Composition for preventing or treating neurological diseases or depression comprising novel lactobacillus plantarum strain

Abstract

The present invention relates to a pharmaceutical composition for ameliorating, preventing or treating neurological diseases, comprising a novel Lactobacillus plantarum KU210152 strain isolated from kimchi, a culture thereof, or a dead cell thereof. Specifically, the composition exhibits probiotic properties such as acid resistance, bile resistance, and intestinal adhesion, and has excellent neuroprotective and depression-alleviating effects against oxidative stress, and thus can be effectively used for alleviating, ameliorating, preventing or treating symptoms of various neurological diseases and depression.

Description

Composition for preventing or treating neurological diseases or depression comprising a novel Lactobacillus plantarum strain

[0001] The present invention relates to a pharmaceutical composition for improving, preventing or treating neurological diseases, comprising a novel strain of Lactobacillus plantarum KU210152, a culture thereof or a killed cell thereof.

[0002] Probiotics are live bacteria that enter the body and have a beneficial effect on health. Their known effects include antioxidant, anti-inflammatory, cholesterol-lowering, and anti-diabetic properties. These properties are reported to vary depending on the strain.

[0003] Changes in brain function impact the physiological function of the gut, and these effects can extend to the gut microbiota. Meanwhile, metabolites produced by the gut microbiota have been reported to cross the blood-brain barrier and influence brain function. These neurons in the gut maintain continuous, two-way communication with the central nervous system, including the brain, a phenomenon known as the gut-brain axis.

[0004] According to Non-Patent Document 1, the composition of the gut microbiome of patients with depression differs from that of healthy individuals. Specifically, the gut microbiome of patients with depression is reported to be deficient in beneficial strains such as Bifidobacteria and Lactobacillus. Related studies suggest that changes in the gut microbiome may influence the development of depression and possibly be related to psychological stress.

[0005] Against this backdrop, the present invention confirmed the possibility of contributing to the treatment of neurological diseases by confirming the neuroprotective effect of the novel strain Lactobacillus plantarum KU210152 isolated from kimchi as a probiotic in a neuronal cell line and the depression-alleviating effect through animal experiments.

[0006] [Prior Art Literature]

[0007] [Non-patent literature]

[0008] (Non-patent document 001) Barandouzi ZA et al, Altered Composition of Gut Microbiota in Depression: A Systematic Review. Front Psychiatry. 2020 Jun 10;11:541.

[0009] The purpose of the present invention is to provide a composition for improving, preventing or treating neurological diseases using a novel strain, Lactobacillus plantarum KU210152.

[0010] To achieve the above purpose, the present invention provides a novel Lactobacillus plantarum KU210152 strain comprising a DNA sequence encoding 16S rRNA represented by the base sequence of SEQ ID NO: 1.

[0011] The present invention also provides a pharmaceutical composition for improving, preventing or treating a neurological disease, comprising the novel Lactobacillus plantarum KU210152 strain deposited under accession number KCCM13371P, a culture thereof or a killed cell thereof.

[0012] The present invention also provides a food composition for preventing or improving neurological diseases, comprising the novel Lactobacillus plantarum KU210152 strain deposited under accession number KCCM13371P, a culture thereof, or a killed cell thereof.

[0013] The present invention also provides an animal feed additive composition for preventing or improving neurological diseases, comprising the novel Lactobacillus plantarum KU210152 strain deposited under accession number KCCM13371P, a culture thereof, or a killed cell thereof.

[0014] The present invention relates to a composition for improving, preventing or treating a neurological disease, comprising the Lactobacillus plantarum KU210152 strain deposited under the accession number KCCM13371P, a culture thereof or a killed cell thereof, wherein the Lactobacillus plantarum KU210152 strain according to the present invention exhibits: i) acid resistance, bile resistance and intestinal adhesion; ii) production of β-glucosidase or β-galactosidase; iii) reduction in ROS production; iv) increase in BDNF and TH expression; v) increase in mRNA expression of TPH-1, SERT and HTR2A; vi) increase in sucrose preference; vii) maintenance of serum corticosterone; viii) increase in Bacteroides spp. strains; Or ⅸ) It has the effect of increasing the synthesis of acetic acid, propionic acid and butyric acid, so it can be used as a pharmaceutical or food composition and an animal feed additive composition for degenerative neurological diseases or mental disorders caused by nerve cell death.

[0015] Figure 1 is an experimental design for inducing depression in a mouse model through restraint stress.

[0016] Figure 2 is a phylogenetic tree obtained through partial sequencing of a portion of the DNA sequence encoding 16S rRNA of the novel strain Lactobacillus plantarum KU210152.

[0017] Figure 3 shows the results of evaluating the neurotoxicity of strain-derived metabolites (conditioned medium, CM) confirmed through MTT analysis.

[0018] Figure 4 shows the results of measuring cell viability according to H2O2 concentration.

[0019] Figure 5 shows the results of measuring the neuronal cell survival rate of strain-derived CM confirmed through MTT analysis.

[0020] Figure 6 shows the results of comparing the morphological changes in SH-SY5Y cells treated with strain-derived CM and H2O2.

[0021] Figure 7 shows the results comparing ROS production in SH-SY5Y cells treated with strain-derived CM and H2O2.

[0022] Figure 8 shows the results of measuring the expression levels of BDNF and TH using RT-PCR when human colon cancer cells were treated with Lactobacillus bacteria.

[0023] Figure 9 shows the results of measuring the gene expression levels of BDNF and TH in nerve cells treated with CM derived from a strain that induces toxicity with H2O2.

[0024] Figure 10 shows the results of the gene expression ratio of Bax and Bcl-2 in nerve cells treated with strain-derived CM and H2O2.

[0025] Figures 11(A) and 11(B) show the results of measuring the activities of caspase-9 and caspase-3 after treating nerve cells with strain-derived CM and H2O2, respectively.

[0026] Figures 12(A), 12(B), and 12(C) respectively show the results of measuring changes in pH, titratable acidity, and number of viable cells during the fermentation time of soy milk yogurt.

[0027] Figures 13(A), 13(B), and 13(C) are the results of measuring changes in pH, titratable acidity, and number of viable bacteria during the storage period of soy milk yogurt, respectively.

[0028] Figure 14 shows the results of the neurotoxicity evaluation of soy milk yogurt measured by MTT analysis.

[0029] Figure 15 shows the results of measuring cell viability according to H2O2 concentration.

[0030] Figure 16 shows the results of the neuroprotective effect of soy milk yogurt measured by MTT analysis.

[0031] Figure 17 shows the results of comparing the morphological changes in SH-SY5Y cells treated with soy milk yogurt and H2O2.

[0032] Figure 18 shows the results comparing ROS production in SH-SY5Y cells treated with soy yogurt and H2O2.

[0033] Figure 19 shows the results of comparing the change in body weight per hour according to the intake of selected strains in a restraint stress depression model.

[0034] Figure 20 shows the results of comparing sucrose preference according to the intake of selected strains in a restraint stress depression model.

[0035] Figure 21 shows the results of the tail suspension test according to the intake of selected strains in the restraint stress depression model.

[0036] Figure 22 shows the results of an open field test according to the intake of selected strains in a restraint stress depression model.

[0037] Figure 23 shows the results of the elevated plus maze test according to the intake of selected strains in the restraint stress depression model.

[0038] Figure 24 shows the results of measuring the expression level of SERT mRNA in the small and large intestine tissues according to the intake of selected strains in a restraint stress depression model.

[0039] Figure 25 shows the results of measuring the expression level of TPH-1 mRNA in the small and large intestine tissues according to the intake of selected strains in a restraint stress depression model.

[0040] Figure 26 shows the results of measuring the expression levels of HTR2A and SERT mRNA in the prefrontal cortex tissue according to the intake of selected strains in a restraint stress depression model.

[0041] Figure 27 shows the results of measuring the corticosterone content in serum according to the intake of selected strains in a restraint stress depression model.

[0042] Figure 28 shows the results of comparing the composition of the Bacteroides genus in a restraint stress depression model.

[0043] Figure 29 shows the results of analyzing calprotectin levels in a restraint stress depression model.

[0044] Figure 30 shows the genome map of the Lactobacillus plantarum KU210152 strain.

[0045] Hereinafter, the present invention will be described in detail.

[0046] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Generally, the nomenclature used herein is well known and commonly used in the art.

