM~120mM and a pH value of 7.5~8.5 until the final concentration of the PET degrading enzyme PET-mh mutant is 5μg / mL~15μg / mL, and PET degradation is carried out at a temperature of 65℃~75℃ and a rotation speed of 100rpm~220rpm.

[0027] In a third aspect, the present application also provides a coding gene comprising a nucleotide sequence encoding the above-mentioned PET degrading enzyme PET-mh mutant.

[0028] In conjunction with the third aspect, the amino acid sequence of the PET degrading enzyme PET-mh mutant is shown in SEQ ID No. 2 to SEQ ID No. 23, and the nucleotide sequence thereof is shown in SEQ ID No. 24 to SEQ ID No. 45, respectively.

[0029] In a fourth aspect, the present application also provides a recombinant plasmid comprising the nucleotide sequence of the above-mentioned encoding gene.

[0030] In a fifth aspect, the present application also provides a method for constructing the above-mentioned recombinant plasmid: using the nucleotide sequence encoding the amino acid shown in SEQ ID No. 1 as a template, a single point mutation is constructed using the corresponding primers, the target gene is first exponentially amplified by PCR reaction, and then the template chain is removed using the restriction endonuclease Dpn I, and then the PCR product is quickly circularized using DNA ligase to obtain a recombinant plasmid.

[0031] In a sixth aspect, the present application also provides an engineered bacterium, comprising a host cell having the above-mentioned recombinant plasmid.

[0032] In combination with the sixth aspect, the engineered bacteria is Escherichia coli.

[0033] In a seventh aspect, the present application also provides a method for constructing the above-mentioned engineered bacteria: the above-mentioned recombinant plasmid is transformed into BL21 (DE3) competent cells, spread on ampicillin plate culture medium, and positive recombinants are obtained, namely the engineered bacteria.

[0034] In an eighth aspect, the present application also provides the application of the above-mentioned engineered bacteria in the degradation of PET.

[0035] For example, the method for degrading PET using the above-mentioned engineered bacteria can refer to the following operation: the above-mentioned engineered bacteria are cultured in LB liquid culture medium until the OD600 value reaches a range of 0.8 to 1.0, an inducer IPTG (isopropyl β-D-1-thiogalactopyranoside) is added to a concentration of 0.1 mM to 0.15 mM, and expression is induced at a temperature of 15° C. to 17° C. for 20 h to 24 h to obtain a fermentation culture;

[0036] The fermentation culture is centrifuged, resuspended by pipetting with a lysis buffer, and centrifuged again to obtain a crude enzyme solution containing the PET-mh mutant PET-degrading enzyme; the crude enzyme solution is protein purified and then concentrated to obtain a concentrated solution, which is used as a biocatalyst for degrading PET;

[0037] The PET film substrate to be degraded is added to a PET reaction solution, and a biocatalytic reaction is carried out at 65° C.-75° C. The PET reaction solution contains a potassium phosphate buffer solution with a pH of 8.0 and a biocatalyst for degrading PET. Beneficial effects

[0038] The beneficial effects of the present application are as follows: the PET-mh mutant of the PET degrading enzyme provided in the present application has higher activity and thermal stability than the protein with the amino acid sequence shown in SEQ ID No. 1, and the catalytic efficiency is greatly improved. It can more effectively degrade PET plastic waste, which is conducive to the resource regeneration and secondary development of PET waste. It can not only alleviate the pressure on the petroleum resources required for PET production, but also solve the serious environmental pollution problem caused by PET waste, conform to the concept of sustainable development, and can also increase the recycling value of PET and promote the realization of the plastic economy. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] FIG1 shows the degradation effect of the PET-mh mutant of the PET degrading enzyme after mutation of amino acids 63, 68, 124, and 183 in Test Example 1 of the present application on low-crystallinity PET;

[0040] FIG2 shows the degradation effect of the PET-mh mutant of the PET degrading enzyme on low-crystallinity PET after mutation of any one of the amino acids at positions 63, 68, 124, 152, 176, 177 and the amino acid at position 183 in Test Example 1 of the present application;

[0041] FIG3 shows the degradation effect of the PET-mh mutant of the PET degrading enzyme on low-crystallinity PET after mutation of any one of the amino acids at positions 63, 68, 152, 176, 208 and the amino acids at positions 124 and 183 in Test Example 1 of the present application;

[0042] Figure 4 shows the degradation effects of the PET-mh mutant of the PET degrading enzyme in which the amino acid at position 183 is mutated alone, the PET-mh mutant of the PET degrading enzyme in which the amino acid at position 124 or 152 and the amino acid at position 183 are mutated together, and the PET-mh mutant of the PET degrading enzyme in which the amino acids at positions 124, 183 and 208 are mutated together on high-crystalline PET in Test Example 2 of this application.

