Phospholipid conjugates and their uses

Abstract

The present disclosure relates to phospholipid conjugates comprising a phospholipid and a chemical compound, such as an antioxidant, wherein said chemical compound is conjugated to the tail of said phospholipid, along with the use of such phospholipid conjugates for treatment of liver diseases.

Description

[0001] Phospholipid conjugates and their uses

[0002] Technical field

[0003] The present disclosure relates to phospholipid conjugates comprising a phospholipid and a chemical compound, such as an antioxidant, wherein said chemical compound is conjugated to the tail of said phospholipid, along with the use of such phospholipid conjugates for treatment of liver diseases.

[0004] Background

[0005] Chronic liver disease cases impact 1.5 billion people worldwide, with significant increased trends particularly in fatty liver disease, be it from metabolic syndrome or from alcohol in Western countries. As the disease advances, the development of chronic liver failure and repeat hospitalization imparts a huge healthcare cost (>40Bn in the Ell) and societal morbidity, with many succumbing to a severe inflammatory state resulting in multi-organ failure, known as acute-on-chronic liver failure (ACLF).

[0006] Current management for liver failure is entirely supportive, unless a liver transplant can be availed (limited availability), with no licensed treatments available. Given the central role of oxidative stress in liver failure and disease progression (Banerjee P et al 2023), use of N-acetyl cysteine as an antioxidant therapy in liver failure is limited by need for early intervention, and specifically in the context of acute liver failure secondary to drugs (mainly acetaminophen), and is applied only when the patient has already presented in liver failure. Moreover, N-acetyl cysteine targets the lack of glutathione for cell metabolism due to acetaminophen adducts but does nothing to counter the severe reactive oxidant species generation and inflammation common to causes of liver failure. Other strategies to support the liver (albumin dialysis; extracorporeal cell systems) have shown no consistent benefit in improving survival. A key drawback is the lack of significant ability to reverse the impact of necro-inflammation by systems that saturate within hours of application.

[0007] Oxidative stress and inflammation play an important role in the advancement of liver diseases. As described above, clinical treatment has aimed at using N-acetyl cysteine in the acute liver failure setting, which targets the lack of glutathione for cell metabolism but does not counter the ongoing reactive oxygen species (ROS) production by cellular damage and innate immune cell activation. Consequently, extracellular scavenging of ROS might be envisioned as rejuvenating the liver milieu. However, current strategies of reducing oxidant stress such as albumin dialysis, does not specifically feature design of antioxidant capacity, but relies on the capacity of albumin-binding to remove toxins and its antioxidative and immunomodulatory effects, and importantly, has not been shown to have any survival benefit.

[0008] Thus, access to therapeutic strategies that counteract cellular stress induced by reactive oxygen species (ROS) is an unmet clinical need.

[0009] Lipid droplets are organelles that were originally thought to be predominantly static entities for lipid storage. However, it has been recognized over the past 10-15 years that lipid droplets are preserved across species and, they are involved in diverse cellular functions beyond lipid storage including lipid transport and metabolism, protein storage and degradation, or nucleic acid handling as recently discussed in details (Zhang et al. 2019) . Early on, it has been speculated that lipid droplets can establish functional links with other organelles via lipid bridges or specific proteins (Murphy et al. 2009, Rakotonirina-Ricquebourg et al 2022). In particular, the importance of lysosomes in intracellular lipid transport is becoming more evident as outlined by Thelen and Zoncu (Thelen et al 2017). During endocytosis, the inward budding of vesicles from the limiting membrane of endosomes is facilitated by the ESCRT complex, as extensively described in a review by Schoneberg et al.(Schbneberg et al 2017). The lysosomal lumen gradually fills with these vesicles during maturation undergoing coalescence and lipid composition modifications. It is speculated that to maintain cellular lipid homeostasis, these lipids need to be extracted from the lysosomal lumen and inserted into the lysosomal limiting membrane. From there, the lipids can be further transported to other organelles, such as the endoplasmic reticulum (Choudhary et al 2021, Salo et al 2019) where they might undergo esterification and be stored as lipid droplets.

[0010] Although the understanding of the lipid droplets’ importance and their origin is fast improving, fundamental questions such as the mechanisms for protein sorting and localization in the lipid droplets or the lipid droplet biogenesis remain to be elucidated. Further, consideration of lipid droplets as therapeutic target is limited. Lipid droplets have been previously targeted in photodynamic therapies. For instance, boron dipyrromethenes were modified with photodynamic therapy agents for a theragnosis approach in HeLa cells (Tabero et al. 2020). Further, aggregation-induced emission photosensitizers were coated with cell membranes derived from dendritic cells, leading to photodynamic therapy agents accumulating in the lipid droplets of cancer cells (Xu et al 2021). In another report, fatty acids (rumenic acid) and a doxorubicin prodrug were incubated with adipocytes for loading and then injected into the tumor microenvironment (Wen et al 2019). Alternatively, the photosensitizer pyropheophorbide A was conjugated to 1-palmitoyl-2-hydroxy-sn-glycero-3- phosphocholine and incubated with adipocytes, resulting in localization in lipid droplets, which were subsequently purified from the adipocytes and incubated with SKOV3 cancer cells that resulted in an enhanced efficacy of photodynamic therapy (Liang et al 2021).

[0011] Summary

[0012] There is a need for developing safe and effective treatments of liver diseases. Current strategies to modify lipids of the liver with lipid lowering agents do not address the cell specific issues. The present inventors show that phospholipid conjugates comprising a chemical compound conjugated to the tail of a phospholipid associate with lipid droplets in steatotic liver cells and can reduce reactive oxygen species (ROS).

[0013] The main object of the present disclosure is to provide phospholipid conjugates comprising a phospholipid and a chemical compound, such as an antioxidant, wherein the chemical compound is conjugated to the tail of the phospholipid. Such phospholipid conjugates can be used for treatment of liver diseases.

[0014] In a first aspect, the present disclosure concerns a phospholipid conjugate comprising a phospholipid and a chemical compound, such as an antioxidant, wherein said chemical compound is conjugated to the tail of said phospholipid.

[0015] In a second aspect, the present disclosure concerns a phospholipid conjugate for use in the treatment of a liver disease, a. wherein said phospholipid conjugate comprises a phospholipid and a chemical compound, such as an antioxidant, and wherein said chemical compound is conjugated to the tail of said phospholipid.

[0016] In another aspect, the present disclosure concerns a liposome composition comprising the phospholipid conjugate. In another aspect, the present disclosure concerns a small polymer lipid hybrid vesicle comprising the phospholipid conjugate.

[0017] In another aspect, the present disclosure concerns a small polymer lipid hybrid vesicle further comprising an amphiphilic block copolymer.

[0018] In another aspect, the present disclosure concerns a small polymer lipid hybrid vesicle, wherein said amphiphilic block copolymer is poly(cholesteryl methacrylate-co-2- hydroxyethyl methacrylate)-block-poly(2-carboxyethyl acrylate) (BCP).

[0019] In another aspect, the present disclosure concerns a support molecule comprising the phospholipid conjugate.

[0020] In another aspect, the present disclosure concerns a semi-synthetic organelle comprising the phospholipid conjugate.

[0021] In another aspect, the present disclosure concerns an engineered lipid droplet comprising the phospholipid conjugate.

[0022] In another aspect, the present disclosure concerns an engineered lipid droplet comprising the phospholipid conjugate further comprising one or more lipids.

[0023] In another aspect, the present disclosure concerns a composition comprising the phospholipid conjugate and one or more excipients.

[0024] In another aspect, the present disclosure concerns a pharmaceutical composition comprising the phospholipid conjugate and one or more pharmaceutically acceptable excipients.

[0025] In another aspect, the present disclosure concerns an ex vivo composition comprising the phospholipid conjugate and one or more excipients.

[0026] In another aspect, the present disclosure concerns a cellular composition comprising the phospholipid conjugate and one or more cells. In another aspect, the present disclosure concerns a kit of parts comprising a. The phospholipid conjugate, and b. Instructions for use.

[0027] In another aspect, the present disclosure concerns a method of treating or preventing a liver disease, the method comprising administering the phospholipid conjugate to a subject in need thereof.

[0028] In another aspect, the present disclosure concerns a method of modifying the phospholipid ratio in cell membranes, the method comprising administering the phospholipid conjugate to a subject in need thereof.

[0029] In another aspect, the present disclosure concerns a method of manufacturing a phospholipid conjugate, the method comprising the steps of: a. Providing a phospholipid and a chemical compound, such as an antioxidant, and b. Conjugating said chemical compound, such as an antioxidant, to the tail of said phospholipid.

[0030] Description of Drawings

[0031] Figure 1

[0032] Steatotic HepG2 cells, a) Representative CLSM images of HepG2 cells stained with BODIPY493 / 503(green) and CellMask Deep Red (blue) to visualize the fat droplets and the cell membrane, respectively, i) Pristine HepG2 cells (no FFA) and HepG2 cells treated with ii) oleic acid (OA) and palmitic acid (PA) for 24 h, iii) two doses of oleic acid and palmitic acid over 48 h, iv) oleic acid and palmitic acid for 24 h followed by 24 h in regular media, v) 0.9 mM oleic acid for 24 h, and vi) two doses of 0.9 mM oleic acid over 48 h. The mole ratio of oleic acid to palmitic acid was in all cases 0.9 to 0.3 mM. Scale bars are 20 pm. b) The effect of the different FFA treatments on cell viability assessed by the CCK-8 assay (n=3). The statistical significance used to compare the means was determined using a one-way analysis of variance (one-way ANOVA) followed by a Tukey's multiple comparison post hoc test. *p<0.05. c) Intracellular reactive oxygen species (ROS) in pristine HepG2 cells (left) and in HepG2 cells exposed to oleic acid and palmitic acid for 24 h (green: intracellular conversion of 2', 7'- dichlorodihydrofluorescein diacetate (H2DCFDA) to fluorescent 2',7'-dichlorofluorescein (DCF) due to the presence of ROS; blue: Hoechst 33342). Scale bars are 20 pm.

[0033] Figure 2

[0034] Uptake of liposomes in steatotic HepG2 cells. a)i)-iv) Cartoon showing the composition of liposomes with NBD tail-labeled lipids, made of either DOPC, DOPC / DOPE or DOPC / DOPS lipids. Liposome characterization, v) Representative TEM images of (scale bars: 500 nm). Vi) Histograms over diameters measured from TEM images. A minimum of 100 particles were measured for each sample type. The resulting histograms were fitted to a Gaussian amplitude function, yielding the mean size and variance (given as mean diameter ± 2o) as indicated above the histograms, vii) Fluorescence intensity spectra of liposomes (Aex= 488 nm I Aem= 503-650 nm) illustrate the incorporation of the fluorescent lipids. The data are expressed as mean ± SD (n = 3). b) Cell viability of pristine HepG2 cells or steatotic HepG2 cells exposed to Lxfor 24 h., normalized to untreated cells. (n=3) c) Representative CLSM images of steatotic HepG2 cells incubated with i) Lp^a-NBD, ii) L™a-NBD, iii) Lpasil-NBD, or iv) Ata£ii-NBD,head-Rho0r v)Ltaii-NBD,head-RhOf°r24 h (green: NBD on lipids; red: Rho on lipids; blue: Lysotracker Deep Red). Scale bars are 10 pm. vi) Fluorescence intensity of lipid droplets from HepG2 cell incubated in presence or absence of Lppa-NBD. vii) Representative CLSM of lipid droplets purified from steatotic HepG2 cell (bottom panel) or steatotic HepG2 cell incubated with Lppa-NBDfor 24 h (upper panel) (green: tail-NBD; red: Nile Red). Scale bars are 10 pm. d) i) The cell mean fluorescence was monitored by flow cytometry after 24 h incubation with , followed by media exchange and monitoring of the intracellular fluorescence for up to 5 h to estimate the retained Lfaii-NBD- '') The cell mean fluorescence of pristine and steatotic HepG2 cells due to the uptake of NBDin 24 h is divided by the fluorescence intensity of the NBDstock solutions to obtain the relative cell mean fluorescence (Rel. CMF). iii) The change in cell mean fluorescence over 5 h of pristine and steatotic HepG2 cells preexposed L*ail-NBDfor 24 h, normalized to the cell mean fluorescence after 24 h. The media was either regular media or supplemented with FFA (oleic acid : palmitic acid 3:1 molar ratio). (n=3). iv) The fluorescent intensity of the media supernatant of steatotic HepG2 cells during the 5 h exposure to pristine media (Aex / em = 467 / 525 nm). (n=3) v) Representative CLSM images of steatotic HepG2 cells incubated with

[0035] Ltaii-NBD f°r24 h (top) and after 3.5 h (bottom) in in FFA-free media (green: NBD from lipids; blue: Hoechst 33342). The scale bars are 10 pm.

[0036] Figure 3

[0037] Steatotic HepG2 cells and sHVs. a) sHVs made from the amphiphilic block copolymer poly(cholesteryl methacrylate-co-2-hydroxyethyl methacrylate)-block-poly(2- carboxyethyl acrylate) (BCP) and DOPE lipids using either Oregon Green-labeled BOP (i, BCP-OG) or Rhodamine-labeled BCP (ii, BCP-Rho) as well as NBD tail labeled DOPE lipids (iii) for the assembly. HVs characterization, iv) Representative TEM images of sHV^"d-_°RGh0(scale bar: nm). v) Histograms over diameters measured from TEM images. A minimum of 100 particles were measured for each sample type. The resulting histograms were fitted to a Gaussian amplitude function, yielding the mean size and variance (given as mean diameter ± 2o) as indicated above the histograms, vi) Fluorescence emission spectra of SHV^JNBD before (black) and after exposure to 0.02% (grey) and 1% TX (blue) (Aex = 488 nm / Aem = 503-650 nm). The data are expressed as mean ± SD (n = 3). b) The viability of pristine and steatotic HepG2 cells exposed to increasing amounts of sHVpEP"OGor sHVpEPNBD° f°r24 h (10 μL of different concentrations of the stock solution). (n=3) c) Representative CLSM images of pristine (i) or steatotic (ii) HepG2 cells incubated with sHVpEPNBQ° (blue: Lysotracker Deep Red; red: BCP-Rho; green: NBD tail-labeled DOPE). Scale bars are 10 pm. d) Flow cytometry (Aex=488 nm laser) was used to monitor the cell mean fluorescence of pristine or steatotic HepG2 cells due to the uptake of sHVpEPNBD(i) or sHVpEP-OG(ii) after 3 h, 6 h or 24 h. Subsequently, the media was exchanged and the retention of the fluorescent lipids (i) and BCP-Rho (ii) was monitored after 18 h. (n=3)

[0038] Figure 4

[0039] Liposomes with EUK-modified phospholipids, ai) LPG / K'lcrylpcwas made by UV-cross linking EUK-C to the acrylate group using LAP as a photoinitiator. Alternatively, acrylPC was omitted, resulting in LEUK where EUK-C and DOPC is non-cross linked. Mass spectra of liposomes with EUK-modified phospholipids. Mass spectrum of ii) EUK-C, iii) I before (vi) and after UV (vii) and EUK before (viii) and after UV (ix). b) Representative TEM images of LEu^crylpcand . Scale bars are 500 nm. c) i) H2O2 removal by LAcryl. after 30 min and 3 h incubated with 5 pM H2O2. (n=3). EUK liposomes stability, ii) Representative TEM images of LPECUKand £pc / acrylpcafter 7 days (scale bars: 500 nm). iii) H2O2 removal of EUK liposomes after 30 min or 3 hours when incubated with 5 pM H2O2 after 7 days.