[0047] When it is said in this specification that a component or a step "comprises", this does not exclude other components or other steps, but rather may include other components or other steps, unless specifically stated otherwise.

[0048] As used herein, the term "administration" means placing a substance into a subject in a manner that results in at least partial localization to a desired site in the subject. Administration may be accomplished by any method known in the art.

[0049] The term "treatment" in this specification may include, without limitation, any act that can improve or benefit symptoms related to a neurological disorder using the composition of the present invention.

[0050] In this specification, the term "dead cells" refers to a form manufactured through heat treatment of a live cell cultured with a strain, and is a form in which the activity of the strain is prevented, and may include cytoplasm, antibacterial active substances such as bacteriocin, organic acids, etc.

[0051] The present invention provides a novel Lactobacillus plantarum KU210152 strain comprising a DNA sequence encoding 16S rRNA represented by the base sequence of SEQ ID NO: 1.

[0052] [Revised on 22.08.2024 under Article 91 of the Rules] The above strain was assigned the accession number KCCM 13371P by the Korea Microorganism Conservation Center on July 25, 2023. The above strain (KCCM 13371P) is Lactobacillus plantarum. Lactobacillus plantarum is a Gram-positive rod-shaped bacterium with a slightly aerobic strain and is one of the most widely distributed lactic acid bacteria in nature. Lactobacillus plantarum undergoes normal lactic acid fermentation and is a representative kimchi lactic acid bacteria that ferments arabinose, glucose, fructose, galactose, maltose, sucrose, dextran, etc. to produce lactic acid. It is mainly isolated from dairy products, pickles, pickled vegetables such as kimchi, tomatoes, etc., and especially in the later stage of kimchi fermentation, when kimchi is fermented a lot and has a sour taste, it mainly grows and becomes dominant, and it is known to be a bacterium that inhibits the growth of other species, and is generally known to have excellent acid resistance, bile resistance, and intestinal adhesion ability. In addition, the strain does not produce β-glucuronidase and N-acetyl-β-glucosaminidase, which are enzymes that cause cancer in the human body, and is characterized by having antibiotic resistance to gentamicin, kanamycin, streptomycin, and cistrofloxacin, and antibiotic sensitivity to ampicillin, tetracycline, chloramphenicol, and doxycycline.

[0053] The above strain can be produced as a live cell, dead cell, or culture medium, but it is preferable to produce a dead cell by culturing at 25°C to 45°C for 10 to 50 hours and then optimally heat treating at 70°C to 90°C for 10 minutes to 1 hour, but is not limited thereto.

[0054] The present invention also provides a pharmaceutical composition for improving, preventing or treating a neurological disease, comprising the novel Lactobacillus plantarum KU210152 strain deposited under accession number KCCM13371P, a culture thereof or a killed cell thereof.

[0055] The above neurological disease may be, but is not limited to, a degenerative neurological disease or mental disorder caused by nerve cell death.

[0056] The above-mentioned neurodegenerative disease is at least one selected from the group consisting of Parkinson's disease, Alzheimer's disease, Lou Gehrig's disease, Huntington's disease, amyotrophic lateral sclerosis, multiple sclerosis, brain dysfunction due to immune system abnormality, progressive neurodegenerative disease, metabolic encephalopathy, Niemann-Pick disease, and dementia due to cerebral ischemia and cerebral hemorrhage, and the above-mentioned mental disorder may be at least one selected from the group consisting of anxiety, depression, insomnia, obsessive-compulsive disorder, panic disorder, intellectual disability, stress, memory impairment, and cognitive impairment, but is not limited thereto.

[0057] The above neuronal cell death may be induced by, but is not limited to, oxidative stress.

[0058] The above strain may comprise a DNA sequence encoding 16S rRNA represented by the base sequence of sequence number 1.

[0059] The above composition comprises 1 X 10 of the strain, a culture thereof or a dead cell thereof. 6 CFU / mL to 1 X 10 11 It can be included at a concentration of CFU / mL, preferably 1 X 10 8 CFU / mL to 1X 10 10 It may be included at a concentration of CFU / mL, but is not limited thereto.

[0060] The composition may additionally have one or more characteristics selected from the group consisting of, but not limited to, i) acid resistance, cholestasis resistance and intestinal adhesion; ii) production of β-glucosidase or β-galactosidase; iii) reduction of ROS production; iv) increase in BDNF and TH expression; v) increase in mRNA expression of TPH-1, SERT and HTR2A; vi) increase in sucrose preference; vii) maintenance of serum corticosterone; viii) increase in Bacteroides spp. strains; or ix) increase in acetic acid, propionic acid and butyric acid synthesis.

[0061] If the strain has excellent acid and bile resistance, it can safely reach the intestines when ingested, and if it has excellent intestinal adhesion, it can stably settle in the intestines.

[0062] The above β-glucosidase or β-galactosidase is an enzyme that plays a key role in the metabolism of carbohydrates and the survival and function of lactic acid bacteria. β-glucosidase decomposes glucosides found in various plant foods, and β-galactosidase mainly plays a role in decomposing lactose, and is an enzyme essential for the survival and growth of lactic acid bacteria.

[0063] The above ROS are reactive oxygen species (ROS). Their high chemical reactivity allows them to react with various cellular components, such as genes, proteins, and lipids, altering cellular functional substances, disrupting their proper function and causing cellular damage. These ROS are a contributing factor in the exacerbation of various diseases, including cancer, diabetes, and degenerative neurodegenerative diseases.

[0064] The above-mentioned BDNF stands for brain-derived neurotrophic factor, a member of a group of neurotrophic factors that are part of growth factors. BDNF expression tends to be reduced in patients with depression, schizophrenia, obsessive-compulsive disorder, dementia, Alzheimer's disease, Rett syndrome, Huntington's disease, anorexia nervosa, bulimia, and epilepsy.

[0065] The above-mentioned TH is tyrosine hydroxylase, a key factor regulating dopamine synthesis. For example, as Parkinson's disease symptoms worsen, tyrosine hydroxylase expression tends to be reduced.

[0066] The above TPH-1 (tryptophan hydroxylase-1) is mainly expressed in the intestines and sensory nerve cells, and is an enzyme that synthesizes tryptophan into the neurotransmitter serotonin, so it can be used as an indicator of the level of serotonin expression in the brain.

[0067] Serotonin, also known as 5-hydroxytryptamine (5-HT), is a monoamine neurotransmitter derived from tryptophan. A serotonin deficiency can lead to depression.

[0068] The above-mentioned SERT (serotonin transporter) is a protein that plays a crucial role in the serotonin signaling process. Serotonin is responsible for various neurotransmission functions in the central nervous system, some of which involve binding to receptors and transmitting signals. The serotonin transporter is located in the cell membrane and regulates serotonin levels and signaling.

[0069] The above HTR2A is 5-hydroxytryptamine receptor 2A, one of the subtypes of 5-HT receptors (5HTRs), which are proteins that serotonin binds to and transmits signals.

[0070] The pharmaceutical composition of the present invention may further comprise suitable carriers, excipients and diluents commonly used in the manufacture of pharmaceutical compositions.

[0071] The pharmaceutical dosage form of the composition according to the present invention can be used in the form of their pharmaceutically acceptable salts, and can also be used alone or in combination with other pharmaceutically active compounds as well as in an appropriate combination.

[0072] The pharmaceutical composition according to the present invention can be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, and sterile injection solutions, respectively, according to conventional methods. Carriers, excipients, and diluents that can be included in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate mixtures, etc. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations can be manufactured by mixing at least one excipient, such as starch, calcium carbonate, sucrose or lactose, gelatin, etc., with the pharmaceutical composition. In addition to simple excipients, lubricants such as magnesium stearate and talc can also be used. Liquid preparations for oral administration include suspensions, oral solutions, emulsions, syrups, etc. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, suspending agents, emulsions, lyophilized preparations, and preservatives can be included. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspending agents can include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. Suppository bases that can be used include Wetepsol, Macrogol, Tween 61, cocoa butter, laurin butter, and glycerogelatin.

[0073] The preferred dosage of the composition of the present invention varies depending on the patient's condition and weight, the degree of disease, the drug form, the route of administration, and the period of administration, but can be appropriately selected by a person skilled in the art.

[0074] The present invention also provides a food composition for preventing or improving neurological diseases, comprising a novel Lactobacillus plantarum KU210152 strain comprising a DNA sequence encoding 16S rRNA represented by the base sequence of SEQ ID NO: 1 deposited under accession number KCCM13371P, a culture thereof, or a killed cell thereof.