[0043] In the figure, ICCG represents the parent PET degrading enzyme, i.e., the enzyme comprising the amino acid sequence shown in SEQ ID No. 1. The numbers on the horizontal axis indicate the positions of the mutations. For example, 63 and 68 indicate mutations at amino acids 63 and 68, respectively; 176-183 indicates mutations at amino acids 176 and 183; and 124-183-208 indicates mutations at amino acids 124, 183, and 208. Modes for Carrying Out the Invention

[0044] In order to make the purpose, technical solutions and advantages of this application more clear, the following further describes this application in detail with reference to specific embodiments. It should be understood that the specific embodiments described herein are only used to explain this application and are not intended to limit this application.

[0045] In this application, the numbering of the mutation positions in the PET-mh mutant of the PET degrading enzyme corresponds to the numbering of the amino acid sequence of the original PET degrading enzyme as shown in SEQ ID No. 1. Amino acids are represented by single-letter abbreviations, such as S29A, which indicates that the S at position 29 in the amino acid sequence of the original PET degrading enzyme as shown in SEQ ID No. 1 is replaced (mutated) with A.

[0046] With my country's rapid economic development, PET products, characterized by their low price, light weight, convenience, and strong plasticity, have been produced and used in large quantities. The resulting PET waste is causing unimaginable pollution. Biological methods, which use enzymes or microorganisms to degrade PET into monomeric molecules such as terephthalic acid (TPA) and ethylene glycol, are considered the most promising way to reduce PET plastic pollution. However, biological degradation of PET plastics is plagued by problems such as poor enzyme stability and low catalytic efficiency.

[0047] Modifying the amino acid sequence of an enzyme is a common way to obtain new functions, but not all modifications can produce mutants with ideal functions.

[0048] To address the above-mentioned issues, the present invention provides a PET-mh mutant of the PET-degrading enzyme, which is obtained by mutating at least one of the amino acids at positions 29, 62, 63, 68, 124, 152, 176, 177, 183, 208, and 219 of the amino acid sequence shown in SEQ ID No. 1. Mutating the amino acid at position 177 can increase the melting point (Tm) of the crystalline polymer to 99.6°C; mutations at other amino acids can improve thermal stability to varying degrees while also increasing the efficiency of PET degradation.

[0049] The examples of the present application also provide a method for constructing the above-mentioned PET degrading enzyme PET-mh mutant and its application in hydrolyzing PET.

[0050] The present application also provides a gene encoding the above mutant, the nucleotide sequence of which is shown in SEQ ID No. 24 to SEQ ID No. 45.

[0051] The present application also provides a recombinant plasmid containing the above-mentioned nucleotide sequence, a method for constructing the same, and an engineered bacterium constructed using the recombinant plasmid.

[0052] The examples of this application also provide a method for constructing the engineered bacteria and its application in degrading PET.

[0053] The solution of this application is described below through specific embodiments.

[0054] Unless otherwise specified, the reagents in the following examples were commercially available or obtained according to methods known in the art.

[0055] Example 1

[0056] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-serine at position 29 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-alanine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 2, and the nucleotide sequence is shown in SEQ ID No. 24.

[0057] Example 2

[0058] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-alanine at position 62 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-threonine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 3, and the nucleotide sequence is shown in SEQ ID No. 25.

[0059] Example 3

[0060] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-aspartic acid at position 63 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-threonine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 4, and the nucleotide sequence is shown in SEQ ID No. 26.

[0061] Example 4

[0062] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-alanine at position 68 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-asparagine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 5, and the nucleotide sequence is shown in SEQ ID No. 27.