[0040] Figure 5

[0041] Steatotic HepG2 cells and Lpc / Kqcrylpc. a) i) HepG2 cells exposed to FFA for 5 h before the addition of the different liposome formulations for 19 h followed by the detection of the intracellular ROS. ii) Representative CLSM images of pristine HepG2 cells (I), steatotic HepG2 cells (II), and steatotic HepG2 cells incubated with Lpc / Kqcrylpc(III),LEUK (IV), or Lpc / acrylpc(V) (green: carboxy-DCF; blue: Hoechst 33342). Scale bars are 10 pm. b) The pixel intensity originating from carboxy-DCF. At least 7 images of each condition was used per repeat (n=3). The statistical significance used to compare the means was determined using a one-way analysis of variance (one-way ANOVA) followed by a Tukey's multiple comparison post hoc test. *p<0.05.

[0042] Figure 6

[0043] Steatotic HHL-5 cells, a) i) HHL-5 cells were cultured in glucose or galactose media, and exposed to 0.3-1 .2 mM FFA (oleic acid:palmitic acid in a either 3:1 or 1 :3 mole ratio) for 24 h or 48 h. ii) The cell viability of HHL-5 cells exposed to increasing amounts of FFA. (n=3) b) Representative CLSM images of HHL-5 cells exposed to 0 mM-1.2 mM FFA (oleic acid:palmitic acid mole ratio of either 3:1 or 1 :3) for 48 h (green: BODIPY493 / 503stained lipid droplets; blue: Hoechst 33342). c) Intracellular ROS in response to 0 mM-1.2 mM FFA (oleic acid:palmitic acid mole ratio of 3:1 or 1 :3) for 48 h (green: carboxy-DCF; blue Hoechst 33342). d) The expression of the mitochondrial transcripts ND1 (Complex II), Cytb (Complex III), COXI and COXII (Complex IV) and ATP6 / 8 (Complex V) of pristine and steatotic HHL-5 cells was measured by RT-qPCR. (n=3, *p<0.1). The statistical significance used to compare the means was determined using a one-way analysis of variance (one-way ANOVA) followed by a Tukey's multiple comparison post hoc test.

[0044] Figure 7 a) Representative fluorescence microscopy images of steatotic HHL-5 cells exposed incubated with Lpfn-NBDfor 24 h (green: NBD tail-labeled DOPE). Scale bar is 50 pm. b) i) Pristine and steatotic HHL-5 cells were either incubated in (FFA-free) media or media containing Lp<(J / Kqcrylpcor L^UK f°r48 h before assessing the intracellular ROS levels, ii) Representative fluorescent microscopy images of pristine and steatotic HHL-5 cells as well as these cells incubated with Lp<(J / Kqcrylpcor L^UK f°r48 h (green: carboxyDCF). Scale bars are 50 pm. iii) The pixel intensities in the images originating from carboxy-DCF. (***p<0.0005, n=4) The statistical significance used to compare the means was determined using a one-way analysis of variance (one-way ANOVA) followed by a Tukey's multiple comparison post hoc test, c) i) The viability of pristine or steatotic HHL-5 cells treated with Lp<(J / Kqcrylpcor L^UK 'ncomparison to untreated pristine and steatotic HHL-5 cells measured using the CCK-8 assay. The data is normalized to untreated pristine HHL-5 cells, ii) I) Representative bright field images of pristine and steatotic HHL-5 cells as well as pristine and steatotic HHL-5 cells treated withLEUKCrylPC or LEUK incubated with the dye neutral red to assess the cell viability. Scale bars are 50 pm. II) The neutral red treated HHL-5 cells were de-stained to quantitate the amount of sequestered neutral red by measuring the absorbance of the solution, d) The expression of the mitochondrial transcripts ND1 (Complex II), Cytb (Complex III), COXI and COXII (Complex IV) and ATP6 / 8 (Complex V) of pristine and steatotic HHL-5 cells treated with Lp<(J / Kqcrylpcor L^UK compared to untreated pristine and steatotic HHL- 5 cells measured by RT-qPCR. (*p<0.05, n=3). The statistical significance used to compare the means was determined using a one-way analysis of variance (one-way ANOVA) followed by a Tukey's multiple comparison post hoc test.

[0045] Figure 8

[0046] Treatment of HepG2 cells with FFA. a) Treatment 0: HepG2 cells were left untreated with FFAs for 48 h. b) Treatment 1: The media was exchanged to media containing a final concentration of 1.2 mM FFA (0.9 mM OA and 0.3 mM PA), and left for 24 h before the media was exchanged to media containing 1.2 mM FFA for 24 h. c) Treatment 2: The media was exchanged to media with a final concentration of 1.2 mM FFA, and left for 24 h before the media was exchanged FFA-free media for 24 h. d) Treatment 3: The media was replace with FFA-free media and let to incubate for 24 h before the media was exchanged to media containing 1.2 mM FFA for 24 h. Figure 9 a) Hepatocytes (HepG2 or HHL-5 cells) are incubated with free fatty acids (FFAs; oleic acid and palmitic acid), b) i) The steatotic hepatocytes are incubated with liposomes made from phospholipids that contained lipids with covalently attached fluorophores NBD to either the tail or head groups to yield L^U-NSDOR^ead-NBD - ") Alternately, a small antioxidant molecule (ELIK-C) was integrated with the lipids to yield LP^crylPCwith ROS scavenging capability.

[0047] Figure 10 a) Chemical structure of NBD tail-labled DOPE lipids, b) CLSM image of HepaRG cells exposed to L^U-NSD showing the lysosomal escape of the lipids and their location in the fat droplets. Scale bar: 10 pm

[0048] Detailed description

[0049] The term “a” refers to one or more.

[0050] The term “salen-manganese complexes” as used herein refers to catalase mimetics with superoxide dismutase (SOD) and peroxidase mimetic activity. Salen-manganese complexes such as the prototype N,N'-bis(salicylidene) ethylenediamine chloride (EUK- 8) contain a coordinated manganese ion whose status determines whether the complex functions as an SOD or catalase mimetic. Without being bound by theory, the mechanism employed for the dismutation of superoxide anions is very similar to that of MnSOD. In a first step, Mn(lll) is reduced to Mn(ll) by a superoxide anion, releasing molecular oxygen. The Mn(ll) is then converted back to Mn(lll) by another superoxide anion, yielding water. In the context of its catalase mimetic activity, salen-manganese is oxidized to a salen-oxomanganese complex by hydrogen peroxide, liberating water. The initial complex is then regenerated, detoxifying another molecule of hydrogen peroxide thereby releasing water and molecular oxygen.

[0051] The term “ELIK-8” refers to a compound having a structure according to Formula (I)

[0052]

[0053] The term “EUK-134” refers to a compound having a structure according to Formula (II)

[0054] The term “EUK-189” refers to a compound having a structure according to Formula (III)

[0055] (III).

[0056] The term “EUK-207” refers to a compound having a structure according to Formula (IV)

[0057]

[0058] The term “ELIK-B” refers to a compound having a structure according to Formula (VI)

[0059]

[0060] The term “ELIK-C” refers to a compound having a structure according to Formula (VII)

[0061] The term “ELIK-D” refers to a compound having a structure according to Formula (VIII)

[0062]

[0063] (VIII).

[0064] The term “phospholipid” refers to a lipid containing a phosphate group, such as a lipid comprising two fatty acids, a phosphate group, and a glycerol molecule. A list of phospholipids is given in Table 1.

[0065] Table 1 : Phospholipid abbreviation and chemical name.

[0066] The term “acrylPC” refers to 1-palmitoyl-2-[16-(acryloyloxy)palmitoyl]-sn-glycero-3- phosphorylcholine (16:0-16:0(acrylate) PC)

[0067] Phospholipid Conjugate

[0068] The present disclosure concerns phospholipid conjugate comprising a phospholipid and a chemical compound, which may for example be compatible with the inherent intracellular lipid transport mechanisms. In this way, the present disclosure may take advantage of the inherent intracellular lipid transport mechanisms in delivering engineered phospholipids to intracellular lipid droplets in e.g. steatotic hepatic cells. In one embodiment, the present disclosure concerns a phospholipid conjugate comprising a phospholipid and a chemical compound, such as an antioxidant, wherein said chemical compound is conjugated to the tail of said phospholipid.

[0069] This may be used in the treatment of diseases, for example in liver disease.

[0070] In another embodiment, the present disclosure concerns a phospholipid conjugate for use in the treatment of a liver disease, wherein said phospholipid conjugate comprises a phospholipid and a chemical compound, such as an antioxidant, and wherein said chemical compound is conjugated to the tail of said phospholipid.

[0071] Lipids

[0072] Identifying a suitable lipid for the preparation of the phospholipid conjugate described herein will depend on the end use of the phospholipid conjugates. The lipids could be e.g. a natural or a synthetic phospholipid. In some embodiments, said phospholipid is selected from the group consisting of natural phospholipids and synthetic phospholipids.

[0073] There are multiple groups of phospholipids to which a chemical compound could be conjugated. In some embodiments, said phospholipid is selected from the group consisting of phosphatidic acids, phosphatidylcholines, phosphatidylglycerols, phosphatidylethanolamines and phosphatidylserines. In some embodiments, said phospholipid is selected from the group consisting of DDPC, DEPA-NA, DEPC, DEPE, DEPG-NA, DLOPC, DLPA-NA, DLPC, DLPE, DLPG-NA, DLPG-NH4, DLPS-NA, DMPA-NA, DMPC, DMPE, DMPG-NA, DMPG-NH4, DMPG-NH4 / NA, DMPS-NA, DOPA-NA, DOPC, DOPE, DOPG-NA, DOPS-NA, DPPA-NA, DPPC, DPPE, DPPG- NA, DPPG-NH4, DPPS-NA, DSPA-NA, DSPC, DSPE, DSPG-NA, DSPG-NH4, DSPS- NA, EPC, HEPC, HSPC, LYSOPC, MYRISTIC, LYSOPC PALMITIC, LYSOPC STEARIC, Milk Sphingomyelin, MPPC, MSPC, PMPC, POPC, POPE, POPG-NA, PSPC, SMPC, SOPC and SPPC. In some embodiments, said phospholipid is selected from the group consisting of DOPC, DOPE and DOPS. In some embodiments, said phospholipid is DOPC. In some embodiments, said phospholipid is DOPE. In some embodiments, said phospholipid is DOPS. In some embodiments, the phospholipid is selected from the group consisting of 4ME 16:0 NBD PE (NBD-DPhPE), 4ME 16:0 PC, 4ME 16:0 PE, 4ME 16:0 PG, 4ME 16:0 PA, 4ME 16:0 PS, 4ME 16:0 Coenzyme A, 4ME 16:0 Diether PC, 4ME 16:0 Diether PE, 4ME 16:0 Diether DG, 12:0 Biotin-18: 1 PE, Biotin Sphingosine, Biotin S1P, 18:1- 12:0 Biotin DG, 12:0 N-Biotinyl Fatty Acid, 18:1-12:0 Biotin PS, 18:1-12:0 Biotin PA, 18:1-12:0 Biotin PE, 18:1-12:0 Biotin PC, 18:1-6:0 Biotin PI(3,5)P2, 12:0 Biotinyl LPA, 18:1-6:0 Biotin PI(4,5)P2, 18:1-12:0 Biotin PIP3, 12:0 Biotinyl Coenzyme A, 12:0 N- Biotinyl fatty acid NHS, 18:0 (9,10dibromo) PC, 16:0-18:0(4, 5-dibromo) PC, 16:0-18:0 (6-7BR) PC, 16:0-18:0 (9-10BR) PC, 16:0-18:0 (11-12BR) PC, 16:0-succinoyl PC, PAzePC, Azelaoyl-PAF, PGPC, 16:0-09:0 (ALDO) PC, POVPC, POBPC, 23:2 Diyne PE [DC(8,9)PE], 16:0-23:2 Diyne PC, 16:0-23:2 Diyne PE, 23:2 Diyne PC [DC(8,9)PC], 16:0-16:0(acrylate) PC, 14:0-14:0(COOH) PC.

[0074] The lipids of the present disclosure may be amphipathic lipids, which means molecules that have a hydrophilic "head" group and one or more hydrophobic "tail" groups. For specific conjugation of the chemical compound, to e.g. the tail group, the phospholipids may contain chemically reactive groups, such as an acrylate group. In some embodiments, said chemical compound is covalently conjugated to the tail of said phospholipid. In some embodiments, said phospholipid and said chemical compound, such as said antioxidant, are conjugated via a chemically reactive group located at the tail of the phospholipid. In some embodiments, the phospholipid comprises an acrylate group. In some embodiments, said phospholipid and said chemical compound, such as said antioxidant, are conjugated via acrylPC. In some embodiments, the phospholipid has an unmodified head group. In some embodiments, the chemically reactive group is an acrylate group.

[0075] Chemical compound

[0076] The chemical compound conjugated to the phospholipid may be a functional compound that, e.g. when contacted with a cell will exert or be capable of exerting a beneficial effect on the cell. This beneficial effect could for example be lowering the oxidative stress if the chemical compound is e.g. an antioxidant. In some embodiments, said chemical compound is an antioxidant. In some embodiments, said antioxidant has superoxide dismutase activities and / or catalase-mimetic activities. The chemical compound could be salen-manganese complexes. These salen- manganese complexes are a group of small antioxidant compounds, which were first reported in the 1930’s. Selecting a suitable salen-manganese complex for the manufacturing of antioxidative phospholipid conjugates may depend on the requirements for catalytic activity and water solubility of the salen-manganese complex. In some embodiments, said antioxidant is a salen-manganese complex.

