Targeted relocalization compounds and methods of use thereof

Abstract

Disclosed herein are bifunctional compounds that facilitate relocalization of a target protein, e.g., between subcellular compartments and / or organelles. Also disclosed herein are compositions comprising the compounds and methods of using the compounds, e.g., in treating disorders such as cancer and neurodegenerative diseases.

Description

[0001] TARGETED RELOCALIZATION COMPOUNDS AND METHODS OF USE THEREOF

[0002] TECHNICAL FIELD

[0003] Disclosed herein are bifunctional compounds that facilitate relocalization of a target protein, e.g., between subcellular compartments and / or organelles. Also disclosed herein are compositions comprising the compounds and methods of using the compounds, e.g., in treating disorders such as cancer and neurodegenerative diseases.

[0004] CROSS-REFERENCE TO RELATED APPLICATIONS

[0005] This application claims the benefit of U.S. Provisional Application No. 63 / 587,903, filed October 4, 2023, the content of which is herein incorporated by reference in its entirety.

[0006] SEQUENCE LISING STATEMENT

[0007] The content of the electronic sequence listing titled STDU2_42456_601_SequenceListing.xml (Size: 120,650 bytes; and Date of Creation: October 3, 2024) is herein incorporated by reference in its entirety.

[0008] BACKGROUND

[0009] Spatiotemporal control of subcellular protein localization creates a coordinated system to regulate cellular physiology. Aberrant trafficking and localization of proteins underlies numerous diseases, including cancers, neurodegenerative diseases, and genetic disorders. Mutations which reroute tumor suppressor proteins from the nucleus to the cytoplasm are common mechanisms for promoting oncogenesis. Translocation of RNA-binding proteins such as TDP43 and FUS to the cytoplasm is a hallmark of amyotrophic lateral sclerosis (ALS) with numerous deleterious phenotypic consequences, including increased cytoplasmic aggregates. Correcting these phenotypes through selective inhibition of protein trafficking would present several challenges given the conserved nature of nuclear export and import machinery. The global toxicity of nuclear import / export inhibition has restricted the application of molecules which target these pathways. Yet, the clinical success of global nuclear export inhibitors such as Selinexor in certain contexts suggests that targeted approaches to control protein trafficking could find widespread use to reprogram protein localization. SUMMARY

[0010] Disclosed herein is a compound of formula (I):

[0011] SP-L-TP (I) or a pharmaceutically acceptable salt thereof, wherein:

[0012] SP is a moiety that binds to a shuttle protein;

[0013] L is a linker; and

[0014] TP is a moiety that binds to a target protein; wherein the compound promotes relocalization of the target protein from one subcellular compartment or organelle to another subcellular compartment or organelle.

[0015] In some embodiments, the compound promotes translocation of the target protein from the cytoplasm to the nucleus. In some embodiments, the shuttle protein comprises one or more nuclear localization sequence (NLS). In some embodiments, each of the one or more nuclear localization sequence (NLS) comprises an amino acid sequence of: K-K / R-X-K / R, wherein X can be any amino acid; (R / P)X¥KR( K / R)(ADE) (SEQ ID NOs: 1-4) wherein (ADE) represents any amino acid except for Asp or Glu, KRX(W / F / Y)XXAF (SEQ ID NOs: 5-7); and LGKR(K / R)(W / F / Y) (SEQ ID NO: 8-9), or a bipartite sequence thereof.

[0016] In some embodiments, the shuttle protein is a nuclear hormone receptor. In some embodiments, the nuclear hormone receptor is an estrogen receptor (e.g., estrogen receptor alpha). In some embodiments, the nuclear hormone receptor is glucocorticoid receptor.

[0017] In some embodiments, the compound promotes translocation of the target protein from the nucleus to the cytoplasm. In some embodiments, the shuttle protein comprises one or more nuclear export sequence (NES). In some embodiments, each of the one or more nuclear export sequence(NES) comprises an amino acid sequence selected from: Y1-XXX-Y2-XX-Y3-X-Y4; Y1-XX-Y2-XX-Y3-X-Y4; Y1-XXX-Y2-XXX-Y3-X-Y4; Y1-XX-Y2-XXX-Y3-X-Y4; Yl-X- Y2-XX-Y3-X-Y4; Y1-XX-Y2-XXX-Y3-XX-Y4, wherein X is any amino acid and each Y is individually selected from: L, V, 1, F, M, A, C, T, and W, wherein each NES can only have one of A, C, T, or W.

[0018] In some embodiments, SP is a moiety selected from:

[0019]

[0020] In some embodiments, the target protein is an RNA-binding protein, a transcriptional regulator, or a tumor suppressor protein.

[0021] In some embodiments, TP is a moiety selected from:

[0022] In some embodiments, L is a direct bond or comprises any combination of -CH2-, - CH=CH-, -C=C-, -O-, -NR'-, -BR'-, -S-, -C(O)-, -C(NR')-, -S(O)-, -S(O)2-, arylene, heteroarylene, cycloalkylene, and heterocyclylene moieties, wherein R' is selected from hydrogen and C1-C6alkyl. In some embodiments, L comprises any combination of the following moieties: wherein p is 1 , 2, 3, 4, 5, or 6; and q is 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, or 16. Tn some embodiments, L has a formula selected from:

[0023] In some embodiments, the compound is selected from:

[0024]

[0025] and pharmaceutically acceptable salts thereof.

[0026] Also disclosed herein are compositions comprising a compound as disclosed herein or a pharmaceutically acceptable salt thereof.

[0027] Further disclosed herein are methods for relocalizing a target protein in a cell comprising introducing to the cell a compound as disclosed herein or a pharmaceutically acceptable salt thereof. In some embodiments, the relocalizing comprises translocating the target protein into the nucleus. In some embodiments, the relocalizing comprises translocating the target protein out of the nucleus.

[0028] In some embodiments, the target protein is a RNA binding protein, a kinase, a transcriptional regulator, a nuclear hormone receptor, a phosphatase, an E3 ligase, a deubiquitinase, a bromodomain-containing protein (Brd), or a caspase, or a variant or disease- causing mutant thereof.

[0029] In some embodiments, the target protein comprises SRY, SHOX, TRPS1, ARX, FOXP2, AIRE, RPS19, AGT, hsMOK2, SHOC2, rhodopsin, AVPR2, ATP7B, ABCA1, Tau, TARDBP, FUS, FOXO, p53, Breast Cancer Gene 1 (BRCA1), retinoblastoma protein (Rb), Sirtuin 1 (SIRT1), tumor- specific cyclin E isoforms, V-ERB-B2 erythroblastic leukemia viral oncogene (ErbB3), Mucin-13, inhibitor of growth family, member 1 (INGl / p33), SET-CAN fusion protein, Mucin- 1 C-terminal (MUC1-C), KL-6 mucin, epidermal growth factor receptor (EGFR), androgen receptor, nuclear receptor corepressor (N-CoR), nucleophosmin (NPM1), β-catenin, Adenomatous polyposis coli (APC), p27, p44 / WDR77, E-cadherin, ERM binding protein 50 (EBP50), epithelial cell adhesion molecule (EPCAM), B7-H1, B7-H3, B7-H4, cyclin DI, vascular endothelial growth factor receptor (VEGFR), VEGFR-2, serotonin receptor 1A (5- HTR1A), mucin 1 (MUC1), human epidermal growth factor receptor 2 (HER2), homeobox transcription factor Nanog, mammary serine protease inhibitor (MASPIN), transcriptional adaptor 3 (AD A3), cytokinc-induccd apoptosis inhibitor 1 (CIPIN1), NME.NM23 nucleoside diphosphate kinase 1 (NME 1, NME23), cyclin B2, TDP43, FUS, SOD1, NMNAT1, TMEM192, KRAS, or a variant or disease-causing mutant thereof. In select embodiments, the target protein comprises SMARCB1, TDP43, FUS, F0X03A, FKBP12.

[0030] In some embodiments, the cell is in vitro or ex vivo. In some embodiments, the cell is in a subject. In some embodiments, the method comprises administering the compound or a composition thereof to the subject. In some embodiments, the subject has a disease or disorder associated with a mislocalized protein. In some embodiments, the disease or disorder is cancer or a neurodegenerative disorder.

[0031] In some embodiments, the methods further comprise introducing to the cell a shuttle protein or a nucleic acid encoding thereof. In some embodiments, the methods further comprise upregulating the expression or function of an endogenous shuttle protein in the cell.

[0032] BRIEF DESCRIPTION OF THE DRAWINGS

[0033] FIGS. 1A-1J show the development of a quantitative cell-by-cell analysis pipeline and application to targeted protein relocalization. FIG. 1A, Subcellular nucleocytoplasmic target localization control via protein transport coupling by Targeted Relocalization Activating Molecules (TRAMs). FIG. IB, Model bifunctional molecule which engages ecDHFR and FKBP12F36Vdomains. FIG. 1C, Viral constructs for generating stable cell lines to study localization control of NMNAT1. NES = HIV-1 REV NES (LPPLERLTL; SEQ ID NO: 10). FIG. ID, Co-immunoprecipitation of Flag-tagged NMNAT1 with mCherry shuttle protein in the presence of 1. 1: input F: flowthrough E: eluate. FIG. IE, Representative live-cell images for NMNAT1 relocalization driven by 1 in HeLa derived Export Line A (EL- A) after 3-hour treatment. FIG. IF, Computational pipeline for cell-by-cell analysis of dual protein translocation. FIG. 1G, TRAM 1-coupled nuclear export dose response derived using analysis pipeline after 3- hour treatment. FIG. 1H, Impact of relative shuttle :target protein ratio on nuclear export of NMNAT1. FIG. II, Representative nuclear import of a diffuse protein driven by NMNAT1 after 3-hour treatment with 1. FIG. 1J, Impact of relative stoichiometry on nuclear import of mCherry. Images in FIGS. IE and II are representative of three biological replicates. Data in FIGS. 1G, 1H, and 1J are mean ± s.d. of three independent experiments. Immunoblots in FIG. ID are representative of three independent experiments. Scale bars are 20 pm. P values in FIG. 1 G were determined by one-way ANOVA comparing each condition to DMSO.

[0034] FIGS. 2A-2N show nuclear hormone receptors are shuttles for cytoplasmic and diffuse proteins and provide a basis for quantitative assessment of target relocalization susceptibility. FIG. 2A, Nuclear hormone receptor (ERα, GR) hijacking for import of target proteins. FIG. 2B, TRAMs engaging GR, ERα and FKBP12F36Vor FKBP12. FIG. 2C, Combinatorial pairing of GR or ERa with NESs, and HIV-1 REV NES with NLSs. Quantitation of the mean percentage nuclear fluorophore in HeLa cells expressing ERa (FIG. 2D) or GR (FIG. 2E) and the NES sequences at different doses of 5 or 4 respectively after 3 hours. FIG. 2F, Quantitation of the mean percentage nuclear fluorophore in HeLa cells expressing HIV-1 REV NES and the respective NLS sequences at different doses of 1 after 3 hours. FIG. 2G, Sigmoidal best fit curves derived from single-cell plots of percentage nuclear fluorophore against relative GFP:mCherry ratio. Comparison of target NES-bearing protein relocalization (HIV-1 REV NES (LLPLERLTL; SEQ ID NO: 10); MEK1 NES (ALQKKLEELELDE ; SEQ ID NO: 65); P53 NES (FRELNEALEL; SEQ ID NO: 66); IKBOI NES (MVKELQEIRL ; SEQ ID NO: 67)) into the nucleus by GR or ERa with 100 nM 4 or 5 after a 3 hours. DMSO treatment is plotted as a dotted line. FIG. 2H, Best fit curves as in m comparing targets for each shuttle. FIG. 21, Analysis of overexpressed GR localization across MEK1 and HIV-1 REV NES. FIG. 2J, Comparison of NLS-containing target protein relocalization into the nucleus by HIV-1 REV NES (HIV-1 REV NES (LLPLERLTL; SEQ ID NO: 10)) at the optimal concentrations of 1 after 3 hours (100 nM for SV40, NMNAT1, 10 nM for NPM1, P53). FIGS. 2K and 2M, Relocalizability score of the target proteins (columns) when partnered with the respective shuttle proteins (rows). FIGS. 2L and 2N, Localization score of target proteins (columns) when partnered with the shuttle proteins (rows). For FIGS. 2H, 21, 2J, DMSO treatment values are shown as a dashed line of the respective color. Images in FIG. 2D are representative of three biological replicates. Data in FIGS. 2D-2F are mean ± s.d. of three independent experiments. Scale bars are 20 pm. P values in FIGS. 2D-2F were determined by two-way ANOVA with Dunnett’s post hoc test comparing each condition to DMSO within each protein pairing.

[0035] FIGS . 3 A-3L show targeted relocalization can move mutant proteins into nuclei and out of stress granules. FIG. 3A, Genetic constructs for stable incorporation. FIG. 3B, Representative images of HeLa cells stably expressing target proteins SMARCB 1Q318X, TDP43DNLS= TDP43(K82A / R83A / K84A), or FUSR495Xand shuttle protein ERa under an inducible promoter after 3- hour treatment with 5. FIG. 3C, Representative violin plots of population shifts in percentage nuclear target protein upon treatment with 5 for 3 hours. FIG. 3D, Best fit curves derived from single cell plots of percentage nuclear mCherry against GFP:mCherry. FIG. 3E, Relocalizability and localization strengths calculated for SMARCB1Q318X, TDP43DNLS, or FUSR495Xusing ERa as a shuttle protein. FIG. 3F, Schematic for ERa-induced relocalization of FUSR495Xfrom stress granules. FIG. 3G, Experimental workflow for cells pre-treated with NaAsCh for an hour to induce stress granule formation prior to relocalization via TRAM treatment. FIG. 3H, Timelapse live-cell imaging snapshots of FUSR495Xextraction from granules after treatment with 5. FIG. 31, Representative fixed-cell immunofluorescent images of stress granule marker G3BP1 and mCherry-FUSR495xafter treatment with 5 or control compounds. FIG. 3J, Quantification of stress granules in cells after treatment with 5 or control compounds. FIG. 3K, Comparison of mCherry- FUSR495Xpositive puncta in cells treated with bifunctional molecule 5 or control molecules. FIG. 3E, Comparison of G3BP1 -positive puncta in cells treated with bifunctional molecule 5 or control molecules. Images in FIGS. 3B and 3H are representative of three biological replicates. Images in FIG. 31 are representative of two biological replicates. Three fields of view totaling a minimum of 40 cells per condition per repeat were used to generate mean values for FIGS. 3J- 3E. Data in FIGS. 3J-3E is mean ± s.d. of three independent experiments. Violin plots in FIG. 3C are representative of three independent experiments. Scale bars are 20 pm. P values in FIG. 3J were determined by two-way ANOVA with Dunnett’s post hoc test comparing each dataset to its relative DMSO control. P values in FIGS. 3K-3E were determined by unpaired two-tailed t-tests.

[0036] FIGS. 4A-4I show endogenous targets are susceptible to relocalization with TRAMs that engage endogenous shuttles. FIG.4A, Bifunctional molecules which engage METAP2 or PARP1 and FKBP12F36Vor FKBP12. FIG.4B, Representative live-cell images of FKBP12F36Vnuclear export when treated with 11 or unlinked warhead controls for 3 hours. Dose response curve for percentage nuclear FKBP12F36Vafter a 3-hour treatment with 11. FIG.4C, Representative live- cell images of FKBP12F36Vnuclear import when treated with 12 or unlinked warhead controls for 3 hours. Dose response curve for percentage nuclear FKBP12F36Vafter a 3-hour treatment with 12. FIG.4D, Representative live-cell images of PRMT9 knock-in HEK293T cells treated for 24 hours with 11. FIG.4E, Dose response curve for percentage nuclear PRMT9 after a 24-hour treatment with 11. FIG.4F, Representative live-cell images of SOS1 knock-in HEK293T cells treated for 24 hours with 12. FIG.4G, Dose response curve for percentage nuclear SOS1 after a 24-hour treatment with 12. FIG.4H, Representative live-cell images of FKBP12 knock-in HEK293T cells treated for 24 hours with 13. FIG. 41, Dose response curve for percentage nuclear FKBP12 after a 24-hour treatment with 13. Images in FIGS.4B-4D, 4F and 4H, are representative of three biological replicates. Data in FIGS. 4B, 4C, 4E, 4G, 41 are mean ± s.d. of three independent experiments. P values in FIGS. 4B, 4C, 4E, 4G, 41 were determined by one- way ANOVA with Dunnett’s post hoc test comparing each condition to the DMSO control. Scale bars are 20 pm.

[0037] FIGS. 5A-5F show targeted relocalization of NMNAT1 can protect against axon injury. FIG. 5A, Schematic for DRG neuron harvesting, transduction of model proteins via AAV, small molecule treatment and axotomy. FIG. 5B, Constructs delivered by AAV to study the gain-of- function potential for mNMNATl relocalization in neurons, and definition of labels for neuronal imaging. GAP43at is the 20 amino acid dipalmitoylation domain (MLCCMRRTKQVEKNDEDQKI; SEQ ID NO: 11) found at the N terminus of growth- associated protein-43. FIG. 5C, Representative live-cell images of mNMNATl in primary DRG neurons when treated with 1 or control molecules. FIG. 5D, Representative live-cell images of axonal-tagged protein in axons and axon termini after exposure to 1 for 24 hours followed by axotomy to induce degeneration. mRuby3 signal was used to monitor degeneration across treated neurons. Axontag = GAP43at-mRuby3-ecDHFR. FIG. 5E, Quantification of axonal degeneration over time in the axon. FIG. 5F, Quantification of axonal degeneration at 72 h in the axon termini. Images in FIGS. 5C-5D are representative of neurons harvested from 4 embryos. For the plots in FIG. 5E, 3 replicates each from 4 embryos were combined for DMSO and 1 nM 1, for the 1 nM 2 + InM 3 condition, 3 replicates each from 2 embryos were combined. For plots in FIG. 5F, a total of 6 replicates derived from 4 different embryos were combined for the DMSO and 1 nM 1 treatment data, and a total of 4 replicates derived 2 different embryos were combined for the InM 2 + InM 3 condition. Data in FIGS. 5E-5F are mean ± s.e.m. P values in FIGS. 5E-5F were determined by two-way ANOVA with Tukey’s post hoc test comparing the 1 nM treatment of 1 to the DMSO (purple) or the unlinked warhead control (green) at each time point. Scale bars are 20 pm.

[0038] FIGS. 6A-6K show examination of NMNAT1 export cell lines. FIG. 6A, Unlinked warhead controls for 1. 2: trimethoprim (TMP), binds EcDHFR, 3: binds FKBP12F36V. la, TRAM which engages EcDHFR and FKBP12F36Vcontaining a (PEG)3 linker between the warheads. FIG. 6B, Localization of either protein upon treatment of EL-A with unlinked warheads 2 and 3. FIG. 6C, Comparison of the relative mCherry / GFP median fluorescence intensity ratio between the three isolated clonal export lines (EL-A-C). FIG. 6D, Ability of three NMNAT 1 export lines exhibiting different relative export shuttle (mCherry) to NMNAT 1 (GFP) ratios to translocate NMNAT 1 from the nucleus promoted by 1 or inhibited by leptomycin B (LMB) after 3 -hour treatment. FIG. 6E, Representative live-cell images for NMNAT 1 relocalization treated with 1 or control molecules, or 1 and leptomycin-B (LMB) in Export Line A (EL-A) after 3 h. FIG. 6F, Representative live-cell images for NMNAT1 relocalization treated with 1 or 1 and leptomycin-B (LMB) in Export Line B (EL-B) after 3 h. FIG. 6G, Representative live-cell images for NMNAT1 relocalization treated with 1, or 1 and leptomycin-B (LMB) in Export Line C (EL-C) after 3 h. Levels of mCherry FIG. 6H, and GFP FIG. 61, after treatment with 1 for 3 h across four isolated export cell lines with varying nuclear and cytoplasmic protein expression levels. FIG. 6J, Representative live-cell images for NMNAT1 relocalization with export line EL-A treated with varying concentrations of la. FIG. 6K, Dose response curve of NMNAT 1 and NES localization for EL-A in response to treatment with la. MFI: Median fluorescence intensity. Images in FIGS. 6E-6G, 6J are representative of three biological replicates. Data in FIG. 6B-6D, 61, 6K are mean ± s.d. of three independent experiments. Scale bars are 20 pm. P values in FIG. 6B were determined by unpaired two-tailed t-tests comparing treatment to the DMSO control. NMNAT1 = FKBP12F36V-GFP-NMNAT1 , NES = mCherry- ecDHFR-NES(HIV-l REV) P values in FIGS. 6D, 6K were determined by one-way ANOVA with Dunnett’s post hoc test comparing each condition to the DMSO control. P values in FIG. 6H, 61 were determined by two-way ANOVA with Sidak post hoc test comparing the treated condition to the DMSO control for each line. Hoechst stains the nucleus.

[0039] FIGS. 7A-7D are illustrations of gating and segmentation pictures automatically generated from analysis pipeline applied to three different cell types. FIG. 7A, Imaging analysis pipeline applied on HeLa cells. Gating histograms generated with the set bounds indicated. Masks for nuclear and cytoplasm areas overlay ed onto respective fluorophore images. Cytoplasm areas are circumferentially grown from nuclei masks retaining the relative size between the masks. FIG. 7B, Imaging analysis pipeline applied to HEK293T cells. Masks for nuclear and cytoplasm areas overlayed onto respective fluorophore images, with segmentation of highly confluent cells and gating out of dead cells (high nuclear stain over a small area) and debris. FTG. 7C, Representative live-cell images for NMNAT1 rclocalization in EL-A treated with 1 or control molecules in cells seeded at high (0.04 x 106cells) and low density (0.01 x 106cells). FIG. 7D, Quantification of nuclear GFP and mCherry from c. Images in c are representative of three biological replicates. Data in FIG. 7D are mean ± s.d. of three independent experiments. Scale bars are 20 pm. P values in FIG. 7D were determined by one- way ANOVA with Dunnett’s post hoc test comparing each condition to the DMSO control. Hoechst stains the nucleus.

[0040] FIGS. 8A-8I show NMNAT1 can be utilized as a nuclear import shuttle. FIG. 8A, Representative live-cell images of clonal import line A (IL-A) upon treatment with 1 or small molecule controls for 3 h. FIG. 8B, Quantification of localization upon treatment of the IL-A with unlinked warheads 2 and 3. FIG. 8C, Comparison of the relative mCherry / GFP median fluorescence intensity ratio between the three isolated clonal import lines (IL-A-C). FIG. 8D, Ability of three representative import cell lines (IL) with different relative target (mCherry) and shuttle (NMNAT1) ratios to redistribute a diffuse protein target after 3-hour treatment with 1. FIG. 8E, Representative live-cell images of clonal import line B (IL-B) upon treatment with 1 for 3 h. FIG. 8F, Representative live-cell images of clonal import line C (IL-C) upon treatment with 1 for 3 h. FIG. 8G, Quantification of NMNAT1 protein localization change upon treatment with 10 nM 1 in IL-A-C possessing different mCherry / GFP ratios. FIG. 8H, Levels of GFP after treatment with 1 for 3 h in four isolated import cell lines with varying nuclear protein expression levels. FIG. 81, Levels of mCherry after treatment with 1 for 3 h across four isolated import cell lines with varying diffuse protein expression levels. Images in FIGS. 8 A, 8E, 8F, are representative of three biological replicates. Data in FIGS. 8B-8D, 8G-8I are mean ± s.d. of three independent experiments. Scale bars are 20 pm. MFI = median fluorescence intensity. P values in FIGS. 8H-8I were determined by two-way ANOVA with Sidak post hoc test comparing the treated condition to the DMSO control for each line. P values in FIGS. 8B, 8D were determined by unpaired two-tailed t-tests comparing treatment to the DMSO control.

[0041] FIGS. 9A-9L show validation of GR as import shuttle for FKBP12. FIG. 9A, TRAM engaging GR and FKBP12. FIGS. 9B-9C, Unlinked warhead controls for GR-based TRAMs. 8 binds to GR and 9 binds to FKBP12. FIG. 9D, Nuclear hormone receptor (ERa, GR) hijacking for import of target proteins. FIG. 9E, Nuclear localization of mCherry-FKBP12 after treatment with 6 or unlinked warheads 8 and 9 for 3 h. FIG. 9F, Nuclear localization of GR after treatment with 6 or unlinked warheads for 3 h. FIG. 9G, Genetic construct for stable incorporation. FIG. 9H, Representative live-cell images of GR-dependent FKBP12 import upon treatment with 6 or unlinked warheads 8 and 9 for 3 h. FIG. 91, FKBP12 nuclear import dose response derived from the analysis pipeline after a 3-hour treatment with 6 engaging GR. FIG. 9J, Nuclear mCherry localization upon treatment with 6 in competition with either lx or lOx of 8 and 9 for 3 h. FIG. 9K, Nuclear localization of GR upon treatment with 6 in competition with either lx or lOx of 8 or 9 for 3 h. FIG. 9L, Representative live-cell images of the unlinked warhead competition assay for GR-dependent FKBP12 import after a 3-hour treatment. Images in FIGS. 9H, 9L, are representative of three biological replicates. Data in FIGS. 9E-9F, 9I-9K are mean ± s.d. of three independent experiments. Scale bars arc 20 pm. P values in FIGS. 9E-9F, 9I-9K were determined by one-way ANOVA with Dunnett’s post hoc test comparing each condition to the DMSO control. Hoechst stains the nucleus.

[0042] FIGS. 10A-10H show validation of GR as import shuttle for FKBP12F36V. FIG. 10A, TRAM engaging GR and FKBP12F36V. FIG. 10B, Representative live-cell images of GR dependent FKBP12F36Vimport upon treatment with 4 or unlinked warheads 8 and 3 for 3 h. FIG. 10C, FKBP12F36Vnuclear import dose response derived from the analysis pipeline after a 3-hour treatment with 4 engaging GR. FIG. 10D, Nuclear localization of mCherry-FKBP12F36vafter treatment with 4 or unlinked warheads 3 and 8 for 3 h. FIG. 10E, Nuclear localization of GR after treatment with 4 or unlinked warheads 3 and 8 for 3 h. FIG. 10F, Representative live-cell images of the unlinked warhead competition assay for GR-dependent FKBP12F36Vimport after 3-hour treatment. FIG. 10G, mCherry localization upon treatment with 4 in competition with either lx or lOx of 8 or 3 for 3 h. FIG. 10H, Nuclear localization of GR upon treatment with 4 in competition with either lx or lOx of 8 or 3 for 3 h. Images in FIGS. 10B, 10F are representative of three biological replicates. Data in FIGS. 10C-10E, 10G-10H are mean ± s.d. of three independent experiments. Scale bars are 20 pm. P values in FIGS. 10C-10E, 10G-10H were determined by one-way ANOVA with Dunnett’s post hoc test comparing each condition to the DMSO control. Hoechst stains the nucleus.

[0043] FIGS. 11A-11H show validation of Era as import shuttle for FKBP12. FIG. 11A. TRAM engaging ERa and FKBP12, raloxifene (10) unlinked control binds to ERa. FIG. 1 IB, FKBP12 nuclear import dose response derived from the analysis pipeline after a 3-hour treatment with 7 engaging ERa. FIG. 11C, Representative live-cell images of ERa-dependent FKBP12 import upon treatment with 7 or unlinked warheads 10 and 9 for 3 h. FIG. 1 ID, Nuclear localization of mCherry-FKBP12 after treatment with 7 or unlinked warheads 10 and 9 for 3 h. FIG. HE, Nuclear localization of ERa after treatment with TRAM 7 or unlinked warheads 10 and 9 for 3 h. FIG. 1 IF, Nuclear mCherry localization upon treatment with 7 in competition with either lx or 10x of 10 or 9 for 3 h. FIG. 11G, Nuclear localization of ERa upon treatment with 7 in competition with either lx or 10x of 10 or 9 for 3 h. FIG. 11H, Representative live-cell images of the unlinked warhead competition assay for ERa-dependent FKBP12 import after a 3-hour treatment. Images in FIGS. 11C, 11H are representative of three biological replicates. Data in FIGS. 11B, 11D-11G are mean ± s.d. of three independent experiments. Scale bars are 20 pm. P values in FIGS. 1 IB, 11D-11G, were determined by one- way ANOVA with Dunnett’s post hoc test comparing each condition to the DMSO control. Hoechst stains the nucleus.

[0044] FIGS. 12A-12H show validation of Era as import shuttle for FKBP12F 36V. FIG. 12A. TRAM engaging ERa and FKBP12F36V. FIG. 12B, FKBP12F36Vnuclear import dose response derived from the analysis pipeline after a 3-hour treatment with 5 engaging ERa. FIG. 12C, Representative live-cell images of ERa-dependent FKBP12F36Vimport upon treatment with 5 or unlinked warheads 3 and 10 for 3 h. FIG. 12D, Nuclear localization of mCherry- FKBP12F36Vafter treatment with 5 or unlinked warheads 3 and 10 for 3 h. FIG. 12E, Nuclear localization of ERa after treatment with 5 or unlinked warheads 3 and 10 for 3 h. FIG. 12F,

[0045] Representative live-cell images of the unlinked warhead competition assay for ERa-dependent FKBP12F36Vimport for 3 h. FIG. 12G, mCherry localization upon treatment with 5 in competition with either lx or lOx of 3 or 10 for 3 h. FIG. 12H, Nuclear localization of ERa upon treatment with 5 in competition with either lx or lOx of 3 or 10 for 3 h. Images in FIGS. 12C, 12F are representative of three biological replicates. Data in FIGS. 12B, 12D, 12E, 12G, 12H are mean ± s.d. of three independent experiments. Scale bars are 20 pm. P values in FIGS. 12B, 12D, 12E, 12G, 12H were determined by one-way ANOVA with Dunnett’s post hoc test comparing each condition to the DMSO control. Hoechst stains the nucleus.

[0046] FIGS. 13A-13F show nuclear import of mutant proteins with ERa. FIG. 13A, Representative live-cell images of HeLa cells stably expressing target mutant protein SMARCB 1Q318X(SMARCB1*) and ERa under an inducible promoter after a 3-hour treatment of 5. FTG. 13B, Representative live-cell images of HeLa cells stably expressing target mutant protein (TDP* = TDP43K82A / R83A / K84A) and ERα under an inducible promoter after a 3-hour treatment of 5. FIG. 13C, Representative live-cell images of HeLa cells stably expressing target mutant protein FUSR495X(FUS*) and ERa under an inducible promoter after a 3-hour treatment of 5. FIG. 13D, Violin plots of the distribution of respective target mutant protein and ERα in the three cell lines under different treatment conditions, across 3 repeats. FIG. 13E, Mean percent nuclear target protein and ERa upon treatment with 5 for 3 h in HeLa cells stably expressing the target mutant protein and ERa under an inducible promoter. FIG. 13F, Representative immunoblot of mutant proteins after a 3-hour treatment with 5. Images in FIG. 13A-C are representative of three biological replicates. Data in FIG. 13E, is mean ± s.d. of three independent experiments. Data in FIG. 13F is representative of two independent experiments. P values in e were determined by one-way AN / VA comparing each condition to the DMSO control. Scale bars are 20 pm. Hoechst stains the nucleus.