[0063] Example 5

[0064] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-leucine at position 124 in the amino acid sequence shown in SEQ ID No. 1 is mutated to S-glycine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 6, and the nucleotide sequence is shown in SEQ ID No. 28.

[0065] Example 6

[0066] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-leucine at position 152 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-methionine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 7, and the nucleotide sequence is shown in SEQ ID No. 29.

[0067] Example 7

[0068] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-threonine at position 176 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-arginine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 8, and the nucleotide sequence is shown in SEQ ID No. 30.

[0069] Example 8

[0070] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-valine at position 177 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-isoleucine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 9, and the nucleotide sequence is shown in SEQ ID No. 31.

[0071] Example 9

[0072] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-histidine at position 183 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-tyrosine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 10, and the nucleotide sequence is shown in SEQ ID No. 32.

[0073] Example 10

[0074] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-isoleucine at position 208 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-threonine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 11, and the nucleotide sequence is shown in SEQ ID No. 33.

[0075] Example 11

[0076] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-valine at position 219 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-methionine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 12, and the nucleotide sequence is shown in SEQ ID No. 34.

[0077] Example 12

[0078] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-aspartic acid at position 63 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-threonine, and the L-histidine at position 183 is mutated to L-tyrosine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 13, and the nucleotide sequence is shown in SEQ ID No. 35.

[0079] Example 13

[0080] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-alanine at position 68 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-asparagine, and the L-histidine at position 183 is mutated to L-tyrosine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 14, and the nucleotide sequence is shown in SEQ ID No. 36.

[0081] Example 14

[0082] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-leucine at position 124 in the amino acid sequence shown in SEQ ID No. 1 is mutated to S-glycine, and the L-histidine at position 183 is mutated to L-tyrosine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 15, and the nucleotide sequence is shown in SEQ ID No. 37.

[0083] Example 15

[0084] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-leucine at position 152 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-methionine, and the L-histidine at position 183 is mutated to L-tyrosine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 16, and the nucleotide sequence is shown in SEQ ID No. 38.

[0085] Example 16

[0086] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-threonine at position 176 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-arginine, and the L-histidine at position 183 is mutated to L-tyrosine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 17, and the nucleotide sequence is shown in SEQ ID No. 39.

[0087] Example 17

[0088] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-valine at position 177 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-isoleucine, and the L-histidine at position 183 is mutated to L-tyrosine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 18, and the nucleotide sequence is shown in SEQ ID No. 40.

[0089] Example 18

[0090] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-aspartic acid at position 63 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-threonine, the L-leucine at position 124 is mutated to S-glycine, and the L-histidine at position 183 is mutated to L-tyrosine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 19, and the nucleotide sequence is shown in SEQ ID No. 41.

[0091] Example 19

[0092] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-alanine at position 68 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-asparagine, the L-leucine at position 124 is mutated to S-glycine, and the L-histidine at position 183 is mutated to L-tyrosine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 20, and the nucleotide sequence is shown in SEQ ID No. 42.

[0093] Example 20

[0094] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-leucine at position 124 in the amino acid sequence shown in SEQ ID No. 1 is mutated to S-glycine, the L-alanine at position 152 is mutated to L-asparagine, and the L-histidine at position 183 is mutated to L-tyrosine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 21, and the nucleotide sequence is shown in SEQ ID No. 43.

[0095] Example 21

[0096] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-leucine at position 124 in the amino acid sequence shown in SEQ ID No. 1 is mutated to S-glycine, the L-threonine at position 176 is mutated to L-arginine, and the L-histidine at position 183 is mutated to L-tyrosine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 22, and the nucleotide sequence is shown in SEQ ID No. 44.

[0097] Example 22

[0098] The present application provides a PET degrading enzyme PET-mh mutant, in which the L-leucine at position 124 in the amino acid sequence shown in SEQ ID No. 1 is mutated to S-glycine, the L-histidine at position 183 is mutated to L-tyrosine, and the L-isoleucine at position 208 is mutated to L-threonine. The amino acid sequence of the resulting mutant is shown in SEQ ID No. 23, and the nucleotide sequence is shown in SEQ ID No. 45.