[0075] The above neurological disease may be, but is not limited to, a degenerative neurological disease or mental disorder caused by nerve cell death.

[0076] The above-mentioned neurodegenerative disease is at least one selected from the group consisting of Parkinson's disease, Alzheimer's disease, Lou Gehrig's disease, Huntington's disease, amyotrophic lateral sclerosis, multiple sclerosis, brain dysfunction due to immune system abnormality, progressive neurodegenerative disease, metabolic encephalopathy, Niemann-Pick disease, and dementia due to cerebral ischemia and cerebral hemorrhage, and the above-mentioned mental disorder may be at least one selected from the group consisting of anxiety, depression, insomnia, obsessive-compulsive disorder, panic disorder, intellectual disability, stress, memory impairment, and cognitive impairment, but is not limited thereto.

[0077] In the present invention, the food in the food composition may be a main ingredient, auxiliary ingredient, food additive, health functional food, or functional beverage of food, but is not limited thereto.

[0078] Foods to which the food composition according to the present invention can be added include, for example, various foods, beverages, gum, tea, vitamin complexes, health functional foods, and other functional foods. In addition, the foods in the present invention include, but are not limited to, special nutritional foods (e.g., formulated milk, infant food, etc.), processed meat products, fish products, tofu, jelly, noodles (e.g., ramen, noodles, etc.), bread, health supplements, seasoned foods (e.g., soy sauce, soybean paste, red pepper paste, mixed paste, etc.), sauces, confectionery (e.g., snacks), candies, chocolates, gum, ice cream, processed dairy products (e.g., fermented milk, cheese, etc.), other processed foods, kimchi, pickled foods (various kimchi, pickled vegetables, etc.), beverages (e.g., fruit drinks, vegetable drinks, soy milk, fermented drinks, etc.), and natural seasonings (e.g., ramen soup, etc.). The above food, beverage or food additive can be manufactured by a conventional manufacturing method.

[0079] The above health functional food refers to a food group that has added value by using physical, biochemical, or bioengineering techniques to enable the function of the food to be expressed or performed for a specific purpose, or a food that has been designed and processed to sufficiently express the body's internal regulatory function for regulating the biological defense rhythm, disease prevention, and recovery, etc. of the food composition.

[0080] The above functional food may include a food additive acceptable from a food science perspective, and may further include one or more of suitable carriers, additives, excipients, and diluents commonly used in the manufacture of functional foods.

[0081] The above health functional food may be formulated into one selected from the group consisting of tablets, pills, powders, granules, powders, capsules, and liquid formulations, further comprising at least one of a carrier, a diluent, an excipient, and an additive. Foods to which the extract of the present invention can be added include various foods, powders, granules, tablets, capsules, syrups, beverages, gum, tea, vitamin complexes, and health functional foods.

[0082] As additives that may be further included in the present invention, one or more ingredients selected from the group consisting of natural carbohydrates, flavoring agents, nutrients, vitamins, minerals (electrolytes), flavoring agents (synthetic flavoring agents, natural flavoring agents, etc.), coloring agents, fillers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH regulators, stabilizers, preservatives, antioxidants, glycerin, alcohol, carbonating agents, and fruit pulp may be used.

[0083] Examples of the above-mentioned natural carbohydrates include monosaccharides such as glucose, fructose, etc.; disaccharides such as maltose, sucrose, etc.; and polysaccharides such as dextrin, cyclodextrin, etc., common sugars, and sugar alcohols such as xylitol, sorbitol, erythritol, etc. As the flavoring agent, natural flavoring agents (thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used.

[0084] In addition to the above, the health functional food of the present invention may contain various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc. In addition, the composition according to the present invention may contain fruit pulp for the production of natural fruit juice and vegetable beverages. These ingredients may be used independently or in combination.

[0085] Specific examples of the carrier, excipient, diluent and additive include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, erythritol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium phosphate, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, polyvinylpyrrolidone, methylcellulose, water, sugar syrup, methylcellulose, methyl hydroxy benzoate, propyl hydroxy benzoate, talc, magnesium stearate and mineral oil, and it is preferable to use at least one selected from the group consisting of:

[0086] Furthermore, in addition to those described above, the food containing the food composition of the present invention may contain various nutrients, vitamins, minerals (electrolytes), natural carbohydrates, flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and fillers (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH regulators, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, and fruit pulp, and the above components may be used independently or in combination.

[0087] The present invention also provides an animal feed additive composition for preventing or improving neurological diseases, comprising a novel Lactobacillus plantarum KU210152 strain comprising a DNA sequence encoding 16S rRNA represented by the base sequence of SEQ ID NO: 1 deposited under accession number KCCM13371P, a culture thereof, or a killed cell thereof.

[0088] The above neurological disease may be, but is not limited to, a degenerative neurological disease or mental disorder caused by nerve cell death.

[0089] The above-mentioned neurodegenerative disease is at least one selected from the group consisting of Parkinson's disease, Alzheimer's disease, Lou Gehrig's disease, Huntington's disease, amyotrophic lateral sclerosis, multiple sclerosis, brain dysfunction due to immune system abnormality, progressive neurodegenerative disease, metabolic encephalopathy, Niemann-Pick disease, and dementia due to cerebral ischemia and cerebral hemorrhage, and the above-mentioned mental disorder may be at least one selected from the group consisting of anxiety, depression, insomnia, obsessive-compulsive disorder, panic disorder, intellectual disability, stress, memory impairment, and cognitive impairment, but is not limited thereto.

[0090] The above feed additive composition can be added to feed, and "feed" can mean any natural or artificial diet, meal, etc., or a component of the meal, which is suitable for or intended for an animal to eat, ingest, or digest. The type of the feed is not particularly limited, and feed commonly used in the relevant technical field can be used. Non-limiting examples of the feed include plant feed such as grains, roots, fruits, food processing by-products, algae, fibers, pharmaceutical by-products, oils, starches, meal, or grain by-products; and animal feed such as proteins, inorganic substances, oils, minerals, oils, single-cell proteins, zooplankton, or food.

[0091] The above feed additive composition may be in the form of a dry or liquid formulation, and may further include other non-pathogenic microorganisms in addition to the above strain.

[0092] When the above feed additive composition is used as an animal feed additive, various grains and soybean proteins, as well as peanuts, peas, sugar beets, pulp, grain by-products, animal viscera powder, and fish meal powder, can be used as feed raw materials, and these can be used without limitation in an unprocessed or processed form.

[0093]

[0094] Hereinafter, the present invention will be described in more detail through examples. These examples are intended solely to illustrate the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples, in accordance with the gist of the present invention.

[0095]

[0096] Example 1: Experimental Materials and Methods

[0097] 1-1. Strains used

[0098] Lactobacillus rhamnosus GG strain was used as a standard strain. Lactobacillus plantarum KU210152 was isolated from kimchi using MRS medium. Streptococcus thermophilus P206 strain, isolated from the commercial starter ABT-B, was used as a starter in the production of soy milk yogurt.

[0099] The results of analyzing the base sequence of a portion of the DNA sequence encoding 16S rRNA of the Lactobacillus plantarum strain of the present invention (partial sequencing) are as follows.

[0100] SEQ ID NO: 1: GAATTGACGGGGGCCGCCCCAAGCGGTGGAGCTGTGGTTAATTCCAACCTCCCAAGAACCTTACCGGCTTTGAATCTATTCAAATT

[0101]

[0102] The phylogenetic diagram of the above strain is as shown in Fig. 2, and it was assigned the accession number KCCM 13371P by the Korea Microbiological Conservation Center on July 25, 2023.

[0103]

[0104] 1-2. Measurement of acid resistance, bile resistance, and intestinal adhesion

[0105] Acid resistance of the strain was determined by inoculating the strain into MRS liquid medium containing 0.3% pepsin, adjusting the pH to 2.5, and culturing it at 37°C for 3 hours. The number of bacteria was compared with the initial number of inoculated bacteria. Bile resistance was determined by inoculating the strain into MRS liquid medium containing 0.3% bile acid, and culturing it at 37°C for 24 hours. The number of bacteria was compared with the initial number of inoculated bacteria.