[0047] FIGS. 14A-14D show TRAM-mediated protein relocalization from stress granules. FIG. 14A, Timelapse imaging snapshots of FUSR495Xwhen cells are treated with DMSO after stress granule formation. FIG. 14B, Timelapse imaging snapshots of FUSR495Xextraction from granules when cells are treated with 5. FIG. 14C, Representative fixed-cell immunofluorescent images of stress granule marker G3BP1 and mCherry-FUSR495Xafter treatment with 5 or control compounds for 3 h. FIG. 14D, Quantification of stress granules in cells after treatment with varying concentrations of 5 or control compounds for 3 h. Images in FIG. 14C are representative of three biological replicates. Images in FIGS. 14A-14B are representative of two independent experiments. Data in FIG. 14D are mean ± s.d. of three independent experiments. Scale bars are 20 pm. P values in FIG. 14D were determined by two-way ANOVA with Dunnett’s post hoc test comparing each condition to their DMSO control.

[0048] FIGS. 15A-15K show validation of PARP1 and METAP2 as protein shuttles in ectopic expression systems. FIG. 15A, Unlinked warheads that engage METAP2 (14) and PARP1 (15). FIG. 15B, Co-immunoprecipitation of mCherry-FKBP12F36vupon GFP-METAP2 pulldown in the presence of TRAM. I = input, F = flowthrough, E = eluate. FIG. 15C, Representative live-cell images of mCherry-FKBP12F36vafter treatment with 11 or with unlinked warheads, 14 or 3 for 3 h in the presence of METAP2. FIG. 15D, Quantification of FKBP12F36Vrelocalization upon treatment with 11 for 3 h. FIG. 15E, METAP2 localization upon TRAM 11 treatment for 3 h. 11. FTG. 15F, Representative live-cell-images of FKBP 12F36Vafter treatment with 12 or the unlinked warheads, 15 and 3 or in the absence of PARP1 after 3 h. FIG. 15G, Quantification of mCherry-FKBP12F36vrelocalization upon treatment with 12 for 3 h. FIG. 15H, Quantification of GFP-PARP1 localization upon TRAM upon treatment with 12 for 3 h. FIG. 151, mCherry-FKBP12F36vlocalization upon treatment with 12 for 3 h in competition with either lx or lOx of each individual unlinked warhead 15 and 3. FIG. 15J, Quantification of mCherry-FKBP12F36vlocalization from FIG. 151. FIG. 15K, Quantification of GFP-PARP1 localization from FIG. 151. Images in FIGS. 15C, 15F, 151 are representative of three biological replicates. Immunoblots in FIG. 15B are representative of two independent experiments. Data in FIGS. 15D, 15E, 15G, 15H, 15J, 15K are mean ± s.d. of three independent experiments. Scale bars are 20 pm. P values in FIGS. 15D, 15E, 15G, 15H, 15J, 15K were determined by one-way ANOVA with Dunnett’s post hoc test comparing each condition to the DMSO control. Hoechst stains the nucleus.

[0049] FIGS. 16A-16F show validation of Cas9-CRISPR mediated endogenously tagged lines. FIG. 16A, Schematic for modified PITCh knock-in into target proteins. FIG. 16B, Sequencing of the regions near the N terminus of the endogenous PRMT9 gene after donor cassette insertion into endogenous PRMT9 (SEQ ID NOs: 68-69). FIG. 16C, Sequencing of the region downstream the N terminus of the endogenous S0S1 gene after donor cassette insertion into endogenous S0S1. FIG. 16D, Due to high GC content of the genomic region upstream of the N terminus of SOS1 (SEQ ID NOs: 70), immunoblotting was used to validate successful incorporation of donor cassette onto endogenous S0S1 after GFP pulldown, I = input, F = flowthrough, E = eluate. FIG. 16E, Sequencing of the regions near the N terminus of the endogenous FKBP12 gene (SEQ ID NOs: 71-72)after donor cassette insertion into endogenous FKBP12. FIG. 16F, Demonstration of GFP-FKBP12F36Vtagging of endogenous PRMT9, SOS1 and GFP tagging of endogenous FKBP12 in HEK293T cells. Immunoblots in FIGS. 16D, 16F are representative of two independent experiments.

[0050] FIGS. 17A-17G show METAP2 as an endogenous nuclear import shuttle to relocalize endogenous PRMT9. FIG. 17A, Representative live-cell images of endogenous PRMT9 localization upon treatment with different concentrations of TRAM 11 for 24 h. FIG. 17B, Violin plots illustrating the homogenous population shift in PRMT9 localization upon TRAM 11 treatment at different concentrations for 24 h. FIG. 17C, Representative live-cell images of endogenous PRMT9 localization upon treatment with unlinked warheads 14 and 3 for 24 h. FIG. 17D, Quantification of localization changes observed in FIG. 17C. FIG. 17E, Violin plots showcasing the lack of homogenous population shift in PRMT9 localization when treated with the unlinked warheads 14 and 3 versus TRAM 11 for 24 h. FIG. 17F, Quantification of the change in PRMT9 localization upon treatment with 11 after pre-treatment for 1 h with either lx or lOx of 14 or competed with lx, or lOx of 3 for 24 h. FIG. 17G, Representative images of the competition assay quantified in FIG. 17F. Images in FIGS. 17A, 17C, 17G are representative of three biological replicates. Data in FIGS. 17D, 17F are mean ± s.d. of three independent experiments. Scale bars are 20 pm. P values in FIGS. 17B, 17D-17F were determined by one- way ANOVA with Dunnett’s post hoc test comparing each condition to the DMSO control. Hoechst stains the nucleus.

[0051] FIGS. 18A-18G show PARP1 as an endogenous nuclear import shuttle to relocalize endogenous SOS1. FIG. 18A, Representative live-cell images of endogenous SCSI localization upon treatment with different concentrations of TRAM 12 for 24 h. FIG. 18B, Violin plots illustrating the homogenous population shift in SOS1 localization upon TRAM 12 treatment at different concentrations for 24 h. FIG. 18C, Representative live-cell images of endogenous SOS1 localization after treatment with unlinked warheads 15 and 3 for 24 h. FIG. 18D, Quantification of localization changes observed in FIG. 18C. FIG. 18E, Violin plots showcasing the lack of homogenous population shift in SOS1 localization when treated with the unlinked warheads 15 and 3 versus TRAM 12 for 24 h. FIG. 18F, Quantitation of change in SOS1 localization upon treatment with 12 in competition with either lx or lOx of 15 or 3 for 24 h. FIG. 18G, Representative images of SOS1 localization in the competition assay in FIG. 18F. Images in FIGS. 18 A, 18C, 18G are representative of three biological replicates. Data in FIGS. 18D, 18F are mean ± s.d. of three independent experiments. Scale bars are 20 pm. P values in FIG. 18B, 18D-18F were determined by one-way ANOVA with Dunnett’s post hoc test comparing each condition to the DMSO control. Hoechst stains the nucleus.

[0052] FIGS. 19A-19G show PARP1 as an endogenous nuclear import shuttle to relocalize endogenous FKBP12. FIG. 19A, Representative live-cell images of partial endogenous FKBP12 localization upon treatment with different concentrations of TRAM 13 for 24 h. FIG. 19B, Violin plots illustrating a homogenous population shift in FKBP12 localization upon TRAM 13 treatment at different concentrations for 24 h. FIG. 19C, Representative live-cell images of endogenous FKBP12 localization after treatment with unlinked warheads 15 and 9 for 24 h. FIG. 19D, Quantification of localization changes observed in FIG. 19C. FIG. 19E, Violin plots showcasing the lack of homogenous population shift in FKBP12 localization when treated with the unlinked warheads 15 and 9 versus TRAM 13 for 24 h. FIG. 19F, Quantification of the change in FKBP12 localization upon treatment with 13 in competition with either lx or 1 Ox of 15 or 9 for 24 h. FIG. 19G, Representative images of FKBP12 localization in the competition assay in FIG. 19F. Images in FIGS. 19A, 19C, 19G are representative of three biological replicates. Data in FIGS. 19D, 19F are mean ± s.d. of three independent experiments. Scale bars are 20 pm. P values in FIGS. 19B, 19D-19F were determined by one-way ANOVA with Dunnett’s post hoc test comparing each condition to the DMSO control. Hoechst stains the nucleus.

[0053] FIGS. 20A-20G show nuclear export of NMNAT1 neurons. FIG. 20A, Representative live-cell images of NMNAT 1 upon treatment with TRAM 1 or unlinked warheads 2 and 3 at 10 nM for 24 h. FIG. 20B, Representative images of before and after axotomy on explants. Axotomies were performed using a biopsy punch, the mRuby3-Axontag protein serves as an axonal marker, Axontag = GAP43at-mRuby3-ecDHFR. FIG. 20C, Representative images of axons and axon termini post-axotomy, that have been pre-treated with unlinked controls for 24 h prior. . FIG. 20D, Quantification of axon degeneration over time. FIG. 20E, Quantification of axon degeneration over time in axon termini. FIG. 20F, Comparison of the degeneration index in axona at different time points with different treatment conditions. FIG. 20G, Comparison of the degeneration index (DI) in the axon termini at different time points with different treatment conditions. DI was calculated as the ratio of fragmented axon area over total axon area. For plots in FIGS. 20D, 20F, a total of 12 replicates derived from 4 different embryos were combined in the plots for all conditions except 1 nM 2 + 1 nM 3. A total of 6 replicates derived from 2 different embryos were combined in the plots for the 1 nM 2 + 1 nM 3 condition. For plots in FIGS. 20E, 20G, a total of 6 replicates derived from 4 different embryos were combined in the plots for all conditions except 1 nM 2 + 1 nM 3. A total of 4 replicates derived from 2 different embryos were combined in the plots for the 1 nM 2 + 1 nM 3 condition. Data in FIGS. 20D, 20E is shown as the mean + s.e.m. values. Data in FIGS. 20F, 20g is shown as the mean + s.d. values. P values in FIGS. 20D, 20E, were determined by two-way ANOVA with Tukey’s post hoc test comparing the 1 nM treatment of 1 with the DMSO (purple) or the unlinked warhead control (green) at each time point. P values in FIGS. 20F, 20G were determined by one-way ANOVA with Dunnctt’s post hoc test comparing each treatment to the DMSO control at each time point. Images in FIGS. 20A-20C are representative of neurons harvested from 4 different embryos. Scale bars are 20 pm.

[0054] FIGS. 21A-21Ishow endogenously-tagged proteins are susceptible to relocalization using nuclear hormone shuttles. FIG. 21A, Demonstration of GFP-FKBP12F36Vtagging of endogenous FOXO3A in HEK293T cells stably expressing ERoc. FIG. 21B, Representative live-cell images of FOXO3A knock-in HEK293T cells containing ERoc and treated with 5 or small molecule controls. FIG. 21C, Group quantitative analysis of FOXO3A knock-in cells treated with varying concentrations of 5 for 3 hours. Cells were divided into 4 groups based on their average nuclear mCherry intensity G4: 4900 > x > 2000, G3: 2000 > x > 800, G2: 800 > x > 200, Gl: 200 > x > 50. FIG. 21D, Demonstration of GFP tagging of endogenous FKBP12 in HEK293T cells stably expressing ERoc. FIG. 2 IE, Representative live-cell images of FKBP12 knock-in HEK293T cells containing ERoc and treated with 7 or small molecule controls for 3 hours. FIG. 21F, Quantitative analysis of nuclear FKBP12 in the top 5% ER-expressing HEK293T cells treated with 7 or small molecule controls for 3 hours. Number of cells: DMSO: 26, 1 pM 5: 28, 1 pM Raloxifene + 1 pM SLF: 30. FIG. 21G, Demonstration of GFP tagging of endogenous FKBP12 in HCT116 cells stably expressing GR. FIG. 21H, Representative live-cell images of FKBP12 knock-in HCT116 cells containing GR and treated with 6 or small molecule controls for 3 hours. FIG. 211, Quantitative analysis of nuclear FKBP12 in the top 5% GR-expressing HCT116 cells. Number of cells: DMSO: 18, 1 pM 6: 16, 1 pM Dexamethasone + 1 pM SLF: 16. Scale bars are 20 pm. Immunoblots are representative of two independent experiments. Images are representative of three biological replicates. Data are compiled from three independent experiments. P values in FIGS. 2 IF and 21H were determined by unpaired two-tailed t-tests of the respective datasets to DMSO. P values: (*) indicates P < 0.05 (**) indicates P < 0.01, (***) indicates P < 0.001, P < 0.0001.

[0055] DETAILED DESCRIPTION

[0056] The ability to exert targeted, pharmacological control of the subcellular location of an individual protein could provide avenues for addressing intractable diseases, as function- blocking molecules address only a small number of disease-relevant activities. Gain-of-function molecules that directly drive the formation of neocomplexes between proteins lift several constraints that restrict the range of viable therapeutic targets. In the context of controlling subcellular localization, correcting diseased phenotypes directly resulting from protein mislocalization or imparting beneficial function through protein relocation could expand the range of therapeutic options. A selection of tools for studying protein sequestration upon different stimuli with synthetic protein fusions to nuclear hormone receptor ligand binding domains, LOV2 domains, or binding sites for localization sequence containing nanobodies, have enabled fundamental studies of altered protein localization. Early work employing chemically- induced proximity between FRB and FKBP12 fused to arrayed localization sequences driven by rapamycin demonstrated the potential of small molecule control over localization programming. This approach was extended to the rapid sequestration of cytoplasmic and endosomal proteins onto mitochondrial surfaces to attenuate activity.

[0057] Therapeutic modulation of target protein location via coupling to a cellular shuttle or anchor protein provides an alternative avenue for programmable molecular control. A quantitative approach was used to identify features which govern the ability to hijack protein trafficking, develop a collection of shuttle proteins and ligands, and demonstrate relocalization of proteins bearing endogenous localization signals. Disclosed herein are Targeted Relocalization Activating Molecules (TRAMs) which couple the trafficking of a target protein to the trafficking of a shuttle protein. Nuclear hormone receptors were harnessed as viable shuttle in TRAMs to redistribute disease-driving mutant proteins such as SMARCB1Q318X, TDP43ANLS, and FUSR495X. Small molecule-mediated relocalization of FUSR495Xto the nucleus from the cytoplasm reduced the number of cellular stress granules in a model of cellular stress. Using Cas9-mediated knock- in tagging, nuclear enrichment of both low abundance (FOXO3a) and high abundance (FKBP12) endogenous proteins was demonstrated following molecular coupling to nuclear hormone receptor trafficking. Finally, small molecule-mediated redistribution of NMNAT1 from nuclei to axons in primary neurons was able to slow axonal degeneration and pharmacologically mimic the WldS gain-of-function phenotype from mice resistant to certain types of neurodegeneration. Through coupling shuttles and targets using drug-like molecules, therapeutic modulation of protein function can be advanced based on the concept of controlled protein trafficking. Definitions

[0058] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present disclosure. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.

[0059] The modifier “about” used in connection with a quantity is inclusive of the stated value and has the meaning dictated by the context (for example, it includes at least the degree of error associated with the measurement of the particular quantity). The modifier “about” should also be considered as disclosing the range defined by the absolute values of the two endpoints. For example, the expression “from about 2 to about 4” also discloses the range “from 2 to 4.” The term “about” may refer to ±10% of the indicated number. For example, “about 10%” may indicate a range of 9% to 11%, and “about 1” may mean from 0.9 - 1.1. Other meanings of “about” may be apparent from the context, such as rounding off; for example, “about 1” may also mean from 0.5 to 1.4.

[0060] The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The singular forms “a,” “and” and “the” include plural references unless the context clearly dictates otherwise. The present disclosure also contemplates other embodiments “comprising,” “consisting of’ and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not.

[0061] “Polynucleotide” or “oligonucleotide” or “nucleic acid,” as used herein, means at least two nucleotides covalently linked together. The polynucleotide may be DNA, RNA, or a hybrid, where the polynucleotide may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine. The nucleic acid, whether DNA or RNA may comprise non-natural nucleotides, modified nucleotides, and / or non- nucleotide building blocks that can exhibit the same function as natural nucleotides (e.g., “nucleotide analogs”). Nucleic acids may be obtained by chemical synthesis methods or by recombinant methods.

[0062] Polynucleotides may be single- or double-stranded or may contain portions of both double stranded and single stranded sequence. The depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of a depicted single strand. Many variants of a nucleic acid may be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and complements thereof.

[0063] A “peptide” or “polypeptide” is a linked sequence of two or more amino acids linked by peptide bonds. Peptides and polypeptides include proteins such as binding proteins, receptors, and antibodies. The terms “polypeptide” and “protein,” are used interchangeably herein.

[0064] A “subject” or “patient” may be human or non-human and may include, for example, animal strains or species used as “model systems” for research purposes, such a mouse model as described herein. Likewise, patient may include either adults or juveniles (e.g., children). Moreover, patient may mean any living organism, preferably a mammal (e.g., a human or a non- human) that may benefit from the administration of compositions contemplated herein. Examples of mammals include, but are not limited to, any member of the Mammalian class: humans, non- human primates such as chimpanzees, and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, swine; domestic animals such as rabbits, dogs, and cats; laboratory animals including rodents, such as rats, mice and guinea pigs, and the like. Examples of non- mammals include, but are not limited to, birds, fish, and the like. In one embodiment of the methods and compositions provided herein, the mammal is a human.

[0065] As used herein, the terms “providing,” “administering,” “introducing,” are used interchangeably herein and refer to the placement into a subject by a method or route which results in at least partial localization to a desired site. Administration can be by any appropriate route which results in delivery to a desired location in the subjectDefinitions of specific functional groups and chemical terms are described in more detail below. For purposes of this disclosure, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75thEd., inside cover, and specific functional groups are generally defined as described therein. Additionally, general principles of organic chemistry, as well as specific functional moieties and reactivity, are described in Sorrell, Organic Chemistry, 2ndedition, University Science Books, Sausalito, 2006; Smith, March’s Advanced Organic Chemistry: Reactions, Mechanism, and Structure, 7thEdition, John Wiley & Sons, Inc., New York, 2013; Larock, Comprehensive Organic Transformations, 3rdEdition, John Wiley & Sons, Inc., New York, 2018; and Carruthers, Some Modem Methods of Organic Synthesis, 3rdEdition, Cambridge University Press, Cambridge, 1987; the entire contents of each of which are incorporated herein by reference.

[0066] As used herein, the term “alkyl” refers to a radical of a straight or branched saturated hydrocarbon chain. The alkyl chain can include, e.g., from 1 to 24 carbon atoms (C1-C24 alkyl), 1 to 16 carbon atoms (C1-C16 alkyl), 1 to 14 carbon atoms (C1-C14 alkyl), 1 to 12 carbon atoms (Ci- C12 alkyl), 1 to 10 carbon atoms (C1-C10 alkyl), 1 to 8 carbon atoms (C1-C8alkyl), 1 to 6 carbon atoms ( C1-C6alkyl), 1 to 4 carbon atoms (C1-C4 alkyl), 1 to 3 carbon atoms (C1-C3 alkyl), or 1 to 2 carbon atoms (C1-C2 alkyl). Representative examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, iso-propyl, n-butyl, sec-butyl, iso-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, 3-methylhexyl, 2,2-dimethylpentyl, 2,3-dimethylpentyl, n-heptyl, n-octyl, n- nonyl, n-decyl, n-undecyl, and n-dodecyl.

[0067] As used herein, “aryl” refers to a radical of a monocyclic, bicyclic, or tricyclic 4n+2 aromatic ring system (e.g., having 6, 10, or 14 π electrons shared in a cyclic array) having 6-14 ring carbon atoms and zero heteroatoms (“C6-C14aryl”). In some embodiments, an aryl group has six ring carbon atoms (“C6aryl”; i.e., phenyl). In some embodiments, an aryl group has ten ring carbon atoms (“C10aryl”; e.g., naphthyl such as 1-naphthyl and 2-naphthyl). In some embodiments, an aryl group has fourteen ring carbon atoms (“C14aryl”; e.g., anthracenyl and phenanthrenyl).

[0068] As used herein, the term “cycloalkyl” refers to a radical of a saturated carbocyclic ring system containing three to ten carbon atoms and zero heteroatoms. The cycloalkyl may be monocyclic, bicyclic, bridged, fused, or spirocyclic. Representative examples of cycloalkyl include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclononyl, cyclodecyl, adamantyl, bicyclo[2.2.1]heptanyl, bicyclo[3.2.1]octanyl, and bicyclo[5.2.0]nonanyl.

[0069] As used herein, “heteroaryl” refers to a radical of a 5-10 membered monocyclic or bicyclic 4n+2 aromatic ring system (e.g., having 6 or 10 it electrons shared in a cyclic array) having ring carbon atoms and 1-4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen and sulfur (“5-10 membered heteroaryl”). In heteroaryl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom, as valency permits. Heteroaryl bicyclic ring systems can include one or more heteroatoms in one or both rings. “Heteroaryl” also includes ring systems wherein the heteroaryl ring, as defined above, is fused with one or more aryl groups wherein the point of attachment is either on the aryl or heteroaryl ring, and in such instances, the number of ring members designates the number of ring members in the fused (aryl / heteroaryl) ring system. Bicyclic heteroaryl groups wherein one ring does not contain a heteroatom (e.g., indolyl, quinolinyl, and the like) the point of attachment can be on either ring, i.e., either the ring bearing a heteroatom (e.g., 2-indolyl) or the ring that does not contain a heteroatom (e.g., 5-indolyl). Exemplary 5-membered heteroaryl groups containing one heteroatom include, without limitation, pyrrolyl, furanyl and thiophenyl. Exemplary 5-membered heteroaryl groups containing two heteroatoms include, without limitation, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl. Exemplary 5- membered heteroaryl groups containing three heteroatoms include, without limitation, triazolyl, oxadiazolyl, and thiadiazolyl. Exemplary 5-membered heteroaryl groups containing four heteroatoms include, without limitation, tetrazolyl. Exemplary 6-membered heteroaryl groups containing one heteroatom include, without limitation, pyridinyl. Exemplary 6-membered heteroaryl groups containing two heteroatoms include, without limitation, pyridazinyl, pyrimidinyl, and pyrazinyl. Exemplary 6-membered heteroaryl groups containing three or four heteroatoms include, without limitation, triazinyl and tetrazinyl, respectively. Exemplary 7- membered heteroaryl groups containing one heteroatom include, without limitation, azepinyl, oxepinyl, and thiepinyl. Exemplary 5,6-bicyclic heteroaryl groups include, without limitation, indolyl, isoindolyl, indazolyl, benzotriazolyl, benzothiophenyl, isobenzothiophenyl, benzofuranyl, benzoisofuranyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzoxadiazolyl, benzthiazolyl, benzisothiazolyl, benzthiadiazolyl, indolizinyl, and purinyl. Exemplary 6,6- bicyclic heteroaryl groups include, without limitation, naphthyridinyl, pteridinyl, quinolinyl, isoquinolinyl, cinnolinyl, quinoxalinyl, phthalazinyl, and quinazolinyl.

[0070] As used herein, “heterocyclyl” refers to a radical of a 3- to 10-membered non-aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, sulfur, boron, phosphorus, and silicon (“3-10 membered heterocyclyl”). In heterocyclyl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom, as valency permits. A heterocyclyl group can either be monocyclic (“monocyclic heterocyclyl”) or a fused, bridged or spiro ring system such as a bicyclic system (“bicyclic heterocyclyl”), and can be saturated or can be partially unsaturated. Heterocyclyl bicyclic ring systems can include one or more heteroatoms in one or both rings. “Heterocyclyl” also includes ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more cycloalkyl groups wherein the point of attachment is either on the cycloalkyl or heterocyclyl ring, or ring systems wherein the heterocyclyl ring, as defined above, is fused with one or more aryl or heteroaryl groups, wherein the point of attachment is on the heterocyclyl ring, and in such instances, the number of ring members continue to designate the number of ring members in the heterocyclyl ring system. A heterocyclyl group may be described as, e.g., a 3-7-membered heterocyclyl, wherein the term “membered” refers to the non- hydrogen ring atoms, i.e., carbon, nitrogen, oxygen, sulfur, boron, phosphorus, and silicon, within the moiety. Exemplary 3-membered heterocyclyl groups containing one heteroatom include, without limitation, azirdinyl, oxiranyl, and thiorenyl. Exemplary 4-membered heterocyclyl groups containing one heteroatom include, without limitation, azetidinyl, oxetanyl, and thietanyl. Exemplary 5-membered heterocyclyl groups containing one heteroatom include, without limitation, tetrahydrofuranyl, dihydrofuranyl, tetrahydro thiophenyl, dihydrothiophenyl, pyrrolidinyl, dihydropyrrolyl, and pyrrolyl-2, 5-dione. Exemplary 5-membered heterocyclyl groups containing two heteroatoms include, without limitation, dioxolanyl, oxasulfuranyl, disulfuranyl, and oxazolidin-2-one. Exemplary 5-membered heterocyclyl groups containing three heteroatoms include, without limitation, triazolinyl, oxadiazolinyl, and thiadiazolinyl. Exemplary 6-membered heterocyclyl groups containing one heteroatom include, without limitation, piperidinyl (e.g., 2,2,6,6-tetramethylpiperidinyl), tetrahydropyranyl, dihydropyridinyl, pyridinonyl (e.g., l-methylpyridin-2-onyl), and thianyl. Exemplary 6-membered heterocyclyl groups containing two heteroatoms include, without limitation, piperazinyl, morpholinyl, pyridazinonyl (2-methylpyridazin-3-onyl), pyrimidinonyl (e.g., l-methylpyrimidin-2-onyl, 3- methylpyrimidin-4-onyl), dithianyl, dioxanyl. Exemplary 6-membered heterocyclyl groups containing two heteroatoms include, without limitation, triazinanyl. Exemplary 7-membered heterocyclyl groups containing one heteroatom include, without limitation, azepanyl, oxepanyl and thiepanyl. Exemplary 8-membered heterocyclyl groups containing one heteroatom include, without limitation, azocanyl, oxecanyl and thiocanyl. Exemplary 5-membered heterocyclyl groups fused to a C.6 aryl ring (also referred to herein as a 5,6-bicyclic heterocyclyl ring) include, without limitation, indolinyl, isoindolinyl, dihydrobcnzofuranyl, dihydrobcnzothicnyl, benzoxazolinonyl, and the like. Exemplary 5-membered heterocyclyl groups fused to a heterocyclyl ring (also referred to herein as a 5,5-bicyclic heterocyclyl ring) include, without limitation, octahydropyrrolopyrrolyl (e.g., octahydropyrrolo[3,4-c]pyrrolyl), and the like. Exemplary 6-membered heterocyclyl groups fused to a heterocyclyl ring (also referred to as a 4,6-membered heterocyclyl ring) include, without limitation, diazaspirononanyl (e.g., 2,7- diazaspiro[3.5]nonanyl). Exemplary 6-membered heterocyclyl groups fused to an aryl ring (also referred to herein as a 6,6-bicyclic heterocyclyl ring) include, without limitation, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and the like. Exemplary 6-membered heterocyclyl groups fused to a cycloalkyl ring (also referred to herein as a 6,7-bicyclic heterocyclyl ring) include, without limitation, azabicyclooctanyl (e.g., (l,5)-8-azabicyclo[3.2.1]octanyl).

[0071] Exemplary 6-membered heterocyclyl groups fused to a cycloalkyl ring (also referred to herein as a 6,8-bicyclic heterocyclyl ring) include, without limitation, azabicyclononanyl (e.g., 9- azabicyclo [3.3.1 ]nonanyl) .

[0072] When a group or moiety can be substituted, the term “substituted” indicates that one or more (e.g., 1, 2, 3, 4, 5, or 6; in some embodiments 1, 2, or 3; and in other embodiments 1 or 2) hydrogens on the group indicated in the expression using “substituted” can be replaced with a selection of recited indicated groups or with a suitable substituent group known to those of skill in the ail (e.g., one or more of the groups recited below), provided that the designated atom’s normal valence is not exceeded. Substituent groups include, but are not limited to, alkyl, alkenyl, alkynyl, alkoxy, acyl, amino, amido, amidino, aryl, azido, carbamoyl, carboxyl, carboxyl ester, cyano, cycloalkyl, cycloalkenyl, guanidino, halo, haloalkyl, haloalkoxy, heteroalkyl, heteroaryl, heterocyclyl, hydroxy, hydrazino, imino, oxo, nitro, phosphate, phosphonate, sulfonic acid, thiol, thione, or combinations thereof.

[0073] As used herein, in chemical structures the indication: represents a point of attachment of one moiety to another moiety (e.g., a substituent group to the rest of the compound).

[0074] When substituent groups are specified by their conventional chemical formulae, written from left to right, recited group also encompasses substituent groups resulting from writing the structure from right to left. For example, -CH2O- optionally also recites -OCH2-, and - OC(O)NH- also optionally recites -NHC(O)O-.

[0075] For compounds described herein, groups and substituents thereof may be selected in accordance with permitted valence of the atoms and the substituents, such that the selections and substitutions result in a stable compound, e.g., which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc.

[0076] Compounds

[0077] Disclosed herein are compounds of formula (I):

[0078] SP-L-TP (I) and pharmaceutically acceptable salts thereof, wherein:

[0079] SP is a moiety that binds to a shuttle protein;

[0080] L is a linker; and

[0081] TP is a moiety that binds to a target protein; wherein the compound promotes relocalization of the target protein from one subcellular compartment or organelle to another subcellular compartment or organelle.

[0082] In some embodiments, the compounds of formula (I) promote translocation of the target protein from the cytoplasm to the nucleus. In such embodiments, the shuttle protein can be any protein that localizes to the nucleussuch as a protein comprising one or more nuclear localization sequences (NLSs).

[0083] In some embodiments, the shuttle protein comprises one or more nuclear localization sequence (NLS). The nuclear localization sequence may be appended, for example, to the N- terminus, a C-terminus, internally, or a combination thereof of the shuttle protein. In such cases when the shuttle protein comprises two or more NLSs, the NLSs may be in tandem, separated by a linker, at either end of the protein, or one or more may be embedded in the protein.

[0084] The nuclear localization sequence may comprise any amino acid sequence known in the art to functionally tag or direct a protein for import into a cell’s nucleus (e.g., for nuclear transport). The NLS may be any naturally-occurring NLS, or any non-naturally occurring NLS (e.g., an NLS with one or more desired mutations). Usually, a nuclear localization sequence comprises one or more positively charged amino acids, such as lysine and arginine. The NLS may be appended by a linker. In some embodiments, the NLS is a monopartite sequence. A monopartite NLS comprises a single cluster of positively charged or basic amino acids. In some embodiments, the monopartite NLS comprises a sequence of K-K / R-X-K7R, wherein X can be any amino acid. Exemplary monopartite NLS sequences include those from the SV40 large T-antigen, c-Myc, and TUS-proteins. In some embodiments, the NLS is a bipartite sequence. Bipartite NLSs comprise two clusters of basic amino acids, separated by a spacer of about 9-12 amino acids. Exemplary bipartite NLSs include the nuclear localization sequences of nucleoplasmin, EGL-12, or bipartite SV40. In some embodiments, the NLS comprises a sequence of: K-K / R-X-K / R, wherein X can be any amino acid; (R / P)XXKR(K / R)(ΛDE) (SEQ ID NOs: 1-4) wherein (ΛDE) represents any amino acid except for Asp or Glu, KRX(W / F / Y)XXAF (SEQ ID NOs: 5-7); and LGKR(K / R)(W / F / Y) (SEQ ID NO: 8-9), or a bipartite sequence thereof.