[0077] Similar to the lipids, the salen-manganese complexes may comprise a reactive group allowing for the specific conjugation of the salen-manganese complex to the lipid. In some embodiments, said antioxidant is a salen-manganese complex and comprises an allyl group.

[0078] The salen-manganese complexes could for example be Eukarion (EUK), which possess superoxide dismutase and catalase activities and are excellent candidates in the preparation of antioxidative phospholipid conjugates. Salen-manganese complexes offer broad opportunities to manipulate their structure and coordination chemistry for envisioned applications. Compared to enzymes, EUK has reduced cost, higher stability, and it exhibits less environmental sensitivity. A variety of modified EUK compounds, including EUK-C, have been described. In some embodiments, said antioxidant is an Eukarion (EUK) compound. In some embodiments, said antioxidant is selected from the group consisting of EUK-8, EUK-134, EUK-189 and EUK-207. In some embodiments, said antioxidant is selected from the group consisting of EUK-A, EUK-B, EUK-C and EUK-D. In some embodiments, said antioxidant is EUK-B. In some embodiments, said antioxidant is EUK-C. In some embodiments, said phospholipid is DOPC and said antioxidant is EUK-C. In some embodiments, said phospholipid is DOPE and said antioxidant is EUK-C. In some embodiments, said phospholipid is DOPS and said antioxidant is EUK-C. In some embodiments, said phospholipid is acrylPC and said antioxidant is EUK-C.

[0079] A number of antioxidants can be used as an alternative to salen-manganese complexes. These antioxidants may remove free radicals generated from oxidation reaction or, for example inhibit other oxidation reactions by becoming oxidized themselves. In some embodiments, said antioxidant is selected from the group consisting of ascorbic acid (vitamin C), glutathione, lipoic acid, carotenes, retinol (vitamin A), a-tocopherol (vitamin E) and ubiquinol (coenzyme Q), quenchers of nitric oxide synthase.

[0080] The chemical compound can also be a fluorophore. The fluorophore may be moiety that itself fluoresces, can be made to fluoresce, or can provide for quenching of fluorescence of a fluorophore of a FRET pair. In some embodiments, said chemical compound is a fluorophore. In some embodiments, said fluorophore is NBD and / or Rhodamine (Rho).

[0081] Conjugation

[0082] A number of strategies for conjugating a chemical compound to a phospholipid exists. This could be using UV-crosslinking of the chemical compound and the phospholipid, for example in the presence of a photoinitiator and UV light. Another useful procedure to prepare phospholipid conjugates may be the Copper(l)-catalyzed Azide-Alkyne Cycloaddition (CuAAC) from azide and alkyne intermediates by 1 ,3-dipolar cycloaddition, sometimes referred to as "Click chemistry". The CuAAC provides a method of coupling heterobifunctional precursors containing azide and alkyne functional groups. Yet other non-limiting examples are a NHS / EDC (N- hydroxysuccinimide and N-ethyl-N'-(dimethylaminopropyl)carbodiimide) reaction, which allows for the conjugation of primary amine groups with carboxyl groups, and a thiol- maleimide reaction. In some embodiments, the conjugation is by UV-crosslinking. In some embodiments, the conjugation is by a click chemistry reaction, a NHS / EDC reaction, or a thiol-maleimide reaction.

[0083] Use of the Phospholipid Conjugate

[0084] As described above, the present disclosure may utilize the inherent intracellular lipid transport mechanisms in delivering engineered phospholipids to intracellular lipid droplets in e.g. steatotic hepatic cells. Without being bound by theory, the inherent intracellular mechanisms of lipid transport may be from endosomes via the endoplasmic reticulum to lipid droplets. In some embodiments, the phospholipid conjugate locates in the cytoplasmic lipid droplets upon incubation with cells, such as liver cells. The phospholipid conjugates may be used in a number of cell types. In some embodiments, the cells are selected from the group consisting of liver cells, immune cells, endothelial cells and stellate cells.

[0085] Further, the phospholipid conjugates may be e.g. reduce or be capable of reducing reactive oxygen species, nitrosative stress and / or oxidative stress. In some embodiments, the phospholipid conjugate reduces reactive oxygen species (ROS). In some embodiments, the phospholipid conjugate reduces nitrosative stress. In some embodiments, the phospholipid conjugate reduces oxidative stress.

[0086] These phospholipid conjugates may be used therapeutically or prophylactically to e.g. improve liver function or in the treatment of a liver disease. In some embodiments, the phospholipid conjugate improves liver function. In some embodiments, said liver disease is selected from the group consisting of fatty liver disease (FLD), such as hepatic steatosis and non-alcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), liver fibrosis, liver cirrhosis, liver cancer, such as hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), hepatitis, such as hepatitis A, hepatitis B and hepatitis C, chronic hepatitis, hereditary hemochromatosis, primary sclerosing cholangitis, cholestasis and liver failure.

[0087] As described herein above, the phospholipids conjugates of the present disclosure may comprise antioxidants, such as salen-manganese complexes which exhibit dual functions, i.e. superoxide dismutase- and catalase-mimetic activities. Without being bound by theory, the redox state constitutes an important underlying factor in a number of liver disorders and participates in the development of inflammatory, metabolic and proliferative liver diseases. Under normal conditions, the antioxidative stress is balanced by molecular strategies in the hepatic cells. However, if the oxidative capacity of antioxidant agents in the cells are outcompeted by the oxidants, the oxidative stress may cause damage of cellular structures such as DNA. The phospholipid conjugates of the present disclosure may be used in the treatment of liver diseases, such as liver failure. In some embodiments, the phospholipid conjugate comprises a phospholipid and an antioxidant and improves liver function. In some embodiments, said liver disease is selected from the group consisting of fatty liver disease (FLD), such as hepatic steatosis and non-alcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), hepatic steatosis, non-alcoholic steatohepatitis (NASH), liver fibrosis, liver cirrhosis, liver cancer, such as hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), hepatitis, such as hepatitis A, hepatitis B and hepatitis C, chronic hepatitis, hereditary hemochromatosis, primary sclerosing cholangitis, cholestasis and liver failure.

[0088] The phospholipid conjugates of the present disclosure be found in liposomes, which are spherical vesicles. These liposomes may further comprise one or more lipids. In another embodiment, the present disclosure concerns a liposome composition comprising the phospholipid conjugate. The liposome composition further comprising one or more lipids. In some embodiments, said one or more lipids are selected from the group consisting of free fatty acids, glycerolipids, such as triglycerides, phospholipids, sphingolipids, prenols, saccharolipids, and sterols, such as cholesterols. In some embodiments, said one or more lipids are cholesterols.

[0089] In another embodiment, the present disclosure concerns an engineered lipid droplet comprising the phospholipid conjugate. In another embodiment, the present disclosure concerns an engineered lipid droplet comprising the phospholipid conjugate further comprising one or more lipids. In some embodiments, said one or more lipids are selected from the group consisting of free fatty acids, glycerolipids, such as triglycerides, phospholipids, sphingolipids, prenols, saccharolipids, and sterols, such as cholesterols. In some embodiments, said one or more lipids are cholesterols.

[0090] Similarly, the phospholipid conjugates of the present disclosure may be found in hybrid vesicles, for example assembled from the phospholipids and amphiphilic block copolymers. In another embodiment, the present disclosure concerns a small polymer lipid hybrid vesicle comprising the phospholipid conjugate. In another embodiment, the present disclosure concerns a small polymer lipid hybrid vesicle further comprising an amphiphilic block copolymer. In another embodiment, the present disclosure concerns a small polymer lipid hybrid vesicle, wherein said amphiphilic block copolymer is poly(cholesteryl methacrylate-co-2-hydroxyethyl methacrylate)-block-poly(2- carboxyethyl acrylate) (BCP).

[0091] The phospholipid conjugates may also be found in semi-synthetic organelles, for example in liver cells, or in a support molecule. In another embodiment, the present disclosure concerns a semi-synthetic organelle comprising the phospholipid conjugate. In another embodiment, the present disclosure concerns a support molecule comprising the phospholipid conjugate.

[0092] Pharmaceutical compositions and excipients

[0093] The phospholipid conjugates of the present disclosure may be administrated to a subject in need thereof and may for example be formulated in a composition further comprising excipients.

[0094] Such excipients include any commonly used excipients in pharmaceutics and should be selected on the basis of compatibility and the release profile properties of the desired dosage form. Exemplary carrier materials include, e.g., binders, suspending agents, disintegration agents, filling agents, surfactants, solubilizers, stabilizers, lubricants, wetting agents, diluents, and the like. "Pharmaceutically compatible carrier materials" may comprise, e.g., acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerine, magnesium silicate, sodium caseinate, soy lecithin, sodium chloride, tricalcium phosphate, dipotassium phosphate, sodium stearoyl lactylate, carrageenan, monoglyceride, diglyceride, pregelatinized starch, and the like. In another embodiment, the present disclosure concerns a composition comprising the phospholipid conjugate and one or more excipients. In another embodiment, the present disclosure concerns a pharmaceutical composition comprising the phospholipid conjugate and one or more pharmaceutically acceptable excipients. In another embodiment, the present disclosure concerns an ex vivo composition comprising the phospholipid conjugate and one or more excipients.

[0095] The liposome composition, small polymer lipid hybrid vesicle, engineered lipid droplet, composition or pharmaceutical composition for use in the treatment of a liver disease, such as fatty liver disease (FLD), such as hepatic steatosis and non-alcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), liver fibrosis, liver cirrhosis, liver cancer, such as hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), hepatitis, such as hepatitis A, hepatitis B and hepatitis C, chronic hepatitis, hereditary hemochromatosis, primary sclerosing cholangitis, cholestasis and liver failure.

[0096] In another embodiment, the present disclosure concerns a cellular composition comprising the phospholipid conjugate and one or more cells. In some embodiments, the one or more cells are selected from the group consisting of liver cells, immune cells, endothelial cells and stellate cells.

[0097] In another embodiment, the present disclosure concerns a method of treating or preventing a liver disease, the method comprising administering the phospholipid conjugate to a subject in need thereof. In some embodiments, said liver disease is selected from the group consisting of fatty liver disease (FLD), such as hepatic steatosis and non-alcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), liver fibrosis, liver cirrhosis, liver cancer, such as hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), hepatitis, such as hepatitis A, hepatitis B and hepatitis C, chronic hepatitis, hereditary hemochromatosis, primary sclerosing cholangitis, cholestasis and liver failure.

[0098] In another embodiment, the present disclosure concerns a method of modifying the phospholipid ratio in cell membranes, the method comprising administering the phospholipid conjugate to a subject in need thereof.

[0099] Kit

[0100] The phospholipid conjugates of the present disclosure may further be distributed in the form of a kit.

[0101] In another embodiment, the present disclosure concerns a kit of parts comprising a. The phospholipid conjugate of the present disclosure, and b. Instructions for use.

[0102] Manufacturing

[0103] In another embodiment, the present disclosure concerns a method of manufacturing a phospholipid conjugate, the method comprising the steps of: a. Providing a phospholipid and a chemical compound, such as an antioxidant, and b. Conjugating said chemical compound, such as an antioxidant, to the tail of said phospholipid. Examples

[0104] List of abbreviations acrylPC 1-palmitoyl-2-[16-(acryloyloxy)palmitoyl]-sn-glycero-3- phosphorylcholine

[0105] ATP6 / 8 ATP synthase subunit 6 and 8 (subunits of complex V) BCP poly(cholesteryl methacrylate-co-2-hydroxyethyl methacrylate)-block-poly(2-carboxyethyl acrylate)

[0106] BCP-OG Oregon Green-labeled BCP BCP-Rho Rhodamine-labeled BCP carboxy-DCF ca rboxy d i ch I o rof I u o resce i n carboxy-H2DCFDA 6-carboxy-2',7'-dichlorodihydrofluorescein diacetate CCK-8 cell counting kit

[0107] Choi cholesterol CLSM confocal laser scanning microscopy

[0108] COXI and COXI I cytochrome c oxidase I and II (subunits of complex IV) Cytb cytochrome b

[0109] DCF fluorescent 2',7'-dichlorofluorescein Dhhydrodynamic diameter DLS dynamic light scattering DOPC 1.2-Dioleoyl-sn-glycero-3-phosphocholine DOPE 1.2-dioleoyl-sn-glycero-3-phosphoethanolamine DOPS 1.2-Dioleoyl-sn-glycero-3-phospho-L-serine (sodium salt) EtOH ethanol FBS Fetal bovine serum FFAs free fatty acids GADPH glyceraldehyde 3-phosphate dehydrogenase H2DCFDA 2',7'-dichlorodihydrofluorescein diacetate H2O2 hydrogen peroxide HBSS Hanks’ balanced salt solution HCI hydrochloric acid

[0110] HEPES 4-(2-hydroxyethyl)piperazine-1 -ethane-sulfonic acid L Liposomes LAP Lithium phenyl(2,4,6-trimethylbenzoyl)phosphinate MEME minimum essential medium eagle MeOH methanol MS Mass spectra

[0111] NaCI sodium chloride

[0112] NaOH sodium hydroxide

[0113] NBD-PC 1-palmitoyl-2-{12-[(7-nitro-2-1 ,3-benzoxadiazol-

[0114] 4yl)amino]dodecanoyl}-sn-glycero-3- phosphocholine

[0115] NBD-PE 1 ,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7- nitro-2- 1 ,3-benzoxadiazol-4-yl)

[0116] NBD-PS 1-palmitoyl-2-{12-[(7-nitro-2-1 ,3-benzoxadiazol-4- yl)amino]dodecanoyl}-sn-glycero-3-phosphoserine (ammonium salt)

[0117] ND1 NADH-ubiquinone oxidoreductase chain 1

[0118] NFW nuclease-free water

[0119] OA oleic acid

[0120] PA palmitic acid

[0121] PDI polydispersity index

[0122] PBS phosphate buffered saline

[0123] RhoPE 1 ,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-

[0124] (lissamine rhodamine B sulfonyl)