[0099] Example 23

[0100] The examples of this application provide the use of the PET-mh mutant of the PET degrading enzyme in Examples 1 to 22 in hydrolyzing PET:

[0101] Using the PET to be degraded as a substrate, the PET-mh mutant of the PET degrading enzyme of each example was added to 300 μL of potassium phosphate buffer with a pH of 8 to a final concentration of 500 nM as the PET reaction solution, and PET degradation was performed in a water bath at 60° C. to 75° C.

[0102] Example 24

[0103] The present application provides a recombinant plasmid containing a gene encoding the PET-mh mutant of the PET degrading enzyme in Examples 1 to 22 and a construction method thereof:

[0104] Take the recombinant plasmid containing the gene encoding the PET-mh mutant of the PET degrading enzyme in Example 1 as an example:

[0105] 1. Using the nucleotide sequence encoding the amino acids shown in SEQ ID No. 1 as a template and corresponding primers, exponentially amplify the target gene by PCR to construct a PET-mh mutant (PET-mh-1). The primers are designed as follows:

[0106] Upstream primer P1

[0107] 5'-CACCGTTGCGCGGCT-3'

[0108] Downstream primer P2

[0109] 5'- CAAACGGTGTAGGTTGCCAC -3'

[0110] In the PCR reaction system, P1 and P2 were used as upstream and downstream primers, and the ICCG enzyme gene (SEQ ID No. 1) was used as a template to perform PCR reaction and exponentially amplify the target gene.

[0111] The amplification reaction system is:

[0112]

[0113] The amplification program was as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 20 s, annealing at Tm-5°C for 20 s, extension at 72°C for 2 min, 30 cycles; and extension at 72°C for 5 min.

[0114] The PCR amplified products were subjected to 1% agarose gel electrophoresis and recovered using a DNA recovery kit to obtain the gene of the PET-mh mutant containing a single point mutation.

[0115] 2. The template strand was then removed using restriction endonuclease Dpn I, followed by rapid circularization of the PCR product using DNA ligase to obtain a recombinant plasmid containing the gene encoding the PET-mh mutant of the PET degrading enzyme described in Example 1.

[0116] The same method can be used to construct recombinant plasmids containing genes encoding the PET-mh mutants of the PET-degrading enzymes described in Examples 2 to 22. The PCR amplification system and procedures used to construct recombinant plasmids containing genes encoding the PET-mh mutants of the PET-degrading enzymes described in different Examples are the same, differing only in the design of the upstream and downstream primers and templates. In the process of constructing the recombinant plasmid containing the gene encoding the PET-mh mutant of the PET degrading enzyme in Examples 1 to 11, the nucleotide sequence encoding the amino acid shown in SEQ ID No. 1 (SEQ ID No. 46) was used as a template, and the corresponding primers were used to exponentially amplify the target gene by PCR reaction to construct the corresponding PET-mh mutants (PET-mh-1 to PET-mh-11). In the process of constructing the recombinant plasmid containing the gene encoding the PET-mh mutant of the PET degrading enzyme in Examples 12 to 17, the nucleotide sequence encoding the amino acid shown in SEQ ID No. 10 (SEQ ID No. 32) was used as a template, and the corresponding primers were used to exponentially amplify the target gene by PCR reaction to construct the corresponding PET-mh mutants (PET-mh-12 to PET-mh-17). In the process of constructing the recombinant plasmid containing the gene encoding the PET-mh mutant of the PET degrading enzyme in Examples 18 to 22, the nucleotide sequence encoding the amino acid shown in SEQ ID No. 15 (SEQ ID No. No.37) as a template, and using the corresponding primers, the target gene was first exponentially amplified by PCR reaction to construct the corresponding PET-mh mutants (PET-mh-18 to PET-mh-22). The details are shown in Table 1:

[0117] Table 1 Primers designed to construct recombinant plasmids containing genes encoding the PET degrading enzyme mutants in Examples 2 to 22

[0118]

[0119]

[0120] Example 25

[0121] The present application provides an engineering bacterium containing the recombinant plasmid of Example 24 and a method for constructing the same:

[0122] The recombinant plasmids of Example 24 were transformed into BL21(DE3) (full gold, CD601) competent cells and plated on ampicillin plate culture medium to obtain positive recombinants, which were the engineered Escherichia coli bacteria containing the recombinant plasmids of Example 24.