[0085] In some embodiments, the NLS is an NMNAT1 NLS. In some embodiments, the NLS is an SV40 NLS. In some embodiments, the NLS is an P53 NLS. In some embodiments, the NLS is an NPMl NLS.

[0086] In some embodiments, the shuttle protein includes nuclear hormone receptors such as, e.g., an estrogen receptor (e.g., estrogen receptor-a, estrogen receptor-0), an estrogen-related receptor (e.g., estrogen-related receptor-a, estrogen-related receptor-0, estrogen-related receptor- / ), thyroid hormone receptor, a 3-ketosteroid receptor (e.g., androgen receptor, glucocorticoid receptor, mineralocorticoid receptor, progesterone receptor), a thyroid hormone receptor (e.g., thyroid hormone receptor-a, thyroid hormone receptor-0), a retinoid x receptor (e.g., retinoid X- receptor-a, retinoid X-receptor-0, retinoid X-receptor- / ), a vitamin D receptor-like receptor (e.g., vitamin D receptor, pregnane X receptor, constitutive androstate receptor), a DAX-like receptor (e.g., DAX1 or SHP), a retinoic acid receptor (e.g., retinoic acid receptor-a, retinoic acid receptor-0, retinoic acid receptor-γ ), a peroxisome proliferator-activated receptor (e.g., peroxisome proliferator-activated receptor-a, peroxisome proliferator-activated receptor-0, peroxisome proliferator-activated receptor-γ), a Rev-Erb receptor (e.g., Rev-Erb-a, Rev-Erb-0), a retinoic acid-related orphan receptor (e.g., RAR-related orphan receptor-a, RAR-related orphan receptor-0, RAR-related orphan receptor-γ), a Liver X receptor-like receptor (e.g., famesoid X receptor, farnesoid X-receptor-0, liver X receptor-a, Liver X receptor-0), a hepatocyte nuclear factor-4 receptor (e.g., hepatocyte nuclear factor-4-a, hepatocyte nuclear factor-4- / ), a testicular receptor (e.g., testicular receptor 2, testicular receptor 4), a tailless-like receptor (e.g., TLX, PNR), a COUP-TF-like receptor (e.g., COUP-TF1 , COUP-TF2, V-erbA-related gene), a nerve growth factor IB-likc receptor (e.g., nerve growth factor IB, nuclear receptor related 1, neuron- derived orphan receptor 1), a fushi tarazu Fl -like receptor (e.g., steroidogenic factor 1, liver receptor homolog- 1), or a germ cell nuclear factor receptor. In some embodiments, the shuttle protein is an estrogen receptor, e.g., estrogen receptor-a. In some embodiments, the shuttle protein is a 3-ketosteroid receptor, such as glucocorticoid receptor.

[0087] Other proteins that localize to the nucleus and therefore can be used as shuttle proteins include bromodomain-containing proteins such as Brd4, poly(ADP-riose) polymerase (PARP).

[0088] In some embodiments, the compounds of formula (I) promote translocation of the target protein from the nucleus to the cytoplasm. In such embodiments, the shuttle protein can be any protein that localizes to the cytoplasm, such as a protein comprising one or more nuclear export sequences (NESs).

[0089] A nuclear export sequence (NES) has the oppositive function of a nuclear localization sequence, which is an amino acid sequence that tags, designates, or otherwise marks a protein for export out of the nucleus by nuclear transport. A nuclear export sequence (NES) can be of any size and composition, for example more than 25, 25, 15, 12, 10, 8, 7, 6, 5 or 4 amino acids, but will preferably comprise at least a four to ten amino acid sequence known to function as a nuclear export signal. The NES may be any NES sequence known in the art. The NES may be any naturally-occurring NES, or any non-naturally occurring NES (e.g., an NES with one or more desired mutations).

[0090] In some embodiments, each of the one or more nuclear export sequence(NES) comprises an amino acid sequence selected from: Y1-XXX-Y2-XX-Y3-X-Y4; Y1-XX-Y2-XX-Y3-X-Y4; Y1-XXX-Y2-XXX-Y3-X-Y4; Y1-XX-Y2-XXX-Y3-X-Y4; Y1-X-Y2-XX-Y3-X-Y4; Yl-XX- Y2-XXX-Y3-XX-Y4, wherein X is any amino acid and each Y is individually selected from: L, V, I, F, M, A, C, T, and W, wherein each NES can only have one of A, C, T, or W. See for example, Xu, et al., Molecular Biology of the Cell (2012), Sep;23(18):3677-93.

[0091] In some embodiments, the NES is an HIV-1 REV NES (LLPLERLTL; SEQ ID NO: 10). In some embodiments, the NES is MEK1 NES (ALQKKLEELELDE; SEQ ID NO: 65). In some embodiments, the NES is P53 NES (FRELNEALEL; SEQ ID NO: 66). In some embodiments, the NES is IKBα NES (MVKELQEIRL; SEQ ID NO: 67). In compounds of formula (I), SP is a moiety that binds to a shuttle protein, such as any shuttle protein described above. For example, in embodiments in which estrogen rcccptor-a is the shuttle protein, SP can be a moiety based on raloxifene, which binds to estrogen receptor-a. In embodiments in which glucocorticoid receptor is the shuttle protein, SP can be a moiety based on dexamethasone, which binds to the glucocorticoid receptor. In embodiments in which Brd4 is the shuttle protein, SP can be a moiety based on JQ1, which binds to Brd4. In embodiments in which PARP is the shuttle protein, SP can be a moiety based on olaparib, which binds to PARP1. In embodiments in which MetAP2 is the shuttle protein, SP can be a moiety based on fumagillin, which binds to MetAP2. Other known compounds that bind to these proteins can similarly be used as the basis for moiety SP.

[0092] In some embodiments, SP is a moiety selected from:

[0093] The target protein can be any protein for which it would be beneficial to rclocalizc the protein from one subcellular compartment or organelle to another subcellular compartment or organelle (e.g., from the cytoplasm to the nucleus or from the nucleus to the cytoplasm). In some embodiments, the target protein is an RNA-binding protein, a transcriptional regulator, a tumor suppressor protein, a kinase, a nuclear hormone receptor, a phosphatase, an E3 ligase, a deubiquitinase, a bromodomain-containing protein (Brd), or a caspase, or a variant or disease- causing mutant of any thereof. For example, in some embodiments, the target protein comprises SRY, SHOX, TRPS 1 , ARX, FOXP2, AIRE, RPS 19, AGT, hsMOK2, SHOC2, rhodopsin, AVPR2, ATP7B, ABCA1, Tau, TARDBP, FUS, FOXO, p53, Breast Cancer Gene 1 (BRCA1), retinoblastoma protein (Rb), Sirtuin 1 (SIRT1), tumor- specific cyclin E isoforms, V-ERB-B2 erythroblastic leukemia viral oncogene (ErbB3), Mucin- 13, inhibitor of growth family, member 1 (INGl / p33), SET-CAN fusion protein, Mucin-1 C-terminal (MUC1-C), KL-6 mucin, epidermal growth factor receptor (EGFR), androgen receptor, nuclear receptor corepressor (N- CoR), nucleophosmin (NPM1), β-catenin, Adenomatous polyposis coli (APC), p27, p44 / WDR77, E-cadherin, ERM binding protein 50 (EBP50), epithelial cell adhesion molecule (EPCAM), B7-H1, B7-H3, B7-H4, cyclin D1, vascular endothelial growth factor receptor (VEGFR), VEGFR-2, serotonin receptor 1A (5-HTR1A), mucin 1 (MUC1), human epidermal growth factor receptor 2 (HER2), homeobox transcription factor Nanog, mammary serine protease inhibitor (MASPIN), transcriptional adaptor 3 (ADA3), cytokine-induced apoptosis inhibitor 1 (CIPIN 1), NME.NM23 nucleoside diphosphate kinase 1 (NME 1, NME23), cyclin B2, TDP43, FUS, SOD1, NMNAT1, TMEM192, KRAS, anaplastic lymphoma kinase (ALK), or a variant or disease-causing mutant thereof. In some embodiments, the target protein comprises SMARCB1, TDP43, FUS, FOXO3A, or FKBP12, or a variant or disease-causing mutant thereof. In some embodiments, the target protein comprises FKBP12. In some embodiments, the target protein comprises FKBP12F36V. In some embodiments, the target protein comprises SMARCB 1Q318X, TDP43ANLS, or FUSR495X.

[0094] In compounds of formula (I), TP is a moiety that binds to the target protein, such as any target protein described above. For example, in embodiments in which FKBP12 is the target protein, TP can be a moiety based on AP1510, which binds to FKBP12. In embodiments in which FKBP12F36Vis the target protein, TP can be a moiety based on API 867, which binds to the FKBP12F36V. In embodiments in which the target protein is ALK, TP can be a moiety:

[0095] In some embodiments, TP is a moiety selected from:

[0096]

[0097] In some embodiments, the target protein comprises a moiety or domain to facilitate its relocalization. For example, the target protein may comprise a moiety or domain, e.g., a polypeptide or protein, which interacts with the disclosed compounds to facilitate its rclocalization. An target protein as described above may be fused with FKBP12 or FKBP12F36Vto which a TP moiety, as described above, binds.

[0098] In compounds of formula (I), the group L is a linker, which provides a covalent attachment between the SP and TP moieties. The exact structure of linker may not be critical in some embodiments, provided it is substantially non-interfering with the binding activities of the SP and TP moieties. In some embodiments, L is a direct bond. In other embodiments, L comprises any combination of -CH2-, -CH=CH-, -C=C-, -O-, -NR'-, -BR'-, -S-, -C(O)-, -C(NR')-, -S(O)-, -S(O)2-, arylene, heteroarylene, cycloalkylene, and heterocyclylene moieties, wherein R' is selected from hydrogen and C1-C6 alkyl, and wherein the arylene, heteroarylene, cycloalkylene, and heterocyclylene moieties are independently unsubstituted or substituted with 1, 2, or 3 substituents.

[0099] In some embodiments, the linker comprises an alkylene chain (e.g., having 2-20 -CH2- units). In other embodiments, the linker comprises an alkylene chain that is interrupted by, and / or terminated by (at either or both termini), at least one group selected from -O-, -S-, -N(R')- , -CH=CH-, -C=C-, -C(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -C(NOR')-, -C(O)N(R’)-, - C(O)N(R')C(O)-, -C(O)N(R')C(O)N(R')-, -N(R’)C(O)-, -N(R')C(O)N(R')-, -N(R’)C(O)O-, - OC(O)N(R')-, -C(NR')-, -N(R')C(NR')-, -C(NR')N(R')-, -N(R')C(NR')N(R')-, -OB(CH3)O-, - S(O)2-, -OS(O)-, -S(O)O-, -S(O)-, -OS(O)2-, -S(O)2O-, -N(R')S(O)2-, -S(O)2N(R')-, -N(R')S(O)-, -S(O)N(R')-, -N(R')S(O)2N(R')-, -N(R')S(O)N(R')-, C3-C12 cycloalkylene, 3- to 12-membered heterocyclylene, 5- to 10-membered arylene, 5- to 12-membered heteroarylene, or any combination thereof, wherein each R' is independently selected from hydrogen and C1-C6alkyl, and wherein the interrupting and terminating groups may be the same or different.

[0100] In some embodiments, L comprises an alkylene chain: wherein q is 1, 2, 3, 4,

[0101] 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, or 16. In some embodiments, q is 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12. For example in some embodiments, q is 1-16, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9,

[0102] 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2, 2-16, 2-15, 2-14, 2-13, 2-12, 2-11, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5,

[0103] 2-4, 2-3, 3-16, 3-15, 3-14, 3-13, 3-12, 3-11, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-16, 4-15, 4-14, 4- 13, 4-12, 4-11, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-16, 5-15, 5-14, 5-13, 5-12, 5-11, 5-10, 5-9, 5-8, 5- 7, 5-6, 6-16, 6-15, 6-14, 6-13, 6-12, 6-11, 6-10, 6-9, 6-8, 6-7, 7-16, 7-15, 7-14, 7-13, 7-12, 7-11, 7-10, 7-9, 7-8, 8-16, 8-15, 8-14, 8-13, 8-12, 8-11, 8-10, 8-9, or 9-16, 9-15, 9-14, 9-13, 9-12, 9-11, 9-10, 10-16, 10-15, 10-14, 10-13, 10-12, 10-11, 11-16, 11-15, 11-14, 11-13, 11-12, 12-16, 12-15, 12-14, 12-13, 13-16, 13-15, 13-14, 14-16, 14-15, and 15-16. In some embodiments, q is 1. In some embodiments, q is 2. In some embodiments, q is 3. In some embodiments, q is 4. In some embodiments, q is 5. In some embodiments, q is 6. In some embodiments, q is 7. In some embodiments, q is 8. In some embodiments, q is 9. In some embodiments, q is 10. In some embodiments, q is 11. In some embodiments, q is 12. In some embodiments, q is 13. In some embodiments, q is 14. In some embodiments, q is 15. In some embodiments, q is 16. Specific examples of alkylene chains, include:

[0104] In some embodiments, L comprises an alkylene chain interrupted by a functional group, such as -C(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -C(NOR')-, -C(O)N(R’)-, - C(O)N(R’)C(O)-, - C(O)N(R')C(O)N(R')-, -N(R')C(O)-, -N(R')C(O)N(R')-, -N(R')C(O)O-, -OC(O)N(R’)-, -C(NR')-, -N(R’)C(NR’)-, -C(NR')N(R')-, -N(R')C(NR')N(R’)-, -0B(CH3)0-, -S(O)2-, -OS(O)-, -S(O)O-, -

[0105] S(0)-, -0S(0)2-, -S(0)20-, -N(R’)S(0)2-, -S(O)2N(R')-, -N(R’)S(O)-, -S(O)N(R')-, -

[0106] N(R')S(O)2N(R’)-, or -N(R')S(O)N(R')-.

[0107] In some embodiments, L comprises one or more alkylene glycol repeat units, such as ethylene glycol or propylene glycol repeat units. For example, in some embodiments, L comprises a poly- or oligo-ethylene glycol chain: , wherein p is 1, 2, 3, 4, 5, or 6. In some embodiments, L comprises a group of formula: , wherein p is 1, 2, 3, 4,

[0108] 5, or 6. In some embodiments, p is 1-6, 1-5, 1-4, 1-3, 1-2, 2-6, 2-5, 2-4, 2-3, 3-6, 3-5, 3-4, 4-6, 4-

[0109] 6, or 5-6. In some embodiments, p is 1. In some embodiments, p is 2. In some embodiments, p is

[0110] 3. In some embodiments, p is 4. In some embodiments, p is 5. In some embodiments, p is 6.

[0111] In some embodiments, L comprises any combination of the following moieties: wherein p is 1, 2, 3, 4, 5, or 6; and q is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16.

[0112] In some embodiments, L has a formula selected from: and pharmaceutically acceptable salts thereof.

[0113] The synthetic schemes and specific examples as described below are illustrative and are not to be read as limiting the scope of the disclosure or the claims. Alternatives, modifications, and equivalents of the synthetic methods and specific examples are contemplated.

[0114] Pharmaceutical Compositions

[0115] The disclosed compounds may be incorporated into pharmaceutical compositions suitable for administration to a subject (such as a patient, which may be a human or non-human). The pharmaceutical compositions may include a “therapeutically effective amount” or a “prophylactic ally effective amount” of the agent. A “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result. A therapeutically effective amount of the composition may be determined by a person skilled in the art and may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the composition to elicit a desired response in the individual. A therapeutically effective amount is also one in which any toxic or detrimental effects of a compound of the disclosure are outweighed by the therapeutically beneficial effects. A “prophylactically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease or condition, the prophylactically effective amount will be less than the therapeutically effective amount.

[0116] The pharmaceutical compositions may include pharmaceutically acceptable carriers. The term “pharmaceutically acceptable carrier,” as used herein, means a non-toxic, inert solid, semi- solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. Some examples of materials which can serve as pharmaceutically acceptable carriers are sugars such as, but not limited to, lactose, glucose and sucrose; starches such as, but not limited to, com starch and potato starch; cellulose and its derivatives such as, but not limited to, sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as, but not limited to, cocoa butter and suppository waxes; oils such as, but not limited to, peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols; such as propylene glycol; esters such as, but not limited to, ethyl oleate and ethyl laurate; agar; buffering agents such as, but not limited to, magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer’s solution; ethyl alcohol, and phosphate buffer solutions, as well as other non-toxic compatible lubricants such as, but not limited to, sodium lauryl sulfate and magnesium stearate, as well as coloring agents, releasing agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the composition, according to the judgment of the formulator.

[0117] Thus, the compounds and their pharmaceutically acceptable salts may be formulated for administration by, for example, solid dosing, eye drop, in a topical oil-based formulation, injection, inhalation (either through the mouth or the nose), implants, or oral, buccal, parenteral, or rectal administration. Techniques and formulations may generally be found in “Remington’s Pharmaceutical Sciences,” (Meade Publishing Co., Easton, Pa.). Therapeutic compositions must typically be sterile and stable under the conditions of manufacture and storage.

[0118] The route by which the disclosed compounds are administered and the form of the composition will dictate the type of carrier to be used. The composition may be in a variety of forms, suitable, for example, for systemic administration (e.g., oral, rectal, nasal, sublingual, buccal, implants, or parenteral) or topical administration (e.g., dermal, pulmonary, nasal, aural, ocular, liposome delivery systems, or iontophoresis).

[0119] Carriers for systemic administration typically include at least one of diluents, lubricants, binders, disintegrants, colorants, flavors, sweeteners, antioxidants, preservatives, glidants, solvents, suspending agents, wetting agents, surfactants, combinations thereof, and others. All carriers arc optional in the compositions.

[0120] Suitable diluents include sugars such as glucose, lactose, dextrose, and sucrose; diols such as propylene glycol; calcium carbonate; sodium carbonate; sugar alcohols, such as glycerin; mannitol; and sorbitol. The amount of diluent(s) in a systemic or topical composition is typically about 50 to about 90% by weight of the composition.

[0121] Suitable lubricants include silica, talc, stearic acid and its magnesium salts and calcium salts, calcium sulfate; and liquid lubricants such as polyethylene glycol and vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil and oil of theobroma. The amount of lubricant(s) in a systemic or topical composition is typically about 5 to about 10% by weight of the composition.

[0122] Suitable binders include polyvinyl pyrrolidone; magnesium aluminum silicate; starches such as com starch and potato starch; gelatin; tragacanth; and cellulose and its derivatives, such as sodium carboxymethylcellulose, ethyl cellulose, methylcellulose, microcrystalline cellulose, and sodium carboxymethylcellulose. The amount of binder(s) in a systemic composition is typically about 5 to about 50% by weight of the composition.

[0123] Suitable disintegrants include agar, alginic acid and the sodium salt thereof, effervescent mixtures, croscarmellose, crospovidone, sodium carboxymethyl starch, sodium starch glycolate, clays, and ion exchange resins. The amount of disintegrant(s) in a systemic or topical composition is typically about 0.1 to about 10% by weight of the composition. Suitable colorants include a colorant such as an FD&C dye. When used, the amount of colorant in a systemic or topical composition is typically about 0.005 to about 0.1% by weight of the composition.

[0124] Suitable flavors include menthol, peppermint, and fruit flavors. The amount of flavor(s), when used, in a systemic or topical composition is typically about 0.1 to about 1.0%.

[0125] Suitable sweeteners include aspartame and saccharin. The amount of sweetener(s), when used, in a systemic or topical composition is typically about 0.001 to about 1% by weight of the composition.

[0126] Suitable antioxidants include butylated hydroxyanisole (“BHA”), butylated hydroxytoluene (“BHT”), and vitamin E. The amount of antioxidant(s) in a systemic or topical composition is typically about 0.1 to about 5% by weight of the composition.

[0127] Suitable preservatives include benzalkonium chloride, methyl paraben, and sodium benzoate. The amount of preservative(s) in a systemic or topical composition is typically about 0.01 to about 5% by weight of the composition.

[0128] Suitable glidants include silicon dioxide. The amount of glidant(s) in a systemic or topical composition is typically about 1 to about 5% by weight of the composition.

[0129] Suitable solvents include water, isotonic saline, ethyl oleate, glycerin, hydroxylated castor oils, alcohols such as ethanol, and phosphate buffer solutions. The amount of solvent(s) in a systemic or topical composition is typically from about 0 to about 100% by weight of the composition.

[0130] Suitable suspending agents include AVICEL RC-591 (from FMC Corporation of Philadelphia, PA) and sodium alginate. The amount of suspending agent(s) in a systemic or topical composition is typically about 1 to about 8% by weight of the composition.

[0131] Suitable surfactants include lecithin, Polysorbate 80, and sodium lauryl sulfate, and the TWEENS from Atlas Powder Company of Wilmington, Delaware. Suitable surfactants include those disclosed in the C.T.F.A. Cosmetic Ingredient Handbook, 1992, pp.587-592; Remington’s Pharmaceutical Sciences, 15th Ed. 1975, pp. 335-337; and McCutcheon’s Volume 1, Emulsifiers & Detergents, 1994, North American Edition, pp. 236-239. The amount of surfactant(s) in the systemic or topical composition is typically about 0.1% to about 5% by weight of the composition. Although the amounts of components in the systemic compositions may vary depending on the type of systemic composition prepared, in general, systemic compositions include 0.01% to 50% by weight of an active compound and 50% to 99.99% by weight of one or more carriers. Compositions for parenteral administration typically include 0.1% to 10% by weight of actives and 90% to 99.9% by weight of a carrier including a diluent and a solvent.

[0132] Compositions for oral administration can have various dosage forms. For example, solid forms include tablets, capsules, granules, and bulk powders. These oral dosage forms include a safe and effective amount, usually at least about 5% by weight, and more particularly from about 25% to about 50% by weight of actives. The oral dosage compositions include about 50% to about 95% by weight of carriers, and more particularly, from about 50% to about 75% by weight.

[0133] Tablets can be compressed, tablet triturates, enteric-coated, sugar-coated, film-coated, or multiple-compressed. Tablets typically include an active component, and a carrier comprising ingredients selected from diluents, lubricants, binders, disintegrants, colorants, flavors, sweeteners, glidants, and combinations thereof. Specific diluents include calcium carbonate, sodium carbonate, mannitol, lactose and cellulose. Specific binders include starch, gelatin, and sucrose. Specific disintegrants include alginic acid and croscarmellose. Specific lubricants include magnesium stearate, stearic acid, and talc. Specific colorants are the FD&C dyes, which can be added for appearance. Chewable tablets preferably contain sweeteners such as aspartame and saccharin, or flavors such as menthol, peppermint, fruit flavors, or a combination thereof.

[0134] Capsules (including implants, time release and sustained release formulations) typically include an active compound, and a carrier including one or more diluents disclosed above in a capsule comprising gelatin. Granules typically comprise a disclosed compound, and preferably glidants such as silicon dioxide to improve flow characteristics. Implants can be of the biodegradable or the non-biodegradable type.

[0135] The selection of ingredients in the carrier for oral compositions depends on secondary considerations like taste, cost, and shelf stability, which are not critical for the purposes of this disclosure.

[0136] Solid compositions may be coated by conventional methods, typically with pH or time- dependent coatings, such that a disclosed compound is released in the gastrointestinal tract in the vicinity of the desired application, or at various points and times to extend the desired action. The coatings typically include one or more components selected from the group consisting of cellulose acetate phthalate, polyvinyl acetate phthalate, hydroxypropyl methyl cellulose phthalate, ethyl cellulose, EUDRAGIT® coatings (available from Evonik Industries of Essen, Germany), waxes and shellac.

[0137] Compositions for oral administration can have liquid forms. For example, suitable liquid forms include aqueous solutions, emulsions, suspensions, solutions reconstituted from non- effervescent granules, suspensions reconstituted from non-effervescent granules, effervescent preparations reconstituted from effervescent granules, elixirs, tinctures, syrups, and the like. Liquid orally administered compositions typically include a disclosed compound and a carrier, namely, a carrier selected from diluents, colorants, flavors, sweeteners, preservatives, solvents, suspending agents, and surfactants. Peroral liquid compositions preferably include one or more ingredients selected from colorants, flavors, and sweeteners.

[0138] Other compositions useful for attaining systemic delivery of the subject compounds include sublingual, buccal and nasal dosage forms. Such compositions typically include one or more of soluble filler substances such as diluents including sucrose, sorbitol and mannitol; and binders such as acacia, microcrystalline cellulose, carboxymethyl cellulose, and hydroxypropyl methylcellulose. Such compositions may further include lubricants, colorants, flavors, sweeteners, antioxidants, and glidants.

[0139] The disclosed compounds can be topically administered. Topical compositions that can be applied locally to the skin may be in any form including solids, solutions, oils, creams, ointments, gels, lotions, shampoos, leave-on and rinse-out hair conditioners, milks, cleansers, moisturizers, sprays, skin patches, and the like. Topical compositions include: a disclosed compound (e.g., a compound of formula (I), or a pharmaceutically acceptable salt thereof), and a carrier. The carrier of the topical composition preferably aids penetration of the compounds into the skin. The carrier may further include one or more optional components.

[0140] The amount of the carrier employed in conjunction with a disclosed compound is sufficient to provide a practical quantity of composition for administration per unit dose of the compound. Techniques and compositions for making dosage forms useful in the methods of this disclosure are described in the following references: Modern Pharmaceutics, Chapters 9 and 10, Banker & Rhodes, eds. (1979); Lieberman et al., Pharmaceutical Dosage Forms: Tablets (1981); and Ansel, Introduction to Pharmaceutical Dosage Forms, 2nd Ed., (1976). A carrier may include a single ingredient or a combination of two or more ingredients. In the topical compositions, the carrier includes a topical carrier. Suitable topical carriers include one or more ingredients selected from phosphate buffered saline, isotonic water, deionized water, monofunctional alcohols, symmetrical alcohols, aloe vera gel, allantoin, glycerin, vitamin A and E oils, mineral oil, propylene glycol, PPG-2 myristyl propionate, dimethyl isosorbide, castor oil, combinations thereof, and the like. More particularly, carriers for skin applications include propylene glycol, dimethyl isosorbide, and water, and even more particularly, phosphate buffered saline, isotonic water, deionized water, monofunctional alcohols, and symmetrical alcohols.

[0141] The carrier of a topical composition may further include one or more ingredients selected from emollients, propellants, solvents, humectants, thickeners, powders, fragrances, pigments, and preservatives, all of which are optional.

[0142] Suitable emollients include stearyl alcohol, glyceryl monoricinoleate, glyceryl monostearate, propane- 1,2-diol, butane- 1,3-diol, mink oil, cetyl alcohol, isopropyl isostearate, stearic acid, isobutyl palmitate, isocetyl stearate, oleyl alcohol, isopropyl laurate, hexyl laurate, decyl oleate, octadecan-2-ol, isocetyl alcohol, cetyl palmitate, di-n-butyl sebacate, isopropyl myristate, isopropyl palmitate, isopropyl stearate, butyl stearate, polyethylene glycol, triethylene glycol, lanolin, sesame oil, coconut oil, arachis oil, castor oil, acetylated lanolin alcohols, petroleum, mineral oil, butyl myristate, isostearic acid, palmitic acid, isopropyl linoleate, lauryl lactate, myristyl lactate, decyl oleate, myristyl myristate, and combinations thereof. Specific emollients for skin include stearyl alcohol and polydimethylsiloxane. The amount of emollient(s) in a skin-based topical composition is typically about 5% to about 95% by weight of the composition.

[0143] Suitable propellants include propane, butane, isobutane, dimethyl ether, carbon dioxide, nitrous oxide, and combinations thereof. The amount of propellant(s) in a topical composition is typically about 0% to about 95% by weight of the composition.

[0144] Suitable solvents include water, ethyl alcohol, methylene chloride, isopropanol, castor oil, ethylene glycol monoethyl ether, diethylene glycol monobutyl ether, diethylene glycol monoethyl ether, dimethylsulfoxide, dimethyl formamide, tetrahydrofuran, and combinations thereof. Specific solvents include ethyl alcohol and homotopic alcohols. The amount of solvent(s) in a topical composition is typically about 0% to about 95% by weight of the composition.

[0145] Suitable humectants include glycerin, sorbitol, sodium 2-pyrrolidone-5-carboxylate, soluble collagen, dibutyl phthalate, gelatin, and combinations thereof. Specific humectants include glycerin. The amount of humectant(s) in a topical composition is typically 0% to 95% by weight of the composition.

[0146] The amount of thickener(s) in a topical composition is typically about 0% to about 95% by weight of the composition.

[0147] Suitable powders include beta-cyclodextrins, hydroxypropyl cyclodextrins, chalk, talc, fullers earth, kaolin, starch, gums, colloidal silicon dioxide, sodium polyacrylate, tetra alkyl ammonium smectites, trialkyl aryl ammonium smectites, chemically-modified magnesium aluminum silicate, organically-modified montmorillonite clay, hydrated aluminum silicate, fumed silica, carboxyvinyl polymer, sodium carboxymethyl cellulose, ethylene glycol monostearate, and combinations thereof. The amount of powder(s) in a topical composition is typically 0% to 95% by weight of the composition.

[0148] The amount of fragrance in a topical composition is typically about 0% to about 0.5%, particularly, about 0.001% to about 0.1% by weight of the composition.

[0149] Suitable pH adjusting additives include HC1 or NaOH in amounts sufficient to adjust the pH of a topical pharmaceutical composition.

[0150] Methods of Use

[0151] The disclosed compounds and pharmaceutical compositions may be used in methods for relocalizing a target protein. Relocalizing refers to moving a target protein from one subcellular compartment or organelle to another subcellular compartment or organelle. For example, the methods may comprise moving a target protein into the nucleus, moving a target protein out of the nucleus, moving a target protein out of the mitochondria, moving a target protein out of the endoplasmic reticulum, or moving a target protein from the cytoplasm to its intended destination (e.g., an organelle, extracellular, plasma membrane). In some embodiments, the methods further comprise introducing a compound as disclosed herein to a cell.

[0152] In some embodiments, the methods further comprise engineering the target protein to add the moiety or domain to the target protein. For example, genetic engineering technique may be utilized to add a moiety or domain to a putative target protein to which the compounds disclosed herein recognize and bind. For example, a moiety or domain, e.g., a polypeptide or protein as described above, which interacts with the disclosed compounds is added to the target protein prior to introduction or administration of the disclosed compounds.

[0153] In some embodiments, the methods further comprise introducing a shuttle protein, a nucleic acid encoding thereof, or a shuttle protein activating agent (e.g., to increase expression of the shuttle protein in the cell) to the cell.

[0154] In some embodiments, the cell is in vitro or ex vivo. In some embodiments, the cell is in vivo. In some embodiments, the introducing comprises administration to a subject in need thereof.