[0125] ROS reactive oxygen species

[0126] RT reverse transcription

[0127] RT-qPCR Quantitative reverse transcription polymerase chain reaction

[0128] TEM transmission electron microscopy

[0129] TX Triton-X-100

[0130] Materials used for all Examples

[0131] Nile red, 4-(2-hydroxyethyl)piperazine-1-ethane-sulfonic acid (HEPES, *99.5%), Triton- X-100 (TX), sepharose 2B, sodium chloride (NaCI), hydrochloric acid (HCI), sodium hydroxide (NaOH) phosphate buffered saline (PBS), 0.25% trypsin-EDTA, galactose, ethanol 96%, sulfuric acid, vanillin, phosphoric acid, palmitic acid, oleic acid, minimum essential medium eagle (MEME, M2279, Sigma Aldrich), MEM non-essential amino acid solution, galactose, cell counting kit (CCK-8), and Neutral Red were purchased from Sigma Aldrich. Lithium phenyl(2,4,6-trimethylbenzoyl)phosphinate (LAP), hydrogen peroxide 3%, methanol (MeOH), ethanol (EtOH) and chloroform were purchased from VWR. Fetal bovine serum (FBS), DMEM glucose free (11966025), glucose, sodium pyruvate, L-glutamine, BODIPY 493 / 503, CellMask Deep Red plasma membrane stain, LysoTracker Deep Red, Hoechst 33342, GlutaMAX, dichlorodihydrofluorescein diacetate (carboxy-H2DCFDA), streptomycin and penicillin, High-Capacity cDNA Reverse Transcription Kit, Reaction Buffer with MgCI2 for DNase I (10X), DNase I, RNase-free (1 U / μL), nuclease-free water (NFW), DEPC treated water, RNaseZap™ RNase Decontamination Solution, and SYBR™ Power SYBR™ Green PCR Master Mix and Amplex™ UltraRed Reagent were purchased from Thermo Fisher Scientific. RNAeasy mini kit was purchased from Qiagen. 1 ,2-Dioleoyl-sn- glycero-3-phospho-L-serine (sodium salt) (DOPS), 1 ,2-Dioleoyl-sn-glycero-3- phosphocholine (DOPC), cholesterol (Choi), 1 ,2-dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE), 1 ,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N- (lissamine rhodamine B sulfonyl) (RhoPE), 1 -palmitoyl-2-{12-[(7-nitro-2-1 ,3- benzoxadiazol-4yl)amino]dodecanoyl}-sn-glycero-3- phosphocholine (NBD-PC), 1- palmitoyl-2-{12-[(7-nitro-2-1 ,3-benzoxadiazol-4-yl)amino]dodecanoyl}-sn-glycero-3- phosphoserine (ammonium salt) (NBD-PS), 1 ,2-dipalmitoyl-sn-glycero-3- phosphoethanolamine-N-(7-nitro-2-1 ,3-benzoxadiazol-4-yl) (NBD-PE), and 1-palmitoyl- 2-[16-(acryloyloxy)palmitoyl]-sn-glycero-3-phosphorylcholine (acrylPC) were purchased from Avanti Polar Lipids. Lipid Droplet Isolation Kit was purchased from Abeam.

[0132] EUK-C was synthesized was synthesized as previously reported (Ade et al 2019).

[0133] HEPES buffer consisted of 10 mM HEPES and 150 mM NaCI at pH 7.4. Ultrapure water (18.2 MQ cm resistance) was provided by an ELGA Purelab Ultra system (ELGA LabWater, Lane End).

[0134] General methods

[0135] Liposome Assembly

[0136] Liposomes (L) were assembled by rehydration method. A total amount of 1.5 mg of lipids were mixed in a 25 mL round bottom flask (see Table 2 for details). The solvent was dried under nitrogen stream for 5 min. The flasks were left overnight in the vacuum line for further drying. The film was rehydrated using 1 mL HEPES buffer (pH 7.4) followed by sonicating for 5 seconds and vortexing for 5 seconds. The solution was extruded through 400 nm (*21) and 200 nm (*21) membranes at room temperature using an Avanti Mini Extruder. The different liposomes were referred to as L*_zwhere x indicated the type phospholipids (e.g. PC for 1 ,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC)), and y and z the position and type, respectively, of the fluorescent label covalently attached to the lipids if fluorescent lipids were used during assembly. For more details see Table 2 below.

[0137] Table 2. Overview of the assembly of the different liposomes. a)Dh: Hydrodynamic diameter obtained from DLS; b)PDI: Polydispersity index obtained from DLS; c) HV diameter as determined from TEM images

[0138] The hydrodynamic diameter (Dh) and polydispersity index (PDI) was determined by using dynamic light scattering (DLS, Malvern Zeta sizer Nano-590 at A = 632 nm at 25 °C). The liposomes were visualized under transmission electron microscopy (TEM). Electron microscopy grids were made hydrophilic by glow discharging (45 s, air, 15 mA) 300 mesh copper formvar / carbon grids (Ted Pella). 3 μL of sample was deposited on the grid and left to adsorb for 45 s before blotting the excess. The grids were stained with 3 μL of 2% uranyl for 5s. TEM images were taken using a Tecnai G2 spirit instrument (TWIN / BioTWIN, FEI co.). The size distributions of vesicles were calculated from the TEM images by measuring at least 100 particles employing the software Fiji. The resulting histograms were fitted to a Gaussian amplitude function, yielding the mean size and variance (given as mean diameter ± 2a).

[0139] The fluorescence emission spectra of the liposomes were obtained by adding 100 μL of assemblies to a black 96-well plate and recording the emission spectra from Aem= 503-650 nm using Aex= 488 nm on a multimode plate reader (PerkinElmer). Lipid amount of the liposomes was determined using the phospho-vanillin reaction. First, 150 μL of sulfuric acid (18 M) were added to 15 μL of sample, heated to 90°C for 10 minutes followed by 5 minutes cooling in the fridge at 4 °C. Then, 100 μL of the mixture was transferred to a 96 well plate and 100 μL of vanillin reagent (6 mg / mL in ultrapure water / phosphoric acid mixture 1 :4) was added and the mixture was incubated for 30 minutes at 37 °C before recording the absorbance (A= 540 nm) using a multimode plate reader. All samples were normalized to 1 mg mL'1PC lipid for the subsequent experiments.

[0140] Hybrid Vesicle Assembly and Characterization

[0141] Small hybrid vesicles (sHVs) were assembled by rehydration method. 0.4 mg of P (10 mg mL'1in chloroform / MeOH 2:1) and 1.1 mg of DOPE (25 mg mL'1in chloroform) were mixed in a 25 mL round bottom flask (see Table 2 for details). The solvent was dried and dried using a rotary evaporator (Heidolph G5) for 10 min. The flasks were left overnight in the vacuum line for further drying. The film was rehydrated using 1 mL HEPES buffer (pH 9) followed by sonicating for 5 seconds and vortexing for 5 seconds. The solution was extruded through 400 nm (x21) and 200 nm (x21) membranes at room temperature using an Avanti Mini Extruder. Then, the solutions were purified by size exclusion chromatography (Sepharose 2B) to exchange the pH to 7.4 and separate sHVs from micelles and other impurities.

[0142] Fluorescently labeled sHVs were assembled by mixing 0.4 mg POGor PRh0(10 mg mL-1in chloroform / MeOH 2:1) and 1.1 mg DOPE (25 mg mL-1in chloroform)) or 1.063 mg DOPE (25 mg mL-1in chloroform) and 0.037 mg NBD-PE (1 mg mL'1in chloroform), respectively, and referred to as sHVpEP-0Gand SHVPE£NBD° -

[0143] The hydrodynamic diameter (Dh) and polydispersity index (PDI) was determined by using dynamic light scattering (DLS, Malvern Zeta sizer Nano-590 at A = 632 nm at 25 °C). The stability of the sHVs was tested in HEPES buffer or in HEPES containing 0.02 % TX final concentration. pH sensitivity of the sHVs was assessed using DLS. Dh, PDI and correlograms of sHVo and SHVCL were obtained before and after decreasing the pH to 4 by adding 3 μL μL HCI (1 M). Then, 3 μL NaOH (1 M) were added to increase the pH back to 7. The sample was incubated for 1 min before recording the correlograms.

[0144] The sHVs were visualized under transmission electron microscopy (TEM). Electron microscopy grids were made hydrophilic by glow discharging (45 s, air, 15 mA) 300 mesh copper formvar / carbon grids (Ted Pella). 3 μL of sample was deposited on the grid and left to adsorb for 45 s before blotting the excess. The grids were stained with 3 μL of 2% uranyl for 5s. TEM images were taken using a Tecnai G2 spirit instrument (TWIN / BioTWIN, FEI co.). The size distributions of vesicles were calculated from the TEM images by measuring at least 100 particles employing the software Fiji. The resulting histograms were fitted to a Gaussian amplitude function, yielding the mean size and variance (given as mean diameter ± 2o).

[0145] The FRET of the sHVs was obtained by adding 100 μL of the to a black 96-well plate and recording the emission spectra from Aem= 503-650 nm using Aex= 488 nm. Then, TX was added to a final concentration of 0.02 %TX and the emission spectra was recorded again immediately and after 3 h incubation at room temperature.

[0146] Liposomes with Conjugated EUK-C

[0147] Liposomes were assembled by rehydration method. A total amount of 1.5 mg of lipids were mixed with 50 μL EUK-C (10 mg mL-1in EtOH) in a 25 mL round bottom flask (see Table 2 for details). The solvents were dried under nitrogen stream for 5 min. The flasks were left overnight in the vacuum line for further drying. The film was rehydrated using 1 mL HEPES buffer (pH 7.4) containing a final concentration of 0.5 mg mL-1LAP followed by sonicating for 5 seconds and vortexing for 5 seconds. The solution was extruded through 400 nm (*21) and 200 nm (*21) membranes at room temperature using an Avanti Mini Extruder. Then, the solution was UV irradiated for 1 minute and purified by size exclusion chromatography (Sepharose 2B) to remove free LAP. Finally, the samples were up-concentrated using a centrifugal filtration unit (Vivaspin® 500, 3kDa).

[0148] The fluorescence intensity spectra of the liposomes was obtained by adding 100 μL of the assemblies to a black 96-well plate and recording the emission spectra from Aem= 503-650 nm using Aex= 488 nm. The hydrogen peroxide (H2O2) removal activity was assessed by incubating the assemblies with 5 pM of H2O2 (final concentration) for 30 min or 3 h. Then, the samples were incubated for 30 min with the AmplexUltraRed reaction mix, and the fluorescence was measured at Aex / em= 540 / 590 nm using a multiplate reader. Mass spectra (MS) were recorded on a Waters LCT Premier XE time of flight mass spectrometer equipped with electrospray ionization. The results were normalized to the highest intensity peak and presented as relative intensity (%).

[0149] HepG2 Cell Work - General Aspects

[0150] The human liver cancer cell line HepG2 was purchased from European Collection of Cell Cultures. HepG2 cells were cultured in 75 cm2(TC-treated) culture flasks in glucose free DM EM at 37 °C and 5% CO2. The media was supplemented with 10% FBS, 2 mM glutamine, 100μg mL-1streptomycin, and 100 II mL-1penicillin, 10 mM galactose and 1 mM sodium pyruvate.

[0151] Steatotic HepG2 Cells

[0152] A 500 mM water-soluble oleic acid (OA) in ultrapure H2O solution was made. A 500 mM palmitic acid (PA) solution in EtOH was made by vortexing or sonication. From these, a solution of 180 mM oleic acid and 60 mM palmitic acid (3:1 molar ratio) in ultrapure H2O (final concentration) was prepared, which is 200* the final concentration needed in cell media. HepG2 cells were seeded in a 96-well plate (30 000 cells per well) and allowed to adhere overnight at 37 °C in 5% CO2. The next day, three different treatments were initiated in addition to untreated cells (referred to as Treatment 0): Treatment 1 : the media was exchanged to media containing a final concentration of 1.2 mM FFA (0.9 mM oleic acid and 0.3 mM palmitic acid), left for 24 h before the media was exchanged to media containing 1 .2 mM FFA for 24 h; T reatment 2: the media was exchanged to media with a final concentration of 1 .2 mM FFA, left for 24 h before the media was exchanged FFA-free media for 24 h; and Treatment 3: the media was replace with FFA-free media and let to incubate for 24 h before the media was exchanged to media containing 1 .2 mM FFA for 24 h (Figure 8).

[0153] The FFA-treated HepG2 cells were visualized by confocal laser scanning microscopy (CLSM). To this end, 300 000 HepG2 cells in 1 mL cell media were seeded in a confocal dish and allowed to adhere overnight at 37 °C in 5% CO2, and the HepG2 cells were treated with FFA as outlined above. The cells were washed 2* with PBS, and 120 μL of a staining solution of 2 pM BODIPY4937503in PBS was added to the center of each confocal dish. The cells were left to incubate for 15 min at 37 °C in 5% CO2, and CellMask Deep Red plasma membrane stain was added at 1 v / v% for a final concentration of 5 pg mL-1for the last 5 min of the incubation time. The cells were washed 2* in PBS and 170 μL PBS was added to each well followed by imaging by CLSM. The fluorescent signal was collected in two channels; Aex= 639 nm and Aem= 640-700 nm (CellMask Deep Red plasma membrane stain), and Aex= 488 nm and Aem= 500-550 nm (BODIPY4937503).

[0154] Lipid Droplet Isolation for Steatotic HepG2 Cells

[0155] Lipid droplets were isolated following the protocol from the Lipid Droplet Isolation Kit (Abeam). Briefly, 2.5 million HepG2 cells were seeded in a 75 cm2flask and incubated overnight. Then, 70 μL of FFA solution (oleic acid:palmitic acid 3:1 , 0.9 mM oleic acid and 0.3 mM palmitic acid) were mixed in 14 mL cell media and added to the cells for 24 hours. Finally, 1 mL of Ltfn-NBDwere mixed in 14 mL of cell media and incubated for 24 h prior to lipid droplet isolation. The fluorescence intensity spectra of the lipid droplets were obtained by adding 100 μL of the assemblies to a black 96-well plate and recording the emission spectra from Aem= 503-650 nm using Aex= 488 nm. Lipid droplets were visualized using a Zeiss LSM700 confocal laser scanning microscope (CLSM) (Carl Zeiss, Germany) by fluorescently staining the lipid droplets with Nile Red (0.5 μg mL-1for 15 minutes). The images were recorded with 63* magnification, a resolution of 1024 x 1024 ppi, a speed of 7 pm s"1and 4-line averaging was used. The following excitation wavelengths were used: Aex= 488 nm laser for tail-NBD or Nile Red.