[0123] Example 26

[0124] The present application provides an example of the use of the engineered bacteria in Example 25 in the degradation of PET:

[0125] The engineered E. coli strain constructed in Example 25 was first cultured in 5 mL of LB liquid medium (containing 100 mg / L ampicillin) for 12-16 hours. The strain was then transferred to a shake flask at a 1% inoculum size. When the OD600 value reached the range of 0.8-1.0, the inducer IPTG (isopropyl β-D-1-thiogalactopyranoside) was added to a concentration of 0.1 mM. Expression was induced at 16°C for 22 hours to obtain a fermentation culture.

[0126] The fermentation culture was centrifuged at 4000 rpm for 20 minutes to obtain a bacterial slurry containing the PET-mh mutant. The slurry was resuspended in lysis buffer (50 mM Tris-HCl, 150 mM NaCl, and 10 mM imidazole per liter, pH 7.5) and disrupted using an ultrahigh-pressure continuous flow cell disruptor to obtain a lysed cell suspension. This lysed cell suspension was centrifuged at 10,000 rpm for 1 hour at 4°C. The supernatant was collected to obtain a crude enzyme solution containing the PET-mh mutant. The crude enzyme solution was filtered through a 0.45 μm filter, mixed with the Ni medium, and then placed in a shaking incubator at 4°C and 180 rpm for at least 1 hour. The protein was then purified using Ni-NTA column chromatography. Contaminants were first washed away with wash buffer (50 mM Tris-HCl, 150 mM NaCl, and 20 mM imidazole per liter, pH 7.5). Elution was then performed with elution buffer (50 mM Tris-HCl, 300 mM NaCl, and 300 mM imidazole per liter, pH 7.5). The eluate was collected as the purified protein solution. The purified protein solution was concentrated to 5 mg / mL using a protein concentrator tube. The concentrate was collected and stored at 4°C. The concentrate was then added to the catalytic system (final concentration: 10 μg / mL) as a biocatalyst for PET degradation.

[0127] The PET substrate to be degraded was added to 300 μL of PET reaction solution (each liter of PET reaction solution contained 100 mM potassium phosphate buffer, pH = 8.0, and PET-mh mutant protein was added to a final concentration of 10 μg / mL), and placed at 65°C-75°C for biocatalytic reaction.

[0128] Comparative Example 1

[0129] This comparative example provides a PET degrading enzyme mutant, in which the L-alanine at position 211 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-arginine.

[0130] Comparative Example 2

[0131] This comparative example provides a PET degrading enzyme mutant, in which the L-serine at position 212 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-arginine.

[0132] Comparative Example 3

[0133] This comparative example provides a PET degrading enzyme mutant, in which the L-proline at position 179 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-glutamic acid.

[0134] Comparative Example 4

[0135] This comparative example provides a PET degrading enzyme mutant, in which the L-serine at position 66 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-alanine.

[0136] Comparative Example 5

[0137] This comparative example provides a PET degrading enzyme mutant, in which the L-alanine at position 66 in the amino acid sequence shown in SEQ ID No. 1 is mutated to S-glycine.

[0138] Test Example 1

[0139] The method of Example 23 was used to investigate the effects of the protein with the amino acid sequence shown in SEQ ID No. 1, the PET degrading enzyme mutants of Examples 1 to 22, and Comparative Examples 1 to 5 on the degradation of low-crystallinity PET for 5 h.

[0140] Using a PET film (6 mm diameter) with a crystallinity of 7.3% as the substrate, the protein with the amino acid sequence shown in SEQ ID No. 1, the PET-mh mutant PET-degrading enzyme from each example, or the PET-degrading enzyme mutant from each comparative example was added to 300 μL of potassium phosphate buffer at pH 8 to a final concentration of 500 nM. PET degradation was performed in a water bath at 60°C-75°C. After 5 hours of reaction, methanol was added to terminate the reaction. The production of TPA, bis(2-hydroxyethyl)terephthalate (BHET), and 4-((2-Hydroxyethoxy)carbonyl)benzoic acid (MHET) was determined by reverse-phase HPLC. BHET and MHET are intermediates produced during the enzyme's PET degradation process.