[0106]

[0107] HT-29 cell line, a human intestinal epithelial cell line, was seeded in a 24-well plate (1Х10 5 After culturing (8 log CFU / mL) the Lactobacillus plantarum KU210152 strain was inoculated. After culturing at 37°C for 2 hours, the cells were washed three times with PBS to remove bacteria that were not attached to the cells, and the bacteria attached to the cells were detached from the cells with a 1% Triton X-100 solution. The bacteria were diluted to an appropriate multiple and plated on MRS agar medium, and the number of attached bacteria was measured after culturing at 37°C. The intestinal adhesion ability was calculated by comparing the number of initially inoculated bacteria with the number of attached bacteria.

[0108]

[0109] To evaluate the probiotic properties of Lactobacillus plantarum KU210152, acid and bile tolerance were measured. After 3 hours of culture in the presence of 0.3% pepsin (pH 2.5), the comparative strain Lactobacillus rhamnosus GG showed 98.67%, Lactobacillus plantarum KU210152 showed 99.36%, and Lactobacillus rhamnosus GG showed 98.35%. After 24 hours of treatment in the presence of 0.3% bile acid, Lactobacillus rhamnosus GG showed 94.99%, and Lactobacillus plantarum KU210152 showed 96.68%.

[0110] The intestinal adhesion capacity of Lactobacillus plantarum KU210152 was 5.58%, which was superior to that of Lactobacillus rhamnosus GG, which showed 1.71% (Table 1).

[0111] L. rhamnosus GGL. plantarumKU210152 Tolerance to artificial gastric acid 98.67±1.82% 100.12±1.30% Tolerance to artificial bile salt 94.99±0.78% 96.68±0.53% Adhesion ability 1.71±0.26% 5.58±0.12%

[0112] 1-3. Measurement of enzyme production

[0113] [Revised 22.08.2024 under Article 91] The enzyme production capacity of the strains was assessed using the API ZYM kit. Lactobacillus rhamnosus GG and Lactobacillus plantarum KU210152, cultured for 24 hours, were diluted in PBS to 9 log CFU / mL before use. Enzyme activity was assessed based on the intensity of color change.

[0114] Enzyme production experiments were conducted to determine whether Lactobacillus plantarum KU210152 produces beneficial or harmful enzymes. Neither Lactobacillus rhamnosus GG nor Lactobacillus plantarum KU210152 produced β-glucuronidase, a known carcinogenic enzyme. In addition, both strains produced β-glucosidase, which is beneficial for soy milk fermentation, and β-galactosidase, which is beneficial for lactose degradation (Table 2).

[0115] Enzyme L. rhamnosus GGL. plantarum KU210152 Control 00 Alkaline phosphate 22 Esterase 11 Esterase lipase 11 Lipase 11 Leucine arylamidase 34 Valine arylamidase 43 Cystine arylamidase 22 Trypsin 00 α- Chymotrypsin 00 Acid phosphatase 33 Naphthol-AS-BI-phosphohydrolase (Naphthol-AS-BI-phosphohydrolase) 2 2 α-Galactosidase 1 1 β-Galactosidase 4 4 ​​β-Glucuronidase 0 0 α-Glucosidase 1 1 β-Glucosidase 3 3 N-Acetyl-β-glucosaminidase 4 4 ​​α-Mannosidase 0 0 α-Fucosidase 0 0, 0 nM; 1, 5 nM; 2, 10 nM; 3, 20 nM; 4, 30 nM; and 5, ≥ 40 nM

[0116] Example 2: Experiments on neuroprotection in neural cell lines

[0117] 2-1. Preparation of dead cells and strain-derived metabolites (conditioned medium; CM)

[0118] Lactobacillus strains were cultured in MRS medium for 24 hours. After washing twice with PBS, dead cells were prepared by heat treatment at 80°C for 30 minutes. Human intestinal epithelial cells HT-29 were inoculated into 6-well plates (5X10 5 cells / mL) for 5 days, Lactobacillus dead cells (1Х10 9CFU / mL) and cultured for 24 hours. The supernatant was collected, centrifuged at 14,000Хg and 4℃ for 10 minutes, and filtered using a 0.45 μM filter to produce strain-derived metabolites (conditioned medium; CM).

[0119]

[0120] 2-2. Soymilk yogurt manufacturing and measurement of viable cell count, pH, and titratable acidity

[0121] Soy milk was sterilized by heating at 90℃ for 10 minutes and then cooled to 42℃. Streptococcus thermophilus P206, used as a starter, was cultured in MRS medium for 18 hours and then inoculated into each yogurt at a 1% concentration. Probiotic soy yogurt was inoculated with 1% each of Lactobacillus rhamnosus GG and Lactobacillus plantarum KU210152. Fermentation was performed at 42℃ until the pH value reached 4.5, and the manufactured yogurt was stored at 4℃ for 21 days. CY represents soy yogurt fermented with only the starter, GY represents soy yogurt fermented with the starter and Lactobacillus rhamnosus GG, and PY represents soy yogurt fermented with the starter and Lactobacillus plantarum KU210152.

[0122] The viable cell count, pH, and titratable acidity of soy yogurt were measured during the fermentation and storage periods. The viable cell count was confirmed by spreading a plate on MRS medium. The pH and titratable acidity were measured using a pH meter. The titratable acidity was calculated by measuring the amount of 0.1 N sodium hydroxide (NaOH) titrated until the pH increased to 8.3 after mixing 10 g of soy yogurt with 10 mL of distilled water. The titratable acidity was calculated according to Equation 1 below.

[0123] [Formula 1]

[0124]

[0125] Three soy yogurts were prepared using a starter and two Lactobacillus strains. All three yogurts (CY, GY, and PY) showed initial pH values ​​of approximately 6.7 during 6 h of fermentation and pH values ​​of 4.6, 4.4, and 4.5 after fermentation, respectively. Titrable acidity gradually increased. CY increased from 0.10% to 0.47%, GY from 0.10% to 0.60%, and PY from 0.10% to 0.50%. The viable cell count also increased during fermentation. CY showed changes of 7.22-8.87 log CFU / mL, GY 7.47-9.00 log CFU / mL, and PY 7.54-9.00 log CFU / mL (see Fig. 12).

[0126] Soy yogurt was stored for 21 days and its characteristics were checked every 7 days. The pH of the three yogurts was maintained at approximately 4.5 for CY, 4.3 for GY, and 4.4 for PY, and the titratable acidity was maintained at approximately 0.47%, 0.61%, and 0.52% for CY, GY, and PY, respectively. The viable cell count decreased during the storage period. CY changed from 8.80 log CFU / mL to 8.45 log CFU / mL, GY changed from 8.92 log CFU / mL to 8.24 log CFU / mL, and PY changed from 8.62 log CFU / mL to 7.96 log CFU / mL (see Fig. 13).

[0127]

[0128] 2-3. Preparation of yogurt supernatant

[0129] A soy yogurt supernatant was prepared for use in cell experiments. 10 g of yogurt was mixed with 2.5 mL of sterilized distilled water and centrifuged at 14,240 x g, 4°C for 5 minutes. The resulting supernatant was adjusted to pH 7.0 with 1 M NaOH, centrifuged again, and filtered through a 0.45 μM filter.

[0130]

[0131] 2-4. Measurement of the protective effect against nerve cell death

[0132] MTT assay was performed to measure the cytotoxicity of the samples on SH-SY5Y neuronal cells and their cytoprotective effect against H2O2, an oxidative stress. SH-SY5Y cells (1Х10 6 cells / mL) were cultured in a 96-well plate for 24 hours. To evaluate the toxicity of the sample, the sample was treated and cultured for 24 hours. To confirm the neuroprotective effect, the sample was cultured for 4 hours and treated with H2O2 for 20 hours. Afterwards, the medium was removed and MTT (5 mg / mL) was treated for 4 hours. The reacted MTT solution was removed, and 100 μL of DMSO solution was added and reacted for 20 minutes to dissolve the crystals. After that, the absorbance was measured at 570 nm, and the cell viability was calculated according to Equation 2 below.

[0133] [Formula 2]

[0134]

[0135] 1) Measurement of the neuronal cell death protection effect of strain-derived CM and morphological changes in cells

[0136] Before confirming the neuronal cell death protective effect of strain-derived CM, the cytotoxicity of strain-derived CM was assessed using an MTT assay. Neither strain showed toxicity toward neuronal cells (see Fig. 3).

[0137] Cell viability was determined by treating with hydrogen peroxide (H2O2), an oxidative stressor, at concentrations ranging from 0 to 300 μM. Since a viability of 50.92% was observed at 150 μM, this concentration was used in subsequent strain-derived CM experiments (see Fig. 4).