[0156] Vesicle Uptake and Retention by HepG2 Cells

[0157] HepG2 cells were seeded in a 96-well plate (30000 cells per well) and allowed to adhere overnight at 37 °C in 5% CO2, followed by treatment with 1.2 mM FFA (oleic acid:palmitic acid 3:1 mol ratio) for 24 h. The cell media was exchanged to 100 μL FFA-free media containing 10 v / v% for 24 h. For uptake experiments, the cells were washed 2x with PBS, and 30 μL of trypsin-EDTA (5 min at 37 °C) was used to detach the cells. The trypsin was neutralized with 125 μL cell medium, the cells were harvested and kept on ice. For retention experiments, the liposome-containing medium was exchanged to new medium, and the supernatant was collected after 1 .5 h, 2.5 h or 5 h. The fluorescent signal originating from NBD in the supernatant was measured using a multimode plate reader (Aex / em= 467 / 525 nm). In addition, the HepG2 cells were harvested as described above, and the cell median fluorescence was monitored by flow cytometry (Guava easyCyte Single Sample Flow Cytometer, Merck) using an excitation wavelength of A = 488 nm. The autofluorescence of the cells was subtracted by analyzing control cells where no liposomes were added. Three independent repeats were performed and at least 2000 cells were measured in each sample.

[0158] Visualizing of HepG2 Cells and Liposomes

[0159] HepG2 cells were seeded and treated with 1 .2 mM FFA (oleic acid:palmitic acid 3:1 mole ratio) in confocal dishes, and incubated with 10 orLtaii-NBD+ Lhlad-Rho f°r24 h as outlined above. The cells were washed 2x with PBS, and 120 μL of a staining solution of 50 nM Lysotracker Deep Red in PBS was added to each confocal dish. The cells were left to incubate for 45 min at 37 °C in 5% CO2. The cells were washed 2* in PBS, and 170 μL PBS was added to each well followed by imaging using CLSM. The fluorescent signal was collected in three channels; Aex= 488 nm and Aem= 500-550 nm (NBD), Aex= 555 nm and Aem= 570-630 nm (Rhodamine), and Aex= 639 nm and Aem= 640-700 nm (Lysotracker Deep Red).

[0160] Intracellular ROS in HepG2 cells

[0161] HepG2 cells were seeded and treated with 1.2 mM FFA (oleic acid:palmitic acid 3:1 molar ratio) for 24 h in confocal dishes as outlined above. After the first 5 h of FFA incubation time, 1 was added. Non-FFA treated and non-liposome treated HepG2 cells were included as controls. The cells were washed 2x with PBS, and 120 μL of a staining solution of 25 pM carboxy-F^DCFDA in PBS was added to the center of each confocal dish. The cells were left to incubate for 30 min at 37 °C in 5% CO2, and during the last 15 min incubation time, Hoechst 33342 was added at 1 v / v% for a final concentration of 5 pM. The cells were washed 2* in PBS, and 170 μL PBS was added to each well followed by imaging using CLSM. The fluorescent signal was collected in two channels; Aex= 405 nm and Aem= 415-500 nm (Hoechst 33342) with a 2% laser power and 803 detector gain, and Aex= 488 nm and Aem= 500-800 nm (carboxy-DCF) with a 2% laser power and 870 detector gain. The settings during imaging were kept constant allowing for quantification of the pixel intensities in the carboxy-DCF channel. The images were analyzed using Imaged. A threshold (25-85) was applied to each image to exclude background pixels and aggregated dye. The mean pixel intensity from the cells was measured from 7-24 images, and the mean pixel intensities were normalized to the mean pixel intensity from FFA-treated HepG2 cells. The relative pixel intensity from three independent repeats were measured.

[0162] HHL-5 Cell Work - General Aspects

[0163] The work on the immortalized human liver cell line HHL-5 was conducted at the Royal Free Hospital, London. HHL-5 cells were cultured in 75 cm2(TC-treated) culture flasks in either MEME or glucose free DM EM at 37 °C and 5% CO2. All media were supplemented with 10% FBS, 2 mM GlutaMAX, 100μg mL-1streptomycin, and 100 U mL-1penicillin. In addition, 1 % MEM nonessential amino acid solution was added to the MEME media to yield glucose media, and 10 mM galactose and 1 mM sodium pyruvate was added to the glucose free cell media to yield galactose media.

[0164] Steatotic HHL-5 Cells HHL-5 were seeded in glucose or galactose media in a 12-well plate (150000 cells per well) and allowed to adhere overnight at 37 °C in 5% CO2. The next day, the media was removed, and 1 mL FFA-free or FFA-containing media (containing either 0.3 mM, 0.6 mM or 1.2 mM FFA, with an oleic acid:palmitic acid ratio of 3:1 or 1 :3) was added. The HHL-5 cells were left to incubate for 48 h at 37 °C in 5% CO2.

[0165] HHL-5 cells were washed 2* in PBS, and 500 μL of a staining solution of 2 pM BODIPY493 / 503in PBS was added to each well of a 12 well plate for visualization using an epifluorescent microscope. The plate was left to incubate for 15 min at 37 °C in 5% CO2, and during the last 5 min incubation time, Hoechst 33342 was added at 1 v / v% for a final concentration of 1 pM. The cells were washed 2* in PBS, and 150 μL Hanks’ balanced salt solution (HBSS) was added to each well for imaging.

[0166] The HHL-5 cells were washed 2* with PBS, and 500 μL of a staining solution of 25 pM carboxy-H2DCFDA in PBS was added to each well for visualization of intracellular ROS in by fluorescence microscopy. The HHL-5 cells were left to incubate for 30 min at 37 °C in 5% CO2, and during the last 5 min incubation time, Hoechst 33342 was added at 1 v / v% for a final concentration of 1 pM. The cells were washed 2* in PBS, and 300 μL PBS was added to each well for imaging. The settings during imaging were kept constant allowing for quantification of the pixel intensities in the carboxy-DCF channel. The images were analyzed using Imaged. A threshold (12-255) was applied to each image to exclude background pixels. The mean pixel intensities from the cells were measured from min 9 images, and the mean pixel intensities were normalized to the mean pixel intensity from FFA-treated HHL-5 cells. The relative pixel intensity from three independent repeats were measured.

[0167] Expression of the mitochondrial transcripts

[0168] RNA isolation from HHL-5 cells

[0169] HHL-5 cells cultured in 12 well plates were washed with 1 * with PBS, and the RNA was isolated using the Rneasy Mini Kit following the protocol. Briefly, 350 pl buffer RLT was added to the wells and were left on a plate shaker for 5 min. 350 μL 70% EtOH was added to each tube and was mixed thoroughly. Then, 700 μL was transferred to the Rneasy Mini spin column and the protocol was followed including DNAse digestion. For the final centrifugation step, 50 μL RNAse-free water was used to elute the RNA. The yield was measured using a Nanodrop 2000. Quantification of mitochondrial transcript by quantitative reverse transcription- polymerase chain reaction (RT-qPCR)

[0170] After RNA isolation, reverse transcription (RT) was performed using the High-Capacity cDNA Reverse Transcription Kit. Each sample was diluted to 600 ng in 14.2 μL DEPC water, and was mixed with 10 μL reaction mix (2 μL 10* RT Buffer, 2 μL 10* RT random primers, 0.8 μL 25* dNTP stock solution (100 mM), 1 μL MultiScribe™ Reverse Transcriptase (50 U / μL)) in PCR tube strips on ice. RT was performed on a thermocycler and after RT, each sample was diluted 10* by adding 180 μL NFW. Quantitative realtime PCR (qPCR) was performed in triplicates in a 96-well reaction plate in final volumes of 10 μL. Each reaction well contained 2 μL sample, 5 μL 2* Power SYBRGreen PCR Master Mix, 0.5 μL forward primers, 0.5 μL reverse primers and 2 μL nuclease free water (NFW) for a final concentration of 6 ng of cDNA template and 0.5 pM of forward and reverse primers. Mitochondrial (ATP 6 / 8, COX I, COX II, Cytb, ND1) and housekeeping gene transcripts (glyceraldehyde 3-phosphate dehydrogenase (GADPH) and p-2- globulin) expression were amplified using primer sequences (5’ to 3’, see Table 3 for details).

[0171] Oligo Name Sequence (5' to 3') P-2 -globulin Forward TCTTTTTCAGTGGGGGTGAA (SEQ ID NO: 1) P-2 -globulin Reverse CTCACGTCATCCAGCAGAGA (SEQ ID NO: 2) GADPH Forward AGCCACATCGCTCAGACAC (SEQ ID NO: 3) GADPH Reverse GCCCAATACGACCAAATCC (SEQ ID NO: 4) ATP6 / 8 Forward CACAACACTAAAGGACGAACCT (SEQ ID NO: 5) ATP6 / 8 Reverse GGGATGGCCATGGCTAGGTTTA (SEQ ID NO: 6) COX I Forward GGAGCAGGAACAGGTTGAACAG (SEQ ID NO: 7) COX I Reverse GTTGTGATGAAATTGATGGC (SEQ ID NO: 8) COX II Forward CGTCTGAACTATCCTGCCCG (SEQ ID NO: 9) COX II Reverse TGGTAAGGGAGGGATCGTTG (SEQ ID NO: 10) Cytb Forward CTGATCCTCCAAATCACCACAG (SEQ ID NO: 11) Cytb Reverse GCGCCATTGGCGTGAAGGTA (SEQ ID NO: 12) ND1 Forward GAGCAGTAGCCCAAACAATCTC (SEQ ID NO: 13) ND1 Reverse GGGTCATGATGGCAGGAGTAAT (SEQ ID NO: 14)

[0172] Table 3. Overview over the primes used to quantify mitochondrial transcripts. Three independent repeats were performed in triplicates. The sequences of primers were previously reported by Durigon et al. (Durigon et al 2018). Changes in the mitochondrial gene expression was determined using the 2'AACtmethod setting p-2-globulin or GADPH to 1 , and is represented as fold-change relative to non-FFA treated cells.

[0173] HepG2 and HHL-5 Cell Viability

[0174] CCK-8 assay

[0175] The HepG2 or HHL-5 cells were treated with FFA, in combination with liposomes or sHVs, as outlined above. Then, the cells were washed once with PBS, and either 100 μL or 1000 μL of cell medium containing 2.5 μL or 25 μL of cell counting kit-8 solution (CCK-8) was added to each well of a 96 or 12 well plate, respectively. The plates were let to incubate for 2 h at 37 °C in 5% CO2 before analysis using a multimode plate reader by measuring the absorbance at A = 450 nm. Three independent repeats were performed in duplicate for all experiments.

[0176] Neutral Red Uptake Assay

[0177] The HHL-5 cells were treated with FFA and Lp<(J / Kqcrylpcor LPuK.asoutlined above. The night before the assay, neutral red was dissolved in PBS (4 mg mL-1) , followed by dilution 100x in FBS-free media to give a saturated neutral red (40μg mL-1) solution, and left at 37 °C in 5% CO2 overnight. The next day, the neutral red solution was centrifuged at 600 xg for 10 min to sediment the precipitate. Then, the HHL-5 cells were washed once with PBS, and 1 mL of neutral red containing cell medium was added to each well and let to incubate for 3 h at 37 °C in 5% CO2 before washing extensively (~ 5-10 x with PBS), until no neutral red precipitate was observed in the microscope. Each well was imaged in 300 μL HBSS using bright field microscopy. Then, the HBSS was removed from each well and 500 μL de-staining solution (50% ethanol 96%, 49% deionized water, 1 % glacial acetic acid) was added to each well and left to incubate while shaking for 10 min at room temperature. 100 μL from each well was transferred to a 96 well plate and the absorbance (A = 540 nm) was measured using a multimode plate reader. Three independent repeats were performed in duplicates for all experiments.

[0178] HHL-5 Cells and EUK-Loaded Liposomes: HHL-5 were seeded in glucose media in a 12-well plate (100000 cells per well) and allowed to adhere overnight at 37 °C in 5% CO2. The cells were treated for 48 h with 1 mL FFA-free or FFA-media (1.2 mM FFA, with an oleic acid:palmitic acid mole ratio of 3:1). Then, the media was exchanged to FFA-free media containing 10 v / v% Lp<(J / Kqcrylpcor L^uK (concentrations were normalized according to lipid content) and left to incubate for 48 h, followed by visualization of the intracellular ROS, assessment of the viability and RT-qPCR. All characterizations were done as outlined above.

[0179] Statistical analysis

[0180] A one-way analysis of variance (one-way ANOVA) followed by a Tukey’s multiple comparison post hoc test was used to compare mean values.

[0181] Example 1: Establishment of steatotic HepG2 Cells

[0182] The aim of this Example is to establish steatotic HepG2 cells. Hepatocytes can be induced to develop steatosis, a condition of fat accumulation, by exposing them to a mixture of FFAs. We incubated HepG2 cells with a 1 .2 mM FFA concentration (oleic acid : palmitic acid molar ratio of 3:1) for up to 48 h in order to induce steatosis followed by staining of the cell membrane (CellMask Deep Red shown blue) and the lipid droplets (BODIPY493 / 503 shown in green) for visualization.

[0183] For material and methods, please see “General Methods”, in particular the sections “Steatotic HepG2 Cells” and “Lipid Droplet Isolation for Steatotic HepG2 Cells”.

[0184] Results

[0185] Confocal laser scanning microscopy (CLSM) images revealed that untreated HepG2 cells (Figure 1 ai) contained very few lipid droplets. However, HepG2 cells exhibited a substantial increase in the number of lipid droplets when exposed to FFAs for 24 h (Figure 1 aii). This increase seemed to be even more noticeable after 48 h of exposure (Figure 1 aiii). Interestingly, the accumulation of lipid droplets in the cells persisted even when the FFA-containing media was replaced with regular media (Figure 1aiv). In contrast, there was little to no noticeable increase in lipid droplet content when palmitic acid was omitted even after 48 hours of incubation (Figure 1av / vi). This observation was in agreement with previous reports, which have demonstrated that oleic acid induced steatosis in HepG2 cells. However, the combination of both oleic acid and palmitic acid has been found to be more potent in promoting steatosis compared to oleic acid alone. Furthermore, it has been observed that oleic acid exhibits lower cytotoxicity and can even counteract the cytotoxic effects caused by palmitic acid. With this latter aspect in mind, the HepG2 cell viability was evaluated using the CCK-8 assay. The treatment with oleic acid and palmitic acid for 24 h led to a significant decrease in cell viability of ~ 30% compared to the untreated HepG2 cells (Figure 1 b). Interestingly, the cell viability continued to drop by approximately 10% in the following 24 hours, regardless of the presence of FFAs. This finding suggested that the 24 h period was insufficient for the cells to recover completely from the damage caused by FFAs. Furthermore, it implied that the FFA challenge might not have been strong enough to inflict further damage beyond the initial impact. Additionally, oleic acid treatment lead to a drop in cell viability of ~ 80%.