[0155] In some embodiments, the disclosed compounds and pharmaceutical compositions may be used in methods for treatment of disorders, including disorders associated with mislocalized proteins. Such disorders include cancer and neurological disorders.

[0156] In some embodiments, the disease or disorder is cancer. In some embodiments, the cancer comprises a solid tumor. In some embodiments, the cancer comprises a blood cancer or lymphoma. In some embodiments, the cancer is metastatic cancer. In some embodiments, the disclosed compounds, compositions, or methods result in suppression of elimination of metastasis. In some embodiments, the disclosed compounds, compositions, or methods result in decreased tumor growth. In some embodiments, the disclosed compounds, compositions, or methods prevent tumor recurrence.

[0157] The compounds and compositions herein may be useful to treat a wide variety of cancers including carcinoma, sarcoma, lymphoma, leukemia, melanoma, mesothelioma, multiple myeloma, or seminoma. The cancer may be a cancer of the bladder, blood, bone, brain, breast, cervix, colon / rectum, endometrium, head and neck, kidney, liver, lung, lymph nodes, muscle tissue, ovary, pancreas, prostate, skin, spleen, stomach, testicle, thyroid, or uterus.

[0158] In some embodiments, the cancer is invasive and / or metastatic cancer (e.g., stage II cancer, stage III cancer or stage IV cancer). In some embodiments, the cancer is an early stage cancer (e.g., stage 0 cancer, stage I cancer), and / or is not invasive and / or metastatic cancer.

[0159] In some embodiments, the subject has a neurological disease or disorder. Non-limiting examples of neurological diseases include schizophrenia, depression, hypopituitarism, diabetes insipidus, sicca syndrome, dystonia, epilepsy, essential tremor, Tourette syndrome, obsessive- compulsive disorder, depression, stroke, chorea, cluster headache, dementia, tinnitus, nerve damage or injury, and neurodegenerative diseases. Neurodegenerative diseases are central nervous system diseases characterized by progressive, normally gradual, loss of functional neural tissue. Non-limiting examples of neurodegenerative diseases include frontotemporal dementia (FTD), Parkinson’s disease (PD), Alzheimer’s disease (AD), amyotrophic lateral sclerosis (ALS), Friedreich's ataxia, Multiple sclerosis, Wallerian neurodegeneration, Niemann-Pick disease, Huntington's disease, transmissible spongiform encephalopathy, Charcot-Marie-Tooth disease, dementia with Lewy bodies (DLB), corticobasal degeneration, progressive supranuclear palsy, Bell’s palsy, neuronal ceroid lipofuscinoses, and hereditary spastic paraparesis.

[0160] In the methods described herein, a compound or pharmaceutical composition may be administered to the subject by any convenient route of administration, whether systemically / peripherally or at the site of desired action, including but not limited to, oral (e.g. by ingestion); topical (including e.g. transdermal, intranasal, ocular, buccal, and sublingual); pulmonary (e.g. by inhalation or insufflation therapy using, e.g. an aerosol, e.g. through mouth or nose); rectal; vaginal; parenteral, for example, by injection, including subcutaneous, intradermal, intramuscular, intravenous, intraarterial, intracardiac, intrathecal, intraspinal, intracapsular, subcapsular, intraorbital, intraperitoneal, intratracheal, subcuticular, intraarticular, subarachnoid, and intrasternal; or by implant of a depot, for example, subcutaneously or intramuscularly. In some embodiments, the administration comprises oral administration. Additional modes of administration may include adding the compound and / or a composition comprising the compound to a food or beverage, including a water supply for an animal, to supply the compound as part of the animal’s diet.

[0161] It will be appreciated that appropriate dosages of the compounds, and compositions comprising the compounds, can vary from patient to patient. Determining the optimal dosage will generally involve the balancing of the level of therapeutic benefit against any risk or deleterious side effects of the treatments of the present disclosure. The selected dosage level will depend on a variety of factors including, but not limited to, the activity of the particular compound, the route of administration, the time of administration, the rate of excretion of the compound, the duration of the treatment, other drugs, compounds, and / or materials used in combination, and the age, sex, weight, condition, general health, and prior medical history of the patient. The amount of compound and route of administration will ultimately be at the discretion of the physician, although generally the dosage will be to achieve local concentrations at the site of action which achieve the desired effect without causing substantial harmful or deleterious sidc-cffccts.

[0162] Administration in vivo can be effected in one dose, continuously or intermittently (e.g., in divided doses at appropriate intervals) throughout the course of treatment. Methods of determining the most effective means and dosage of administration are well known to those of skill in the art and will vary with the formulation used for therapy, the purpose of the therapy, the target cell being treated, and the subject being treated. Single or multiple administrations can be carried out with the dose level and pattern being selected by the treating physician. In general, a suitable dose of the compound is in the range of about 100 μg to about 250 mg per kilogram body weight of the subject per day.

[0163] Administration can be once, on a continuous basis (e.g. by an intravenous drip), or on a periodic / intermittent basis, including about once per hour, about once per two hours, about once per four hours, about once per eight hours, about once per twelve hours, about once per day, about once per two days, about once per three days, about twice per week, about once per week, and about once per month. The administration may be continued until a desired reduction of symptoms is achieved.

[0164] A wide range of second therapies may be used in conjunction with the methods of the present disclosure. The second therapy may be administration of an additional active agent or may be a second therapy not connected to administration of another agent. Such second therapies include, but are not limited to, surgery, immunotherapy, radiotherapy.

[0165] The second therapy may be administered at the same time as the initial therapy, either in the same composition or in a separate composition administered at substantially the same time as the first composition. In some embodiments, the second therapy may precede or follow the treatment of the first therapy by time intervals ranging from hours to months.

[0166] The following examples further illustrate aspects of the disclosure but, of course, should not be construed as in any way limiting its scope.

[0167] EXAMPLES

[0168] The following abbreviations are used in the Examples: BOC is teit-butyloxycarbonyl; DCM is dichloromethane; DIPEA is A,A-diisopropylethylamine; DMF is dimethylformamide; Et is ethyl; EtOAc is ethyl acetate; ESI is electrospray ionization; HATU is 1- [bis(dimethylamino)methylene]- 1 H- 1 ,2,3-triazolo[4,5-&]pyridinium 3-oxide hcxafluorophosphatc; HRMS is high resolution mass spectrometry; LCMS is liquid chromatography mass spectrometry; LRMS is low resolution mass spectrometry; Me is methyl; MeOH is methanol; NMR is nuclear magnetic resonance; PPh3 is triphenylphosphine; RT is room temperature; TFA is trifluoroacetic acid; THF is tetrahydrofuran; TLC is thin layer chromatography.

[0169] Example 1: Compound Syntheses

[0170] Reagent-grade chemical reagents were purchased from Sigma Aldrich, TCI, Ambeed, or Broadpharm. All chemical reactions were performed in standard glassware capped with rubber septa or glass vials under ambient atmosphere unless stated otherwise. Thin-layer chromatography (TLC) was conducted on pre-coated glass plates covered with 0.2 mm silica gel (F-254) for monitoring reactions. TLC plates were visualized with UV light, or stained with KMnCL or ninhydrin. Crude reaction residues were purified via column chromatography using Biotage SNAP KP-Sil or Ultra C18 cartridges (10- 100g) with a Biotage Isolera Prime ACI automated fraction collector.

[0171] Chemical analysis instrumentation

[0172] Proton NMR NMR) spectra were recorded on a Varian 400 MHz or 600 MHz spectrometer at 25 °C. Spectra are reported in ppm downfield of tetramethylsilane and arc referenced to the residual resonances of the protium NMR solvent (CDCI3: 7.26 [CHCI3], CH3OD: MestReNova (v 14.3.1) was used for all chemical NMR analysis. Data are reported as chemical shift, multiplicity (br, broad; s, singlet; d, doublet; t, triplet; q, quartet; quin, quintet; sept, septet; m, multiplet), coupling constants in Hertz (Hz) and integration. For all FKBP12 and FKBP12F36Vligand-containing compounds, molecules are mixtures of rotamers and select minor rotamer peaks are reported. High-resolution mass spectrometric data were obtained on a Thermo Exploris 240 Orbitrap mass spectrometer by the Stanford University Mass Spectrometry (SUMS) core facility.

[0173] Synthesis of 1

[0174] Carboxylic acid (50 mg, 0.072 mmol, 1 equiv.) was added to HATU (41 mg, 0.11 mmol 1.5 equiv.), and DIPEA (0.1 mL, 0.58 mmol, 8.0 equiv.), in DMF (0.5 mL) and stirred at room temperature for 10 minutes, before a solution of amine (36 mg, 0.11 mmol, 1.5 equiv.) in DMF (0.5 ml) was added. The mixture was stirred overnight at room temperature, then extracted with EtOAc (10 mL), washed with water (2 x 10 mL), saturated NaHCO3(10 mL), brine (10 mL), then dried over Mg2SO4and filtered. The filtrate was concentrated under reduced pressure and purified by flash column chromatography (0-10% MeOH in CH2C12) to yield an off white solid (9.2 mg, 13% yield).1H NMR (400 MHz, CD3OD) δ 7.39 (s, 1H), 7.10 (t, 7= 7.9 Hz, 1H), 6.88 - 6.80 (m, 1H), 6.80 - 6.73 (m, 1H), 6.70 - 6.60 (m, 2H), 6.58 (s, 2H), 6.52 (s, 2H), 6.47 (d, J = 7.7 Hz, 1H), 5.47 (t, 7 = 7.1 Hz, 1H), 5.40 - 5.37 (m, 1H), 4.57 - 4.38 (m, 2H), 4.15 - 4.08 (m, 1H), 3.95 - 3.85 (m, 2H), 3.82 - 3.80 (m, 2H), 3.78 (s, 6H), 3.75 - 3.73 (m, 1H), 3.73 (s, 6H), 3.67 (s, 2H), 3.65 (s, 4H), 3.62 (s, 2H), 3.58 - 3.43 (m, 1H), 3.25 - 3.10 (m, 1H), 2.75 - 2.69 (m, 1H), 2.63 - 2.13 (m, 2H), 2.13 - 1.78 (m, 4H), 1.78 - 1.40 (m, 5H), 1.26 (d, 7= 21.8 Hz, 3H), 0.89 (t, 7 = 7.2 Hz, 3H), 0.81 (t, 7 = 7.1 Hz, 3H). HRMS ESI-MS (m / z): [M+H]+Expected: 1009.4917, Measured: 1009.4909.

[0175] Synthesis of 3 To carboxylic acid (Jorgensen, F. P. et al. J. Med. Chem. 2019, 62, 5191-5216) (75 mg, 0.11 mmol, 1 cquiv.) was added propargyl amine (9.0 mg, 0.17 mmol, 1.5 cquiv.), HATU (63 mg, 0.17 mmol, 1.5 equiv.), DMF (1.0 mL) and DIPEA (57 μL, 0.33 mmol, 3.0 equiv.). The mixture was stirred overnight at room temperature, then extracted with EtOAc (10 mL), washed with water (2 x 10 mL), saturated NaHCO ; (10 mL), brine (10 mL), then dried over Mg2SO4and filtered. The filtrate was concentrated under reduced pressure, and resulting residue was purified by silica gel chromatography (0-10% MeOH in CH2O2) to yield a white solid (50 mg, 62%).1H NMR (400 MHz, CDC13) 57.18 (t, J = 7.9 Hz, 1H), 6.79 - 6.70 (m, 2H), 6.70 - 6.61 (m, 2H), 6.39 (s, 2H), 5.62 (dd, J = 8.2, 5.4 Hz, 1H), 5.45 (d, J= 5.5 Hz, 1H), 4.50 (s, 2H), 4.21 - 4.07 (m, 2H), 3.90 - 3.80 (m, 9H), 3.78 (s, 3H), 3.65 (s, 3H), 3.58 (t, J = 7.9 Hz, 1H), 2.82-2.72 (m, 1H), 2.65-2.35 (m, 1H), 2.29-2.25 (m, 1H), 2.22 (t, J= 2.6 Hz, 1H), 2.18 - 1.82 (m, 2H), 1.80 - 1.09 (m, 5H), 0.97 - 0.79 (m, 3H). HRMS ESI-MS (m / z): [M+H]+Expected = 731.3538, Measured = 731.3536

[0176] Synthesis of 4 Dexamethasone-OMs (Simons Jr., S. S. et al. J. Org. Chem. 1980, 45, 3084-3085) (1.0 g, 2.13 mmol, 1 equiv.) was dissolved in anhydrous DMF (7.0 mL) and cooled to 0 °C. NaN3(207 mg, 3.19 mmol, 1.5 equiv.) was added to the mixture and the reaction was warmed to room temperature and stirred for 2 hours. After consumption of the starting material was observed by TLC, the reaction mixture was diluted with ethyl acetate (15 mL) and washed with water (3 x 15 mL). The organic layer was dried with MgSO4, filtered, and concentration under reduced pressure to yield a white solid. The resulting residue was carried forward without further purification. ‘H NMR (600 MHz, CDCI ): δ 7.17 (d, J = 10.2 Hz, 1H), 6.33 (dd, J= 10.2, 1.9 Hz, 1H), 6.11 (s, 1H), 4.38 (d, J= 9.8 Hz, 1H), 4.33 (d, J= 18.7 Hz, 1H), 3.96 (d, J= 18.6 Hz, 1H), 3.21 - 3.07 (m, 1H), 2.61 (td, 7 = 13.8, 6.4 Hz, 1H), 2.47 - 2.33 (m, 3H), 2.30 (s, 1H), 2.18 - 2.09 (m, 1H), 1.93 - 1.71 (m, 3H), 1.54 (s, 3H), 1.39 (d, J = 14.2 Hz, 1H), 1.05 (s, 3H), 0.93 (d, J = 7.3 Hz, 3H). LRMS ESLMS (m / z): [M+H]+Expected - 418.21, Measured - 418.29.

[0177] To a solution of the dcxamcthasonc-N3(961 mg, 2.30 mmol, 1.0 equiv.) in THF (27 mL) was added triphenylphosphine (905 mg, 3.50 mmol, 1.5 equiv.), and the reaction mixture was stirred for 30 minutes at 30 °C. IM HC1 was added (13.5 mL) and mixture was stirred at 30 °C. After three hours, monitoring by TLC showed complete consumption of the starting material and the mixture was acidified with IM HC1 solution to pH=3, diluted with ethyl acetate, then washed with water (3 x 50 mL). The aqueous phase was treated with IM NaOH (aq.) to pH =13, then extracted with ethyl acetate (3 x 50 mL). The combined organic phase was dried with MgSO4, filtered, and concentrated to give a yellow solid. This solid was dissolved in 20 mL CH2CI2 and stirred with trifluoroacetic acid (2 mL) for 10 min, then concentrated under reduced pressure to give a light brown foam as the TFA salt (529 mg, 46% yield).1H NMR (400 MHz, CD3OD) 6 7.37 (d, J= 10.1 Hz, 1H), 6.25 (d, 7 = 9.9 Hz, 1H), 6.05 (s, 1H), 4.40 - 4.17 (m, 2H), 3.81 (d, J = 18.5 Hz, 1H), 3.44 (d, 7= 19.7 Hz, 1H) 3.15 - 3.05 (m, 1H), 2.79 - 2.65 (m, 1H), 2.53 - 2.19 (m, 4H), 1.93 - 1.85 (m, 1H), 1.79 - 1.70 (m, 1H), 1.59 (s, 3H), 1.58 - 1.45 (m, 2H), 1.27 - 1.09 (m, 1H), 1.00 (s, 3H), 0.84 (d, 7= 7.3 Hz, 3H). LRMS ESLMS (m / z): [M+H]+Expected = 392.22, Measured = 392.23.

[0178]

[0179] To N-Boc-7-amino-heptanoic acid (81 mg, 0.33 mmol, 1.3 equiv.) was added HATU (146 mg, 0.38 mmol, 1.5 equiv.), DIPEA (0.36 mL, 2.04 mmol, 6.2 equiv.) and DMF (0.6 mL). The reaction mixture was stirred at room temperature for 10 minutes and a solution of dexamethasone-NH2(129 mg, 0.26 mmol, 1.0 equiv.) in DMF (0.6 ml) was added. The mixture was stirred overnight at room temperature, and then extracted with ethyl acetate, washed with water (2 x 10 mL), saturated NaHCO3(aq) (1 x 10 mL), and brine (10 mL), dried over Mg2SO4and filtered. The filtrate was concentrated under reduced pressure and purified by flash column chromatography (0-100% ethyl acetate in hexanes) to yield a white sticky residue (111 mg, 70.3% yield). ‘H NMR (600 MHz, CD3OD): 57.42 (d, J= 10.1 Hz, 1H), 6.29 (dd, J = 10.1, 2.0 Hz, 1H), 6.08 (s, 1H), 4.27 (d, J = 10.1 Hz, 1H), 4.24 - 4.15 (m, 2H), 3.11 - 3.06 (m, 1H), 3.03 (t, 7= 6.9 Hz, 2H), 2.71 (td, 7= 13.7, 6.0 Hz, 1H), 2.52 - 2.41 (m, 1H), 2.40 - 2.32 (m, 2H), 2.30 - 2.19 (m, 3H), 1.87 (dt, 7= 12.1, 5.6 Hz, 1H), 1.73 (dd, 7 = 13.2, 7.2 Hz, 2H), 1.65 - 1.61 (m, 2H), 1.59 (s, 3H), 1.54 - 1.45 (m, 4H), 1.43 (s, 9H), 1.40 - 1.36 (m, 4H), 1.21 - 1.18 (m, 1H), 0.99 (s, 3H), 0.85 (d, 7 = 7.2 Hz, 3H). LRMS ESI-MS (m / z): [M+H -C5H9O2]+Expected = 519.32, Measured = 519.37.

[0180]

[0181] Boc-protected amine (20.0 mg, 0.032 mmol, 1.0 equiv.) was dissolved in 2 mL 33% TFA in DCM and stirred for 2 hours at room temperature. The mixture was concentration under reduced pressure, and to the resulting residue was added HATU (15 mg, 0.039 mmol, 1.3 equiv.), and DIPEA (0.017 mL, 0.096 mmol, 3.0 equiv.) in DMF (0.5 mL), followed by carboxylic acid (22 mg, 0.032 mmol, 1.0 equiv.). The mixture was left stirring overnight at room temperature and was then extracted with ethyl acetate washed with water (2 x 10 mL), saturated NaHCO3(1 x 10 mL), brine (10 mL), dried over MgaSCL and filtered. The filtrate was concentrated under reduced pressure and purified by flash column chromatography (0-10% McOH in CH2CI2), to yield a white solid (22.0 mg, 58% yield).!H NMR (600 MHz, CDC13): δ 7.25 - 7.08 (m, 2H), 6.84 - 6.73 (m, 4H), 6.73 - 6.57 (m, 3H), 6.44 - 6.34 (m, 3H), 6.34 - 6.21 (m, 2H), 6.10 (s, 1H), 5.62 (dd, J= 8.3, 5.2 Hz, 1H), 5.46 - 5.43 (m, 1H), 4.56 - 4.43 (m, 2H), 4.42 - 4.21 (m, 2H), 4.08 (dd, J = 19.5, 5.6 Hz, 1H), 3.89 - 3.81 (m, 11H), 3.78 (s, 3H), 3.67 (s, 5H), 3.59 (t, J= 7.2 Hz, 1H), 3.40 - 3.28 (m, 2H), 3.11 - 3.08 (m, 1H), 2.92 - 2.73 (m, 2H), 2.69 - 2.42 (m, 3H), 2.42 - 2.26 (m, 3H), 2.26 - 2.15 (m, 2H), 2.10 - 2.05 (m, 1H), 2.00 - 1.86 (m, 1H), 1.88 - 1.49 (m, 14H), 1.42 (d, 7 = 5.7 Hz, 2H), 1.38 - 1.12 (m, 15H), 1.01 (s, 3H), 0.96 - 0.75 (m, 9H). HRMS ESI-MS (m / z): [M+H]+Expected = 1194.6272, Measured = 1194.6258. Synthesis of 5

[0182] To the bromide (Hu, J. et al. J. Med. Chem. 2019, 62, 1420-1442) (670 mg, 1.35 mmol, 1.0 equiv.) was added (S) -pipecolic acid methyl ester (523 mg, 3.65 mmol, 2.7 equiv.), DIPEA (727 μL, 4.05 mmol, 3.0 equiv.) and DMF (5.0 mL). The reaction mixture was heated at 80 °C for 24 hours. After cooling to room temperature, the reaction mixture was diluted in ethyl acetate (50 mL) and washed with water (2 x 50 mL) saturated brine (1 x 20 mL). The organic layer was dried with MgSO4. filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (0-60% ethyl acetate in hexanes) to afford the product as yellow foam (700 mg, 93% yield). NMR (400 mHz, CDCI3) 8 (ppm) 7.73 (d, J - 8.8 Hz, 2H), 7.49 (d, J = 8.9 Hz, 1H), 7.31 (d, 7= 8.8 Hz, 2H), 7.27 (d, 7 = 2.4 Hz, 1H), 6.91 (dd, 7= 8.9, 2.4 Hz, 1H), 6.71 (d, 7= 8.8 Hz, 4H), 4.03 (t, 7= 6.3 Hz, 2H), 3.82 (s, 3H), 3.70 (m, 1H), 3.69 (s, 3H), 3.22 (dd, 7 = 8.1, 4.0 Hz, 1H), 3.06 (dt, 7 = 10.5, 4.9 Hz, 1H), 2.93 - 2.71 (m, 2H), 2.40 - 2.31 (m, 1H), 1.87 - 1.64 (m, 2H), 1.44 - 1.25 (m, 2H). LRMS ESI-MS (m / z): [M+H]+Expected = 560.21, Measured = 560.28.

[0183] To the methyl ester (200 mg, 0.36 mmol, 1.0 equiv.) was added LiOH (43 mg, 3.6 mmol, 10.0 equiv.) and a 1:1:1 mixture of THF:MeOH:H2O (3 mL total). After heating the reaction mixture at 40 °C overnight, the reaction was cooled to room temperature, acidified to pH = 3 with 3M HC1, and extracted with EtOAc:MeOH (1:1, 50 mL) and water (25 mL). The water layer was extracted 2 X with 50 mL EtOAc. The organic fractions were dried with MgSO4, filtered, and concentrated to yield 160 mg of a yellow residue which was used without further purification.1H NMR (400 MHz, CD3OD) δ 77.73 (d, J= 8.1 Hz, 2H), 7.49 - 7.42 (m, 2H), 7.28 (d, J= 8.3 Hz, 2H), 6.97 (dd, J= 9.0, 2.3 Hz, 1H), 6.90 (d, J= 8.4 Hz, 2H), 6.76 (d, J= 8.4 Hz, 2H), 4.50 - 4.28 (m, 2H), 3.87 (s, 3H), 3.71 (s, 3H), 3.79-3.60 (m, 3H), 3.21-3.17 (m, 1H), 2.30-2.20 (m, 1H), 1.96-1.55 (m, 5H). LRMS ESI-MS (m / z): [M+H]+Expected = 546.19, Measured = 546.18.

[0184]

[0185] A BBrs solution (1.45 mL, 1.0 M in CH2CI2, 1.45 mmol, 5.0 equiv.) was added dropwise under N2 to a solution of crude acid (160 mg, 1.0 equiv.) in 10 mL of anhydrous CH2CI2 at 0 °C. The dark-red solution was warmed to room temperature and stirred for 2 hours, then MeOH (0.75 mL) was added dropwise to quench the reaction. The solution was concentrated, and the residue was dissolved in ethyl acetate (10 mL) and aqueous saturated NaHCO3(10 mL) and EtOH (1 mL) were added. The organic layer was separated and dried over anhydrous MgSO4. After filtration, the solution was concentrated and the residue was purified by silica gel flash column chromatography (0-50% MeOH in CH2Q2) to afford the product as a yellow solid (118 mg, 79% yield).1H NMR (400 mHz, CD3OD) 5 (ppm) 7.69 (d, J= 8.9 Hz, 2H), 7.42 (d, J= 8.8 Hz, 1H), 7.27 (d, J= 2.3 Hz, 1H), 7.15 (d, J= 8.6 Hz, 2H), 6.91 - 6.82 (m, 3H), 6.61 (d, J = 8.6

[0186] Hz, 2H), 4.46 - 4.28 (m, 2H), 3.74 - 3.45 (m, 4H), 3.08 (t, J= 11.3 Hz, 1H), 2.21 (d, J = 14.0 Hz, 1H), 1.90 - 1.70 (m, 4H), 1.61 - 1.48 (m, 1H). LRMS ESI-MS (m / z): [M+H]+Expected = 518.16, Measured = 518.17.

[0187] To the carboxylic acid (72.5 mg, 0.14 mmol, 1 .0 equiv.) was added to HATU (79.9 mg, 0.21 mmol, 1.5 equiv.), DIPEA (73 μL, 0.42 mmol, 3.0 equiv.) and amine (60.6 mg, 0.28 mmol, 2.0 equiv.) in DMF (0.8 mL). The mixture was left stirring overnight at room temperature, and was then extracted with ethyl acetate, washed with water (2 x 10 mL), saturated NaHCO3(1 x 10 mL), and brine (10 mL), then dried over MgSO4and filtered. The filtrate was concentrated under reduced pressure and purified by flash column chromatography (0-100% ethyl acetate in hexanes) to yield a light-yellow solid (90.7 mg, 90.5% yield).{H NMR (600 MHz, CD3OD) 8 7.75 - 7.69 (m, 2H), 7.41 (d, J= 8.8 Hz, 1H), 7.27 (d, J = 2.3 Hz, 1H), 7.23 - 7.16 (m, 2H), 6.91 - 6.82 (m, 3H), 6.64 (m, 2H), 6.45 (br. s, 1H), 4.20 - 4.10 (m, 1H), 4.13 - 4.07 (m, 1H), 3.20 - 3.07 (m, 3H), 3.05 - 2.94 (m, 2H), 2.93 - 2.86 (m, 1H), 2.84 - 2.79 (m, 1H), 2.61 - 2.55 (m, 1H), 2.20 - 2.08 (m, 1H), 1.86 - 1.83 (m, 1H), 1.77 - 1.73 (m, 1H), 1.65 - 1.60 (m, 1H), 1.58 - 1.55 (m, 1H), 1.47 - 1.40 (m, 10H), 1.30 - 1.22 (m, 6H). LRMS ESI-MS (m / z): [M+H]+Expected = 716.33, Measured = 716.45.

[0188] Boc-protected amine (40 mg, 0.065 mmol, 1.0 equiv.) was dissolved in 2 mL 33% TFA in CH2Q2 and stirred for 2 hours at room temperature. The mixture was concentrated under reduced pressure, and the resulting residue added to HATU (32 mg, 0.085 mmol, 1.3 equiv.) and DIPEA (0.034 mL, 0.20 mmol, 3.1 equiv.) in DMF (0.6 mL) and the carboxylic acid (54 mg, 0.078 mmol, 1.2 equiv.) was added. The mixture was left stirring overnight at room temperature, and was then extracted with ethyl acetate, washed with water (2 x 10 mL), saturated NaHCO3. (1 x 10 mL), brine (10 mL), dried over Mg2SO4and filtered. Filtrate was concentrated under reduced pressure and purified by flash column chromatography (0-100% ethyl acetate in hexane), followed by reverse phase column (0 - 100% 0.1% TFA in CH3CN to 0.1% TFA in water) to yield a light-yellow solid (11.6 mg, 14% yield). 'H NMR (600 MHz, CD3OD): 67.73 (d, J= 8.9 Hz, 2H), 7.41 (d, J= 8.8 Hz, 1H), 7.27 (d, J= 2.2 Hz, 1H), 7.19 - 7.15 (m, 3H), 6.89 (d, 7= 8.9 Hz, 2H), 6.87 - 6.81 (m, 3H), 6.79 - 6.73 (m, 1H), 6.72 - 6.68 (m, 1H), 6.65 (dd, 7 = 8.2, 2.0 Hz, 1H), 6.63 - 6.59 (m, 2H), 6.59 - 6.56 (m, 3H), 5.57 (dd, 7 = 8.3, 5.4 Hz, 1H), 5.37 (d, 7 = 5.7 Hz, 1H), 4.50 - 4.45 (m, 2H), 4.43 - 4.27 (m, 1H), 4.36 - 4.30 (m, 1H), 4.06 (d, 7 = 13.5 Hz, 1H), 3.86 (t, 7 = 7.3 Hz, 2H), 3.83 - 3.79 (m, 2H), 3.79 (s, 2H), 3.78 (s, 3H), 3.68 (s, 2H), 3.67 - 3.63 (m, 5H), 3.59 - 3.41 (m, 2H), 3.27-3.15 (m, 5H), 2.72 (td, 7= 13.5, 3.0 Hz, 1H), 2.65 - 2.49 (m, 1H), 2.45 - 2.38 (m, 1H), 2.30 - 2.25 (m, 1H), 2.15 - 2.10 (m, 1H), 2.05 - 1 .97 (m, 2H), 1 .92 - 1 .75 (m, 4H), 1 .75 - 1 .65 (m, 3H), 1 .63 - 1 .42 (m, 7H), 1.38 - 1.19 (m, 7H), 0.89 (t, 7= 7.3 Hz, 3H). HRMS ESI-MS (zn / z): [M+H]+Expected: 1291.5883, Measured: 1291.5881.