[0138] To measure the neuroprotective effect of strain-derived CM and H2O2, which induces oxidative stress, on neurons, an MTT assay was performed. When the cell viability of the negative control group not treated with H2O2 was set as 100%, the viability of cells treated only with H2O2 was 52.85%. When treated with CM derived from Lactobacillus rhamnosus GG and Lactobacillus plantarum KU210152 and H2O2, the viability was 58.75% and 73.38%, respectively (see Fig. 5).

[0139] To confirm the protective effect of the sample, morphological changes in nerve cells were observed. SH-SY5Y cells (1Х10 6 After culturing the sample (cells / mL) for 24 hours, the sample was treated with H2O2 for 4 hours and H2O2 for 20 hours, and the cell morphology was confirmed under a microscope (see Fig. 6).

[0140] In negative control cells not treated with H2O2, the cell body and neurites were clearly observed. In positive control cells treated with H2O2, cell aggregation and shrinkage were observed. When treated with CM derived from Lactobacillus rhamnosus GG and Lactobacillus plantarum KU210152, cell damage was attenuated, resulting in a similar appearance to the negative control.

[0141]

[0142] 2) Protective effect of soy milk yogurt on neuronal cell death and morphological changes in cells

[0143] Before examining the neuroprotective effects of soy yogurt, we performed an MTT assay to assess the cytotoxicity of the soy yogurt samples. The soy yogurt samples were divided into three concentrations and tested. The original samples showed cell viability rates of less than 40%, indicating toxicity. The 1 / 2 and 1 / 4 dilutions of the three yogurts showed cell viability rates close to 100%, indicating no toxicity. Therefore, the 1 / 2 and 1 / 4 dilutions were used in subsequent experiments (see Figure 14).

[0144] Cell viability was determined by treating cells with H2O2, an oxidative stressor, at concentrations ranging from 0 to 300 μM. Since a viability rate of 48.32% was observed at a concentration of 200 μM, subsequent experiments were conducted at this concentration (see Figure 15).

[0145] MTT assay was performed by treating soy milk yogurt samples and H2O2 in nerve cells (see Fig. 16). When the negative control group without H2O2 treatment was set as 100%, the viability of cells treated only with H2O2 was 45.68%. In the 1 / 2 dilution, CY, GY, and PY showed 22.93%, 37.81%, and 57.38%, respectively, and in the 1 / 4 dilution, CY, GY, and PY showed 46.54%, 54.05%, and 63.57%, respectively. Overall, CY did not show a neuroprotective effect, and the 1 / 4 dilution showed a higher cell viability. In particular, PY showed a high neuroprotective effect in the 1 / 4 dilution. Therefore, the 1 / 4 dilution concentration was used in subsequent experiments.

[0146] In the negative control group not treated with H2O2, neurites were observed. In the positive control group treated with H2O2, cellular damage was observed. This damage was attenuated after GY and PY treatment (see Figure 17).

[0147]

[0148] 2-5. Measurement of reactive oxygen species (ROS) production

[0149] After treating the samples in the nerve cells, the production of reactive oxygen species was confirmed through microscopic imaging. SH-SY5Y cells (1Х10 6 After culturing the cells (cells / mL) in a 12-well plate for 24 hours, the sample was treated for 4 hours and H2O2 for 20 hours. After washing the cells with PBS, the DCF-DA reagent was added and reacted at 37°C for 30 minutes. After the reaction, the cells were washed with PBS and ROS production was observed using a fluorescence microscope.

[0150]

[0151] 1) ROS production in nerve cells after treatment with strain-derived CM

[0152] No ROS production was detected in negative control cells not treated with H2O2, whereas increased ROS production was observed in positive control cells treated with H2O2. This ROS production was significantly reduced after treatment with CM derived from Lactobacillus rhamnosus GG and Lactobacillus plantarum KU210152 (see Fig. 7).

[0153]

[0154] 2) ROS production in nerve cells from soy yogurt

[0155] In negative control cells not treated with H2O2, ROS production was minimal. In positive control cells treated with H2O2, ROS production increased. This ROS production was confirmed to be reduced after treatment with GY and PY (see Figure 18).

[0156]

[0157] 2-6. Gene expression analysis in human colon cancer cells and neural cells

[0158] RT-PCR was performed to determine whether brain-derived neurotrophic factor (BDNF) and TH (tyrosine hydroxylase) were increased or decreased when colon cancer cells were treated with lactic acid bacteria, and whether BDNF, TH, Bax, and Bcl-2 were increased or decreased when strain-derived CM was treated to nerve cells (see Fig. 8). HT-29 cells were treated at 5X10 5 cells / mL in a 6-well plate and treated with lactic acid bacteria kill cells, and cultured for 24 hours. SH-SY5Y cells were cultured at 1Х10 6 The cells were cultured in 6-well plates at 10 cells / mL and reacted with strain-derived CM for 4 hours and H2O2 for 6 hours. Afterwards, RNA was extracted from each cell, converted to cDNA, and RT-PCR was performed to compare gene expression levels.

[0159]

[0160] 1) BDNF expression level in human colon cancer cells HT-29

[0161] RT-PCR was performed to measure the expression levels of BDNF and TH genes when Lactobacillus kill cells were treated in HT-29 colon cancer cells. The control group was treated with PBS instead of Lactobacillus kill cells. When cells were treated with Lactobacillus rhamnosus GG and Lactobacillus plantarum KU210152, BDNF expression levels increased by 1.31-fold and 1.35-fold, respectively, compared to the control group. TH expression levels were 1.15-fold and 1.54-fold, respectively.

[0162]

[0163] 2) BDNF and TH expression levels in human neuroblastoma SH-SY5Y cells induced by oxidative stress with hydrogen peroxide

[0164] To measure the neuroprotective effect of strain-derived CM, changes in BDNF and TH after treatment of SH-SY5Y with strain-derived CM and H2O2 were evaluated by RT-PCR (see Fig. 9).

[0165] In the case of the positive control group treated with only H2O2, the BDNF expression level decreased by 0.81 times compared to the negative control group not treated with H2O2. After treatment with CM derived from Lactobacillus rhamnosus GG and Lactobacillus plantarum KU210152, the expression level increased by 1.36 times and 1.93 times, respectively. In the case of TH expression level, the expression level decreased by 0.74 times when treated with only H2O2, but when treated with CM derived from Lactobacillus rhamnosus GG and Lactobacillus plantarum KU210152, the expression level increased by 1.42 times and 3.25 times, respectively. These results showed that CM derived from Lactobacillus plantarum KU210152 alleviated the decrease in BDNF and TH caused by H2O2.

[0166]

[0167] 3) Measurement of expression levels of apoptosis-related genes (Bax, Bcl-2) in human neuroblastoma SH-SY5Y cells induced by oxidative stress with hydrogen peroxide.

[0168] To measure the neuroprotective effect of strain-derived CM, after treating strain-derived CM and H2O2, the changes in the Bax gene, an apoptosis inducer, and the Bcl-2 gene, an apoptosis inhibitor, were measured by RT-PCR and expressed as the Bax / Bcl-2 ratio (see Fig. 10). In the positive control group in which nerve cells were treated only with H2O2, the Bax / Bcl-2 ratio increased 1.83-fold compared to the control group, but when treated with CM derived from Lactobacillus rhamnosus GG and Lactobacillus plantarum KU210152, the ratio decreased to 0.95-fold and 0.91-fold, respectively. These results confirm that CM derived from Lactobacillus plantarum KU210152 alleviates the apoptosis-induced effect caused by oxidative stress.

[0169]

[0170] 2-7. Measurement of Caspase-9 and Caspase-3 activity

[0171] Caspase activity was measured using a Caspase-9 assay kit (colorimetric) and a Caspase-3 assay kit (colorimetric). SH-SY5Y cells were cultured at 1X10 6The strain-derived CM was cultured in a 6-well plate at 10 cells / mL for 4 hours, and then treated with H2O2 for 6 hours. The cells were lysed using a cell lysis buffer, and the lysate was obtained by centrifugation at 10,000Xg for 1 minute. The protein of each lysed sample was quantified, and the lysate containing 100 μg of protein was diluted in the cell lysis buffer. 50 μL of 2X reaction buffer containing 10 mM DTT was added to 50 μL of the diluted solution. 5 μL of 4 mM LEHD-pNA substrate was added to confirm caspase-9, and 5 μL of 4 mM DEVD-pNA substrate was added to confirm caspase-3. After 2 hours of reaction at 37°C, the enzyme activity was confirmed by measuring the absorbance at 400 nm (see Figure 11).