[0186] Further, the treatment of HepG2 cells with 1.2 mM FFA (oleic acid : palmitic acid 3:1 mole ratio) for 24 h led to an increase in intracellular ROS levels, as evidenced by the fluorescence resulting from the intracellular conversion of 6-carboxy-2’,7’- dichlorodihydrofluorescein diacetate (carboxy-H2DCFDA) to its deacetylated and oxidized product, carboxydichlorofluorescein (carboxy-DCF) (Figure 1c). This indicates that the elevated levels of FFAs provided to hepatocytes lead to oxidative stress and mitochondrial dysfunction.

[0187] Taken all these findings together, treatment with 1.2 mM FFA (oleic acid : palmitic acid 3:1 mole ratio) was chosen for all subsequent experiments with HepG2 cells. HepG2 cells treated this way will be referred to as “steatotic HepG2 cells”.

[0188] Example 2: Intracellular fate of fluorescently labelled lipids formulated as liposomes in steatotic HepG2 cells

[0189] This Example aims to evaluate the intracellular fate of fluorescently labelled lipids formulated as liposomes in steatotic HepG2 cells, the liposomes’ cytotoxicity as well as the lipids’ intracellular location, uptake and retention was determined. To this end, we assembled different types of liposomes (L) via rehydration method followed by extrusion through 400 and 200 nm filters (Figure 2a). The different liposomes were referred to as Ly_zwhere x indicated the type phospholipids (e.g. PC for 1 ,2-dioleoyl-sn-glycero-3- phosphocholine (DOPC)), and y and z the position and type, respectively, of the fluorescent label covalently attached to the lipids if fluorescent lipids were used during assembly. For more details see Table 2 and Figure 2 a) v)). For material and methods, please see “General Methods”, in particular the sections “Vesicle Uptake and Retention by HepG2 Cells” and “Visualizing of HepG2 Cells and Liposomes”.

[0190] Results

[0191] The pristine and steatotic HepG2 cells were incubated with the different liposomes for 24 h and no inherent short-term cytotoxicity was observed (Figure 2b). The lipid content was determined in each liposome batch, and the same lipid concentration was added to the cells (1 mg mL-1PC) in an attempt to make the results comparable. Following on, the steatotic HepG2 cells were incubated with Ltfn-NBD, Ltfn-NBD, or Lt|il-NBD(Figure 2ci, ii, iii) for 24 h, followed by lysosomal staining and imaging using CLSM. In each of the three cases, the phospholipids labeled with tail markers were found to be concentrated within the lipid droplets, and not within the lysosomes. This pattern was consistent regardless of the type of phospholipid used, whether it was DOPC, DOPE, or DOPS. In contrast, the fluorescence originating from Rho and NBD head-labeled phospholipids inLhead-NBD,head-Rho’ remained co-localized with the lysosomes (Figure 2civ). As anticipated, when employing Ltfil-NBD head-Rho, which contained both head and tail- labeled phospholipids, the tail-labeled phospholipids were detected in the lipid droplets, while the head-labeled phospholipids remained sequestered in the lysosomes (Figure 2cv). These findings demonstrated that the positioning of the fluorescent label on the head or tail of the phospholipids influenced their intracellular fate. This observation seemed to remain consistent regardless of the type of phospholipid and fluorescent label used.

[0192] Furthermore, to confirm the association of fluorescent lipids with intracellular droplets, lipid droplets from steatotic HepG2 cells incubated with 1.2 mM FFA (oleic acid : palmitic acid 3:1 mole ratio) for 24 h were purified, stained with Nile Red, and then visualized using CLSM. The CLSM images displayed the expected spherical objects, showing a clear fluorescence signal originating from the lipid droplets from HepG2 cells incubated with NBD-labeled phospholipids (Figure 2 c) vi) and vii)).

[0193] Following on, the uptake and retention in steatotic HepG2 cells was evaluated using flow cytometry with the aim to get first insight into the efficacy of modifying the lipid droplets and the potential long-term effect. To this end, the cell mean fluorescence of steatotic HepG2 cells when exposed to the fluorescently labeled liposomes was monitored after 24 h by flow cytometry before the retention was followed over an additional 5 h (Figure 2di). First, it should be noted that the initial uptake of the same type of liposomes within 24 h was comparable for pristine and steatotic HepG2 cells (Figure 2dii). Second, the change in normalized cell mean fluorescence was followed over 5 h as an indication of fluorescent lipid retention in the HepG2 cells (Figure 2diii). The obtained retention curves were very similar independent on the type of liposomes and the presence of FFA in the media with over 50% loss in normalized cell mean fluorescence in the first 2.5 h and reduction to the background signal within 24 h. In parallel, the fluorescent signal originating from NBD in the media was monitored. The observed gradual increase in fluorescent signal suggested that at least some of the fluorescent lipids (or at least the fluorophores) were released from the cells (Figure 2div). Furthermore, CLSM images of steatotic HepG2 cells incubated with Lpfn-NBDfor 24 h showed that the NBD tail-labelled lipids were retained in the lipid droplets after 3.5 h in regular media (Figure 2dv).

[0194] Example 3: Intracellular fate of fluorescently labelled lipids formulated as small polymer lipid hybrid vesicles in steatotic HepG2 Cells

[0195] This Example aims to determine if tail-labeled NBD lipids had to be formulated as liposomes and if their formulation into small polymer lipid hybrid vesicles (sHVs) would affect their intracellular fate. We chose poly(cholesteryl methacrylate-co-2-hydroxyethyl methacrylate)-block-poly(2-carboxyethyl acrylate) (BCP) as the amphiphilic block copolymer for the sHV assembly in addition to DOPE lipids resulting in sHVpEc p~mwhere m indicated the fluorophore used to label the BCP and n specified the type of fluorophore conjugated to the DOPE lipid tail (Figure 3a). For more details see Table 4 below and Figure 3 a) and related text.

[0196] Table 4. Overview over the assembly of the different hybrid vesicles. a)Dh: Hydrodynamic diameter obtained from DLS; b)PDI: Polydispersity index obtained from DLS; c) HV diameter as determined from TEM images For material and methods, please see “General Methods”, in particular the sections “Hybrid Vesicle Assembly and Characterization” and “Vesicle Uptake and Retention by HepG2 Cell”.

[0197] Results

[0198] The pristine and steatotic HepG2 cells were incubated with sHVpEcpNBB° for 24 h to confirm the absence of inherent short-term cytotoxicity (Figure 3b). It should be noted that the drop to 60% viability of the steatotic HepG2 cells compared to the untreated HepG2 cells was not due to the incubation with sHVpEPNBD° but due to the presence of the lipid droplets.

[0199] Following on, the pristine and steatotic HepG2 cells were incubated with sHVpEPNBD° f°r24 h, followed by staining of the lysosomes and imaging by CLSM. As expected, the BCP-Rho and the fluorescent lipids were co-localized with the lysosomes in pristine HepG2 cells (Figure 3ci). In contrast, the fluorescent lipids were present in lipid droplets in the steatotic HepG2 cells, while the BCP-Rho remained trapped in the lysosomes (Figure 3cii). Consequently, it was concluded that the tail-modified phospholipids could also be transported to the lipid droplets when formulated as sHVs. Finally, the cell mean fluorescence of pristine and steatotic HepG2 cells when exposed to sHVpEp-0Gor sHVpEpNBDfor 3 h, 6 h or 24 h was monitored by flow cytometry monitoring the association with BCP-OG and the fluorescent lipids followed by incubation of the cells in regular media for 18 h. The cell mean fluorescence due to the uptake of the fluorescent lipids plateaued after 6 h in both pristine and steatotic HepG2 cells and decreased to the background level in the 18 h post-sHVpEpNBDexposure (Figure 3di). Interestingly, the cell mean fluorescence due to the uptake of BCP-OG increased steadily over 24 h in pristine and steatotic HepG2 cells and did not decrease within the 18 h in media (Figure 3dii). This might be a coincident due to the chosen sHVs concentration and the selected amount of fluorescent lipids present in the vesicles.

[0200] In summary, the intracellular fate of BCP-OG formulated in sHVs was the same in pristine and steatotic HepG2 cells. In addition, the fluorescent lipids were excreted in both pristine and steatotic HepG2 cells, but likely underwent an alternative intracellular trafficking through the lipid in the latter case even when formulated as sHVs. Example 4: Assembly and antioxidant performance of liposomes comprising EUK- modified phospholipids in steatotic HepG2 Cells

[0201] In this Example, the fluorophore as lipid modification was replaced with a more functional compound in the form of an antioxidant compound, namely an EUK salen-manganese complex. This compound, referred to as EUK-C, offered a handle for conjugation to phospholipids with a terminal double bond, i.e. , 1-palmitoyl-2-[16-(acryloyloxy)palmitoyl]- sn-glycero-3-phosphorylcholine (acrylPC), in the presence of a photoinitiator and UV light (Figure 4a). Further, EUK-C shows superoxide dismutase-like and catalase-like activity and can therefore act as ROS scavenger. The hydrophobic nature of EUK-C allowed for its incorporation in the lipid bilayer during the liposome assembly via the rehydration method. Consequently, it was expected that EUK-C could crosslink to the acrylPC lipids due to the close proximity when exposed to UV light in the presence of the photoinitiator. As a last step, the liposomes were purified via size exclusion chromatography to remove the photoinitiator. Liposomes with different lipid composition and EUK-C were assembled and were referred to as LXEUKwhere x indicates again the used lipids. While all assembled liposomes were expected to carry EUK-C, only LPEJEcrylpcwere expected to offer the opportunity to intracellularly associate the EUK-C with the lipid droplets due to its covalent conjugation to the lipid tail. Liposomes LPEUK, i.e., liposomes made without acrylPC, had no terminal double bond, so no covalent attachment of EUK-C to a lipid was expected. LP^crylPCthat were not exposed to UV showed stability issues within hours of their assembly, evidenced by the occurrence of precipitations, and could therefore not be included as control. Mass spectrometry was conducted to support the covalent attachment of EUK-C to acrylPC (Figure 4 a) ii) and iii)) showing fragments with a m / z ~1240 and -1309 corresponding to the crosslinked phospholipid version whereas none of the other assemblies showed theses fragments in their spectra.

[0202] For material and methods, please see “General Methods”, in particular the section “Liposomes with Conjugated EUK-C”.

[0203] Results

[0204] Transmission electron microscopy (TEM) images showed spherical vesicles after assembly (Figure 4b) and after 7 days confirming their stability in all other assemblies. It should be noted that the hydrodynamic radius of the liposomes could not be assessed in DLS due to the dark colour originating from EUK-C. Finally, the liposomes’ antioxidant performance was assessed by evaluating their hydrogen peroxide (H2O2) removal capability. As expected, £pc / acrylpcdid not show any H2O2 removal in 3 h, while LPEcJEcryipcand LpEgKlowered the H2O2 amount by ~50% in 3 h confirming both, the presence and retained catalytic activity of ELIK-C (Figure 4c).

[0205] Example 5: Liposomes with EUK-modified phospholipids reduces intracellular ROS in steatotic HepG2 Cells

[0206] In this Example, it was demonstrated that steatotic HepG2 cells incubated with LPEJEcrylpcexhibited reduced intracellular ROS levels compared to untreated steatotic HepG2 cells, as well as steatotic HepG2 cells treated with LPECUKand £pc / acrylpc. Specifically, HepG2 cells were exposed to FFA for 5 h before LP^crylPC, LPECUK, or £pc / acryipcwere added for the next 19 h. It should be noted that the sample amount of lipid content was added in all cases (1 mg mL-1PC content). Then, the level of intracellular ROS was assessed by visualizing carboxy-DCF, which originated from converted carboxy-FLDCFDA in the presence of ROS, using CLSM (Figure 5a).

[0207] For material and methods, please see “General Methods”, in particular the section “Intracellular ROS in HepG2 cells”.

[0208] Results

[0209] The steatotic HepG2 cells incubated with Lp? / ^crylPCexhibited intracellular ROS levels comparable to those of pristine HepG2 cells. In contrast, treatment with LPEUK, or £pc / acryipc not|eac|to|owerintracellular ROS levels (Figure 5a). To validate this finding, the mean fluorescence intensity of CLSM images was quantified by summing the pixel values within a region of interest. The background-corrected pixel intensities of each sample were then normalized to the untreated steatotic HepG2 cells (Figure 5b). Steatotic HepG2 cells treated with LP^crylPCexhibited a relative pixel intensity of approximately 0.3, which was significantly different from steatotic HepG2 cells but not significantly different from pristine HepG2 cells. This beneficial effect was only observed after incubation with liposomes where EUK-C was cross-linked to the acrylPC tail, pointing towards the intracellular lipid mediated transfer of the catalytic compound. Example 6: Establishment of steatotic HHL-5 Cells

[0210] This Example has the objective a more physiologically relevant hepatic cell line to investigate whether ability to reduce intracellular ROS levels could be replicated in a more physiologically relevant hepatic cell line. To achieve this, the human hepatocyte line HHL-5 was chosen as an alternative to the hepatic tumor-derived HepG2 cell line. HHL-5 cells more closely resemble the primary hepatocyte phenotype and have previously been utilized as an in vitro non-alcoholic fatty cell disease model.

[0211] For material and methods, please see “General Methods”, in particular the sections “HHL-5 Cell Work - General Aspects,” "Steatotic HHL-5 Cells”, “Expression of the mitochondrial transcripts”, “RNA isolation from HHL-5 cells”, “Quantification of mitochondrial transcript by quantitative reverse transcription-polymerase chain reaction (RT-qPCR)” and “HepG2 and HHL-5 Cell Viability”.

[0212] Results

[0213] First, we identified a suitable FFA treatment that resulted in steatotic HHL-5 cells with limited short-term toxicity. Here, HHL-5 cells were exposed to 0.3-1 .2 mM FFA (oleic acid to palmitic acid either 3:1 or 1 :3 molar ratio) for 24 h or 48 h in either glucose or galactose supplemented media (Figure 6ai) before the cell viability was assessed using the CCK-8 assay (Figure 6aii). These two types of cell media supplements were chosen to evaluate whether a higher oleic acid or palmitic acid content was more suitable for inducing steatosis. As expected, the FFA treatment with the higher palmitic acid content was more toxic in both types of media compared to the FFA treatment with the high oleic acid content. The toxicity was more pronounced in glucose-containing media. In contrast, the FFA treatment with a high content of oleic acid demonstrated similar cytotoxicity in both cell media, showing a maximum reduction of approximately 20% after 48 hours for the highest tested FFA concentration. Hence, glucose-supplemented media was chosen for all subsequent experiments, considering the heightened sensitivity of HHL-5 cells to FFA exposure under these specific conditions.