[0189] Synthesis of 6

[0190] Boc-protected amine (15.1 mg, 0.029 mmol, 1.0 equiv.) was dissolved in 2 mL 33% TFA in DCM and stirred for 2 hours at room temperature. The mixture was concentration under reduced pressure, and to the resulting residue was added HATU (14.4 mg, 0.038 mmol, 1.3 equiv.), and DIPEA (0.015 mL, 0.087 mmol, 3.0 equiv.) in DMF (0.6 mL), followed by carboxylic acid (20.4 mg, 0.035 mmol, 1.2 equiv.). The mixture was left stirring overnight at room temperature and was then extracted with ethyl acetate washed with water (2 x 10 mL), saturated NaHCO3; (1 x 10 mL), brine (10 mL), dried over Mg2SO4and filtered. The filtrate was concentrated under reduced pressure and purified by flash column chromatography (0-10% MeOH in CH2O2), to yield a white solid (20.4 mg, 66% yield).1H NMR (600 MHz, CD3OD): 7.41 (d, J = 10.1 Hz, 1H), 7.32 (t, J = 7.9 Hz, 1H), 7.03 - 6.96 (m, 2H), 6.94 (dd, J = 8.3, 2.6 Hz, 1H), 6.86 (d, 7= 8.2, 1H), 6.78 (d, 7= 2.1 Hz, 1H), 6.72 (dd, 7 = 6.2, 2.1 Hz, 1H), 6.28 (dd, 7 = 10.2, 1.9 Hz, 1H), 6.08 (br. t, 7= 1.8 Hz, 1H), 5.75 (dd, 7 = 8.6, 5.1 Hz, 1H), 5.23 (d, 7= 5.7 Hz, 1H), 4.52 (s, 2H), 4.26 (ddd, 7 = 10.6, 4.1, 2.1 Hz, 1H), 4.18 (s, 2H), 3.81 (s, 3H), 3.80 (s, 3H), 3.44 - 3.37 (m, 1H), 3.35 (s, 1H), 3.27 (t, 7 = 7.1 Hz, 2H), 3.21 (tdd, 7= 13.2, 9.7, 3.8 Hz, 1H), 3.12 - 3.03 (m, 1H), 2.77 - 2.67 (m, 1H), 2.67 - 2.54 (m, 1H), 2.50 - 2.19 (m, 7H), 2.12 - 2.00 (m, 1H), 1.87 (dt, 7= 11.7, 5.5 Hz, 1H), 1.79 - 1.63 (m, 4H), 1.65 - 1.59 (m, 2H), 1.58 (s, 3H), 1.56 - 1.43 (m, 2H), 1.41 - 1.26 (m, 2H), 1.22 (s, 3H), 1.21 (s, 3H), 0.98 (s, 3H), 0.89 (t, 7= 7.5 Hz, 3H), 0.84 (d, 7= 7.2 Hz, 3H). HRMS ESI-MS (m / z): [M+H]+Expected = 1084.5904, Measured = 1084.5919. Synthesis of 7

[0191] Boc-protected amine (40 mg, 0.065 mmol, 1.0 equiv.) was dissolved in 2 mL 33% TFA in CH2CI2 and stirred for 2 hours at room temperature. The mixture was concentrated under reduced pressure, and the resulting residue added to HATU (32 mg, 0.085 mmol, 1.3 equiv.) and DIPEA (0.034 mL, 0.20 mmol, 3.1 equiv.) in DMF (0.6 mL) and the carboxylic acid (46 mg, 0.078 mmol, 1.2 equiv.) was added. The mixture was left stirring overnight at room temperature, and was then extracted with ethyl acetate, washed with water (2 x 10 mL), saturated NaHCO3(1 x 10 mL), brine (10 mL), dried over Mg2SO4and filtered. Filtrate was concentrated under reduced pressure and purified by flash column chromatography (0-100% ethyl acetate in hexanes), followed by reverse phase column (0 - 100% 0.1% TFA in CH3CN to 0.1% TFA in water) to yield an off white solid (2.0 mg, 3% yield).XH NMR (600 MHz, CD3OD): 87.74 (d, J= 8.9 Hz, 2H), 7.41 (d, J= 8.7 Hz, 1H), 7.30 - 7.26 (m, 2H), 7.20 - 7.17 (m, 2H), 7.00 - 6.94 (m, 2H), 6.93 - 6.88 (m, 3H), 6.86 (dd, J = 8.8, 2.3 Hz, 1H), 6.84 (d, J = 8.2 Hz, 1H), 6.76 (d, J = 2.0 Hz, 1H), 6.69 (dd, J= 8.1, 2.0 Hz, 1H), 6.61 (d, J= 8.7 Hz, 2H), 5.72 (dd, J = 8.6, 5.0 Hz, 1H), 5.21 (d, J= 5.8 Hz, 1H), 4.51 - 4.47 (m, 2H), 4.46 - 4.39 (m, 1H), 4.38 - 4.23 (m, 1H), 3.85 - 3.81 (m, 1H), 3.79 (s, 3H), 3.78 (s, 3H), 3.74 - 3.71 (m, 1H), 3.59 - 3.32 (m, 4H), 3.27 - 3.14 (m, 6H), 2.69 - 2.49 (m, 1H), 2.35 - 2.30 (m, 1H), 2.30 - 2.20 (m, 1H), 2.17 - 1.99 (m, 2H), 1.92 - 1.53 (m, 9H), 1.53 - 1.41 (m, 5H), 1.38 - 1.24 (m, 6H), 1.20 (s, 3H), 1.20 (s, 3H), 0.87 (t, J = 7.5 Hz, 3H). HRMS ESI-MS (m / z): [M+H]+Expected: 1181.5515, Measured: 1181.5511.

[0192] Synthesis of 11

[0193]

[0194] To t-Boc-N-amido-PEG9-amine (17 mg, 0.031 mmol, 1.0 equiv.) was added AP1867 (21 mg, 0.031 mmol), HATU (18 mg, 0.046 mmol, 1.6 equiv.), DMF (0.5 mL), and DIPEA (27 μL, 0.155 mmol, 5.0 equiv.). The reaction mixture was stirred overnight at room temperature, then diluted with ethyl acetate (5 mL) washed with water (2 x 5 mL), saturated NaHCO3(1 x 5 mL), brine (5 mL), dried over Mg2SO4and filtered. The filtrate was concentrated under reduced pressure and purified by flash column chromatography (0-10% MeOH in CH2CI2), to yield a colorless residue (30.8 mg, 80% yield). 'H NMR (600 MHz, CDC13) 87.17 (t, J= 7.8 Hz, 1H), 7.12 - 6.94 (m, 1H), 6.94 - 6.82 (m, 1H), 6.82 - 6.73 (m, 2H), 6.73 - 6.58 (m, 3H), 6.41 (s, 2H), 5.62 (dd, J = 8.2, 5.5 Hz, 1H), 5.50 - 5.38 (m, 1H), 5.04 (s, 1H), 4.57 - 4.38 (m, 2H), 3.99 - 3.80 (m, 9H), 3.78 (s, 2H), 3.68 (s, 3H), 3.67 - 3.42 (m, 36H), 3.30 (q, J = 5.3 Hz, 2H), 2.79 (td, J = 13.4, 3.1 Hz, 1H), 2.63 - 2.40 (m, 2H), 2.34 - 2.15 (m, 1H), 2.13 - 1.97 (m, 2H), 1.99 - 1.84 (m, 2H), 1.75 - 1.65 (m, 2H), 1.65 - 1.49 (m, 1H), 1.43 (s, 9H), 0.89 (t, J = 7.3 Hz, 3H).

[0195] Boc-protected amine (21.1 mg, 0.017 mmol) was dissolved in 2 mL 33% TFA in DCM and stirred for 2 hours at room temperature. The p-nitrophenylcarbonate ovalicin derivative (Zhou, G.-C. et al. Euro. J. Med. Chem. 2013, 70, 631-639) (7.6 mg, 0.017 mmol, 1.0 equiv.) was dissolved in 0.25 mL DMF, and deprotected ammonium salt (17.1 pmol) was added in 0.25 mL DMF. To the mixture was added DIPEA (9.2 qL, 0.051 mmol, 3.0 equiv), and the reaction solution was allowed to stir overnight at room temperature. The mixture was then extracted with ethyl acetate (5 mL) washed with water (2 x 5 mL), saturated NaH CO3; (1 x 5 mL), brine (5 mL), dried over Mg2SO4and filtered. The filtrate was concentrated under reduced pressure and purified by flash column chromatography (0-10% MeOH in CH2CI2), to yield a colorless residue (14.0 mg, 57% yield).1H NMR (600 MHz, CDCI3) 87.17 (t, J= 7.8 Hz, 1H), 7.08 - 6.81 (m, 2H), 6.81 - 6.72 (m, 2H), 6.72 - 6.60 (m, 3H), 6.41 (s, 2H), 5.62 (dd, J= 8.2, 5.5 Hz, 1H), 5.52 - 5.42 (m, 1H), 5.24 (s, 1H), 5.22 - 5.16 (m, 1H), 4.53 - 4.42 (m, 2H), 3.89 - 3.79 (m, 10H), 3.78 (s, 2H), 3.68 (s, 3H), 3.67 - 3.48 (m, 41H), 3.43 (s, 3H), 3.35 (q, J = 5.5 Hz, 2H), 2.96 (d, J = 4.3 Hz, 1H), 2.79 (td, J = 13.4, 3.1 Hz, 1H), 2.61 - 2.50 (m, 3H), 2.50 - 2.19 (m, 2H), 2.19 - 2.04 (m, 1H), 1.97 - 1.75 (m, 5H), 1.75 - 1.66 (m, 5H), 1.64 (d, J= 1.3 Hz, 3H), 1.63 - 1.27 (m, 1H), 1.20 (s, 3H), 1.05 (d, J = 13.7 Hz, 1H), 0.95 - 0.73 (m, 3H). HRMS ESI-MS (m / z): [M+H]+Expected = 1440.7787, Measured = 1440.7767.

[0196] Synthesis of 12

[0197]

[0198] To 12-(Boc-amino)dodecanoic acid (94 mg, 0.30 mmol, 1.1 equiv.) was added N- descyclopropanecarbaldehyde olaparib (100 mg, 0.27 mmol, 1.0 equiv.), HATU (134 mg, 0.35 mmol, 1.3 equiv.), DIPEA (0.16 mL, 0.90 mmol, 3.0 equiv.) and DMF (1.5 mL). The mixture was stirred overnight at room temperature, and then extracted with ethyl acetate (10 mL), washed with water (2 x 10 mL), saturated NaHCO? (aq) (1 x 10 mL), and brine (10 mL), dried over Mg2SO4and filtered. The filtrate was concentrated under reduced pressure and purified by flash column chromatography (0-10% MeOH in CH2Q2) to yield a colorless residue (135 mg, 75% yield).1H NMR (600 MHz, CDC13) 6 11.33 - 11.24 (m, 1H), 8.58 - 8.37 (m, 1H), 7.86 - 7.57 (m, 3H), 7.42 - 7.30 (m, 2H), 7.02 (td, 7- 8.7, 5.3 Hz, 1H), 4.56 (br. s, 1H), 4.28 (s, 2H), 3.78 - 3.60 (m, 2H), 3.60 - 3.50 (m, 2H), 3.44 - 3.40 (m, 1H), 3.35- 3.20 (m, 2H), 3.11 - 3.00 (m, 2H), 2.30 (dt, 7 - 43.2, 7.7 Hz, 2H), 1.65 - 1.55 (m, 2H), 1.42 (s, 13H), 1.37 - 1.13 (m, 18H).

[0199]

[0200] Boc-protected amine (135 mg, 0.2 mmol) was dissolved in 2 mL 33% TFA in DCM and stirred for 2 hours at room temperature. The mixture was concentration under reduced pressure, and 14 pmol of the crude product was added HATU (8.2 mg, 0.022 mmol, 1.5 equiv.), and DIPEA (8 μL, 0.043 mmol, 3.0 equiv.) in DMF (0.5 mL), followed by carboxylic acid (10 mg, 0.014 mmol, 1.0 equiv.). The mixture was left stirring overnight at room temperature and was then extracted with ethyl acetate washed with water (2 x 10 mL), saturated NaHCO3(1 x 10 mL), brine (10 mL), dried over Mg2SO4and filtered. The filtrate was concentrated under reduced pressure and purified by flash column chromatography (0-100% MeCN with 0.1% TFA in H2O in 0.1% TFA), to yield a white solid (16.2 mg, 59% yield).1H NMR (600 MHz, CDCI3) δ 10.45

[0201] - 10.24 (m, 1H), 8.54 - 8.38 (m, 1H), 7.84 - 7.60 (m, 3H), 7.42 - 7.29 (m, 2H), 7.18 (ddd, J = 8.6, 7.2, 2.1 Hz, 1H), 7.10 - 6.81 (m, 2H), 6.82 - 6.73 (m, 2H), 6.73 - 6.56 (m, 3H), 6.54 - 6.32 (m, 2H), 5.62 (dd, J= 8.2, 5.5 Hz, 1H), 5.46 (d, J = 5.5 Hz, 1H), 4.48 (s, 2H), 4.28 (s, 2H), 3.88

[0202] - 3.81 (m, 9H), 3.78 (s, 2H), 3.68 (s, 3H), 3.63 - 3.48 (m, 3H), 3.43 (s, 1H), 3.40 - 3.11 (m, 4H),

[0203] 2.79 (td, J= 13.3, 3.0 Hz, 1H), 2.69 - 2.38 (m, 2H), 2.43 - 2.17 (m, 3H), 2.17 - 1.83 (m, 3H),

[0204] 1.80 - 1.47 (m, 9H), 1.37 - 1.10 (m, 17H), 0.99 - 0.73 (m, 3H). HRMS ESI-MS (m / z): [M+H]+Expected = 1239.6388, Measured = 1239.6376.

[0205] Synthesis of 13

[0206]

[0207] To 14 μmol of the TFA’ammonium salt was added HATU (8.2 mg, 0.022 mmol, 1.5 equiv.), and DIPEA (8 μL, 0.043 mmol, 3.0 equiv.) in DMF (0.5 mL), followed by carboxylic acid (10 mg, 0.014 mmol, 1.0 equiv.). The mixture was left stirring overnight at room temperature and was then extracted with ethyl acetate washed with water (2 x 10 mL), saturated NaHCO3(1 x 10 mL), brine (10 mL), dried over Mg2SO4and filtered. The filtrate was concentrated under reduced pressure and purified by flash column chromatography (0-10% MeOH in CH2Q2), to yield a white solid (13.0 mg, 52% yield).!H NMR (600 MHz, CDCL) 5 10.34 - 10.13 (m, 1H), 8.56 - 8.31 (m, 1H), 7.82 - 7.61 (m, 3H), 7.44 - 7.28 (m, 3H), 7.05 (t, J = 8.3 Hz, 1H), 7.01 - 6.91 (m, 2H), 6.84 (dd, J = 8.2, 2.6 Hz, 1H), 6.82 - 6.73 (m, 1H), 6.72 - 6.60 (m, 2H), 5.78 (dd, J= 8.2, 5.6 Hz, 1H), 5.32 (d, J = 5.9 Hz, 1H), 4.49 (s, 2H), 4.28 (s, 3H), 3.85 (s, 4H), 3.85 (s, 3H), 3.82 - 3.63 (m, 4H), 3.63 - 3.51 (m, 2H), 3.43 (s, 1H), 3.40 - 3.21 (m, 5H), 3.16 (td, J= 13.2, 3.2 Hz, 1H), 2.69 - 2.45 (m, 2H), 2.45 - 2.16 (m, 4H), 2.13 - 2.00 (m, 1H), 1.88 - 1.41 (m, 11H), 1.40 - 1.23 (m, 9H), 1.22 (s, 3H), 1.21 (s, 3H), 0.89 (t, 7= 7.5 Hz, 3H). HRMS ESI-MS (m / z): [M+H]+Expected = 1129.6020, Measured = 1129.6016.

[0208] Example 2: Methods & Results

[0209] I. Experimental Methods

[0210] Cell lines

[0211] Adherent cells were cultured in 10 or 15 cm plates at 37 °C in a 5% CO2humidified atmosphere. HeLa, HCT116, and HEK293T cells were obtained from ATCC and were cultured in DMEM supplemented with 10% heat-inactivated fetal bovine serum (HLFBS) and 1% pcnicillin / strcptomy cin .

[0212] Stable Cell Line Generation with Sleeping Beauty Transposase

[0213] Fusion protein constructs were cloned into a pSBtet vector flanked by Sleeping Beauty transposase recognition sites which also encoded constitutive expression of the puromycin resistance gene. The day before transfection, 300,000 cells were seeded into a 6-well plate. The next day, 1.9 μg of transgcnc DNA was mixed with 0.1 μg of Sleeping Beauty Transposasc encoding plasmid in 200 μL of JetPrime buffer, then 4 μL of JetPrime reagent was added. The mixture was gently mixed and left to incubate for 10 minutes at room temperature, after which it was added dropwise to the well. The next morning, media was replaced with fresh cell culture medium. Three days post transfection, antibiotic selection was initiated with 1 μg / mL puromycin until all control cells had died.

[0214] Retrovirus Generation

[0215] One day before transfection, 1.5 million HEK293T cells were seeded into 6 cm dishes. The following day, 130 μL complete DMEM media was added into an Eppendorf tube. 1 μg of transgene cloned into a pMXs vector was added along with 900 ng of the retrovirus pol / gag and 150 ng of VSVg DNA, and gently mixed. PEI (1 mg / mL) was brought to room temperature and gently mixed before adding 6 μL to the DNA mixture. The mixture was gently mixed and incubated for 20 minutes at room temperature. Media in the 6 cm dishes was replaced with fresh complete DMEM. After 20 minutes incubation, the transfection mixture was added drop wise to the 6 cm plate, then the plate was returned to the incubator. The next morning, media was removed and replaced with 5 mL DMEM media containing 30% heat-inactivated fetal serum and 1% Pen / Strep and the plate was returned to the incubator. After 36 hours, the media from the 6 cm plate was collected into 15 mL falcon tube and centrifuged at 1000 RPM for 5 minutes. The supernatant was filtered through a 0.45 pM filter into 300 μL aliquots. Aliquots were stored at - 80 °C.

[0216] Generating Stable Cell Lines with Retrovirus

[0217] On day of infection, cells were seeded at a density of 2 million cells per well in a 6 well plate, and media in the well was added up to 3 mL total volume. 3 μL of polybrene transfection reagent (EMD Millipore Corp. #TR-1003-G) was added to each well. Viral aliquots were thawed at 37 °C, then gently mixed and added to the well. The plate was the centrifuged at 2200 RPM for 45 min at 37 °C, then returned to the incubator. The next morning, the cells were lifted and transferred into a 10 cm plate. When cells reached 70-80% confluency, antibiotic selection was started with 10 μg / mL blasticidin until control cells died. Lentivirus Generation 1 .2 million viral HEK293T cells were seeded per well in a 6 well plate. The next day, 6 μL Mirus-LTl transfection reagent was mixed with 250 μL OptiMEM and left to incubate at room temperature for 15 minutes. 1.5 μg transgene cloned into the pU6 transfer vector was mixed with 0.1 μg gag / pol, 0.1 μg REV, 0.1 μg TAT and 0.2 μg VSVg packaging plasmids. The OptiMEM and Mirus-LTl mixture was then added to the DNA mixture, mixed and left to incubate at room temperature for 15 minutes, then added dropwise to well. Plate was gently swirled to mix, then returned to the incubator. The next morning, media in the well was replaced. 36 hours later, the supernatant was retrieved into 15 mL falcon tubes. The tubes were spun down at 300 g for 5 minutes, then the supernatant was filtered through a 0.45 pm filter into 300 μL aliquots. Aliquots were stored at -80°C. Generating Stable Lines with Lentivirus

[0218] 200,000 cells were seeded per well in a 24 well plate. Polybrene was added (EMD- Millipore TR-1003-G) to a final concentration of 8 μg / ml in a total volume of ImL in a well of a 24 well plate, then viral aliquots thawed at 37 °C were then added drop wise into the well, then returned to the incubator. The next day, media was replaced. 48 hours after infection, antibiotic selection was started with 1 μg / mL puromycin until the control well died. Live Cell Confocal Microscopy

[0219] Adherent cells were plated (35,000 cells / well in an 8-well chamber slide) one day before small molecule treatment. Doxycycline-inducible lines were plated two days before small molecule treatment at half the seeding density. One day before treatment, cells are treated with doxycycline to a final working concentration of 1 μg / mL in 250 μL of complete growth media. On the day of treatment, wells are gently rinsed with 2 x 300 μL PBS, then incubated with 250 pl of complete phenol red-free growth media with small molecules added for the indicated time. After the indicated time, 1 μL of a fresh Hoechst 33342 solution (0.5 μg / μL in PBS) was added directly to the existing media in each well to achieve a final Hoechst 33342 concentration of 2 μg / mL, and incubated for 10 minutes. Cells were imaged with a Nikon AIR confocal microscope using a Plan Fluor 60X oil immersion, 1.30-numerical aperture objective. The microscope was equipped with a 405-nm violet laser, a 488-nm blue laser, a 561-nm green laser, and a 639-nm laser. Images were exported and analyzed using the FIJI software package. Fixed-Cell Confocal Microscopy Adherent cells were plated (50,000 cells / well in an 8-well chamber slide) one day before the experiment. Cells were then washed three times with DPBS and fixed with 4% paraformaldehyde in PBS for 15 minutes at room temperature, washed three times, and permeabilized with 0.1% Triton for 5 minutes at room temperature. Cells were blocked in 10% goat serum in PBS for 1 hour at room temperature, and incubated with primary antibody overnight at 4°C. Cells were washed with PBS three times, then incubated with secondary antibody and DAPI for 1 hour at room temperature. Cells were washed with PBS and imaged with a Nikon AIR confocal microscope using a Plan Fluor 60X oil immersion 1.30-numerical aperture objective. The microscope was equipped with a 405-nm violet laser, a 488-nm blue laser, a 561-nm green laser, and a 639-nm laser. Images were exported and analyzed using the FIJI software package.

[0220] Custom Imaging Analysis Pipeline Construction:

[0221] 1) Segmentation: A binary image is generated from a nuclear stained image (e.g. DAPI) of a field of view using Otsu thresholding. This binary image is then used as a mask to label coordinates within an acquired field of view corresponding to nuclei. Watershed transform is carried out to segment touching nuclei, and individual nuclei within a field of view are assigned with different numerical labels starting from 1 (“nlabels”).

[0222] 2) Generating masks: “Celllabels” - “nlabels” are then expanded by 6 pixels circumferentially to capture cell area. At the same time, “nlabels” is also expanded by 3 pixels to generate “expandednlabels”. Cytoplasmic labels (“clabels”) are obtained by subtracting the “expandednlabels” from “celllabels”. “Nlabels” is also shrunk by 3 pixels to avoid taking in nuclear boundary measurements for the cytoplasm or nuclear readings. These pixel numbers can also be user defined.

[0223] 3) Gating: Average nuclear stain intensities per area (“avg. nuc int”) are then tabulated for these individual nuclei, and a histogram is generated. Kernel density estimation is used to generate a probability density function (PDF) from this histogram. A normal distribution centered around the main peak of the PDF based on the full width at half maximum (FHWM) is then generated and overlayed. Assuming the population “avg nuc int” follows a normal distribution, the ends of the normal distributions are set as the gate bounds. Any nuclei without “avg nuc int” within the set gate bounds is gated out and labels for those nuclei and their respective cytoplasmic label are dropped to give “gatednlabels” and “gatedclabels”. Alternatively, if the user wishes to set fixed values for the gate bounds, this can also be passed in as an argument in the script.

[0224] 4) Summing intensities per cell: Fluorophore images for this field of view are overlay ed with the “gatednlabels” and “gatedclabels” to extract flurophore intensities tabulated for every single nuclear and cytoplasmic label. Average fluorophore intensites for each nuclei / cytoplasm label are also generated by dividing the intensity over the area of the label, to give a nuclear and cytoplasmic flurophore concentration (pixel intensity per area) per cell.

[0225] 5) Calculations and output. For each cell, the average fluorophore pixel intensity per area is then used in the following calculation to give percent nuclear fluorophore: percent nuc GFP per label

[0226] These values, including the average fluorophore intensity per label, are tabulated in a dataframe and output to an excel with a separate sheet for each condition. A summary of the mean for each value for each condition is also tabulated and output as an excel sheet. In addition, a folder is also created containing the gating histogram, as well as overlay masks onto the fluorophore images and the segmentation and nuclear masks from the original nuclear stain images for each field of view.

[0227] Modified Imaging Analysis Pipeline for relative protein ratio estimation and validation

[0228] The pipeline built as described above was improved by plotting each individual cell label onto the overlay of the masks on the fluorophore images. This facilitates the user to be able to visually inspect the image and correlate the visual analysis of that cell with the pipeline derived metrics for that cell. 10 cells for a field of view of a treatment condition were manually picked across a range of protein expression levels by visual analysis. For the 10 cells in each image, the drawing tool in ImageJ was used to manually demarcate the cell boundary using the cytoplasmic protein fluorophore image. For each demarcated cell area, the raw integrated density of each fluorophore channel was obtained using the ImageJ measure function. For each cell, the relative ratio of the two fluorophores was obtained by dividing the raw integrated density of GFP by the raw integrated density of RFP to give GFP / mCherry whole cell.

[0229] For each cell analyzed via manual integration as detailed above, their average fluorophore nuclear intensity and cytoplasmic intensity obtained from the image analysis pipeline were summed to give an estimate of whole cell fluorophore intensity, and a ratio of this value between the two fluorophores was obtained to give the relative protein ratio estimate GFP / mCherry masked.

[0230] The estimates of the relative protein ratio calculated from pipeline metrics (GFP / mCherry masked) was plotted against the relative protein ratio obtained from manual visual integration using ImageJ (GFP / mCherry whole cell), for all 10 cells in each condition, for 3 repeats. Simple linear regression was used to plot the trendline between the two values, and the Pearson correlation coefficient R value was calculated for each graph.

[0231] Single cell plots and best fit curves to extract theoretical maximal relocalizability

[0232] Percentage nuclear fluorophore metrics for each single cell was plotted against the GFP / mCherry masked values calculated from the image analysis pipeline. Data from 3 repeats were combined into a single plot for each condition and outliers that had GFP / mCherry masked values beyond 3 standard deviations away from the mean were gated out. For nuclear import cases, agonist sigmoidal best-fit curves were plotted using the equation of Y=Bottom + (XAHillslope)*(Top-Bottom) / (XAHillSlope + EC50AHillSlope). For nuclear export cases, antagonist sigmoidal best-fit curves were plotted using the equation of Y=Bottom + (Top- Bottom) / (l+(IC50 / X)AHillSlope). The y values at which these best-fit curves plateaued were identified as the theoretical maximum relocalization for that condition. Relative relocalizability and localization metric calculations

[0233] Rclocalizabilty score is taken as the maximum rclocalization demonstrated (extracted from the plateau of the best-fit curve) minus the DMSO treated percentage nuclear fluorophore, over the maximal theoretical possible change in their respective direction of movement. Relocalizability score is on a scale of -1 to 1, where -1 is the most relocalizable nuclear protein moving from the nucleus to cytoplasm, and 1 is the most relocalizable cytoplasmic protein moving from the cytoplasm to the nucleus.

[0234] Relative localization score is given by subtracting the absolute value of the relocalizability score from the initial percentage fluorophore in the steady state primary compartment.

[0235] Cytoplasmic localization score = DMSO treated protein % cytoplasmic - |relocalizability score| Nuclear localization score = DMSO treated protein % nuclear - |relocalizability score|

[0236] Flow Cytometry

[0237] Adherent cells were lifted with trypsin and tran sf erred into an Eppendorf or conical tube using complete media. Cells were pelleted at 300g and washed three times with PBS. Cells were resuspended in PBS and analyzed on either a BD Accuri C6+ or LSR II flow cytometer. Endogenous Tagging of Proteins Using Modified PITCh

[0238] To facilitate ease of cloning different target sgRNAs into the cassette, a modified all-in- one CRIPSR-Cas9 vector was made containing two orthogonal U6 promoter-stem loop pairs from the parental PITCh vector (Sakuma, T., et al. Nat. Protoc. 11, 118-133 (2016)). The PITCH protocol was then followed to insert donor sequences into endogenous targets. Briefly, a day before transfection, adherent cells were seeded at a density of 25,000 cells in a 10 cm dish. On the day of transfection, media was replaced with 7 mL Opti-MEM. Both 1.2 μg of guide vector (containing target sgRNA, PTTCh sgRNA and Cas9) and 0.6 pg of donor vector were added to 500 pl of Opti-MEM in an Eppcndorf tube. To another Eppcndorf tube containing 500 pl Opti- MEM was added 30 pl Lipofectamine 2000. Both Eppcndorf tubes were gently mixed and left to incubate for 5 minutes at room temperature. The two solutions were then mixed and incubated for 30 minutes at room temperature, after which the mixture was added drop wise to the 10 cm plate containing cells. Cells were incubated for 24 hours, after which, the media was replaced with 10 mL of complete growth media. 72h after transfection, media was replaced with complete growth media containing puromycin (1 μg / ml), and selection continued by replacing media with fresh complete growth media supplemented with puromycin every two days. After complete death of control cells, puromycin selection was stopped and cells were expanded for immunoblotting.

[0239] Immunoblotting for Endogenously Tagged Proteins

[0240] Cells were lifted with trypsin then washed with PBS three times and lysed with RIPA buffer supplemented with protease inhibitor cocktail (Roche) and 0.1% Benzonase (Millipore- Sigma) on ice for 15 minutes in Eppendorf tubes. The lysates were centrifuged at 21,000g for 15 minutes at 4 °C. The supernatant was collected, and the protein concentration was determined by BCA assay (Pierce). Equal amounts of lysates were loaded onto 4-12% Bis-Tris gel and separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The gel was then transferred onto a nitrocellulose membrane and blocked with 5% milk in TBS-T for 1 hour at room temperature. The membrane was incubated with primary antibody overnight at 4 °C, and washed 3 times with TBS-T. Subsequently, the membrane was incubated with secondary antibody for 1 hour at room temperature and washed three times with TBS-T for visualization with an Odyssey CLx Imager (LI-COR).

[0241] Preparation of antibody cross-linked beads for immunoprecipitation

[0242] Immunoprecipitation with cross-linking was adapted from the Pierce Crosslink Magnetic IP / Co-IP Kit (Cat. 88805, Thermo Scientific). Beads were prepared by conjugation with mCherry Polyclonal Antibody (PA5-34974, Invitrogen). For each immunoprecipitation reaction, 2 mL of IX Modified Coupling Buffer was made by diluting 0.1 mL of 20X Coupling Buffer and 0.1 mL of IP Lysis / Wash Buffer with 1.8 mL of ultrapure water. The bottle of Pierce Protein A / G Magnetic Beads was vortexed to obtain a homogeneous suspension from which 25 μL of beads was aliquoted into a microcentrifuge tube. The tube was placed on a magnetic stand to collect the beads for 1 minute. Storage solution was removed and discarded before rinsing the beads with 2 x 500 μL of IX Modified Coupling Buffer. 7.5 μL of anti mChcrry antibody (PA5- 34974, Invitrogen) was diluted to a final concentration of 0.5 μg / μL with ultrapure water, 20X Coupling Buffer (diluted 1:20) and IP Lysis / Wash Buffer (diluted 1:20). 100 μL of the prepared antibody solution was added to the beads and incubated on a rotating platform for 15 minutes at room temperature. Beads were gently flick-mixed every 5-10 minutes during incubation to ensure that the beads stayed in suspension. The beads were collected with a magnetic stand and the supernatant was removed and discarded. The beads were washed with 1 x 100 μL IX Modified Coupling Buffer and 2 x 300 μL of IX Modified Coupling Buffer. 217 μL of DMSO was added to a fresh tube of DTT to prepare a 10X solution (25 mM). This stock solution was mixed, then diluted 1:100 in DMSO to give a 0.25 mM DSS solution. 2.5 μL of 20X Coupling Buffer, 4 μL of 0.25 mM DSS and 43.5 μL of ultrapure water was added to the beads and the beads was incubated for 30 minutes at room temperature on a rotator. The beads were vortexed every 10-15 minutes during incubation to ensure that the beads stayed in suspension. Beads were collected with a magnetic stand and the supernatant removed. 100 μL of Elution Buffer was added to the beads and gently mixed for 5 minutes at room temperature on a rotating platform. Beads were collected with the magnetic stand, and this process was repeated twice more. Finally, 200 μL of cold RIPA lysis buffer was added the beads and tubes were inverted to mix. Beads were collected with a magnetic stand, and supernatant was removed to afford the antibody-cross- linked beads.