[0172] In the positive control group treated with only H2O2 to the nerve cells, the activity of caspase-9 increased by 156.26% compared to the control group. Lactobacillus rhamnosus GG and CM derived from Lactobacillus plantarum KU210152 showed enzyme activities of 101.74% and 92.37%, respectively. The activity of caspase-3 was 173.37% in the positive control group. After treatment with Lactobacillus rhamnosus GG and CM derived from Lactobacillus plantarum KU210152, the activities were 116.86% and 99.55%, respectively. Through this, it can be confirmed that treatment with CM derived from Lactobacillus rhamnosus GG and Lactobacillus plantarum KU210152 strains exhibits a neuronal cell protective effect.

[0173]

[0174] Example 3: Experiment to confirm the effect of alleviating depression

[0175] 3-1. Experimental animals

[0176] To establish an animal model of restraint stress-induced depression for the screening of novel probiotics, we conducted a study using C57BL / 6 mice (WIKIM IACU 202140). Four-week-old, 14-17 g mice were purchased from Z-Bio Co., Ltd. (Gwangju, Korea). Experiments were conducted after a one-week acclimatization period. Fluoxetine (Sigma, MO, USA), the positive control used in the experiment, was suspended in phosphate-buffered saline (PBS) and administered at a dose of 20 mg / kg.

[0177] The experimental animals were divided into control group (PBS administration, n=10), restraint group (restraint + PBS administration, n=8), fluoxetine group (restraint + fluoxetine, n=8), and Lactobacillus plantarum KU210152 group (10 9 CFU / 200 μL, n=8) and administered orally. Fluoxetine (Sigma, MO, USA), the positive control group used in the experiment, was suspended in PBS and set at a concentration of 20 mg / kg.

[0178] Lactic acid bacteria and PBS were administered for 7 weeks, and restraint stress and fluoxetine were administered 5 days a week for 4–7 weeks until sacrifice (Fig. 1). Restraint stress was induced using a 50 mL conical tube, and depression was induced by restraining the mice for 4 hours per day (Fig. 1).

[0179]

[0180] 3-2. Weight changes in a depression model induced by restraint stress

[0181] Many studies have reported that restraint stress induces weight loss, which can be used to confirm the induction of depression. Depressed mice induced by restraint stress were weighed weekly after being placed in the cage (see Figure 19). Lactic acid bacteria and PBS were administered orally daily for four weeks, and from the fourth week, depression was induced through stress through daily restraint. Changes in body weight were observed from the fifth week, one week after restraint.

[0182] In patients with depression, weight loss is known to be caused by factors such as eating disorders and decreased social activities. In this experiment, the control group showed the highest weight change, followed by the positive control group, the fluoxetine group. In the 5th week, compared to the control group, no weight change was observed in the restraint stress groups and the Lactobacillus plantarum (L. plantarum) KU210152 administration group, except for the fluoxetine group. The weight gain in the control group indicates that depression was induced, and the alleviated weight change indicates that depression was alleviated.

[0183]

[0184] 3-3. Sucrose Preference Test (SPT)

[0185] SPT eliminated learning about the location of sucrose and water by providing 1% (w / v) sucrose and water in identical tubes at irregular intervals for 72 h. After 72 h, mice were intraperitoneally administered LPS and PBS in proportion to their body weight, and fasted for 24 h. The mice were separated into cages, one per cage. 1% (w / v) sucrose and water were provided for 4 h, with the tubes rotated every 2 h. The tubes were weighed before and after administration, and sucrose preference was measured using Equation 3.

[0186]

[0187] [Formula 3]

[0188] Sucrose preference (%) = Sucrose intake / (Water intake + Sucrose intake) Х100

[0189]

[0190] Through a sucrose preference test, it was confirmed that depression was induced by a decrease in sucrose preference due to restraint stress, and the sucrose preference of selected lactic acid bacteria was confirmed to have an effect in alleviating depression (see Figure 20).

[0191] The group that received restraint stress and PBS (Restraint) showed a significantly decreased preference for sucrose compared to the control group and fluoxetine group (p<0.05), and the preference for sucrose was confirmed to be high in the Lactobacillus plantarum KU210152 group.

[0192] Through these results, it was confirmed that depression was induced by restraint stress in the sugar preference test, and the depression alleviation effect was confirmed in the group administered the selected lactic acid bacteria, Lactobacillus plantarum KU210152.

[0193]

[0194] 3-4. Tail Suspension Test (TST)

[0195] The mice were moved to their cages one hour prior to the behavioral analysis test to acclimate them to the laboratory's lighting and environment. A climbstopper was attached to the mouse's tail, which was then taped 20-25 cm from the nose to the floor. Immobility was recorded for 6 minutes, and the total immobility time was calculated for 360 seconds.

[0196] In the TST test, the immobility time of animals was measured to confirm the induction of depression due to restraint stress and the depression-alleviating effect of the selected lactic acid bacteria. In the TST test, the group that received restraint stress and PBS (Restraint) showed a significantly higher immobility time than the control group and fluoxetine group (p<0.05), and there was no significant difference in immobility time between the control group and the group administered the selected lactic acid bacteria (see Figure 21).

[0197] The TST results showed that depression was induced by restraint stress, and there was no difference in immobility time between the control group and the positive control group, fluoxetine administration group, confirming that the selected probiotics were effective in alleviating depression.

[0198]

[0199] 3-5. Open Field Test (OFT)

[0200] The open field used was a closable box measuring 45 cm (l) X 45 cm (w) X 40 cm (h) (TSE Systems LTD, Germany), and the noise level inside the open field was maintained at 10 dB before the experiment. Mice were placed in the open field and filmed for 10 minutes to measure the time in the center, the time in the periphery, and the time spent looking around with both paws raised.

[0201] We measured the time spent in the center and the time spent in the periphery of the OFT to determine whether depression was induced by restraint stress, and confirmed the depression-alleviating effect of selected lactic acid bacteria.

[0202] The control group had the highest central dwell time, while the other groups subjected to restraint stress showed lower central dwell times compared to the control group. Compared to the control group, the group administered Lactobacillus plantarum KU210152 showed no significant difference, and the periphery dwell time did not differ significantly among the groups (see Figure 22).

[0203]

[0204] 3-6. Elevated plus maze test (EPM)

[0205] The EPM test is a behavioral analysis method for anxiety and depression symptoms. It measures the time and distance spent in the open and closed arms, and can be used as an indicator to confirm the induction of depression.

[0206] The EPM used in the analysis was a cross-shaped (+) maze made of black acrylic and installed 50 cm above the floor. Two of the four passages (25 cm long and 5 cm wide) facing each other were open, and the other two passages of equal size had walls 16 cm high. The central platform was 5 cm wide and 5 cm high, and 6 minutes of filming was conducted from the ceiling in the center of the maze for analysis.

[0207] The time spent in the open arm was significantly shorter in the depression-induced stress group compared to the control group. However, the group administered the selected probiotic, Lactobacillus plantarum KU210152, showed a slightly improved retention time in the open arm compared to the positive control group, fluoxetine.

[0208] Through these results, it was confirmed that depression was induced by restraint stress in the EPM test, and in the group administered with the selected lactic acid bacteria, Lactobacillus plantarum KU210152, there was no significant difference in the time spent in the open arm and the close arm, confirming the effect of alleviating depression (see Figure 23).

[0209]

[0210] 3-7. Confirmation of mRNA expression levels of depression-related genes in intestinal tissue

[0211] After sacrificing the mice, the small and large intestines were separated and the mRNA expression levels of tryptophan hydroxylase-1 (TPH-1), serotonin transporter (SERT), chromogranin A (ChgA), and 5-HT transporters (5HTRs) were investigated.

[0212] The tissue was transferred to a pre-filled bead tube (Lysing Matrix E, MP Biomedicals, CA, USA) and 1 mL of TRIzol reagent (Invitrogen, MA, USA) was added per 50-100 mg of tissue. The mixture was beaten twice for 40 seconds using a bead beater (BEADBLASTER 24, Benchmark Scientific, NJ, USA). The mixture was left to stand at room temperature for 5 minutes, 0.2 mL of chloroform per 1 mL of TRIzol was added, and centrifuged at 4°C and 12,000 rpm for 15 minutes. 0.5 mL of isopropanol was added to the supernatant, and centrifuged at 4°C and 12,000 rpm for 10 minutes. The supernatant was removed, and 1 mL of 75% (v / v) ethanol was added, followed by centrifugation for 5 minutes. After removing the supernatant and drying for 30 minutes to 1 hour, RNA was dissolved in 0.2-0.3 mL of nuclease-free water (Noble Bio, Gyeonggi, Korea) and used.