[0141] The results are shown in Table 2.

[0142] Table 2 TPA, BHET and MHET production (low crystallinity, 5h)

[0143]

[0144] The above results indicate that mutants obtained by mutating amino acids 63, 68, 124, and 183 individually, or by mutating any one of amino acids 63, 68, 124, 152, 176, and 177 in addition to amino acid 183, or by mutating any one of amino acids 63, 68, 152, 176, and 208 in addition to amino acids 124 and 183, can achieve higher degradation efficiency than the protein with the amino acid sequence shown in SEQ ID No. 1 within 5 hours of degradation. The yields of MHET and TPA are shown in Figures 1 to 3.

[0145] Test Example 2

[0146] This test example investigated the effects of the protein with the amino acid sequence shown in SEQ ID No. 1 and the PET-mh mutants of Examples 9, 14, 15, and 22 on the degradation of high-crystalline PET for 5 h using the method of Example 23.

[0147] PET particles (100 mg) obtained by grinding PET plastic bottles with a crystallinity of 26% were used as a substrate. A protein with an amino acid sequence as shown in SEQ ID No. 1 or a PET-mh mutant of the PET degrading enzyme of each example was independently added to 300 μL of potassium phosphate buffer at a pH of 8 to a final concentration of 500 nM. This was used as the PET reaction solution. PET degradation was carried out in a 70°C water bath. After 5 hours of reaction, methanol was added to terminate the reaction. The generated TPA, BHET, and MHET were analyzed by reverse-phase HPLC.

[0148] The results are shown in Table 3.

[0149] Table 3 TPA, BHET and MHET production (high crystallinity, 5h)

[0150]

[0151] The above results indicate that mutants mutating amino acid 183 alone, mutating amino acids 124 or 152 and 183 together, or mutating amino acids 124, 183, and 208 all achieved higher degradation efficiency for highly crystalline PET than the protein with the amino acid sequence shown in SEQ ID No. 1 within 5 hours. The yields of MHET and TPA are shown in Figure 4.

[0152] Test Example 3

[0153] This test example investigated the effects of the protein with the amino acid sequence shown in SEQ ID No. 1 and the PET-mh mutants of Examples 1, 2, 6, 7, 10, and 11 on the degradation of PET with different crystallinity for 24 hours according to the method of Example 23.

[0154] Using PET of varying crystallinity as a substrate, the protein with the amino acid sequence shown in SEQ ID No. 1 or the PET-mh mutant of each example was added to 300 μL of potassium phosphate buffer at pH 8 to a final concentration of 500 nM. PET degradation was performed in a 60°C-75°C water bath. After 24 hours of reaction, methanol was added to terminate the reaction, and the production of TPA and MHET was determined by reverse-phase HPLC.

[0155] The results are shown in Table 4.

[0156] Table 4 TPA and MHET production (24h)

[0157]

[0158] From the above results, it can be seen that by mutating amino acids 29, 62, 152, 176, 208 or 219 alone, the resulting mutants can achieve higher degradation effects on PET of different morphologies and crystallinity than the protein with the amino acid sequence shown in SEQ ID No. 1 after 24 hours of degradation.

[0159] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent replacements or improvements made within the spirit and principles of the present application should be included in the scope of protection of the present application.

Claims

1. A PET degrading enzyme PET-mh mutant, characterized in that: The PET degrading enzyme PET-mh mutant has an amino acid sequence as follows: at least one of the amino acids at positions 29, 62, 63, 68, 124, 152, 176, 177, 183, 208, and 219 in the amino acid sequence shown in SEQ ID No. 1 is mutated.

2. The PET-degrading enzyme PET-mh mutant according to claim 1, characterized in that: The PET degrading enzyme PET-mh mutant has an amino acid sequence in which the amino acid at position 29 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-alanine; and / or The amino acid at position 62 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-threonine; and / or The amino acid at position 63 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-threonine; and / or The amino acid at position 68 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-asparagine; and / or The amino acid at position 124 in the amino acid sequence shown in SEQ ID No. 1 is mutated to S-glycine; and / or The amino acid at position 152 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-methionine; and / or The amino acid at position 176 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-arginine; and / or The amino acid at position 177 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-isoleucine; and / or The amino acid at position 183 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-tyrosine; and / or The amino acid at position 208 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-threonine; and / or The amino acid at position 219 in the amino acid sequence shown in SEQ ID No. 1 is mutated to L-methionine.