[0214] The subsequent evaluation concentrated on assessing the formation of lipid droplets after a 48 h exposure to FFAs at concentrations ranging from 0.3 to 1.2 mM, with oleic acid to palmitic acid mole ratios of either 3:1 or 1 :3. Higher levels of lipid droplets were observed in both cases starting with the lowest FFA concentration compare to the pristine HHL-5 cells. However, the FFA treatment with the higher palmitic acid content resulted in more extensive lipid droplet formation observable in areas of the well where HHL-5 cells could withstand the FFA treatment (Figure 6b).

[0215] Next, the intracellular ROS levels in the FFA treated HHL-5 cells were compared using intracellular fluorescent carboxy-DCF as marker in wide-field fluorescence microscopy images. As expected, the levels of intracellular ROS increased with increasing lipid droplet contents, with higher ROS levels observed in HHL-5 cell exposed to FFA with high palmitic acid content (Figure 6c). We would like to note that there was some variability in how the FFA treatment affected the HHL-5 cells, and consequently how many HHL-5 cells were washed off during the staining protocols.

[0216] Furthermore, the impact of FFA exposure on mitochondrial gene expression was examined by investigating whether the transcript levels of genes involved in mitochondrial bioenergetics were influenced. To achieve this, the transcript levels of specific subunits of electron transport chain complexes were quantified. This included NADH-ubiquinone oxidoreductase chain 1 (ND1 , a subunit of complex I), cytochrome b (Cytb, a component of complex III), cytochrome c oxidase I and II (COXI and COXII, subunits of complex IV), and ATP synthase subunit 6 and 8 (ATP6 / 8, subunits of complex V). Quantitative reverse transcription polymerase chain reaction (RT-qPCR) was utilized to quantify the transcript levels after 24 h or 48 h of exposure to 1 .2 mM FFA, with oleic acid to palmitic acid mole ratios of either 3:1 or 1 :3 (Figure 6d). There was a tendency for ND1 to be downregulated, while COXI and COXII (components of complex IV) showed statistically significant upregulation after 48 h of oleic acid:palmitic acid 3:1 exposure. However, Cytb and ATP6 / 8 remained unchanged compared to pristine HHL- 5 cells. On the other hand, following 48 h of oleic acid:palmitic acid 1 :3 exposure, ND1 and ATP6 / 8 were downregulated, while Cytb, COXI, and COXII remained unchanged compared to pristine HHL-5 cells. We speculate that there might be an initial upregulation in an attempt to compensate for the extra demands on the cellular energetics due to the FFA exposure. However, after more persistent lipid droplet exposure, the mitochondria starts being dysfunctional resulting in down-regulation. A recent publication on mitochondrial adaptation in non-alcoholic fatty liver disease provides supportive arguments for this hypothesis.

[0217] Taken all these findings together, steatotic HHL-5 cells were obtained by exposure to 1.2 mM FFA (oleic acid:palmitic acid 3:1 molar ratio) for 48 h due to the relatively low cytotoxicity, presence of lipid droplets and intracellular ROS as well as effects on the mitochondrial transcript levels.

[0218] Example 7: Effect of Liposomes with Conjugated EUK on ROS levels in steatotic HHL- 5 Cells

[0219] The objective of this Example was to evaluate if LP<(J / KqcrylPCcould lower the intracellular ROS level in steatotic HHL-5 cells.

[0220] For material and methods, please see “General Methods”, in particular the sections “HHL-5 Cells and EUK-Loaded Liposomes”, “Expression of the mitochondrial transcripts”, “RNA isolation from HHL-5 cells”, “Quantification of mitochondrial transcript by quantitative reverse transcription-polymerase chain reaction (RT-qPCR)” and “HepG2 and HHL-5 Cell Viability”.

[0221] Results

[0222] We first illustrated that fluorescent tail-modified phospholipids were transported to the intracellular lipid droplets when formulated as Lpfn-NBDand incubated with steatotic HHL- 5 cells for 24 h (Figure 7a).

[0223] Next, pristine or steatotic HHL-5 cells were exposed to LP<(J / KqcrylPC for 48 h (Figure 7bi), followed by incubation with carboxy-H2DCFDA and imaging of the samples using the obtained carboxy-DCF as a measure for the intracellular ROS level (Figure 7bii). The fluorescence images showed that the signal from carboxy-DCF was similar for untreated steatotic HHL-5 cells and steatotic HHL-5 cells exposed to Lp<oK. However, steatotic HHL-5 cells incubated with Lp?I / I?crylPCexhibited a visibly lower fluorescent signal, although not as low as that observed for pristine HHL-5 cells. With the aim to analyze the data more quantitatively, the mean fluorescence intensity of images were determined, and the resulting pixel intensities for each condition were normalized to untreated steatotic HHL-5 cells (Figure 7biii). Steatotic HHL-5 cells treated withLEUKCrylPChad a relative pixel intensity of around 0.6, which was statistically significantly different from both pristine and untreated steatotic HHL-5 cells. In contrast, steatotic HHL-5 cells treated with LBuKhad a comparable relative pixel intensity to untreated steatotic HHL-5 cells. In essence, this result strongly supports the success of the strategy of using liposome-formulated ELIK-C crosslinked to the lipid tail of a phospholipids to reduce intracellular ROS also in steatotic HHL-5 cells.

[0224] Subsequently, the study evaluated whether LP<(J / Kqc'ylPCtreatment of steatotic HHL-5 cells would lead to an increase in cell viability. Two different cell viability assays were employed, namely the CCK-8 assay (Figure 7ci) and the neutral red uptake assay (Figure 7cii). The latter was included as an alternative method for assessing cell viability, relying on the lysosomal buffering capacity of the cells, while CCK-8 measured the formazan dye produced by cellular dehydrogenases, which is correlated with the number of living cells. However, the reduction in viability was caused by the FFA treatment, and neither of these methods indicated any difference in cell viability between Lp<(J / KqcrylpcorLEUK treated steatotic HHL-5 cells and untreated steatotic HHL-5 cells.

[0225] Lastly, the mitochondrial transcript levels of electron transfer chain subunits were quantified by RT-qPCR steatotic HHL-5 cells were exposed to LP<(J / KncrylPCor L^UK f°r48 h. It is important to highlight that in this case, the 48 h FFA exposure was followed by an additional 48 h incubation in pristine media as the control condition for cells left untreated with liposomes, as opposed to the RT-qPCR analysis performed immediately after the initial 48 h FFA incubation (Figure 7d). The extended experimental time revealed a more pronounced impact on mitochondrial function, with all the tested mitochondrial transcripts showing a significantly lower level in steatotic HHL-5 cells compared to pristine HHL-5 cells (Figure 7f). Further, treatment of the steatotic HHL-5 cells with Lp<(J / Kqcrylpcresulted in higher transcript levels of ND1 , COXII and ATP6 / 8 compared to untreated steatotic HHL-5 cells. The present results, however, show a promising potential of the Lp<(J / Kqcrylpcto alleviate the stress on mitochondria due to steatosis, by lowering the intracellular ROS locally in proximity to the lipid droplets.

[0226] Example 8: Fluorescent lipid transfer in HepaRG cells

[0227] Tail-labelled liposome assembly: Liposomes (L) were prepared using the rehydration method. 0.425 mg of 1 ,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 0.5315 mg of 1 ,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 0.037 mg of 1 ,2-dipalmitoyl- sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1 ,3-benzoxadiazol-4-yl) (NBD-PE) and 0.01 mg of cholesterol were mixed in a 25 mL round bottom flask. The solvent was initially evaporated under a nitrogen stream for 5 min, followed by further drying under a vacuum overnight to ensure complete removal of solvent. The resulting lipid film was rehydrated with 1 mL of HEPES buffer (pH 7.4), and the suspension was vortexed and sonicated to achieve a homogeneous dispersion. The solution was extruded through 400 nm (*21) and 200 nm (*21) membranes respectively with an Avanti Mini Extruder. The liposomes were denoted as Ltan-NBD’ indicating the tail group of DOPE was labelled with NBD. The resulting liposomes were normalized to the same fluorescence intensity by up- or down-concentrating.

[0228] Steatotic HepaRG cells’. The human immortalized hepatic cell line, HepaRG, was purchased from Thermo Fisher. HepaRG cells were cultured in 75 cm2(TC-treated) culture flasks in Willliam’s E medium at 37°C under a humidified atmosphere with 5% CO2. The culture medium was supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, 100 μg mL"1streptomycin, and 100 U mL"1penicillin, 50 μM hydrocortisone 21-hemisuccinate sodium salt, and 5μg mL"1recombinant human insulin to maintain cell growth. For differentiation, the maintenance medium was further supplemented with 2% (v / v) dimethyl sulfoxide (DMSO). A 500 mM oleic acid (OA) stock solution was prepared in ultrapure water, and a 500 mM palmitic acid (PA) solution was prepared in ethanol, both by vortexing and sonication. From these stock solutions, free fatty acids (FFAs) stock solution was prepared by combining 180 mM OA and 60 mM PA at a 3:1 molar ratio, resulting in a final concentration of 240 mM in ultrapure water, which is 200* the final concentration required for cell culture medium. The differentiation medium was further supplemented with a final concentration of 1.2 mM free fatty acids (FFAs) and 0.48 mM bovine serum albumin (BSA) at a molar ratio of 5:1.

[0229] Firstly, HepaRG cells were cultured in a maintenance medium until reaching complete confluency. One week later, the cells were either expanded as progenitor cells or cultured in a differentiation medium (supplemented with 2% DMSO) for another two weeks. The differentiation medium was refreshed every other day. Morphological changes during the two-week differentiation period could be monitored by microscopy. After two weeks of differentiation, HepaRG cells were treated with medium containing 1 .2 mM FFAs and 0.48 mM BSA for 24 h, followed by replacing with fresh medium containing the same concentrations of FFAs and BSA and incubation for an additional 24 h. Later, the HepaRG cells were either further stressed with 5 mM acetaminophen (APAP) or maintained in an FFAs-free differentiation medium for another 24 h. Visualizing of HepaRG cells and liposomes: 1 xio5HepaRG cells were seeded in confocal dishes and cultured for one week to reach 100% confluency. The cells were further treated with a differentiation medium containing 2% DMSO for two weeks, followed by 1 .2 mM FFAs (OA: PA 3:1 molar ratio) with BSA for two consecutive 24- hour periods. Subsequently, the differentiated and steatotic HepaRG cells were incubated with 10 v / v% L^U-NSD f°r anadditional 24 h. The cells were then washed twice with PBS, and 500 μL of a staining solution of 50 nM Lysotracker Deep Red in PBS was added to each confocal dish. The cells were incubated for 45 min at 37 °C with 5% CO2. Later, the cells were washed twice with PBS, and 200 μL of PBS was added to each well for imaging using CLSM. The fluorescent signal was collected in two channels: Aex= 488 nm and Aem= 500-550 nm (NBD) and Aex= 639 nm and Aem= 640-700 nm (Lysotracker Deep Red).

[0230] Results

[0231] The results are presented in Figure 10. Figure 10 a) shows the chemical structure of NBD tail-labled DOPE lipids and Figure 10 b) shows a CLSM image of HepaRG cells exposed to L^U-NSD showing the lysosomal escape of the lipids and their location in the fat droplets.

[0232] In summary, the data illustrates that steatotic HepaRG cells are able to transfer fluorescent lipids formulated as liposomes into lipid droplet using an inherent mechanism.

[0233] References

[0234] Zhang, C. & Liu, P., Proteomics. 2019, 19, 1700223.

[0235] Murphy, S., Martin, S. & Parton, R.G., Biochim. Biophys. Acta Mol. Cell Biol. Lipids. 2009, 1791 , 441-447.

[0236] Rakotonirina-Ricquebourg, R., Costa, V. & Teixeira, V., Prog. Lipid Res. 2022, 85, 101141.

[0237] Thelen, A.M. & Zoncu, R., Trends Cell Biol. 2017, 27, 833-850.

[0238] Schdneberg, J., Lee, l.-H., Iwasa, J.H. & Hurley, J.H., Nat. Rev. Mol. Cell Biol. 2017, 18, 5-17.

[0239] Choudhary, V. & Schneiter, R., Front. Cell Dev. Biol. 2021 , 9.

[0240] Salo, V.T. & Ikonen, E., Curr. Opin. Cell Biol. 2019, 57, 64-70.

[0241] Tabero, A., Garcia-Garrido, F., Prieto-Castaneda, A., Palao, E., Agarrabeitia, A.R., Garcia-Moreno, I., Villanueva, A., de la Moya, S. & Ortiz, M.J., Chem. Comm. 2020, 56, 940-943.

[0242] Xu, X., Deng, G., Sun, Z., Luo, Y., Liu, J., Yu, X., Zhao, Y., Gong, P., Liu, G., Zhang, P., Pan, F., Cai, L. & Tang, B.Z., Adv. Mater. 2021 , 33, 2102322.

[0243] Wen, D., Wang, J., Van Den Driessche, G., Chen, Q., Zhang, Y., Chen, G., Li, H., Soto, J., Liu, M., Ohashi, M., Wang, Z., Abdou, P., Hu, Q., Dotti, G., Li, S., Fourches, D. & Gu, Z., Matter. 2019, 1 , 1203-1214.

[0244] Liang, T., Wen, D., Chen, G., Chan, A., Chen, Z., Li, H., Wang, Z., Han, X., Jiang, L., Zhu, J. J. & Gu, Z., Adv Mater. 2021 , 33, e2100629.

[0245] Ade, C., Brodszkij, E., Thingholm, B., Gal, N., Itel, F., Taipaleenmaki, E., Hviid, M.J., Schattling, P.S. & Stadler, B., ACS Appl. Polym. Mater. . 2019, 1 , 1532-1539.

[0246] Durigon, R., Mitchell, A.L., Jones, A.W., Manole, A., Mennuni, M., Hirst, E.M., Houlden, H., Maragni, G., Lattante, S., Doronzio, P.N., Dalia Rosa, I., Zollino, M., Holt, I. J. & Spinazzola, A., EMBO Molecular Medicine. 2018, 10, e8550.

[0247] Items

[0248] 1 . A phospholipid conjugate comprising a phospholipid and a chemical compound, such as an antioxidant, wherein said chemical compound is conjugated to the tail of said phospholipid.

[0249] 2. A phospholipid conjugate for use in the treatment of a liver disease, wherein said phospholipid conjugate comprises a phospholipid and a chemical compound, such as an antioxidant, and wherein said chemical compound is conjugated to the tail of said phospholipid.

[0250] 3. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said chemical compound is covalently conjugated to the tail of said phospholipid.