[0213] RNA concentration was measured using Nanodrop 2000 (Thermo Fisher Scientific, USA), and cDNA was synthesized using a cDNA synthesis kit (TOPscriptTM, Daejeon, Korea) using 1 ng of RNA. The synthesized cDNA was analyzed by real-time quantitative PCR (Bio-Rad CFX-96, CA, USA) using TOPreal qPCR 2Х premix (Enzynomics, Korea). Primer sequences are shown in Table 3.

[0214]

[0215] Gene name Sequence source Chromogranin AChgA_FAGGTCTCTTCCCCCAAGGCG (SEQ ID NO: 2) Xie et al. (2020)ChgA_RTCTGAAGCCATAGGCGCGGG(SEQ ID NO: 3)Tryptophan hydrolase-1Tph1_FAAGAAATTGGCCTGGCTTC(SEQ ID NO: 4)Tph1_RGTTTGCACAGCCCAAACTC(SEQ ID NO: 5)Serotonin transporterSERT_FTATCCAATGGGTACTCCGCAG(SEQ ID NO: 6)SERT_RCCGTTCCCCTTGGTGAATCT(SEQ ID NO: 7)5-HT receptor 2A5HTR2A_FCGAAGCCTCGAACTGGACAAT(SEQ ID NO: 8)5HTR2A_RCCGCAATGGTGAGAATAATCACG(SEQ ID NO: 9)5-HT receptor 45HTR4_FAGTTCCAACGAGGGTTTCAGG(SEQ ID NO: 10)5HTR4_RCAGCAGGTTGCCCAAGATG(SEQ ID NO: 11)5-HT receptor 75HTR7_FTAGCCTACTCCAGTGCCAGT (SEQ ID NO: 12) 5HTR7_RTCCCACAGTGGTCACAGTTT (SEQ ID NO: 13) Glyceraldehyde 3-phosphate dehydrogenase GAPDH_FGGTGAAGGTCGGTGTGAACG (SEQ ID NO: 14) GAPDH_RCTCGCTCCTGGAAGATGGTG (SEQ ID NO: 15)

[0216] In the small intestine tissue, the group that consumed Lactobacillus plantarum KU210152 showed the highest expression level of SERT mRNA, and showed a significant difference from the restraint group, which showed the lowest expression level. In the large intestine tissue, the expression level of SERT was similar in all groups, and no significant results were confirmed (see Figure 24).

[0217] In the small intestine tissue, the expression level of TPH-1 mRNA was significantly higher in the Lactobacillus plantarum KU210152 group compared to the restraint group, similar to the results of the SERT expression level. In the large intestine tissue, the expression level of TPH-1 was measured to be the highest in the control group, and the expression level of the Lactobacillus plantarum KU210152 group did not show a significant difference compared to the control group, and the expression level of the Lactobacillus plantarum KU210152 group was significantly higher compared to the restraint group (see Fig. 25).

[0218] The selected strain, Lactobacillus plantarum KU210152, showed high mRNA expression levels of SERT and TPH-1 in the intestinal tissue of mice induced with depression. These results suggest that the two selected strains are effective in alleviating depression by influencing the mechanisms of serotonin synthesis and uptake.

[0219]

[0220] 3-8. Confirmation of mRNA expression levels of depression-related genes in brain tissue

[0221] Brain-derived neurotrophic factor (BDNF) is a neurotrophic factor that plays an important role in the maintenance and development of the nervous system, such as inducing growth and differentiation during neural development. BDNF is related to the pathophysiological mechanism of depression. Brain tissue was obtained, and the expression level was analyzed using the BDNF primer sequences F-CAC TTT TGA GCA CGT CAT CGA A and R-CAC CCG GGA AGT GTA CAA GTC-R for mRNA expression.

[0222] As a result of measuring the mRNA expression levels of HTR2A and SERT in the prefrontal cortex tissue, the mRNA expression levels of HTR2A were higher in the control group, fluoxetine group, and Lactobacillus plantarum KU210152 group than in other groups, but there was no significant difference as the expression pattern was similar to that of SERT (see Figure 26).

[0223] SERT expression was highest in the fluoxetine group, while the control group and Lactobacillus plantarum KU210152 group showed similar results. This result was similar to the results of SERT mRNA expression in intestinal tissue, but no significant difference was observed. HTR2A, a serotonin receptor, is a serotonin receptor in brain tissue and is frequently analyzed in depression research.

[0224] [Revised 22.08.2024 under Rule 91] The selected strain, Lactobacillus plantarum KU210152, was found to have high mRNA expression levels of SERT and HTR2A in the prefrontal cortex of depressed mice. These results suggest that Lactobacillus plantarum KU210152 influences the mechanisms of serotonin synthesis and uptake.

[0225]

[0226] 3-9. Measurement of serum corticosterone

[0227]

[0228] When the body is exposed to stress, the hypothalamic-pituitary-adrenal gland axis (HPA-axis), part of the neuroendocrine system that regulates the response to stress and various physiological activities, is activated, causing corticosterone levels in the adrenal cortex to increase.

[0229] For analysis of serum corticosterone, blood samples were collected at the time of sacrifice of mice, and serum was separated by centrifugation. The amount of corticosterone in the serum was measured using an ELISA assay (MyBioSource, Inc., CA, USA).

[0230] Serum corticosterone levels in mice induced with depression by restraint stress were lower in the control and fluoxetine groups, suggesting that the mice experienced less stress than the restraint group. Compared to the control group, the restraint group and the group administered Lactobacillus brevis KU15152 showed significantly higher serum corticosterone levels. However, the group administered Lactobacillus plantarum KU210152 showed no significant difference from the control group (Fig. 27).

[0231] Through the above experiment, it was confirmed that depression was induced by restraint stress, and in the group administered Lactobacillus plantarum KU210152, there was no significant difference in the serum corticosterone content between the control group and the fluoxetine group, confirming the effect of alleviating depression and stress.

[0232]

[0233] 3-10. Microbiome Analysis Related to Depression

[0234]

[0235] In cases of depression, the function of γ-aminobutyric acid (GABA) is likely to be altered, and it is known that the Gram-negative bacterium Bacteroides fragilis activates the GABA production pathway, and as Bacteroides fragilis increases, brain signals related to depression decrease (Nat Microbiol. 2019 March; 4(3): 396-403.). To confirm changes in the genus Bacteroides, we analyzed the microbiome from feces obtained through a mouse model of depression.

[0236]

[0237] Fluoxetine intake group KU15152 intake group KU200793 intake group KU210152 intake group Before intake 29.91% 32.07% 29.86% 27.2% After intake 33.27% 34.19% 39.07% 44.8% Significant difference 3.36 2.12 9.21 17.6

[0238] In the results of this microbial community, the increase in the Bacteroides genus was minimal or absent in the normal group and the depression-induced group, but compared to the entire microbial community, the Lactobacillus plantarum KU210152 intake group increased by 17.6%, confirming the possibility of improving depression in all test groups that consumed lactic acid bacteria, and in particular, it is judged that the improvement effect will be the greatest in the Lactobacillus plantarum KU210152 intake group (Fig. 28).

[0239]

[0240] 3-11. Short-chain fatty acids (SCFAs) analysis

[0241]

[0242] Short-chain fatty acids (SCFAs) are small organic compounds produced through anaerobic fermentation of carbohydrates, which serve as food for bacteria in the cecum and colon. They are associated with digestive, immune, and central nervous system functions. The most abundant SCFAs are acetic acid, propionic acid, and butyric acid, and higher levels of these fatty acids have been reported to be associated with improved depression (Gen Psychiatr. 2024 Feb 19;37(1):e101374.).

[0243]

[0244] During the multi-omics analysis, short-chain fatty acids (SCFAs) were analyzed from a total of 49 cecum samples by the Korea Institute of Science and Technology. Acetic acid, propionic acid, and butyric acid were synthesized more in the Lactobacillus brevis KU15152 intake group than in the restraint group.