3. The PET-degrading enzyme PET-mh mutant according to claim 1 or 2, characterized in that: The PET degrading enzyme PET-mh mutant has an amino acid sequence in which at least one of the amino acids at positions 63, 68, 152, 183, 208, and 219 in the amino acid sequence shown in SEQ ID No. 1 is mutated.

4. The PET-degrading enzyme PET-mh mutant according to claim 3, characterized in that: The amino acid sequence of the PET degrading enzyme PET-mh mutant is as follows: at least the 183rd amino acid in the amino acid sequence shown in SEQ ID No. 1 is mutated.

5. The PET-degrading enzyme PET-mh mutant according to claim 4, characterized in that: The amino acid sequence of the PET degrading enzyme PET-mh mutant is as follows: any one of the amino acids at positions 63, 68, 124, 152, 176, 177 and the amino acid at position 183 in the amino acid sequence shown in SEQ ID No. 1 are mutated together.

6. The PET-degrading enzyme PET-mh mutant according to claim 5, characterized in that: The PET degrading enzyme PET-mh mutant has an amino acid sequence as follows: the amino acid at position 124 or 152 and the amino acid at position 183 in the amino acid sequence shown in SEQ ID No. 1 are mutated together.

7. The PET-degrading enzyme PET-mh mutant according to claim 4, characterized in that: The amino acid sequence of the PET degrading enzyme PET-mh mutant is as follows: any one of the amino acids at positions 63, 68, 152, 176, 208 and the amino acids at positions 124 and 183 in the amino acid sequence shown in SEQ ID No. 1 are mutated together.

8. The PET-degrading enzyme PET-mh mutant according to claim 7, characterized in that: The PET degrading enzyme PET-mh mutant has an amino acid sequence as follows: the 208th amino acid and the 124th and 183rd amino acids in the amino acid sequence shown in SEQ ID No. 1 are mutated together.

9. Use of the PET-mh mutant of PET degrading enzyme according to any one of claims 1 to 8 in hydrolyzing PET, characterized in that: The PET-mh mutant of the PET-degrading enzyme is added to a potassium phosphate buffer having a concentration of 80 mM to 120 mM and a pH value of 7.5 to 8.5 until the final concentration of the PET-mh mutant of the PET-degrading enzyme is 5 μg / mL to 15 μg / mL, and PET degradation is performed at a temperature of 65° C. to 75° C. and a rotation speed of 100 rpm to 220 rpm.

10. A coding gene, characterized in that Comprising a nucleotide sequence encoding the PET-mh mutant of the PET degrading enzyme according to any one of claims 1 to 8.

11. The coding gene according to claim 10, characterized in that The amino acid sequence of the PET degrading enzyme PET-mh mutant is shown in SEQ ID No.2 to SEQ ID No.23, and the corresponding nucleotide sequences are shown in SEQ ID No.24 to SEQ ID No.45, respectively.

12. A recombinant plasmid, characterized in that: Comprising the nucleotide sequence encoding the gene according to claim 10 or 11.

13. The method for constructing a recombinant plasmid according to claim 12, characterized in that: Using the nucleotide sequence encoding the amino acid shown in SEQ ID No. 1 as a template, the corresponding primers were used to construct a single point mutation, the target gene was first exponentially amplified by PCR reaction, and then the template chain was removed by restriction endonuclease Dpn I, and then the PCR product was quickly circularized by DNA ligase to obtain a recombinant plasmid.

14. An engineered bacterium, characterized in that: A host cell comprising the recombinant plasmid according to claim 12.

15. The engineered bacteria according to claim 14, characterized in that: The engineered bacteria is Escherichia coli.

16. The method for constructing an engineered bacterium according to claim 15, characterized in that: The recombinant plasmid of claim 12 is transformed into BL21 (DE3) competent cells, and spread on ampicillin plate culture medium to obtain positive recombinants, which are the engineered bacteria.

17. Use of the engineered bacteria according to claim 14 or 15 in degrading PET.

Images