[0243] Co-immunoprecipitations with TRAMs

[0244] For mCherry-eDHFR-NES pulldown, antibody cross-linked beads were incubated with lysate containing 50 μg of protein made up to a total final volume of 200 μL. To this lysate was added TRAM 1 to a final concentration of 100 nM. The solution was rotated overnight at 4 °C. Prior to elution, beads were washed three times with RIPA buffer containing 100 nM of TRAM 1. Proteins were then eluted off the beads by boiling in 60 μL of elution buffer (5% SDS, 20 mM DTT) at 95 °C for 10 minutes. Half the volume of the eluate and 2 μg of protein input and flowthrough were loaded onto a 4-12% Bis-Tris gel and separated by sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE). The gel was then transferred onto a nitrocellulose membrane and blocked with 5% milk in TBS-T for 1 hour at room temperature. The membrane was incubated with primary antibody overnight at 4 °C, and washed 3 times with TBS-T. Subsequently, the membrane was incubated with secondary antibody for 1 hour at room temperature and washed three times with TBS-T for visualization with an Odyssey CLx Imager (LI-COR).

[0245] For pulldown of METAP2, 50 μg of protein extract was diluted to a total volume of 200 μL in RIPA buffer and incubated with 50 μL of magnetic agarose beads (Chromotek, GFP Trap (GTMA-20)). TRAM 11 was added to a final concentration of 100 nM and the solution was rotated overnight at 4 °C. Prior to elution, beads were washed 3 times with RIPA buffer. Proteins were then eluted off the beads by boiling in 60 μL of elution buffer (5% SDS, 20 mM DTT) at 95 °C for 10 minutes. Half the volume of the eluate and 2 μg of protein was loaded for the input and flowthrough lanes onto 4-12% Bis-Tris gel and separated by sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE). The gel was then transferred onto a nitrocellulose membrane and blocked with 5% milk in TBS-T for 1 hour at room temperature. The membrane was incubated with primary antibody overnight at 4 °C, and washed 3 times with TBS-T. Subsequently, the membrane was incubated with secondary antibody for 1 hour at room temperature and washed three times with TBS-T for visualization with an Odyssey CLx Imager (LI-COR).

[0246] Immunoprecipitations for immunoblotting of endogenous tagged proteins.

[0247] For immunoprecipitation of endogenous SOS1, 4 mg of protein extract was diluted to a total volume of 250 μL in RIPA buffer and incubated with 50 μL of magnetic agarose beads (Chromotek, GFP Trap (GTMA-20)), overnight at 4 °C. Prior to elution, beads were washed 3 times with RIPA buffer. Proteins were then eluted off the beads by boiling in 60 μL of elution buffer (5% SDS, 20 mM DTT) at 95 °C for 10 minutes. Half the volume of the eluate and 50 μg of protein was loaded for the input, flowthrough and wild-type HEK293T cell lanes onto 4-12% Bis-Tris gel and separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS- PAGE). The gel was then transferred onto a nitrocellulose membrane and blocked with 5% milk in TBS-T for 1 hour at room temperature. The membrane was incubated with primary antibody overnight at 4 °C, and washed three times with TBS-T. Subsequently, the membrane was incubated with secondary antibody for 1 hour at room temperature and washed three times with TBS-T for visualization with an Odyssey CLx Imager (LI-COR). Sodium Arsenite Treatment and Imaging Adherent cells were plated (25,000 cells / well in an 8-well chamber slide) two days before the experiment. One day before treatment, cells were treated with doxycycline to a final working concentration of 1 μg / mL in 250 μL of complete growth media. On the day of the experiment, cells were treated with 30 pM sodium arsenite in 250 μL complete phenol red-free media for an hour to induce stress granule formation. After an hour, small molecules solutions were added directly into the media in the well, and cells were incubated for another 3 hours. Cells were then washed three times with PBS and fixed with 4% paraformaldehyde in PBS for 15 minutes at room temperature, washed three times, and permeabilized with 0.1% Triton for 5 minutes on ice. Cells were blocked in 10% goat serum in PBS for 1 hour at room temperature then incubated with primary antibody overnight at 4°C. Cells were washed with PBS three times, then incubated with secondary antibody and DAPI for 1 hour at room temperature. Cells were washed with PBS and imaged with a Nikon AIR confocal microscope using a Plan Fluor 60X oil immersion 1.30- numerical aperture objective. The microscope was equipped with a 405-nm violet laser, a 488- nm blue laser, a 561-nm green laser, and a 639-nm laser. Images were exported and analyzed using the FIJI software package.

[0248] For continuous imaging, adherent cells were plated (25,000 cells / mL) in a 24 well glass bottom plate (CELLTREAT Scientific Products 229125) two days prior to treatment. One day before treatment, cells were treated with doxycycline to a final working concentration of 1 μg / mL in 500 μL of complete growth media.

[0249] On the day of imaging, media in the well was replaced with complete phenol red-free media containing 2 μg / mL Hoechst 33342 and 10 pM sodium arsenite. After an hour, the media in the wells was replaced with complete phenol red- free media containing 2 μg / mL Hoechst 33342, 10 pM sodium arsenite and the requisite concentration of small molecule. Immediately after treatment was administered, timelapse imaging was initiated. The plate was maintained at 37°C with 5% of CO2in a stage top incubator (Okolab) over the course of 2.5 hours. Images were acquired by manually capturing images every 5 minutes at a fixed field of view. The Nikon AIR confocal microscope Plan Fluor 60X oil immersion 1.30-numerical aperture objective was used.

[0250] Dorsal Root Ganglion (DRG) Neuron Harvesting and Culturing

[0251] Two days before harvesting DRGs, 250 uL of poly-D lysine (PDL) was added to the bottom of an 8-well chamber slide or 24-well plate to coat the bottom of the well evenly. The slide was incubated at 37 °C in a sterile environment. The next day, PDL was removed, and the wells were washed with tissue culture-grade sterile water. The plate was left to dry with the lid open within a sterile biosafety cabinet for ~ Ih. The slides were subsequently wrapped with parafilm then left in a 4 °C refrigerator.

[0252] Explant Harvesting: The day of neuron harvesting, E18 embryos were obtained from a pregnant rat. Dissection was done to isolate the DRGs. DRGs were kept in a 6 cm plate filled with HBSS + HEPES (cold) while dissection was ongoing. DRGs harvested from different embryos were separated into different plates. After completing dissection, the plates were placed under a dissection microscope to remove any remaining membranes surrounding the DRGS. The DRGs were then transferred into a 1.5 mL tube filled with 600 mL HBSS + HEPES in ice for transfer.

[0253] After DRGs had settled, the HBSS was carefully pipetted off, making sure not to disturb the pellet. DRGs were washed 10 x 1 mL HBSS + HEPES. After removal of the final wash, 1 mL of CO2and 37 °C equilibrated, 0.2 pm filtered neurobasal media supplemented with FUDR (40 pM) and NGF (50 ng / mL) was added, and the pellet was slowly pipette mixed to suspend the DRGs. Single DRGs were seeded in the middle of a PDL coated well in the chamber slide in 15 pl of media. The slide or plate was left to incubate at 37 °C for 30 minutes in a 5% CO2incubator to allow DRGs to adhere, then 250 μL of neurobasal supplemented with FUDR and NGF was carefully added to the well. Neurobasal media supplemented with FUDR and NGF was replaced every other day.

[0254] AAV Production

[0255] On day 0, HEK293T cells were seeded in a 6-well plate for 70% confluency on Day 1. On Day 1, HEK293T cells were co-transfected with plasmids encoding the transgene, RepCap2, and adenovirus E4, E2A, and VA using the PEI MAX transfection reagent according to the manufacturer’s protocol. The morning of Day 2, media was replaced with complete DMEM. On Day 3, the viral supernatant was removed and filtered through a 0.45 pm filter. DRG Neuron Infection with AAV

[0256] Two days post explant seeding, media in the wells were replaced with 250 μL 0.2 pm filtered neurobasal media supplemented with FUDR (40pM) and NGF (50 ng / mL). 8 μL of NMNAT1 transgene viral supernatant and 12 μL of eDHFR transgene viral supernatant was added to each well. 4 days post-infection, neurons were examined for transgene expression. Axotomy and Neuron Imaging

[0257] Prior to the cut, fluorescence images of entire cxplants were acquired in an cpi- fluorescence microscope (Leica DMI 6000B) using a 10X (0.32 NA) objective. The microscope is equipped with ORCA-Flash4.0 Digital CMOS camera, Lumencor SOLA light source, and filter sets: 370-39 / 409 / 448-63 nm (blue emission), 484-25 / 505 / 524-32 nm (green emission), 560- 32 / 581 / 607-40 nm (red emission), and 640-19 / 655 / 680-30 nm (far-red emission).

[0258] Biopsy punch (1.0 mm, Royaltek) was sterilized with 70% EtOH, then dipped into neurobasal media. The biopsy punch was used to severe the cell body from the neurites. The detached cell body was then extracted with sterilized tweezers. To ensure complete removal of the cell body, fluorescence images of entire explants were acquired again in an epi-fluorescence microscope (Leica DMI 6000B) using lOx (0.32 NA) objective post-cut.

[0259] To observe degeneration of the neurites, axon termini and the proximal axon region were imaged with a Nikon AIR confocal microscope using a Plan Fluor 60X oil immersion at Oh, 3h, 6h, 12h, 24h, 48h, 72h, 96h, post injury.

[0260] Axonal degeneration quantification

[0261] Axon degeneration was quantified using a degeneration index (DI) calculated using Image! (v 1.53) as previously described (Sasaki, Y., et al., J. Neurosci. 29, 5525-5535 (2009)). Briefly, mRuby3 signal was used as a marker of the axon. The mRuby3 channel images were binarized, such that axons were converted to white and all other regions black. The total number of white pixels were defined as total axon area. Axonal fragmentation in degenerating axons leads to their particulate structure, unlike healthy axons which are continuous and intact. To detect degenerated axons, the particle analyzer module of ImageJ was used and the area of particles was counted. Since a 60X objective was used, particles were defined as having a size of 0 - 30,000 pixels and circularity above 0.2. The degeneration index (DI) was calculated as the ratio of fragmented axon area over total axon area.

[0262] II. Results

[0263] Nuclear localization and export sequences are recognized by members of the karyopherin family of shuttle proteins to regulate bidirectional transport of cargo between the nucleus and the cytoplasm. To overcome the inherent localization of a protein via protein transport coupling would require 1) a sufficiently strong opposing localization sequence on the shuttling protein and 2) a requisite stoichiometry of shuttling protein. To examine these parameters, nicotinamide nucleotide adenylyltransferase 1 (NMNAT1 ) was chosen as a model nuclear-localized target protein for rclocalization. Since NMNAT1 possesses only a single predicted nuclear localization sequence (NLS) and no known direct DNA-binding domain, it might be susceptible to small molecule-mediated relocalization. To enable the study of proteins lacking known-small molecule binders, the bifunctional molecule 1 was synthesized (FIG. IB), which engages the E. coli dihydrofolate reductase domain (ecDHFR) and the FKBP12F36Vdomain both of which have found widespread use due to their tight binding affinities and orthogonality to most mammalian proteins. An mCherry fusion to ecDHFR and the nuclear export sequence from the HIV-1 REV protein was generated to act as a shuttle protein. As transient transfection results in a range of confounding variables for examining the relative stoichiometries between two proteins and results in non-endogenous, high levels of transgene expression, mCherry-ecDHFR-NES and FKBP12F36V-GFP-NMNAT1 were stably incorporated into HeLa cells (FIG. 1C). Complex formation between both partners mediated by 1 was demonstrated by co -immunoprecipitation (FIG. ID). Clonal export line A (EL-A) was isolated with a relative mCherry / GFP mean fluorescence intensity ratio of 1.0, which demonstrated a clear, dose-dependent translocation of NMNAT1 to the cytoplasm upon treatment with 1 (FIG. IE), an effect that was abrogated at higher concentrations. Simultaneous treatment with the unlinked warheads 2 and 3 had no effect on protein localization (FIGS. 6A-6B).

[0264] The quantification of nucleocytoplasmic transport when studying two proteins simultaneously has traditionally been done by a colocalization metric across a set of representative images. An open-source computational imaging analysis pipeline that provides single cell-level analysis of two different proteins independently in both the nucleus and cytoplasm would be the most accurate approach for gauging protein transport and comparing different target proteins and shuttle proteins (FIG. IF). This custom analysis pipeline was built by first segmenting cells using a nuclear stain reference, then masking cells to capture both a nuclear area and cytoplasmic area. A gating filter on nuclear intensities was applied to remove aberrantly high nuclear- stained objects such as debris and dead cells. Finally, the intensities per cell for the nuclear masked area and cytoplasmic masked area were summed and averaged to give a pixel intensity per area measurement akin to the relative concentration of fluorophore in the nucleus and cytoplasm for each cell. This approach was applicable to numerous cell types and densities (FIGS. 7A-7D). The quantitative analysis pipeline was used to examine dose-, shuttle protein- and stoichiometry- dependent rclocalization. A concentration-dependent hook effect was observed with 1 on the transport of NMNAT1 (FIG. 1G). Quantification of relocalization also revealed that while NMNAT1 was readily extracted to the cytoplasm with 1, NMNAT1 did not possess a sufficiently strong NLS to partially redistribute mCherry-ecDHFR-NES to the nucleus. To examine the impact of relative stoichiometry between NMNAT1 and ecDHFR-NES, two additional clonal export cell lines (EL-B,C) with varying mCherry:GFP ratios were isolated (FIG. 6C). When treated with 1, cell lines with higher mCherry:GFP ratios exhibited a high degree of NMNAT1 redistribution to the cytoplasm (FIG. 1H). Cell lines with intermediate ratios resulted in diffuse NMNAT1 localization. Cells with the lowest relative expression levels of mCherry to GFP (EL-C) exhibited 10% NMNAT1 relocalization upon treatment with 1 (FIG. 6D). When cells were cotreated with leptomycin B (LMB), an inhibitor of nuclear export by exportin 1, along with 1, no relocalization of NMNAT1 was observed and an enrichment in nuclear mCherry resulted (FIGS. 6D-6G). Similar to EL-A, cotreatment with 2 and 3 did not cause protein relocalization in EL-B,C (FIGS. 6D-6G). No degradation was observed as a function of 1 in four clonal cell lines (FIGS. 6H-6I). These results support active NES-driven redistribution of NMNAT1 through small molecule-mediated coupling.

[0265] To examine if diffuse proteins can be sequestered in the nucleus by non-DNA binding proteins, cell lines stably expressing mCherry-ecDHFR without an NES as well as FKBP12F36V- GFP-NMNAT1 were generated. Clonal import cell lines A-C (IL-A-C) with relative mCherry:GFP ratios spanning three orders of magnitude (FIG. 8C) were isolated and analyzed for their ability to sequester mCherry upon treatment with 1. The initial percentage of nuclear mCherry was -50% in all cell lines, consistent with diffuse localization. After treatment with 1, lines IL-A and IL-B with relative mCherry:GFP ratios of 0.001 and 0.1, respectively, were both capable of significant sequestration of mCherry (80% nuclear) (FIGS. II, II, and 8 A, 8D, and 8E). Cotreatment with 2 and 3 had no effect on mCherry localization (FIG. 8B). IL-C, with a relative inCherry :GFP ratio of 1.0 did not exhibit a large enrichment of nuclear mCherry upon treatment with 1 (FIGS. 8D, 8F). No diffusion of FKBP12F36V-GFP-NMNAT1 was observed in cells due to coupling to mCherry-ecDHFR (FIG. 8G). Treatment with 1 did not lead to degradation of either mCherry or NMNAT1 in all four clonal cell lines (FIGS. 8H-8I). Together, these data demonstrate that sufficient levels of anchor or shuttle enforce TRAM-induced rclocalization of a target protein.

[0266] Nuclear hormone receptors such as the estrogen receptor (ERa) and glucocorticoid receptor (GR) exhibit ligand-dependent translocation from the cytoplasm to the nucleus to exert downstream transcriptional activation (FIG. 2A). Several agonists or antagonists of nuclear hormone receptors could be repurposed to hijack the nuclear trafficking capabilities of these proteins. These ligands have previously been incorporated into bifunctional molecules which act as degraders or transcriptional activators. To demonstrate the potential of these receptors as nuclear shuttles, 4-7 (FIG. 2B), which utilize dexamethasone and raloxifene-based warheads known to engage but not downregulate GR and Era, were synthesized. Using ectopically expressed model constructs, these molecules were validated to engage GR and ERa to nuclear enhance FKBP12 and FKBP12F36V, and that ternary complex formation is necessary for this relocalization (FIGS. 9-12).

[0267] To effectively relocalize a target protein, a TRAM must sufficiently engage a shuttle protein capable of overcoming the target’s intrinsic localization. To develop a metric that details a protein’s relative relocalization ability, polyclonal cell lines containing a set of genetic constructs pairing GR and ERa against well-characterized NESs were generated (FIG. 2C). the GR or ERa lines containing NES -tagged targets were treated with varying concentrations of the relevant TRAM (4 or 5), then the relocalization of the NES-tagged protein as well as the nuclear hormone receptor was assessed (FIGS. 2D-2E). Variable degrees of target relocalization dependent both on the shuttle identity (ERa or GR) as well as the NES sequence of the target were observed. For GR, ligand-activated relocalization was observed. ERa remained nuclear regardless of the presence of TRAM. Despite different relative steady-state distributions of ERa and GR prior to TRAM treatment, the relative relocalizabilities of the NES-tagged target proteins remained consistent. ERa was able to partially relocalize the HIV-1 REV NES-containing protein, while the HIV-1 REV NES-containing protein caused partial nuclear export of GR (FIG. 2E). To analyze the relative strength of a small panel of NLSs, they were paired against HIV-1 REV NES (FIG. 2F) using 1 and a gradation in the relocalization ability of the different NLS constructs was observed.

[0268] Using a doxycycline-inducible promoter system, a heterogeneous population of cells containing each pair of proteins was generated which enabled a comparison of the effects of shuttle-to-target ratios across sequences and receptors. The image analysis pipeline was utilized to estimate the ratios between fluorophorcs on a single-cell basis. This analysis was validated by comparison to ratios obtained from manual integration of fluorophore intensity in TRAM- induced nuclear import and export experiments. This analysis was then applied to the comparative NES and NLS relocalization datasets. For each pair, best-fit dose-response curves were derived from data examining protein localization as a function of the relative shuttle-to- target ratio on a per cell basis throughout the entire population. From this analysis the theoretical maximum relocalization of a target as well as the sensitivity of that target's relocalization to the relative ratio of shuttle-to-target protein was calculated. To compare optimal dose-response curves, the concentrations of TRAM which resulted in the highest theoretical maximum movement for each target were selected. Each of the four NES sequences paired with ERa or GR were compared and the effective ratio (ER50) for relocalization was lower for each NES when paired with ERa and the theoretical maximum degree of relocalization was higher (FIG. 2G). While the relative relocalizability between HIV-1 REV NES and MEK1 NES was unable to be distinguished using ERa as a shuttle, clear differences were observed when employing GR as a shuttle protein (FIG. 2H). Thus, the relative relocalizability between targets was able to be distinguished by comparing them across different shuttles. Cells with lower ratios of GR to HIV- 1 REV NES abolished TRAM-mediated nuclear GR enhancement, and reversed it to result in GR nuclear export (FIG. 21). Similarly, the ability of different NLS sequences to be relocalized by the HIV-1 REV NES was compared. A clear trend in relocalizability was observed across different nuclear localization sequences, demonstrating this analysis can be applied to both nuclear import and export (FIG. 2J). Together, these data enable quantitative comparisons of relocalization across target proteins and shuttle proteins as a function of protein ratios. A metric was developed where numerical difference from zero reflects the degree of relocalizability. The observed change in target localization was normalized by the absolute difference between the steady-state localization and complete sequestration in that compartment (FIG. 2K). The relative ranking for relocalization scores amongst the four NES sequences examined was IKBα > P53 > MEK1 > HIV-1 REV. Likewise, the relative ranking for relocalizability of the NLS sequences was NMNAT1 > SV40 > P53 > NPM1. By combining relocalizability with a steady-state distribution descriptor, a localization score was generated that allowed differentiation of the localization strengths of proteins with similar steady-state distributions, such as HIV-1 REV and MEK1 (FIG. 2L). Across the NLS series, localization strength paralleled relocalizability. These metrics suggest intrinsic relocalization abilities for certain sequences and shuttles and imply a hierarchy that may be inferred from differential pairings of candidate shuttles and targets.

[0269] Mislocalized transcriptional regulators and RNA-binding proteins are hallmarks of several cancers and neurodegenerative diseases. Targeted approaches which return these proteins to the nucleus might help ameliorate disease-driving phenotypes. The ability to relocalize three mutant proteins known to exhibit aberrant localization in disease was examined. SMARCB1Q318Xis a mutant C-terminal truncation of SMARCB 1 found in atypical teratoid / rhabdoid tumors which has been reported to exhibit cytoplasmic localization. Mislocalized TDP43 mutants lacking NLS sequences (TDP43DNLS) which seed aggregates in the cytoplasm are a conserved biomarker for ALS. Mutations in the Fused in Sarcoma (FUS) protein which alter its nuclear localization have been observed in ALS patients. The FUSR495Xmutation is associated with an aggressive disease phenotype, and forms cytoplasmic granules in neurons which have been linked to its pathogenic function.

[0270] HeLa cells were engineered to constitutively express each mutant along with ERa on a doxycycline inducible promoter (FIG. 3A). Upon addition of doxycycline and subsequent treatment with 5, the requisite relative ratio of ERa to each mutant required for maximum relocalization was achieved in different fractions of each population (FIGS. 3B, 3C, 13A-13D). Mean population analysis showed significant relocalization across all concentrations of TRAM for each mutant (FIG. 13E) and no ligand-induced protein stabilization (FIG. 13F). Best fit curves allowed for extraction of theoretical maximum relocalization of each mutant (FIG. 3D), from which the relative relocalizability and localization strength of each mutant when paired with ERa was derived (FIG. 3E). TDP43DNLSand FUSR495Xwere more readily relocalized by ERa compared to SMARCB 1Q318Xsuggesting protein-intrinsic features which facilitate or hinder relocalization. FUSR495x-positive cytoplasmic granules might be dissolved if TRAMs could induce redistribution FUSR495Xto the nucleus. To assess protein extraction from granules, FUSR495x-expressing HeLa cells treated with sodium arsenite to instigate stress granule formation were examined (FIG. 3F). After formation of granules, cells were treated with 5 and continuously imaged (FIG. 3G). Relocalization of FUSR495Xfrom both granules and the cytoplasm to the nucleus was observed over the course of two hours after exposure to 5 (FIGS. 3H, 14A-14B). These observations are consistent with small molecule-mediated extraction of FUSR495Xfrom cytoplasmic granules to the nucleus. To quantify the effect of FUSR495Xredistribution on the number of stress granules in cells, fixed-cell immunofluorescence imaging was performed to examine both mCherry-FKBP12F36v-FUSR495xand G3BP1 (FIGS. 31, FIG. 14C). A significant reduction in both FUSR495X-positive and G3BP1 -positive stress granules was observed in cells treated with 5 (FIG. 3J). Treatment with 5 led to more substantial reductions in stress granules than simultaneous treatment with both unlinked warheads 3 and 10 (FIGS. 3K, 3L, 14D). This demonstrates that FUSR495Xcan be relocalized from stress granules to the nucleus and that TRAM treatment can reduce FUSR495X-positive and G3BP1 -positive granules.

[0271] The ability to exploit the cereblon-damaged DNA binding protein 1 and Von Hippel- Lindau E3 ligases as general effector proteins with well-characterized small molecule warheads has contributed to the rapid advancement of targeted protein degradation. Methionine aminopeptidase 2 (METAP2) was identified as a suitable nuclear export shuttle, and poly [ADP- ribose] polymerase 1 (P ARP-1) as a nuclear import shuttle with well-characterized warheads. To demonstrate that these proteins could be used as suitable shuttles, 11-13 were synthesized (FIG. 4A) that utilize fumagillol- and olaparib-based warheads to engage METAP2 and PARP1 respectively. Using ectopically expressed model constructs, TRAMs 11 and 12 were validated to engage METAP2 and PARP1 to nuclear exclude or enhance FKBP12F36Vrespectively and that ternary complex formation is necessary for this relocalization (FIGS. 4B, 4C, 15). Dose- dependent relocalization was observed that reached a minimum of 12% nuclear localization by using 11 to engage METAP2 and 84% nuclear localization by using 12 to engage PARP1.

[0272] The examination of targeted relocalization of endogenous proteins as a therapeutic approach is limited by a lack of small molecule ligands for any desired target protein. To bypass this challenge, a modified Cas9-based protocol for microhomology-mediated end joining was utilized to install binding domains and fluorescent proteins on endogenous protein targets (FIG. 16). A guide RNA plasmid with two orthogonal U6 promoters and stem loops was designed to facilitate rapid cloning for knock-in onto different targets. To illustrate endogenous protein relocalization using endogenously expressed shuttle proteins, candidate targets that had undergone successful tagging in the OpenCell database were sought. PRMT9 is a nuclear- enhanced protein which has recently been explored as a target in acute myeloid leukemia. Using CRISPR-Cas9 tagging, a GFP-FKBP12F36Vcassette was inserted onto PRMT9, and it was demonstrated that PRMT9 could be nuclear excluded upon treatment with TRAM 11 that engages endogenous METAP2 as an export shuttle. Dose-dependent relocalization was observed for the export of endogenous PRMT9 by endogenous METAP2, with maximum export observed at 10 nM of 11 (FIGS. 4D, 4E, 17A-17B). Nuclear export with TRAM 11 was not observed when cells were treated with unlinked warheads 3 and 14 (FIGS. 17C-17E). Pre-treatment with

[0273] 14 or competitive treatment with 3 mitigated the observed nuclear export (FIGS. 17F-17G), illustrating the dependence of relocalization on effective ternary complex formation. To study endogenous protein nuclear import, the GFP-FKBP12F36Vcassette was appended onto endogenous SOS1, which is known to have strong cytoplasmic localization and membrane association. Treatment with TRAM 12 engaging PARP1 resulted in partial redistribution of SOS1 from the cytoplasm to the nucleus (FIGS. 4F, 4G, 18A-18B), which was not observed when treated with the unlinked warheads and abolished when competed with unlinked warheads

[0274] 15 or 3 (FIGS. 18C-18G).

[0275] To examine the ability of ERa and GR to relocalize endogenous proteins, FKBP 12F 36V- GFP was first inserted onto FOXO3A in HEK293T cells (FIG. 21A). FOXO3A is a tumor suppressor transcription factor which is sequestered in the cytoplasm in numerous cancers. ERa was expressed in HEK293T FOXO3a-FKBP12F36v-GFP cells, and upon treatment with 5, redistribution of FOXO3A to the nucleus in ERa-expressing cells was observed (FIG. 21B). Only in the cell groups expressing the highest levels of ERa was significant redistribution observed, demonstrating the potential of molecular coupling to ERa to overcome the endogenous localization programming of cytoplasmic FOXO3A (FIG. 21C). To explore the ability to shift the distribution of abundant, non-localized proteins, we also tagged endogenous FKBP12 with GFP in HEK293T cells stably expressing mCherry-ERa (FIG. 21D). Nuclear concentration of FKBP12 was observed in cells treated with 7 (FIG. 21E), but no significant rclocalization was found using cell group analysis. High expression of FKBP12 might necessitate analysis of only the highest shuttle receptor-expressing cells. When the top 5% of ERa-expressing cells were analyzed, significant nuclear concentration of endogenous FKBP12 was found as a function of treatment with 7 (FIG. 21F). To assess the ability to harness the glucocorticoid receptor (GR) as a nuclear shuttle, 6 was used, which utilizes dexamethasone as a GR-binding warhead. FKBP12 was also endogenously tagged in HCT116 cells, and stably incorporated GR as an mCherry fusion (FIG. 21H). Similar to HEK293T cells, nuclear concentration of FKBP 12 was observed in HCT116 cells which was not significant by cell group analysis (FIG. 21 G). However, significant nuclear concentration of endogenous FKBP12 was observed in the top 5% of cells with the highest expression of GR (FIG. 211). Cotreatment with SLF and dexamethasone did not result in nuclear concentration of FKBP12. Ligand-dependent concentration of GR was also observed in the nucleus, consistent with a ligand-gated TRAM for protein relocalization. An HCT116 endogenously-tagged FKBP12 line expressing mCherry- ERα was generated, and no significant relocalization of FKBP12 was observed at any expression level. The relative expression levels of mCherry-GR and mCherry-ERa were compared, and higher expression of mCherry-GR was observed in our stably expressing HCT116 cells. As FKBP12 is expressed at higher levels than F0X03A by tran scrip tomic analysis, these data support the importance of relative stoichiometries between target and shuttle proteins when assessing targeted protein relocalization. Further, the ability to analyze cell populations with specific shuttle-protein expression levels demonstrates the utility of a quantitative analysis pipeline.

[0276] Motivated by the finding that endogenous levels of shuttle proteins were sufficient to relocalize endogenous protein targets, TRAM 13 was synthesized from warheads directly engaging endogenous FKBP12 and PARP1 and inserted GFP onto endogenous FKBP12 for live- cell visualization. Upon treatment with TRAM 13, significant nuclear enhancement of FKBP12 was observed (FIGS. 4H, 41, 19A-19B) which was abolished upon co-treatment or competition with the unlinked warheads (FIGS. 19C-19G). Here, relocalization of a protein by a rationally designed bifunctional molecule that directly engages both endogenous shuttle and target proteins was shown. Across all three endogenous protein relocalization examples, a homogenous population shift was observed upon TRAM treatment, unlike the ectopic expression models where relocalization is often observed in a subset of the cell population.

[0277] Targeted protein relocalization via coupling to a shuttle protein could enable pharmacological approaches which mimic beneficial gain-of-function mutations. WldS, a mutant protein consisting of mouse NMNAT1 fused to a truncated N-terminal region of UBE4B has been shown to be protective against Wallerian degeneration. Mice bearing the WldS mutation have shown increased resistance to neuropathies and ALS. The ability for small amounts of WldS to traffic to the axon is crucial for its protective function, where it serves to maintain the levels of NAD+upon loss of axonal NMNAT2 during early stages of axonal injury. Small molecule-mediated transport of NMNAT 1 from the nucleus down the axon might serve a similar function to WldS and provide a proof-of-concept example for protein relocalization to drive a gain-of-function phenotype. Dorsal root ganglion (DRG) neurons were harvested from rat embryos and transduced them with Adeno-Associated Viruses (AAV) expressing mouse NMNAT1 (mNMNATl) linked to FKBP 12F 36Vand a truncated sequence of axon-localized GAP-43, fused to ecDHFR (FIGS. 5A-5B). When these neurons were treated with 1, clear redistribution of mNMNAT 1 down axons was observed, which did not occur when neurons were co-treated with unlinked warheads 2 and 3 (FIG. 5C, 20A). To assess the protective function of mNMNATl redistribution, after treatment with 1, an axotomy was performed and the cell bodies were removed (FIG. 20B). Persistent mNMNATl expression was observed in axons axotomy in neurons treated with TRAM 1 . Distinct blebbing and fragmentation of neurites was observed in DMSO or unlinked warhead co-treated neurons 24 hours post axotomy, with near complete neurite death observed after 48 hours (FIG. 5D, 20C). However, in neurons treated with 1, both axon and axon termini health were maintained for at least 72 hours post axotomy and attenuated axon death was observed only after 96 hours (FIGS. 5D-5F, 20D-20G). These observations are consistent with a gain-of-function protective activity of NMNAT1 driven by targeted, TRAM- mediated relocalization from nuclei to axons.