[0245] Sample SCFAs concentration (μmol / g) Acetic acid Propionate Butyric acid Control group 65.3 110.0 465.97 Restraint group 62.4 17.6 60.83 Fluoxetine group 46.4 55.4 85.31 L. brevis KU1515251.6 37.4 838.56 L. plantarum KU21015267.3 06.8 0 53.96

[0246] 3-12. Calprotectin analysis

[0247]

[0248] Calprotectin is an inflammatory protein present in the cytoplasm of neutrophils, macrophages, and monocytes, and lowering the level of calprotectin in the intestine is known to alleviate inflammatory bowel disease and depression (Medicina (Kaunas). 2023 Jul; 59(7): 1240).

[0249] The control group, restraint group, fluoxetine group, Lactobacillus brevis KU15152 intake group, Lactobacillus buchneri KU200793 intake group, and Lactobacillus plantarum KU210152 group were orally administered to mice.

[0250] As a result of the experiment, it was confirmed that the calprotectin level decreased by 0.048 ng / g from 0.170 ng / g to 0.122 ng / g in the Lactobacillus plantarum KU210152 intake group (Fig. 29). Therefore, it can be seen that depression was improved in the Lactobacillus plantarum KU210152 intake group.

[0251]

[0252] 3-13. Whole genome analysis

[0253]

[0254] The chromosome of Lactobacillus plantarum KU210152 strain is circular, and the entire nucleotide sequence of the circular chromosome was reconstructed through genome sequencing. The analysis identified a peroxiredoxin gene associated with antioxidant activity, which has been implicated in cognitive function and antidepressant activity. Furthermore, the gene for glutamate decarboxylase (GAD) was identified. GAD is a key enzyme in GABA synthesis, suggesting that it may influence GABA production, which is associated with brain health.

[0255] [Correction pursuant to Rule 91, August 22, 2024]

[0256] 3-14. Probiotic Safety

[0257]

[0258] According to the safety analysis results of probiotics according to the safety evaluation guide for functional raw materials for health functional foods, the Lactobacillus plantarum KU210152 strain was confirmed to be compliant with the Ministry of Food and Drug Safety guidelines.

[0259] [Correction pursuant to Rule 91, August 22, 2024]

[0260] As confirmed in the above examples, the present invention confirmed the probiotic properties of Lactobacillus plantarum KU210152, a novel strain isolated from kimchi, through confirmation of acid resistance, bile resistance, intestinal adhesion ability, and enzyme production ability, the neuroprotective effect in a neuronal cell line, and the depression-alleviating effect through an animal model induced by restraint stress depression.

[0261]

[0262] Although the embodiments of the present invention have been described above, those skilled in the art will understand that the present invention can be implemented in other specific forms without changing the technical spirit or essential characteristics thereof. Therefore, it should be understood that the embodiments described above are exemplary in all respects and not restrictive.

[0263]

[0264] [Accession number]

[0265] Name of depositor: Korea Center for Microbiological Conservation (KCCM)

[0266] Address of the depository: 3F, Yulim Building, 45 Hongje-nae 2-ga-gil, Seodaemun-gu, Seoul, Republic of Korea 03641

[0267] Accession number: KCCM13371P

[0268] Date of acceptance: 20230725

[0269]

[0270] The present invention is an invention carried out through the following tasks.

[0271]

[0272] [National Research and Development Project Supporting This Invention]

[0273] [Project ID]1545027078

[0274] [Assignment Number]321035053SB010

[0275] [Ministry Name] Ministry of Agriculture, Food and Rural Affairs

[0276] [Name of project management (specialized) organization] National Institute of Agricultural and Food Technology Planning and Evaluation

[0277] [Research Project Name] Development of High Value-Added Food Technology

[0278] [Research Project Name] Microbiome-targeted probiotic discovery and materialization technology

[0279] development

[0280] [Contribution rate] 1 / 1

[0281] [Name of the project performing organization] Konkuk University Industry-Academic Cooperation Foundation

[0282] Research Period: April 1, 2021 - December 31, 2025

Claims

1. A novel Lactobacillus plantarum KU210152 strain comprising a DNA sequence encoding 16S rRNA represented by the base sequence of sequence number 1.

2. A pharmaceutical composition for improving, preventing or treating neurological diseases, comprising the novel Lactobacillus plantarum KU210152 strain deposited under accession number KCCM13371P, a culture thereof or a killed cell thereof.

3. In the second paragraph, the neurological disease is a degenerative neurological disease or mental disorder caused by nerve cell death, pharmaceutical composition.

4. In the third paragraph, the degenerative neurological disease is at least one selected from the group consisting of Parkinson's disease, Alzheimer's disease, Lou Gehrig's disease, Huntington's disease, amyotrophic lateral sclerosis, multiple sclerosis, brain dysfunction due to immune system abnormality, progressive neurodegenerative disease, metabolic brain disease, Niemann-Pick disease, and dementia due to cerebral ischemia and cerebral hemorrhage, and the mental disorder is at least one selected from the group consisting of anxiety, depression, insomnia, obsessive-compulsive disorder, panic disorder, intellectual disability, stress, memory impairment, and cognitive impairment. A pharmaceutical composition.

5. A pharmaceutical composition according to claim 2, wherein the neuronal cell death is induced by oxidative stress.

6. A pharmaceutical composition according to claim 2, wherein the strain comprises a DNA sequence encoding 16S rRNA represented by the base sequence of sequence number 1.

7. In the second paragraph, the composition comprises 1X10 of the strain, a culture thereof, or a dead cell thereof. 6 CFU / mL to 1X10 11 A pharmaceutical composition comprising a concentration of CFU / mL.

8. In the second paragraph, the composition is a pharmaceutical composition for improving, preventing or treating a neurological disease, which further has one or more characteristics selected from the group consisting of the following i) to vi): i) Acid resistance, bile resistance and intestinal adhesion; ⅱ) Production of β-glucosidase or β-galactosidase; ⅲ) Reduced ROS production; ⅳ) Increased expression of BDNF and TH; ⅴ) Increased mRNA expression of TPH-1, SERT, and HTR2A; ⅵ) Increased sugar preference; vii) maintenance of serum corticosterone; ⅷ) Increase in strains of the genus Bacteroides; and ⅸ) Increased synthesis of acetic acid, propionic acid, and butyric acid.

9. A food composition for preventing or improving neurological diseases, comprising a novel Lactobacillus plantarum KU210152 strain comprising a DNA sequence encoding 16S rRNA represented by the base sequence of sequence number 1 deposited under accession number KCCM13371P, a culture thereof, or a killed cell thereof.

10. In the 9th paragraph, the neurological disease is a degenerative neurological disease or mental disorder caused by nerve cell death, food composition.

11. In the 10th paragraph, the degenerative neurological disease is at least one selected from the group consisting of Parkinson's disease, Alzheimer's disease, Lou Gehrig's disease, Huntington's disease, amyotrophic lateral sclerosis, multiple sclerosis, brain dysfunction due to immune system abnormality, progressive neurodegenerative disease, metabolic brain disease, Niemann-Pick disease, and dementia due to cerebral ischemia and cerebral hemorrhage, and the mental disorder is at least one selected from the group consisting of anxiety, depression, insomnia, obsessive-compulsive disorder, panic disorder, intellectual disability, stress, memory impairment, and cognitive impairment. A food composition.

12. An animal feed additive composition for preventing or improving neurological diseases, comprising a novel Lactobacillus plantarum KU210152 strain comprising a DNA sequence encoding 16S rRNA represented by the base sequence of sequence number 1 deposited under accession number KCCM13371P, a culture thereof, or a killed cell thereof.

13. In the 12th paragraph, the neurological disease is a degenerative neurological disease or mental disorder caused by nerve cell death, and an animal feed additive composition.

14. An animal feed additive composition according to claim 13, wherein the degenerative neurological disease is at least one selected from the group consisting of Parkinson's disease, Alzheimer's disease, Lou Gehrig's disease, Huntington's disease, amyotrophic lateral sclerosis, multiple sclerosis, brain dysfunction due to immune system abnormalities, progressive neurodegenerative disease, metabolic encephalopathy, Niemann-Pick disease, and dementia due to cerebral ischemia and cerebral hemorrhage, and the mental disorder is at least one selected from the group consisting of anxiety, depression, insomnia, obsessive-compulsive disorder, panic disorder, intellectual disability, stress, memory impairment, and cognitive impairment.

Images