[0251] 4. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said phospholipid is selected from the group consisting of natural phospholipids and synthetic phospholipids.

[0252] 5. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said phospholipid is selected from the group consisting of phosphatidic acids, phosphatidylcholines, phosphatidylglycerols, phosphatidylethanolamines and phosphatidylserines.

[0253] 6. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said phospholipid is selected from the group consisting of DDPC, DEPA-NA, DEPC, DEPE, DEPG-NA, DLOPC, DLPA-NA, DLPC, DLPE, DLPG-NA, DLPG-NH4, DLPS-NA, DMPA-NA, DMPC, DMPE, DMPG-NA, DMPG-NH4, DMPG-NH4 / NA, DMPS-NA, DOPA-NA, DOPC, DOPE, DOPG-NA, DOPS-NA, DPPA-NA, DPPC, DPPE, DPPG-NA, DPPG-NH4, DPPS-NA, DSPA-NA, DSPC, DSPE, DSPG-NA, DSPG-NH4, DSPS-NA, EPC, HEPC, HSPC, LYSOPC, MYRISTIC, LYSOPC PALMITIC, LYSOPC STEARIC, Milk Sphingomyelin, MPPC, MSPC, PMPC, POPC, POPE, POPG-NA, PSPC, SMPC, SOPC and SPPC. 7. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said phospholipid is selected from the group consisting of 4ME 16:0 NBD PE (NBD-DPhPE), 4ME 16:0 PC, 4ME 16:0 PE, 4ME 16:0 PG, 4ME 16:0 PA, 4ME 16:0 PS, 4ME 16:0 Coenzyme A, 4ME 16:0 Diether PC, 4ME 16:0 Diether PE, 4ME 16:0 Diether DG, 12:0 Biotin-18: 1 PE, Biotin Sphingosine, Biotin S1P, 18:1-12:0 Biotin DG, 12:0 N-Biotinyl Fatty Acid, 18:1-12:0 Biotin PS, 18:1-12:0 Biotin PA, 18:1-12:0 Biotin PE, 18:1-12:0 Biotin PC, 18:1-6:0 Biotin PI(3,5)P2, 12:0 Biotinyl LPA, 18:1-6:0 Biotin PI(4,5)P2, 18:1-12:0 Biotin PIP3, 12:0 Biotinyl Coenzyme A, 12:0 N-Biotinyl fatty acid NHS, 18:0 (9,10dibromo) PC, 16:0-18:0(4, 5-dibromo) PC, 16:0-18:0 (6-7BR) PC, 16:0-18:0 (9-10BR) PC, 16:0-18:0 (11-12BR) PC, 16:0-succinoyl PC, PAzePC, Azelaoyl-PAF, PGPC, 16:0-09:0 (ALDO) PC, POVPC, POBPC, 23:2 Diyne PE [DC(8,9)PE], 16:0-23:2 Diyne PC, 16:0-23:2 Diyne PE, 23:2 Diyne PC [DC(8,9)PC], 16:0-16:0(acrylate) PC, 14:0-14:0(COOH) PC.

[0254] 8. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein the phospholipid comprises an acrylate group.

[0255] 9. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said phospholipid is selected from the group consisting of DOPC, DOPE, DOPS and acrylPC.

[0256] 10. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said phospholipid is DOPC.

[0257] 11. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said phospholipid is DOPE.

[0258] 12. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said phospholipid is DOPS.

[0259] 13. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said phospholipid is acrylPC. 14. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said antioxidant has superoxide dismutase activities and / or catalase-mimetic activities.

[0260] 15. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said antioxidant is a salen-manganese complex.

[0261] 16. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said salen-manganese complex comprises an allyl group.

[0262] 17. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said antioxidant is an Eukarion (EUK) compound.

[0263] 18. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said antioxidant is selected from the group consisting of EUK-8 of formula (I), EUK-134 of formula (II), EUK-189 of formula (III) and EUK-207 of formula (IV)

[0264] (I),

[0265] The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said antioxidant is selected from the group consisting of ELIK-A of formula (V), ELIK-B of formula (VI), ELIK-C of formula (VII) and ELIK-D of formula (VIII)

[0266]

[0267] 20. The phospholipid conjugate or the phospholipid conjugate for use according to

[0268] 5 any one of the previous items, wherein said antioxidant is ELIK-C of formula

[0269] (VII)

[0270]

[0271] 21 . The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said antioxidant is selected from the group consisting of ascorbic acid (vitamin C), glutathione, lipoic acid, carotenes, retinol (vitamin A), a-tocopherol (vitamin E), ubiquinol (coenzyme Q) and quenchers of nitric oxide synthase.

[0272] 22. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said chemical compound is a fluorophore.

[0273] 23. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said fluorophore is NBD and / or Rhodamine (Rho).

[0274] 24. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said chemical compound is an antioxidant.

[0275] 25. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said phospholipid and said chemical compound, such as said antioxidant, are conjugated via a chemically reactive group located at the tail of the phospholipid.

[0276] 26. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein the chemically reactive group is an acrylate group.

[0277] 27. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein the conjugation is done by UV- crosslinking.

[0278] 28. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein the conjugation is by a click chemistry reaction, a NHS / EDC reaction, or a thiol-maleimide reaction.

[0279] 29. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said phospholipid and said chemical compound, such as said antioxidant, are conjugated via acrylPC.

[0280] 30. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein the phospholipid has an unmodified head group.

[0281] 31. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein the phospholipid conjugate locates in the intracellular lipid droplets upon incubation with cells, such as liver cells.

[0282] 32. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein the intracellular lipid droplets are cytoplasmic lipid droplets.

[0283] 33. The phospholipid conjugate or the phospholipid conjugate for use according to item 31 , wherein the cells are selected from the group consisting of liver cells, immune cells, endothelial cells and stellate cells. 34. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein the phospholipid conjugate reduces reactive oxygen species (ROS).

[0284] 35. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein the phospholipid conjugate reduces nitrosative stress.

[0285] 36. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein the phospholipid conjugate reduces oxidative stress.

[0286] 37. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein the phospholipid conjugate improves liver function.

[0287] 38. The phospholipid conjugate or the phospholipid conjugate for use according to any one of the previous items, wherein said liver disease is selected from the group consisting of fatty liver disease (FLD), such as hepatic steatosis and nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), liver fibrosis, liver cirrhosis, liver cancer, such as hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), hepatitis, such as hepatitis A, hepatitis B and hepatitis C, chronic hepatitis, hereditary hemochromatosis, primary sclerosing cholangitis, cholestasis and liver failure.

[0288] 39. A liposome composition comprising the phospholipid conjugate according to any one of the previous items.

[0289] 40. The liposome composition according to item 39 further comprising one or more lipids.

[0290] 41. The liposome composition according to item 40, wherein said one or more lipids are selected from the group consisting of free fatty acids, glycerolipids, such as triglycerides, phospholipids, sphingolipids, prenols, saccharolipids, and sterols, such as cholesterols. 42. The liposome composition according to item 40, wherein said one or more lipids are cholesterols.

[0291] 43. A small polymer lipid hybrid vesicle comprising the phospholipid conjugate according to any one of the previous items.

[0292] 44. A small polymer lipid hybrid vesicle according to any one of the previous items further comprising an amphiphilic block copolymer.

[0293] 45. A small polymer lipid hybrid vesicle according to any one of the previous items, wherein said amphiphilic block copolymer is poly(cholesteryl methacrylate-co-2- hydroxyethyl methacrylate)-block-poly(2-carboxyethyl acrylate) (BCP).

[0294] 46. A support molecule comprising the phospholipid conjugate according to any one of the previous items.

[0295] 47. A semi-synthetic organelle comprising the phospholipid conjugate according to any one of the previous items.

[0296] 48. An engineered lipid droplet comprising the phospholipid conjugate according to any one of the previous items.

[0297] 49. An engineered lipid droplet according to item 48 further comprising one or more lipids.

[0298] 50. The engineered lipid droplet according to item 49, wherein said one or more lipids are selected from the group consisting of free fatty acids, glycerolipids, such as triglycerides, phospholipids, sphingolipids, prenols, saccharolipids, and sterols, such as cholesterols.

[0299] 51. The engineered lipid droplet according to item 49, wherein said one or more lipids are cholesterols. A composition comprising the phospholipid conjugate according to any one of the previous items and one or more excipients. A pharmaceutical composition comprising the phospholipid conjugate according to any one of the previous items and one or more pharmaceutically acceptable excipients. The liposome composition, small polymer lipid hybrid vesicle, engineered lipid droplet, composition or pharmaceutical composition according to any one of the previous items for use in the treatment of a liver disease, such as fatty liver disease (FLD), such as hepatic steatosis and non-alcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), liver fibrosis, liver cirrhosis, liver cancer, such as hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), hepatitis, such as hepatitis A, hepatitis B and hepatitis C, chronic hepatitis, hereditary hemochromatosis, primary sclerosing cholangitis, cholestasis and liver failure. An ex vivo composition comprising the phospholipid conjugate according to any one of the previous items and one or more excipients. A cellular composition comprising the phospholipid conjugate according to any one of the previous items and one or more cells. The cellular composition according to any one of the previous items, wherein the one or more cells are selected from the group consisting of liver cells, immune cells, endothelial cells and stellate cells. A kit of parts comprising a. The phospholipid conjugate according to any one of the previous items, and b. Instructions for use. A method of treating or preventing a liver disease, the method comprising administering the phospholipid conjugate according to any one of the previous items to a subject in need thereof. 60. The method according to item 59, wherein said liver disease is selected from the group consisting of fatty liver disease (FLD), such as hepatic steatosis and non-alcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), liver fibrosis, liver cirrhosis, liver cancer, such as hepatocellular carcinoma, alcoholic liver disease, alcoholic steatohepatitis (ASH), hepatitis, such as hepatitis A, hepatitis B and hepatitis C, chronic hepatitis, hereditary hemochromatosis, primary sclerosing cholangitis, cholestasis and liver failure.

[0300] 61. A method of modifying the phospholipid ratio in cell membranes, the method comprising administering the phospholipid conjugate according to any one of the previous items to a subject in need thereof.

[0301] 62. A method of manufacturing a phospholipid conjugate according to any one of the previous items, the method comprising the steps of: a. Providing a phospholipid and a chemical compound, such as an antioxidant, and b. Conjugating said chemical compound, such as an antioxidant, to the tail of said phospholipid.

Claims

Claims1. A phospholipid conjugate for use in the treatment of a liver disease, wherein said phospholipid conjugate comprises a phospholipid and a chemical compound, such as an antioxidant, and wherein said chemical compound is conjugated to the tail of said phospholipid.

2. The phospholipid conjugate for use according to claim 1, wherein said chemical compound is covalently conjugated to the tail of said phospholipid.

3. The phospholipid conjugate for use according to any one of the previous claims, wherein said phospholipid comprises an acrylate group.

4. The phospholipid conjugate for use according to any one of the previous claims, wherein said phospholipid is selected from the group consisting of DOPC, DOPE, DOPS and acrylPC.

5. The phospholipid conjugate for use according to any one of the previous claims, wherein said chemical compound is an antioxidant.

6. The phospholipid conjugate for use according to any one of the previous claims, wherein said antioxidant has superoxide dismutase activities and / or catalasemimetic activities7. The phospholipid conjugate for use according to any one of the previous claims, wherein said antioxidant is a salen-manganese complex.

8. The phospholipid conjugate for use according to any one of the previous claims, wherein said salen-manganese complex comprises an allyl group.

9. The phospholipid conjugate for use according to any one of the previous claims, wherein said antioxidant is selected from the group consisting of ELIK-8 of formula (I), EUK-134 of formula (II), EUK-189 of formula (III) and EUK-207 of formula (IV)ĨHI),10. The phospholipid conjugate for use according to any one of the previous claims, wherein said antioxidant is selected from the group consisting of ELIK-A of formula (V), EUK-B of formula (VI), EUK-C of formula (VII) and EUK-D of formula (VIII)ĨVII),(VIII).

11. The phospholipid conjugate for use according to any one of the previous claims, wherein said antioxidant is ELIK-C of formula (VII)(VII).

12. The phospholipid conjugate for use according to any one of the previous claims, wherein said phospholipid and said chemical compound, such as said antioxidant, are conjugated via a chemically reactive group located at the tail ofthe phospholipid, optionally wherein the chemically reactive group is an acrylate group.

13. The phospholipid conjugate for use according to any one of the previous claims, wherein the phospholipid has an unmodified head group.

14. The phospholipid conjugate for use according to any one of the previous claims, wherein the phospholipid conjugate reduces reactive oxygen species (ROS) and / or nitrosative stress.

15. The phospholipid conjugate for use according to any one of the previous claims, wherein said liver disease is selected from the group consisting of fatty liver disease (FLD), such as hepatic steatosis and non-alcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), alcoholic liver disease, alcoholic steatohepatitis (ASH) and liver fibrosis.

16. A liposome composition comprising a phospholipid conjugate, wherein said phospholipid conjugate comprises a phospholipid and a chemical compound, such as an antioxidant, and wherein said chemical compound is conjugated to the tail of said phospholipid.

17. The liposome composition according to claim 16, wherein said phospholipid comprises an acrylate group.

18. The liposome composition according to any one of claims 16 to 17, wherein said phospholipid is selected from the group consisting of DOPC, DOPE, DOPS and acrylPC.,19. The liposome composition according to any one of claims 16 to 18, wherein said antioxidant is selected from the group consisting of ELIK-A of formula (V), EUK-B of formula (VI), EUK-C of formula (VII) and EUK-D of formula (VIII)5 20. The liposome composition according to any one of claims 16 to 19, wherein said phospholipid is selected from the group consisting of DOPC, DOPE, DOPSand acrylPC and said chemical compound is ELIK-C of formula (VII)(VII).

21. The liposome composition according to any one of claims 16 to 20, wherein said liposome composition further comprises one or more lipids, optionally wherein said one or more lipids are selected from the group consisting of free fatty acids, glycerolipids, such as triglycerides, phospholipids, sphingolipids, prenols, saccharolipids, and sterols, such as cholesterols.

22. The liposome composition according to any one of claims 16 to 21 , wherein said liposome composition further comprises cholesterol.

23. The liposome composition according to any one of claims 16 to 22 for use in the treatment of a liver disease.

24. A support molecule comprising a phospholipid conjugate, wherein said phospholipid conjugate comprises a phospholipid and a chemical compound, such as an antioxidant, and wherein said chemical compound is conjugated to the tail of said phospholipid.

25. The support molecule according to claim 24, wherein the phospholipid conjugate is as defined in any one of claims 1 to 14.

Images