[0278] FKBP12F36V-linker-3XFLAG-linker-eGFP-linker-NMNATl - FKBP12F36vis shown in bold, 3XFLAG is italicized, eGFP is underlined and NMNAT 1 is italicized and underlined; linkers are plain text (SEQ ID NO: 12) ggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcactacaccgggatgcttga agatggaaagaaagttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgaggctgggaagaag gggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggcatcatcccacc acatgccactctcgtcttcgatgtggagcttctaaaactggaaggaggaggcagtgact«caaggGccacgacggtgGcfacaaggGccGcga categucracaaggacgflcgocgacaagggaggaggcagtatgttgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagc tggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccac cggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgact tcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgag ggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagc cacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccg accactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagacccca acgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaaggggcatggcaccggcag caccggcagcgaaXtcatggaaaattccgagaagactgaagtggttctccttgcttgtggttcattcaatcccatcaccaacatgcacctcaggttgttt gagctggccaaggactacatgaatggaacaggaaggtacacagttgtcaaaggcatcatctctcctgttggtgatgcctacaagaagaaaggact cattcctgcctatcaccgggtcatcatggcagaacttgctaccaagaactctaaatgggtggaagttgatacatgggaaagtcttcagaaggagtgg aaagagactctgaaggtgctaagacaccatcaagagaaattggaggctagtgactgtgatcaccagcagaactcacctactctagaaaggcctgg aaggaagaggaagtggactgaaacacaagattctagtcaaaagaaatccctagagccaaaaacaaaagctgtgccaaaggtcaagctgctgtg tggggcagatttattggagtcctttgctgttcccaatttgtggaagagtgaagacatcacccaaatcgtggccaactatgggctcatatgtgttactcgg gctggaaatgatgctcagaagtttatctatgaatcggatgtgctgtggaaacaccggagcaacattcacgtggtgaatgaatggatcgctaatgaca tctcatccacaaaaatccggagagccctcagaaggggccagagcattcgctacttggtaccagatcttgtccaagaatacattgaaaagcataattt gtacagctctgagagtgaagacaggaatgctggggtcatcctggcccctttgcagagaaacactgcagaagctaagacatag mCherry-linker-ecDHFR-linker-Hiv-1 Rev NES - mCherry is shown in bold, ecDHFR is italicized, Hiv-1 Rev NES is underlined, and linkers are plain text (SEQ ID NO: 13) atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacga gttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttc gcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttcccc gagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatc tacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggat gtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccac ctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgt ggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtataaggccggcctggagtctagaafcagtctgarrgcg gcgttagcggtagatcgcgttatcggcatggaaaacgccatgccgtggaacctgcctgccgatctcgcctggtttaaacgcaacaccttaaataaac ccgtgattatgggccgccatacctgggaatcacitcggtcgtccgttgccaggacgcaaaciatattcitcctcagcagtcaaccgggtacggacgatcg cgtaacgtgggtgaagtcggtggatgaagccatcgcggcgtgtggtgacgtaccagaaatcatggtgattggcggcggtcgcgtttatgaacagttc ttgccaaaagcgcaaaaactgtatctgacgcatatcgacgcagaagtggaaggcgacacccatttcccggattacgagccggatgactgggaatc ggtattcagcgaattccacgatgctgatgcgcagaactctcacagctattgctttgagattctggagcggcgggaagatctgcctccactgaaagact gacactgtag mCherry-linker-ecDHFR - - mCherry is shown in bold, ecDHFR is italicized, and linkers arc plain text (SEQ ID NO: 14) atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacga gttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttc gcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttcccc gagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatc tacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggat gtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccac ctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgt ggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtataaggccggcctggagtetagaateagfefgatgcg gcgttagcggtagatcgcgttatcggcatggaaaacgccatgccgtggaacctgcctgccgatctcgcctggtttaaacgcaacaccttaaataaac ccgtgattatgggccgccatacctgggaatcaatcggtcgtccgttgccaggacgcaaaaatattatcctcagcagtcaaccgggtacggacgatcg cgtaacgtgggtgaagtcggtggatgaagccatcgcggcgtgtggtgacgtaccagaaatcatggtgattggcggcggtcgcgtttatgaacagttc ttgccaaaagcgcaaaaactgtatctgacgcatatcgacgcagaagtggaaggcgacacccatttcccggattacgagccggatgactgggaatc ggtattcagcgaattccacgatgctgatgcgcagaactctcacagctattgctttgagattctggagcggcggtag

[0279] GFP-linker-ERα - GFP is shown in bold, ERoc_ is italicized, and linkers are plain text (SEQ ID NO: 15) atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccg gcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgacc accctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccag gagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagtcgagggcgacaccctggtgaaccgcatcgagctga agggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagc agaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacaccccc atcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatg gtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtccggactcagatctcgagctcaagcttcgaattctgc agtcgacggtciccatgaccatgaccctccacaccaaagcatctgggatggccctactgcatcagatccaagggaacgagctggagcccctgaac cgtccgcagctcaagatccccctggagcggcccctgggcgaggtgtacctggacagcagcaagcccgccgtgtacaactaccccgagggcgccg cctacgagttcaacgccgcggccgccgccaacgcgcaggtctacggtcagaccggcctcccctacggccccgggtctgaggctgcggcgttcggc tccaacggcctggggggtttccccccactcaacagcgtgtctccgagcccgctgatgctactgcacccgccgccgcagctgtcgcctttcctgcagcc ccacggccagcaggtgccctactacctggagaacgagcccagcggctacacggtgcgcgaggccggcccgccggcattctacaggccaaattc agataatcgacgccagggtggcagagaaagattggccagtaccaatgacaagggaagtatggctatggaatctgccaaggagactcgctactgt gcagtgtgcacitgactatgcttcaggctaccattatggagtctggtcctgtgagggctgcaaggccttcttcaagagaagtattcaaggacataacga ctatatgtgtccagccaccaaccagtgcaccattgataaaaacaggaggaagagctgccaggcctgccggctccgcaaatgctacgaagtggga atgatgaaaggtgggatacgaaaagaccgaagaggagggagaatgttgaaacacaagcgccagagagatgatggggagggcaggggtgaa gtggggtctgctggagacatgagagctgccaacctttggccaagcccgctcatgatcaaacgctctaagaagaacagcctggccttgtccctgacg gccgaccagatggtcagtgccttgttggatgctgagccccccatactctattccgagtatgatcctaccagacccttcagtgaagcttcgatgatgggc ttactgaccaacctggcagacagggagctggttcacatgatcaactgggcgaagagggtgccaggctttgtggatttgaccctccatgatcaggtcc accttctagaatgtgcctggctagagatcctgatgattggtctcgtctggcgctccatggagcacccagggaagctactgtttgctcctaacttgctcttg gacaggaaccagggaaaatgtgtagagggcatggtggagatcttcgacatgctgctggctacatcatctcggttccgcatgatgaatctgcaggga gaggagtttgtgtgcctcaaatctattattttgcttaattctggagtgtacacatttctgtccagcaccctgaagtctctggaagagaaggaccatatcca ccgagtcctggacaagatcacagacactttgatccacctgatggccaaggcaggcctgaccctgcagcagcagcaccagcggctggcccagctc ctcctcatcctctcccacatcaggcacatgagtaacaaaggcatggagcatctgtacagcatgaagtgcaagaacgtggtgcccctctatgacctgc tgctggagatgctggacgcccaccgcctacatgcgcccactagccgtggaggggcatccgtggaggagacggaccaaagccacttggccactgc gggctctacttcatcgcattccttgcaaaagtattacatcacgggggaggcagagggtttccctgccacagtctaa mCherrv-V5-FKBP12F36V-linker-SMARCB 1Q318X-linker-p2a-linker-t2a-rtetR-linker-p2a- puroR - mCherry is shown in bold, FKBP12F36Vis italicized, SMARCB1Q318Xis underlined and rtetR is italicized and underlined; puroR is capitalized; V5 is bold and underlined; p2a is bold and italicized; linkers are plain text (SEQ ID NO: 16) atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacga gttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttc gcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttcccc gagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatc tacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggat gtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccac ctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgt ggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtataagggcaagcccatccccaaccccctgctgggcc tggacagcaccggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcactacaccg ggatgcttgaagatggaaagaaagttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgaggctgg gaagaaggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggcatcatc ccaccacatgccactctcgtcttcgatgtggagcttctaaaactggaagggggXggc\.c\gg{.ggagg\X.c\.a\.ga{.ga{.ga{.ggcgc\.gagcaagacc ttcgggcagaagcccgtgaagttccagctggaggacgacggcgagttctacatgatcggctccgaggtgggaaactacctccgtatgttccgaggttctc tgtacaagagatacccctcactctggaggcgactagccactgtggaagagaggaagaaaatagttgcatcgtcacatggaaagaagacgaagcccaac accaaggatcacggatacacgactctagccaccagtgtgaccctgttaaaagcctcggaagtggaagagattctggatggcaacgatgagaagtacaa ggctgtgtccatcagcacagagccccccacctacctcagggaacagaaggccaagaggaacagccagtgggtacccaccctgcccaacagctccca ccacttagatgccgtgccatgctccacaaccatcaacaggaaccgcatgggccgagacaagaagagaaccttccccctttgctttgatgaccatgaccca gctgtgatccatgagaacgcatctcagcccgaggtgctggtccccatccggctggacatggagatcgatgggcagaagctgcgagacgccttcacctg gaacatgaatgagaagttgatgacgcctgagatgttttcagaaatcctctgtgacgatctggatttgaacccgctgacgtttgtgccagccatcgcctctgcc atcagacagcagatcgagtcctaccccacggacagcatcctggaggaccagtcagaccagcgcgtcatcatcaagctgaacatccatgtgggaaacat ttccctggtggaccagtttgagtgggacatgtcagagaaggagaactcaccagagaagtttgccctgaagctgtgctcggagctggggttgggcgggg agtttgtcaccaccatcgcatacagcatccggggaggctctggtgcaacaaacttctctctgctgaaacaagccggagatgtcgaagagaatcctgg accgggctctggtgagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggccccatgtctagactggacaagagcaaagtc ataaacggcgctctggaattactcaatggagtcggtatcgaaggcctgacgacaaggaaactcgctcaaaagctgggagttgagcagcctaccct gtactggcacgtgaagaacaagcgggccctgctcgatgccctgccaatcgagatgctggacaggcatcatacccacttctgccccctggaaggcg agtcatggcaagacttctgcggaacaacgccaagtcattccgctgtgctctcctctcacatcgcgacggggctaaagtgcatctcggcacccgccc aacagagaaacagtacgaaaccctggaaaatcagctcgcgttcctgtgtcagcaaggcttctccctggagaacgcactgtacgctctgtccgccgt gggccactttacactgggctgcgtattggaggaacaggagcatcaagtagcaaaagaggaaagagagacacctaccaccgattctatgccccca cttctgagacaagcaattgagctgttcgaccggcagggagccgaacctgccttccttttcggcctggaactaatcatatgtggcctggagaaacagct aaastscsaaascsscsssccssccsacscccttsacsattttsacttasacatsctcccagccsatscccttsacsactttsaccttgatatsctsc ctgctgacgctcttgacgattttgaccttgacatgctccccgggtccggcgctactaactcagcctgctgaagcaggctsgtgacgtcgaggagaatc ctggtcccATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGC CGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGG

[0280] ACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGAC

[0281] ATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGA

[0282] GCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTC

[0283] CCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCC

[0284] GCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGC

[0285] CGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCT

[0286] CCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAG

[0287] GTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA mCherry-V5-FKBP12F36V-linker-TDP43ΔNLS-linker-p2a-linker-t2a-rtetR-linker-p2a-puroR

[0288] - mCherry is shown in bold, V5 is italicized, FKBP12F36Vis underlined, TDP43ANLSis italicized and underlined, rtetR is bold and underlined, puroR is capitalized, p2a / t2a is bold and italicized, and linkers are plain text (SEQ ID NO: 17) atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacga gttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttc gcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttcccc gagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatc tacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggat gtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccac ctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgt ggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtataagggcafigcccotccccoocccccfgctgggcc tggacagcaccggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcactacaccggg atgcttgaagatggaaagaaagttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgaggctgggaagaa ggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggcatcatcccaccacatg ccactctcgtcttcgatgtggagcttctaaaactggaagggggtggctctggtggaggttctargrcrgaararaffcgggtoaccgaagargagaflcgfl tgagcccattgaciataccatcggaagcicgatgggacggtgctgctctccacggttacagcccagtttccaggggcgtgtgggcttcgctacaggaat ccagtgtctcagtgtatgagaggtgtccggctggtagaaggaattctgcatgccccagatgctggctggggaaatctggtgtatgttgtcaactatcca aaagataacgcagcagcaatggatgagacagatgcttcatcagcagtgaaagtgaaaagagcagtccagaaaacatccgatttaatagtgttgg gtctcccatggaaaacaaccgaacaggacctgaaagagtattttagtacctttggagaagttcttatggtgcaggtcaagaaagatcttaagactggt cattcaaaggggtttggctttgttcgttttacggaatatgaaacacaagtgaaagtaatgtcacagcgacatatgatagatggacgatggtgtgactgc aaacttcctaattctaagcaaagccaagatgagcctttgagaagcagaaaagtgtttgtggggcgctgtacagaggacatgactgaggatgagctg cgggagttcttctctcagtacggggatgtgatggatgtcttcatccccaagccattcagggcctttgcctttgttacatttgcagatgatcagattgcgcag tctctttgtggagaggacttgatcattaaaggaatcagcgttcatatatccaatgccgaacctaagcacaatagcaatagacagttagaaagaagtg gaagatttggtggtaatccaggtggctttgggaatcagggtggatttggtaatagcagagggggtggagctggtttgggaaacaatcaaggtagtaa tatgggtggtgggatgaacttggtgcgtcagcataatccagccatgatggctgccgcccaggcagcactacagagcagttggggtatgatgggc atgttagccagccagcagaaccagtcaggcccatcgggtaataaccaaaaccaaggcaacatgcagagggagccaaaccaggccttcggttct ggaaataactcttatagtggctctaattctggtgcagcaattggttggggatcagcatccaatgcagggtcgggcagtggttttaatggaggctttggct caagcatggattctaagtcttctggctggggaatgggctctQgtgcaacaaacttctctctgctgaaacaagccggagatgtcgaagagaatcctgg accgggctctzgtgagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggccccatQtctaQactQQacaaQaQcaaaztc ataaacggcgctctggaattactcaatggagtcggtatcgaaggcctgacgacaaggaaactcgctcaaaagctgggagttgagcagcctacc ctgtactggcacgtgaagaacaagcgggccctgctcgatgccctgccaatcgagatgctggacaggcatcatacccacttctgccccctggaag gcgagtcatggcaagactttctgcggaacaacgccaagtcattccgctgtgctctcctctcacatcgcgacggggctaaagtgcatctcggcacc cgcccaacagagaaacagtacgaaaccctggaaaatcagctcgcgttcctgtgtcagcaaggcttctccctggagaacgcactgtacgctctgt ccgccgtgggccactttacactgggctgcgtattggaggaacaggagcatcaagtagcaaaagaggaaagagagacacctaccaccgattct atgcccccacttctgagacaagcaattgagctgttcgaccggcagggagccgaacctgccttccttttcggcctggaactaatcatatgtggcctg gagaaacagctaaagtgcgaaagcggcgggccggccgacgcccttgacgattttgacttagacatgctcccagccgatgcccttgacgactttg accttQatatQctQcctzctQacQctcttQacQattttQaccttQacatQctcccczQQtccggcgctactaacttcagcctgctgaagcaggctggt gacgtcgaggagaatcctggtcccATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACG

[0289] TCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACC GTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGT CGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACC ACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGT TGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCC CAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGT CTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCT TCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACC GCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCT GA mCherry-V5-FKBP12F36V-linker-FUSR495X-linker-p2a-linker-t2a-rtetR-linker-p2a-puroR - mCherry is shown in bold, V5 is italicized, FKBP12F36Vis underlined, FUSR495Xis italicized and underlined, rtetR is bold and underlined, p2a / t2a is bold and italicized, puroR is capitalized, and linkers are plain text (SEQ ID NO: 18) atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacga gttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttc gcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttcccc gagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatc tacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggat gtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccac ctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgt ggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtataagggcGagcccatecccaaccccctgcfgggcc f.ggaca.gcaccggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcactacaccggg atgcttgaagatggaaagaaagttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgaggctgggaagaa ggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggcatcatcccaccacatg ccactctcgtcttcgatgtggagcttctaaaactggaagggggtggctctggtggaggttctatggcctcaaacgattatacccaacaagcaacccaaa gctatggggcctaccccacccagcccgggcagggctattcccagcagagcagtcagccctacggacagcagagttacagtggttatagccagtcc acggacacttcaggctatggccagagcagctattcttcttatggccagagccagaacacaggctatggaactcagtcaactccccagggatatggct cgactggcggctatggcagtagccagagctcccaatcgtcttacgggcagcagtcctcctatcctggctatggccagcagccagctcccagcagca cctcgggaagttacggtagcagttctcagagcagcagctatgggcagccccagagtgggagctacagccagcagcctagctatggtggacagca gcaaagctatggacagcagcaaagctataatccccctcagggctatggacagcagaaccagtacaacagcagcagtggtggtggaggtggagg tggaggtggaggtaactatggccaagatcaatcctccatgagtagtggtggtggcagtggtggcggttatggcaatcaagaccagagtggtggag gtggcagcggtggctatggacagcaggaccgtggaggccgcggcaggggtggcagtggtggcggcggcggcggcggcggtggtggtacaac cgcagcagtggtggctatgaacccagaggtcgtggaggtggccgtggaggcagaggtggcatgggcggaagtgaccgtggtggctcaataaat ttggtggccctcgggaccaaggatcacgtcatgactccgaacaggataattcagacaacaacaccatctttgtgcaaggcctgggtgagaatgttac aattgagtctgtggctgattacttcaagcagattggtattattaagacaaacaagaaaacgggacagcccatgattaatttgtacacagacagggaa actggcaagctgaagggagaggcaacggtctcttttgatgacccaccttcagctaaagcagctattgactggtttgatggtaaagaattctccggaaa tcctatcaaggtctcamgctactcgccgggcagactttaatcggggtggtggcaatggtcgtggaggccgagggcgaggaggacccatgggccgt ggaggctatggaggtggtggcagtggtggtggtggccgaggaggatttcccagtggaggtggtggcggtggaggacagcagcgagctggtgact ggaagtgtcctaatcccacctgtgagaatatgaacttctcttggaggaatgaatgcaaccagtgtaaggcccctaaaccagatggcccaggagggg gaccaggtggctctcacatggggggtaactacggggatgatcgtcgtggtggcagaggaggctatgatcgaggcggctaccggggccgcggcgg ggaccgtggaggcttcggctctggtgcaacaaacttctctctgctgaaacaagccggagatgtcgaagagaatcctggaccgggctctggtgaggg cagaggaagtctgctaacatgcggtgacstcgaggagaatcctggccccatg.tctagactss.acaagagcaaas.tcataaacQgcgctctQga attactcaatggagtcggtatcgaaggcctgacgacaaggaaactcgctcaaaagctgggagttgagcagcctaccctgtactggcacgtgaa gaacaagcgggccctgctcgatgccctgccaatcgagatgctggacaggcatcatacccacttctgccccctggaaggcgagtcatggcaaga ctttctgcggaacaacgccaagtcattccgctgtgctctcctctcacatcgcgacggggctaaagtgcatctcggcacccgcccaacagagaaa cagtacgaaaccctggaaaatcagctcgcgttcctgtgtcagcaaggcttctccctggagaacgcactgtacgctctgtccgccgtgggccactt tacactgggctgcgtattggaggaacaggagcatcaagtagcaaaagaggaaagagagacacctaccaccgattctatgcccccacttctgag acaagcaattgagctgttcgaccggcagggagccgaacctgccttccttttcggcctggaactaatcatatgtggcctggagaaacagctaaag tgcgaaagcggcgggccggccgacgcccttgacgattttgacttagacatgctcccagccgatgcccttgacgactttgaccttgatatgctgcct gctgacgctcttgacgattttgaccttgacatgctccccgggtccggcgctactaactfcagccZgc / gaagcaggc^ggZgacgZcgaggflgaflfe ctggtcccATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGC CGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGG ACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGAC ATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGA GCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTC CCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCC GCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGC CGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCT

[0290] CCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAG GTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA mCherry-linker-GR-linker-v5- mCherry is shown in bold, GR is italicized, v5 is underlined, and linkers are plain text (SEQ ID NO: 19) atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacga gttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttc gcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttcccc gagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatc tacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggat gtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccac ctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgt ggaacagtacgaacgcgccgagggccgccactccaccggcggcatggaegagctgtataagtccggactcagatctcgagctatggfictccaa agaatcattaactcctggtagagaagaaaaccccagcagtgtgcttgctcaggagaggggagatgtgatggacttctataaaaccctaagaggag gagctactgtgaaggtttctgcgtcttcaccctcactggctgtcgcttctcaatcagactccaagcagcgaagacttttggttgattttccaaaaggctca gtaagcaatgcgcagcagccagatctgtccaaagcagtttcactctcaatgggactgtatatgggagagacagaaacaaaagtgatgggaaatg acctgggattcccacagcagggccaaatcagcctttcctcgggggaaacagacttaaagcttttggaagaaagcattgcaaacctcaataggtcga ccagtgttccagagaaccccaagagttcagcatccactgctgtgtctgctgcccccacagagaaggagtttccaaaaactcactctgatgtatcttca gaacagcaacatttgaagggccagactggcaccaacggtggcaatgtgaaattgtataccacagaccaaagcacctttgacattttgcaggatttg gagttttcttctgggtccccaggtaaagagacgaatgagagtccttggagatcagacctgttgatagatgaaaactgtttgctttctcctctggcgggag aagacgattcattccttttggaaggaaactcgaatgaggactgcaagcctctcattttaccggacactaaacccaaaattaaggataatggagatctg gttttgtcaagccccagtaatgtaacactgccccaagtgaaaacagaaaaagaagatttcatcgaactctgcacccctggggtaattaagcaagag aaactgggcacagtttactgtcaggcaagctttcctggagcaaatataattggtaataaaatgtctgccatttctgttcatggtgtgagtacctctggag gacagatgtaccactatgacatgaatacagcatccctttctcaacagcaggatcagaagcctatttttaatgtcattccaccaattcccgttggttccga aaattggaataggtgccaaggatctggagatgacaacttgacttctctggggactctgaacttccctggtcgaacagttttttctaatggctattcaagc cccagcatgagaccagatgtaagctctcctccatccagctcctcaacagcaacaacaggaccacctcccaaactctgcctggtgtgctctgatgaag cttcaggatgtcattatggagtcttaacttgtggaagctgtaaagttttcttcaaaagagcagtggaaggacagcacaattacctatgtgctggaagga atgattgcatcatcgataaaattcgaagaaaaaactgcccagcatgccgctatcgaaaatgtcttcaggctggaatgaacctggaagctcgaaaaa caaagaaaaaaataaaaggaattcagcaggccactacaggagtctcacaagaaacctctgaaaatcctggtaacaaaacaatagttcctgcaac gttaccacaactcacccctaccctggtgtcactgttggaggttattgaacctgaagtgttatatgcaggatatgatagctctgttccagactcaacttgga ggatcatgactacgctcaacatgttaggagggcggcaagtgattgcagcagtgaaatgggcaaaggcaataccaggtttcaggaacttacacctg gatgaccaaatgaccctactgcagtactcctggatgtttcttatggcatttgctctggggtggagatcatatagacaatcaagtgcaaacctgctgtgttt tgctcctgatctgattattaatgagcagagaatgactctaccctgcatgtacgaccaatgtaaacacatgctgtatgtttcctctgagttacacaggcttc aggtatcttatgaagagtatctctgtatgaaaaccttactgcttctctcttcagttcctaaggacggtctgaagagccaagagctatttgatgaaattaga atgacctacatcaaagagctaggaaaagccattgtcaagagggaaggaaactccagccagaactggcagcggttttatcaactgacaaaactctt ggattctatgcatgaagtggttgaaaatctccttaactattgcttccaaacatttttggataagaccatgagtattgaattccccgagatgttagctgaaat catcaccaatcagataccaaaatattcaaatggaaatatcaaaaaacttctgtttcatcaaaaggaagatgggaaggccatccccaaccccctggtg ggcctggacagcacctaa mCherry -linker-ERα-linker-v5 - mCherry is shown in bold, ERα is italicized, v5 is underlined, linkers are plain text (SEQ ID NO: 20) atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacga gttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttc gcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttcccc gagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatc tacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggat gtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccac ctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgt ggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtataagtccggactcagatctcgagctatgaccafgacc ctccacaccaaagcatctgggatggccctactgcatcagatccaagggaacgagctggagcccctgaaccgtccgcagctcaagatccccctgga gcggcccctgggcgaggtgtacctggacagcagcaagcccgccgtgtacaactaccccgagggcgccgcctacgagttcaacgccgcggccgc cgccaacgcgcaggtctacggtcagaccggcctcccctacggccccgggtctgaggctgcggcgttcggctccaacggcctggggggtttcccccc actcaacagcgtgtctccgagcccgctgatgctactgcacccgccgccgcagctgtcgcctttcctgcagccccacggccagcaggtgccctactac ctggagaacgagcccagcggctacacggtgcgcgaggccggcccgccggcattctacaggccaaattcagataatcgacgccagggtggcaga gaaagattggccagtaccaatgacaagggaagtatggctatggaatctgccaaggagactcgctactgtgcagtgtgcaatgactatgcttcaggct accattatggagtctggtcctgtgagggctgcaaggccttcttcaagagaagtattcaaggacataacgactatatgtgtccagccaccaaccagtgc accattgataaaaacaggaggaagagctgccaggcctgccggctccgcaaatgctacgaagtgggaatgatgaaaggtgggatacgaaaaga ccgaagaggagggagaatgtgaaacacaagcgccagagagatgatggggagggcaggggtgaagtggggtctgctggagacatgagagct gccaacctttggccaagcccgctcatgatcaaacgctctaagaagaacagcctggccttgtccctgacggccgaccagatggtcagtgccttgttgg atgctgagccccccatactctattccgagtatgatcctaccagacccttcagtgaagcttcgatgatgggcttactgaccaacctggcagacagggag ctggttcacatgatcaactgggcgaagagggtgccaggctttgtggatttgaccctccatgatcaggtccaccttctagaatgtgcctggctagagatc ctgatgattggtctcgtctggcgctccatggagcacccagggaagctactgtttgctcctaacttgctcttggacaggaaccagggaaaatgtgtaga gggcatggtggagatcttcgacatgctgctggctacatcatctcggttccgcatgatgaatctgcagggagaggagtttgtgtgcctcaaatctattattt tgcttaattctggagtgtacacatttctgtccagcaccctgaagtctctggaagagaaggaccatatccaccgagtcctggacaagatcacagacact ttgatccacctgatggccaaggcaggcctgaccctgcagcagcagcaccagcggctggcccagctcctcctcatcctctcccacatcaggcacatg agtaacaaaggcatggagcatctgtacagcatgaagtgcaagaacgtggtgcccctctatgacctgctgctggagatgctggacgcccaccgccta catgcgcccactagccgtggaggggcatccgtggaggagacggaccaaagccacttggccactgcgggctctacttcatcgcattccttgcaaaag tattacatcacgggggaggcagagggtttccctgccacagtcgaagatggcaagcccatccccaaccccctgctgggcctggacagcacctaa mGreenLantern-linker- FKBP12F36V-linker-mNMNAT 1 -v5 - mGreenLantern is shown in bold, FKBP12F36Vis italicized, mNMNATl is underlined, v5 is italicized and underlined, and linkers are plain text (SEQ ID NO: 21) atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtccg cggcgagggcgagggcgatgccaccaacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgt gaccaccttaggctacggcgtggcctgcttcgcccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctac gtccaggagcgcaccatctctttcaaggacgacggtacctacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatc gtgctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaacttcaacagccacaaggtctatatcacggc cgacaagcagaagaacggcatcaaggctaacttcaagacccgccacaacgttgaggacggcggcgtgcagctcgccgaccactaccagcag aacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagccatcagtccaaactgagcaaagaccccaacgagaagcg cgatcacatggtcctgaaggagagggtgaccgccgccgggattacacatgacatggacgagctgtacaagggaggtggctetggaggaggtct ggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcactacaccgggatgcttgaag atggaaagaaagttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgaggctgggaagaaggggtt gcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggcatcatcccaccacatgcc acfcrcgtetrcgargrggugcffctauaacfggaagggggtggctctggtggaggttctatggactcatccaagaagacagaggtggttctcctggcct gtggctcttttaaccccatcaccaacatgcacctcaggctgttcgagctggccaaggactatatgcatgctacaggaaaatacagtgttatcaaaggcatta tctcaccggtcggtgatgcgtacaagaagaaagggctcatcccagcccaccaccgaatcatcatggcagaacttgccaccaagaactcacactgggtg gaagtggatacgtgggaaagtcttcagaaggagtgggtggagactgtgaaggtgctcagataccatcaggagaagctggcaactggcagctgcagtta cccacaaagctcacctgcactggaaaagcctgggcggaagaggaagtgggctgatcaaaagcaagattctagcccacagaagccccaagagcccaa accaacaggtgtgcccaaggtgaaattgctgtgtggggcagatttactggagtccttcagcgtgcccaacttgtggaagatggaggacatcacgcaaatc gtggccaactttgggctcatctgtatcactcgggctggcagtgacgctcagaaattcatctacgagtccgatgtgctgtggagacatcagagcaacatcca cctggtgaacgagtggatcaccaatgacatctcgtccaccaagatccggagggcgctcaggaggggccagagcatccgctacttggtaccggacctg gtccaagagtacattgagaagcatgagctgtacaacacggagagcgaaggcaggaatgctggggtcaccctggctcctctgcagaggaacgccgcag aggccaagcacaaccattccactctgggtggctctggcgggtctggcaagcccarccccaacccccrgcfgggccrggacagcacctag

[0291] GAP43axontag-linker-mRuby3-linker-ecDHFR-FLAG - mRuby3 is shown in bold, ecDHFR is italicized, FLAG is underlined, GAP43axontag is italicized and underlined, and linkers are plain text (SEQ ID NO: 22) afgcrgrgcrgrafgagaagaaccaaacaggrfgaaaagaargargaggaccaaaagarfggttctggcatggtgtctaagggcgaagagctgat caaggaaaatatgcgtatgaaggtggtcatggaaggttcggtcaacggccaccaattcaaatgcacaggtgaaggagaaggcagaccgtacg agggagtgcaaaccatgaggatcaaagtcatcgagggaggacccctgccatttgcctttgacattcttgccacgtcgttcatgtatggcagccgt acctttatcaagtacccggccgacatccctgatttctttaaacagtcctttcctgagggttttacttgggaaagagttacgagatacgaagatggtg gagtcgtcaccgtcacgcaggacaccagccttgaggatggcgagctcgtctacaacgtcaaggtcagaggggtaaactttccctccaatggtcc cgtgatgcagaagaagaccaagggttgggagcctaatacagagatgatgtatccagcagatggtggtctgagaggatacactgacatcgcact gaaagttgatggtggtggccatctgcactgcaacttcgtgacaacttacaggtcaaaaaagaccgtcgggaacatcaagatgcccggtgtccat gccgttgatcaccgcctggaaaggatcgaggagagtgacaatgaaacctacgtagtgcaaagagaagtggcagttgccaaatacagcaacct Iggtggtggcatggacgagctglacaaggccggcctggagtctagaatcagtctgattgcggcgttagcggtagatcgcgttatcggcatggaaaa cgccatgccgtggaacctgcctgccgatctcgcctggtttaaacgcaacaccttaaataaacccgtgattatgggccgccatacctgggaatcaatc ggtcgtccgttgccaggacgcaaaaatattatcctcagcagtcaaccgggtacggacgatcgcgtaacgtgggtgaagtcggtggatgaagccatc gcggcgtgtggtgacgtaccagaaatcatggtgattggcggcggtcgcgtttatgaacagttcttgccaaaagcgcaaaaactgtatctgacgcatat cgacgcagaagtggaaggcgacacccatttcccggattacgagccggatgactgggaatcggtattcagcgaattccacgatgctgatgcgcaga actctcacagctattgctttgagattctggagcggcgggattacaaggatgacgacgataagtag eGFP-linker-GR - eGFP is shown in bold, linker is in plain text, GR is underlined (SEQ ID NO: 23) atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtcc ggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtg accaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacg tccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatc gagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggc cgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcag aacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgc gatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtccggactcagatctcgagctatggactcca aagaatcattaactcctggtagagaagaaaaccccagcagtgtgcttgctcaggagaggggagatgtgatggacttctataaaaccctaagaggaggag ctactgtgaaggtttctgcgtcttcaccctcactggctgtcgcttctcaatcagactccaagcagcgaagacttttggttgattttccaaaaggctcagtaagc aatgcgcagcagccagatctgtccaaagcagtttcactctcaatgggactgtatatgggagagacagaaacaaaagtgatgggaaatgacctgggattc ccacagcagggccaaatcagcctttcctcgggggaaacagacttaaagcttttggaagaaagcattgcaaacctcaataggtcgaccagtgttccagag aaccccaagagttcagcatccactgctgtgtctgctgcccccacagagaaggagtttccaaaaactcactctgatgtatcttcagaacagcaacatttgaag ggccagactggcaccaacggtggcaatgtgaaattgtataccacagaccaaagcacctttgacattttgcaggatttggagttttcttctgggtccccaggt aaagagacgaatgagagtccttggagatcagacctgttgatagatgaaaactgtttgctttctcctctggcgggagaagacgattcattccttttggaagga aactcgaatgaggactgcaagcctctcattttaccggacactaaacccaaaattaaggataatggagatctggttttgtcaagccccagtaatgtaacactg ccccaagtgaaaacagaaaaagaagatttcatcgaactctgcacccctggggtaattaagcaagagaaactgggcacagtttactgtcaggcaagctttc ctggagcaaatataattggtaataaaatgtctgccatttctgttcatggtgtgagtacctctggaggacagatgtaccactatgacatgaatacagcatcccttt ctcaacagcaggatcagaagcctatttttaatgtcattccaccaattcccgttggttccgaaaattggaataggtgccaaggatctggagatgacaacttgac ttctctggggactctgaacttccctggtcgaacagttttttctaatggctattcaagccccagcatgagaccagatgtaagctctcctccatccagctcctcaa cagcaacaacaggaccacctcccaaactctgcctggtgtgctctgatgaagcttcaggatgtcattatggagtcttaacttgtggaagctgtaaagttttcttc aaaagagcagtggaaggacagcacaattacctatgtgctggaaggaatgattgcatcatcgataaaattcgaagaaaaaactgcccagcatgccgctatc gaaaatgtcttcaggctggaatgaacctggaagctcgaaaaacaaagaaaaaaataaaaggaattcagcaggccactacaggagtctcacaagaaacc tctgaaaatcctggtaacaaaacaatagttcctgcaacgttaccacaactcacccctaccctggtgtcactgttggaggttattgaacctgaagtgttatatgc aggatatgatagctctgttccagactcaacttggaggatcatgactacgctcaacatgttaggagggcggcaagtgattgcagcagtgaaatgggcaaag gcaataccaggtttcaggaacttacacctggatgaccaaatgaccctactgcagtactcctggatgtttcttatggcatttgctctggggtggagatcatata gacaatcaagtgcaaacctgctgtgttttgctcctgatctgattattaatgagcagagaatgactctaccctgcatgtacgaccaatgtaaacacatgctgtat gtttcctctgagttacacaggcttcaggtatcttatgaagagtatctctgtatgaaaaccttactgcttctctcttcagttcctaaggacggtctgaagagccaa gagctatttgatgaaattagaatgacctacatcaaagagctaggaaaagccattgtcaagagggaaggaaactccagccagaactggcagcggttttatc aactgacaaaactcttggattctatgcatgaagtggttgaaaatctccttaactattgcttccaaacatttttggataagaccatgagtattgaattccccgagat gttagctgaaatcatcaccaatcagataccaaaatattcaaatggaaatatcaaaaaacttctgtttcatcaaaagtaa

[0292] FKB P 12-linker- V 5 -mCherry - FKBP12 is shown in bold, linker is in plain text, V5 is underlined, mCherry is italicized (SEQ ID NO: 24) atgggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcactacaccgggatgctt gaagatggaaagaaatttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgaggctgggaaga aggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggcatcatccca ccacatgccactctcgtcttcgatgtggagcttctaaaactggaagaagatggcaagcccatccccaaccccctgctgggcctggacagcaccatg gtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcg agatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgg gacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggctt caagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtga agctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgagga cggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaag aagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaac gcgccgagggccgccactccaccggcggcatggacgagctgtataag

[0293] FKBP12F36v-linkcr-V5-mChcrry - FKBP12 is shown in bold, linker is in plain text, V5 is underlined, mCherry is italicized (SEQ ID NO: 25) atgggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcactacaccgggatgctt gaagatggaaagaaagttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgaggctgggaaga aggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggcatcatccca ccacatgccactctcgtcttcgatgtggagcttctaaaactggaagaagatggcaagcccatccccaaccccctgctgggcctggacagcaccarg gtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcg agatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgccctcgcctgg gcicatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgacigctgtccttccccgagggctt caagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtga agctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgagga cggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaag aagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaac gcgccgagggccgccactccaccggcggcatggacgagctgtataag mCherry-V5-FKBP12F36v-linker-MEKl-NES - mCherry is shown in bold, V5 is underlined, FKBP12F36Vis italicized, linker is in plain text, MEK1-NES is italicized and underlined (SEQ ID NO: 26) atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacga gttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttc gcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccca gagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatc tacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggat gtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccac ctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgt ggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtataagggcaagcccatccccaaccccctgctgggcct ggacagcaccggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcactacaccgg gatgcttgaagatggaaagaaagttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgaggctggg aagaaggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggcatcatcc caccacatgccactctcgtcttcgatgtggagcttctaaaactggaagggggtggctctggtggaggttctgccttgcagaagaagctggaggagct agagcttgatgag mCherry-V5-FKBP12F36V-linker-HIV-l-REV-NES - mCherry is shown in bold, V5 is underlined,

[0294] FKBP12F36Vis italicized, linker is in plain text, REV-NES is italicized and underlined (SEQ ID NO: 27) atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacga gttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttc gcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttcccc gagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatc tacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggat gtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccac ctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgt ggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtataagggcaagcccatecccaaccccctgctgggcct ggacagcaccggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcactacaccgg gatgcttgaagatggaaagaaagttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgaggctggg aagaaggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggcatcatcc caccacatgccactctcgtcttcgatgtggagcttctaaaactggaagggggtggctctggtggaggttctctgcctccacttgaaagactgacactg mCherry-V5-FKBP12F36v-linker-P53-NES - mChcrry is shown in bold, V5 is underlined, FKBP12F36Vis italicized, linker is in plain text, P53-NES is italicized and underlined (SEQ ID NO: 28) atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacga gttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttc gcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttcccc gagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatc tacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggat gtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccac ctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgt ggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtataagggcaagcccatccccaaccccctgctgggcct ggacagcaccggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcactacaccgg gatgcttgaagatggaaagaaagttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgaggctggg aagaaggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggcatcatcc caccacatgccactctcgtcttcgatgtggagcttctaaaactggaagggggtggctctggtggaggttctttccgagagctgaatgaggccttggaa etc mCherry-V5-FKBP12F36v-linker-lKBa-NES - mCherry is shown in bold, V5 is underlined,

[0295] FKBP12ra6Vis italicized, linker is in plain text, IKBα -NES is italicized and underlined (SEQ ID

[0296] NO: 29) atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacga gttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttc gcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttcccc gagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatc tacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggat gtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccac ctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgt ggaacastacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtataagggcaagcccatccccaaccccctgctgggcct g^acag^accggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcactacaccgg gatgcttgaagatggaaagaaagttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgaggctggg aagaaggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggcatcatcc mCherry-linker-ecDHFR-Flag-linker-HIV - 1 -REV -NES - mCherry is shown in bold, ecDHFR is underlined, Flag is italicized, linkers are in plain text, HIV-REV-NES is italicized and underlined (SEQ ID NO: 30) atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacga gttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttc gcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttcccc gagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatc tacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggat gtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccac ctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgt ggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtataaggccggcctggagtctagaatcagtctgatgcg gcgttagcggtagatcgcgttatcggcatggaaaacgccatgccgtggaacctgcctgccgatctcgcctggtttaaacgcaacaccttaaataaacccg tgattatgggccgccatacctgggaatcaatcggtcgtccgttgccaggacgcaaaaatattatcctcagcagtcaaccgggtacggacgatcgcgtaac gtgggtgaagtcggtggatgaagccatcgcggcgtgtggtgacgtaccagaaatcatggtgattggcggcggtcgcgtttatgaacagttcttgccaaaa gcgcaaaaactgtatctgacgcatatcgacgcagaagtggaaggcgacacccatttcccggattacgagccggatgactgggaatcggtattcagcgaa ttccacgatgctgatgcgcagaactctcacagctattgctttgagattctggagcggcggguttocaaggutgacgacgatoaggggggtggctctggt ggaggtctctgcctccacttgaaagactgacactg eGFP-V5-FKBP12F36V-linker-SV40-NLS - eGFP is shown in bold, V5 is underlined, FKBP12F36Vis italicized, linker is in plain text, SV40-NLS is italicized and underlined (SEQ ID NO: 31) atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtcc ggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtg accaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacg tccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatc gagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggc cgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcag aacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcg cgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagggcaagcccatccccaaccccctgc tgggcctggacagcaccggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcacta caccgggatgcttgaagatggaaagaaagttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgag gctgggaagaaggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggca tcatcccaccacatgccactctcgtcttcgatgtggagcttctaaaactggaagggggtggctctggtggaggtctccaaaaaagaagagaaaggt a eGFP- V5-FKBP 12F36V-linker-NMNAT 1 -NLS- eGFP is shown in bold, V5 is underlined, FKBPI 2F36Vis italicized, linker is in plain text, NMNAT1-NLS is italicized and underlined (SEQ ID NO: 32) atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtcc ggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtg accaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacg tccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatc gagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggc cgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcag aacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcg cgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagggcaagcccatccccaaccccctgc tgggcctggacagcaccggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcacta caccgggatgcttgaagatggaaagaaagttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgag gctgggaagaaggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggca tcatcccaccacatgccactctcgtcttcgatgtggagcttctaaaactggaagggggtggctctggtggaggttctcctggaaggaagaggaagtg g eGFP-V5-FKBP12F36V-linker-NPMl-NLS- eGFPis shown in bold, V5 is underlined, FKBP12ra6Vis italicized, linker is in plain text, NPM1-NLS is italicized and underlined (SEQ ID NO: 33) atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtcc ggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtg accaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacg tccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatc gagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggc cgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcag aacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcg cgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagggcaagcccatecccaaccccctgc tgggcctggacagcaccggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcacta caccgggatgcttgaagatggaaagaaagttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgag gctgggaagaaggggttgcccagatgagtgtgggtcagagagccanactgactatatctccagattatgcctntggtgccactgggcacccaggca tcatcccaccacatgccactctcgtcttcgatgtggagcttctaaaactggaagggggtggctctggtggaggttctaaaagg(cggcggccacgaa aaaggccggccaggcaaaaaagaaaaag eGFP-V5-FKBP12F36V-linker-P53-NLS- eGFPis shown in bold, V5 is underlined, FKBP12F36Vis italicized, linker is in plain text, P53-NLS is italicized and underlined (SEQ ID NO: 34) atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtcc ggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtg accaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacg tccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatc gagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggc cgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcag aacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcg cgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagggcaagcccatccccaaccccctgc tgggcctggacagcaccggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcacta caccgggatgcttgaagatggaaagaaagttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgag gctgggaagaaggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggca tcaitcccaccacatgccactctcgtcttcgatgtggagcttctaaaactggaagggggtggctctggtggaggttctaagcgagcactgcccaacaac accagctcctctccccagccaaagaagaaa eGFP-linker-METAP2 - eGFP is shown in bold, linker is in plain text, METAP2 is underlined (SEQ ID NO: 35) gtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccgg cgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgac caccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtc caggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcga gctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccg acaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaa cacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcg atcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagggaggtggaggtactagtctcgagatg gcgggtgtggaggaggtagcggcctccgggagccacctgaatggcgacctggatccagacgacagggaagaaggagctgcctctacggctgagga agcagccaagaaaaaaagacgaaagaagaagaagagcaaagggccttctgcagccggggaacaggaacctgataaagaatcaggagcctcagtgg atgaagtagcaagacagttggaaagatcagcattggaagataaagaaagagatgaagatgatgaagatggagatggcgatggagatggagcaactgg aaagaagaagaaaaagaagaagaagaagagaggaccaaaagttcaaacagaccctccctcagttccaatatgtgacctgtatcctaatggtgtatttccc aaaggacaagaatgcgaatacccacccacacaagatgggcgaacagctgcttggagaactacaagtgaagaaaagaaagcattagatcaggcaagtg aagagatttggaatgattttcgagaagctgcagaagcacatcgacaagttagaaaatacgtaatgagctggatcaagcctgggatgacaatgatagaaat ctgtgaaaagttggaagactgttcacgcaagttaataaaagagaatggattaaatgcaggcctggcatttcctactggatgttctctcaataattgtgctgccc attatactcccaatgccggtgacacaacagtattacagtatgatgacatctgtaaaatagactttggaacacatataagtggtaggattattgactgtgctttta ctgtcacttttaatcccaaatatgatacgttattaaaagctgtaaaagatgctactaacactggaataaagtgtgctggaattgatgttcgtctgtgtgatgttgg tgaggccatccaagaagttatggagtcctatgaagttgaaatagatgggaagacatatcaagtgaaaccaatccgtaatctaaatggacattcaattgggc aatatagaatacatgctggaaaaacagtgccgattgtgaaaggaggggaggcaacaagaatggaggaaggagaagtatatgcaattgaaacctttggta gtacaggaaaaggtgttgttcatgatgatatggaatgttcacattacatgaaaaattttgatgttggacatgtgccaataaggcttccaagaacaaaacacttg ttaaatgtcatcaatgaaaactttggaacccttgccttctgccgcagatggctggatcgcttgggagaaagtaaatacttgatggctctgaagaatctgtgtg acttgggcattgtagatccatatccaccattatgtgacattaaaggatcatatacagcgcaatttgaacataccatcctgttgcgtccaacatgtaaagaagtt gtcagcagaggagatgactat eGFP-linker-PARP 1 - eGFP is shown in bold, linker is in plain text, METAP2 is underlined (SEQ ID NO: 36) atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtcc ggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtg accaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacg tccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatc gagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggc cgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcag aacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcg cgatcacatggtcctgctggagtcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagggaggtggaggtactatggcggagt cttcggataagctctatcgagtcgagtacgccaagagcgggcgcgcctcttgcaagaaatgcagcgagagcatccccaaggactcgctccggatggcc atcatggtgcagtcgcccatgtttgatggaaaagtcccacactggtaccacttctcctgcttctggaaggtgggccactccatccggcaccctgacgttga ggtggatgggttctctgagcttcggtgggatgaccagcagaaagtcaagaagacagcggaagctggaggagtgacaggcaaaggccaggatggaatt ggtagcaaggcagagaagactctgggtgactttgcagcagagtatgccaagtccaacagaagtacgtgcaaggggtgtatggagaagatagaaaagg gccaggtgcgcctgtccaagaagatggtggacccggagaagccacagctaggcatgattgaccgctggtaccatccaggctgctttgtcaagaacagg gaggagctgggtttccggcccgagtacagtgcgagtcagctcaagggcttcagcctccttgctacagaggataaagaagccctgaagaagcagctccc aggagtcaagagtgaaggaaagagaaaaggcgatgaggtggatggagtggatgaagtggcgaagaagaaatctaaaaaagaaaaagacaaggata gtaagcttgaaaaagccctaaaggctcagaacgacctgatctggaacatcaaggacgagctaaagaaagtgtgttcaactaatgacctgaaggagctac tcatcttcaacaagcagcaagtgccttctggggagtcggcgatcttggaccgagtagctgatggcatggtgttcggtgccctccttccctgcgaggaatgc tcgggtcagctggtcttcaagagcgatgcctattactgcactggggacgtcactgcctggaccaagtgtatggtcaagacacagacacccaaccggaag gagtgggtaaccccaaaggaattccgagaa

[0297] Endogenous Tagging Sequences

[0298] Donor sequence for FKBP12 endogenous tagging: 5’ microhomol(FKBPlA)-PuroR-linker-D2a-linker-t2a-linker-eGFP-linker-3’ microhomol(FKBPlA) PuroR is shown in bold, cGFP is italicized, t2a / p2a is underlined, microhomol(FKBPlA) is italicized and underlined, and linkers are plain text (SEQ ID NO: 43) gcgtccgccgccgcctggggagtgatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtac gcaccctcgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagct gcaagaactcttcctcacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggacc acgccggagagcgtcgaagcgggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcg cagcaacagatggaaggcctcctggcgccgcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgacc accagggcaagggtctgggcagcgccgtcgtgctccccggagtggaggcggccgagcgcgccggggtgcccgccttcctggaga cctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacc tggtgcatgacccgcaagcccggtgccggttctggtgcaacaaacttctctctgctgaaacaa.gccggagatgtcgaagagaatcctg.ga ccgggatctggtgagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggcccaggatctggtofggfgagcaagg gcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgag ggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtg accaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaag gctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctg gtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagcc acaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgt gcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagt ccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatgg acgagctgtacaagggtggtggatctggtggaggttctggtggaggatctgtgcaggtggaaaccatctcccca

[0299] Donor sequence for F0X03A knock-in:

[0300] 5’ microhomol(FOXO3A)-PuroR-linker-p2a-linker-t2a-linker-eGFP-linker-FKBP12F36V- linker-3’ microhomol(FOXO3A) - PuroR is shown in bold, eGFP is italicized, t2a / p2a is underlined, microhomol(FKBPlA) is italicized and underlined, FKBP12F36Vis bold and unlderlined, and linkers are plain text (SEQ ID NO: 50) gcgggcgggcggcgaagurggcaatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccct cgccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcct cacgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcg ggggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgcc gcaccggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccc cggagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcac cgtcaccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgccggtctggtgcaacaaacttctctctgct gaaacaagccggagatgtcgaagagaatcctggaccgggatctggtgagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctgg cccaggatctggtatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagt tcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggccc accctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgactcttcaagtccgccatgcccgaa ggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaacc gcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcat ggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagc agaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagc gcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagggtggtggatctggtggaggttctggt ggaggatctggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcactacaccgg gatgcttgaagatggaaagaaagttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgaggctg ggaagaaggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggcat catcccaccacatgccactctcgtcttcgatgtggagcttctaaaactggaaggtggtggatctguggc«ccggc»ccccggc

[0301] Donor sequence for PRMT9 knock-in:

[0302] 5’ microhomol(PRMT9)-PuroR-linker-p2a-linker-t2a-linker-eGFP-linker-FKBP12F36v-linker-3’ microhomol(PRMT9) - PuroR is shown in bold, eGFP is italicized, t2a / p2a is underlined, microhomol(PRMT9) is italicized and underlined, FKBP12F36Vis bold and unlderlined, and linkers are plain text (SEQ ID NO: 57) ccutocaugtggfgacigccutgatgaccgagtacaagcccacggtgcgcctcgccacccgcgacgacgtccccagggccgtacgcaccctcg ccgccgcgttcgccgactaccccgccacgcgccacaccgtcgatccggaccgccacatcgagcgggtcaccgagctgcaagaactcttcctca cgcgcgtcgggctcgacatcggcaaggtgtgggtcgcggacgacggcgccgcggtggcggtctggaccacgccggagagcgtcgaagcggg ggcggtgttcgccgagatcggcccgcgcatggccgagttgagcggttcccggctggccgcgcagcaacagatggaaggcctcctggcgccgc accggcccaaggagcccgcgtggttcctggccaccgtcggcgtctcgcccgaccaccagggcaagggtctgggcagcgccgtcgtgctccccg gagtggaggcggccgagcgcgccggggtgcccgccttcctggagacctccgcgccccgcaacctccccttctacgagcggctcggcttcaccgt caccgccgacgtcgaggtgcccgaaggaccgcgcacctggtgcatgacccgcaagcccggtgccggttctggtgcaacaaacttctctctgctgaa acaagccggagatgtcgaagagaatcctggaccgggatctggtgagggcagaggaagtctgctaacatgcggtgacgtcgaggagaatcctggccca ggatctggtatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcag cgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccc tcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggct acgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcat cgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggcc gacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaa cacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcga tcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagggtggtggatctggtggaggttctggtggag gatctggagtgcaggtggaaaccatctccccaggagacgggcgcaccttccccaagcgcggccagacctgcgtggtgcactacaccgggatgc ttgaagatggaaagaaagttgattcctcccgggacagaaacaagccctttaagtttatgctaggcaagcaggaggtgatccgaggctgggaag aaggggttgcccagatgagtgtgggtcagagagccaaactgactatatctccagattatgcctatggtgccactgggcacccaggcatcatccc accacatgccactctcgtcttcgatgtggagcttctaaaactggaaggtggtggatctutgfcgaaactcrcgcggcccaggtcc

[0303] Donor sequence for S0S1 knock-in:

[0304] 5’ microhomol(SOS1)-PuroR-linker-p2a-linker-t2a-linker-eGFP-linker-FKBP12F36v-linker-3,microhomol(SOSl) - PuroR is shown in bold, eGFP is italicized, t2a / p2a is underlined, microhomol(SOSl) is italicized and underlined, FKBP12F36Vis bold and unlderlined, and linkers are plain text (SEQ ID NO: 64 )

Claims

CLAIMS1. A compound of formula (I):SP-L-TP (I) or a pharmaceutically acceptable salt thereof, wherein:SP is a moiety that binds to a shuttle protein;L is a linker; andTP is a moiety that binds to a target protein; wherein the compound promotes relocalization of the target protein from one subcellular compartment or organelle to another subcellular compartment or organelle.

2. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein the compound promotes translocation of the target protein from the cytoplasm to the nucleus.

3. The compound of claim 2, or a pharmaceutically acceptable salt thereof, wherein the shuttle protein comprises one or more nuclear localization sequence (NLS).

4. The compound of claim 3, or a pharmaceutically acceptable salt thereof, wherein each of the one or more nuclear localization sequence (NLS) comprises an amino acid sequence of: K- K / R-X-K / R, wherein X can be any amino acid; (R / P)XXKR(K / R)(ΛDE) (SEQ ID NOs: 1-4) wherein (ADE) represents any amino acid except for Asp or Gin. KRX(W / F / Y)XXAF (SEQ ID NOs: 5-7); and LGKR(K / R)(W / F / Y) (SEQ ID NO: 8-9), or a bipartite sequence thereof.

5. The compound of any of claims 2-4, or a pharmaceutically acceptable salt thereof, wherein the shuttle protein is a nuclear hormone receptor.

6. The compound of claim 5, or a pharmaceutically acceptable salt thereof, wherein the nuclear hormone receptor is an estrogen receptor (e.g., estrogen receptor alpha).

7. The compound of claim 6, or a pharmaceutically acceptable salt thereof, wherein the nuclear hormone receptor is glucocorticoid receptor.

8. The compound of claim 1 , or a pharmaceutically acceptable salt thereof, wherein the compound promotes translocation of the target protein from the nucleus to the cytoplasm.

9. The compound of claim 8, or a pharmaceutically acceptable salt thereof, wherein the shuttle protein comprises one or more nuclear export sequence (NES).

10. The compound of claim 9, or a pharmaceutically acceptable salt thereof, wherein each of the one or more nuclear export sequence (NES) comprises an amino acid sequence selected from: Y1-XXX-Y2-XX-Y3-X-Y4; Y1-XX-Y2-XX-Y3-X-Y4; Y1-XXX-Y2-XXX-Y3-X-Y4;Y1-XX-Y2-XXX-Y3-X-Y4; Y1-X-Y2-XX-Y3-X-Y4; Y1-XX-Y2-XXX-Y3-XX-Y4, wherein X is any amino acid and each Y is individually selected from: L, V, I, F, M, A, C, T, and W, wherein each NES can only have one of A, C, T, or W.

11. The compound of any of claims 1-10, wherein the target protein comprises a moiety or domain which binds to TP.

12. The compound of claim 11, wherein the moiety or domain comprises a polypeptide configured to bind TP.

13. The compound of any one of claims 1-7, or a pharmaceutically acceptable salt thereof, wherein SP is a moiety selected from:

14. The compound of any one of claims 1-13, or a pharmaceutically acceptable salt thereof, wherein the target protein is an RNA-binding protein, a transcriptional regulator, or a tumor suppressor protein.

15. The compound of any one of claims 1-14, or a pharmaceutically acceptable salt thereof, wherein TP is a moiety selected from:

16. The compound of any one of claims 1-15, or a pharmaceutically acceptable salt thereof, wherein L is a direct bond or comprises any combination of -CH2-, -CH=CH-, -C=C-, -O-, -NR'-, -BR'-, -S-, -C(O)-, -C(NR')-, -S(O)-, -S(O)2-, arylene, heteroarylene, cycloalkylene, and heterocyclylene moieties, wherein R' is selected from hydrogen and C1-C6alkyl.

17. The compound of any one of claims 1-16, or a pharmaceutically acceptable salt thereof, wherein L comprises any combination of the following moieties:wherein p is 1, 2, 3, 4, 5, or 6; and q is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16.

18. The compound of any one of claims 1 -17, or a pharmaceutically acceptable salt thereof, wherein L has a formula selected from:

19. The compound of claim 1, wherein the compound is selected from:and pharmaceutically acceptable salts thereof.

20. A composition comprising a compound, or a pharmaceutically acceptable salt thereof, of any of claims 1-19.

21. A method for relocalizing a target protein in a cell comprising introducing to the cell a compound, or a pharmaceutically acceptable salt thereof, of any of claims 1-19.

22. The method of claim 21, wherein the relocalizing comprises translocating the target protein into the nucleus or translocating the target protein out of the nucleus.

23. The method of claim 21 or 22, wherein the target protein is a RNA binding protein, a kinase, a transcriptional regulator, a nuclear hormone receptor, a phosphatase, an E3 ligase, a deubiquitinase, a bromodomain-containing protein (Brd), or a caspase, or a variant or disease- causing mutant thereof.

24. The method of any of claims 21-23, wherein the target protein comprises SRY, SHOX, TRPS1 , ARX, FOXP2, AIRE, RPS19, AGT, hsMOK2, SHOC2, rhodopsin, AVPR2, ATP7B, ABCA1, Tau, TARDBP, FUS, FOXO, p53, Breast Cancer Gene 1 (BRCA1), retinoblastoma protein (Rb), Sirtuin 1 (SIRT1), tumor-specific cyclin E isoforms, V-ERB-B2 erythroblastic leukemia viral oncogene (ErbB3), Mucin-13, inhibitor of growth family, member 1 (INGl / p33), SET-CAN fusion protein, Mucin- 1 C-terminal (MUC1-C), KL-6 mucin, epidermal growth factor receptor (EGFR), androgen receptor, nuclear receptor corepressor (N-CoR), nucleophosminI l l(NPM1 ), P-catenin, Adenomatous polyposis coli (APC), p27, p44 / WDR77, E-cadherin, ERM binding protein 50 (EBP50), epithelial cell adhesion molecule (EPCAM), B7-H1, B7-H3, B7- H4, cyclin DI, vascular endothelial growth factor receptor (VEGFR), VEGFR-2, serotonin receptor 1A (5-HTR1A), mucin 1 (MUC1), human epidermal growth factor receptor 2 (HER2), homeobox transcription factor Nanog, mammary serine protease inhibitor (MASPIN), transcriptional adaptor 3 (ADA3), cytokine-induced apoptosis inhibitor 1 (CIPINl), NME.NM23 nucleoside diphosphate kinase 1 (NME 1, NME23), cyclin B2, TDP43, FUS, SOD1, NMNAT1, TMEM192, KRAS, or a variant or disease-causing mutant thereof.

25. The method of any of claims 21-24, wherein the target protein comprises SMARCB1, TDP43, FUS, FOXO3A, or FKBP12.

26. The method of any of claims 21-25, wherein the target protein comprises a moiety or domain which binds the compound, or a pharmaceutically acceptable salt thereof.

27. The method of claim 26, wherein the moiety or domain comprises a polypeptide configured to bind the compound, or a pharmaceutically acceptable salt thereof.

28. The method of claims 26 or 27, wherein the method further comprises engineering the target protein to add the moiety or domain to the target protein.

29. The method of any of claims 21-28, wherein the cell is in vitro or ex vivo.

30. The method of any of claims 21-28, wherein the cell is in a subject.

31. The method of claim 30, wherein the method comprises administering the compound or a composition thereof to the subject.

32. The method of claim 31, wherein the subject has a disease or disorder associated with a mislocalized protein.

33. The method of claim 32, wherein the disease or disorder is cancer or a neurodegenerative disorder.

34. The method of any of claims 21-33, further comprising introducing to the cell a shuttle protein or a nucleic acid encoding thereof.

35. The method of any of claims 21-34, further comprising upregulating the expression or function of an endogenous shuttle protein in the cell.

Images